[methods in molecular biology] somatic stem cells volume 879 || isolation, culture, and...

203

Shree Ram Singh (ed.), Somatic Stem Cells: Methods and Protocols, Methods in Molecular Biology, vol. 879,DOI 10.1007/978-1-61779-815-3_14, © Springer Science+Business Media, LLC 2012

Chapter 14

Isolation, Culture, and Osteogenic/Chondrogenic Differentiation of Bone Marrow-Derived Mesenchymal Stem Cells

Susanne Grässel , Sabine Stöckl , and Zsuzsa Jenei-Lanzl

Abstract

Musculoskeletal disorders, as non-healing fractures and large bone defects, articular cartilage and subchondral bone injuries, often result in lifelong chronic pain and compromised quality of life. Although generally a natural process, failure of large bone defects to heal such as after complex fractures, resection of tumours, infections, or revisions of joint replacements remains a critical challenge that requires more appropriate solutions as those currently available. In addition, regeneration of chondral and osteochondral defects continues to be a challenge until to date. A profound understanding of the underlying mechanisms of endogenous regeneration is a prerequisite for successful bone and cartilage regeneration. Presently, one of the most promising therapeutic approaches is cell-based tissue engineering which provides a healthy population of cells to the injured site. Use of differentiated cells has severe limitations; an excellent alterna-tive would be the application of adult marrow stromal cells/mesenchymal stem cells (MSC) which possess extensive proliferation potential and proven capability to differentiate along the osteochondral pathway. The process of osteo-/chondrogenesis can be mimicked in vitro by inducing osteo-chondroprogenitor stem cells to undergo osteogenesis and chondrogenesis through exposure of osteo-/chondrogenic favour-able microenvironmental, mechanical, and nutritional conditions. This chapter provides comprehensive protocols for the isolation, expansion, and osteo-/chondrogenic differentiation of adult bone marrow-derived MSC.

Key words: Bone marrow-derived stem cells , Osteogenic differentiation , Chondrogenic differentiation

1. Introduction

Since their discovery, signi fi cant interest has been generated in the potential application of mesenchymal stem cells or multi-potential stromal cells for tissue regeneration and repair, due to their prolif-erative and multi-potential capabilities. Adult bone marrow-derived stromal cells/mesenchymal progenitor cells (MPC or MSC) repre-sent a heterogeneous population which is known to possess extensive proliferative potential and to have a proven capability to

204 S. Grässel et al.

differentiate into lineages of mesenchymal origin such as cartilage, adipose tissue, and bone ( 1 ) . In the early 1970s Friedenstein et al. detected multipotent adult mesenchymal progenitor/stem cells possessing properties of embryonic stem cells (ESC) in bone mar-row ( 2 ) . This early fi nding was later popularized by Pittenger et al. and since then MSC have been discovered in a multitude of adult tissues ( 3 ) . Regardless of the source of origin, BMSC possess three distinctive characteristics; they can be expanded in vitro, they have an extensive proliferation capacity, and they can differentiate into multiple lineages namely, osteocytes, chondrocytes (Fig. 1 ), adipo-cytes, astrocytes, and myocytes ( 3– 5 ) . The lack of a unique anti-genic marker is still the major limiting factor for unambiguously de fi ning MSC in vivo as well as in vitro. In fact, bone marrow-derived stromal cells are not a homogenous population, as re fl ected by their complex transcriptome, which encodes a wide range of proteins involved in different developmental pathways and in a large number of diverse biological processes ( 6, 7 ) . Despite evi-dence that MSC can transdifferentiate into multiple cell types in vitro and in vivo, the real contribution of MSC to tissue repair, through signi fi cant engraftment and differentiation into biologi-cally and functionally relevant tissue-speci fi c cell types, is still unclear ( 8 ) . The lack of consistent transdifferentiation in vivo might be a result of the limited number of mesenchymal precursor cells derived from non-mesodermal embryonic lineages, as recently indicated by the rapid decrease in the number of MSC of neuroepi-thelial origin in the adult bone marrow. It can be assumed that in post-natal life, the relative importance of MSC derived from other

Fig. 1. Chondrogenic differentiation cascade of bone marrow-derived MSC (BMSC) during embryogenesis. Schematic representation of the single steps of BMSC chondrogenesis during enchondral ossi fi cation ( 88 ).

20514 Isolation, Culture, and Osteogenic/Chondrogenic…

developmental lineages decreases due to the increasing importance of mesodermal MSC ( 9 ) .

The reconstruction of post-traumatic cartilage lesions and large bone defects as well as tumour-related bone defects are still a profound clinical problem. Before clinical trials are accepted, the safety pro fi le and success of new drugs or implants are usually tested in small and large animal models. Despite the advantages of animals as pre-clinical models for tissue engineering, only limited information concerning MSC from most animals is available. The majority of MSC research has been done on MSC derived from rodent and human ( 3, 10, 11 ) while studies on MSC from large animals are scarce.

In this chapter, we provide comprehensive protocols for the isolation, expansion, and osteo-chondrogenic differentiation of adult bone marrow-derived MSC (BMSC). In addition to human, BMSC have been identi fi ed in large and small animals as rat, mouse, rabbit, pig, horse, cow, sheep goat, cat, dog, and non-human pri-mates. Here, we focus on the species, which are most frequently considered for research in regenerative medicine as outlined below.

1. Clean bench (Heraeus). 2. Gloves (Roth). 3. Falcon tubes 50 mL (BD Biosciences). 4. Eppendorf cups 1.5 mL (Eppendorf). 5. Pipette tips 5, 10, 50 mL (Sarstedt AG&Co). 6. Pasteur pipettes (Roth). 7. Cell culture fl asks 25, 75 and 125 cm 2 (Sarstedt AG&Co). 8. Cell culture microscope (Zeiss). 9. Centrifuge (Sigma). 10. Neubauer hemocytometer (Roth). 11. CO 2 incubator (Eppendorf).

1. Dulbecco’s Modi fi ed Eagle’s medium (DMEM) low glucose (1 g/L glucose, Gibco Invitrogen) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin.

2. Dulbecco’s phosphate-buffered saline (DPBS) 1× sterile, with-out calcium and magnesium (PAA).

3. FBS (PAN Biotech GmbH). 4. Penicillin–streptomycin (Gibco Invitrogen). 5. 0.05% Trypsin-EDTA (PAN Biotech GmbH).

2. Materials

2.1. Basic Materials for All Species

2.2. Cell Culture Reagents

2.2.1 Human

Basic Reagents


6. Ficoll (Sigma). 7. DMSO (Sigma). 8. 20-Gauge (G) needle (BD Biosciences).

1. DMEM low glucose (1 g/L glucose, Gibco Invitrogen) supplemented with 100 nM dexamethasone, 10 mM sodium b -glycerophosphate, 0.05 mM ascorbic acid.

2. DPBS 1× sterile, without calcium and magnesium (PAA). 3. Coon’s modi fi ed Ham’s F12 medium supplemented with

10 −6 M bovine insulin, 8 × 10 −8 M human apo-transferrin, 8 × 10 −8 M bovine serum albumin, 4 × 10 −6 M linoleic acid, 10 −3 M sodium pyruvate (control medium). To induce osteo-genic differentiation, the control medium was supplemented with 7 × 10 −3 M b -glycerophosphate, 10 −8 M dexamethasone, and 2.5 × 10 −4 M ascorbic acid.

4. 0.05% Trypsin-EDTA (PAN Biotech GmbH). 5. Dexamethasone (Sigma). 6. Sodium b -glycerophosphate (Sigma). 7. L -ascorbic acid 2-phosphate (Sigma). 8. Trypan blue (Sigma). 9. 6-Well plates (Sigma).

1. DMEM high glucose (4.5 g/L glucose, Gibco Invitrogen) supplemented with 100 nM dexamethasone, 1% 100× ITS + 3 (insulin–transferrin–selenium), 200 m M L -ascorbic acid 2-phos-phate, 1 mM sodium pyruvate, and 10 ng/mL human trans-forming growth factor b -1 (TGF b -1).

2. DPBS 1× sterile, without calcium and magnesium (PAA). 3. Coon’s modi fi ed Ham’s F12 medium supplemented with

10 −6 M bovine insulin, 8 × 10 −8 M human apo-transferrin, 8 × 10 −8 M bovine serum albumin, 4 × 10 −6 M linoleic acid, 10 −3 M sodium pyruvate (control medium). To induce chon-drogenic differentiation, the control medium was supple-mented with 10 ng mL/1 recombinant human TGF b -1, 10 −7 M dexamethasone, and 2.5 × 10 −4 M ascorbic acid.

4. 0.05% Trypsin-EDTA (PAN Biotech GmbH). 5. Dexamethasone (Sigma). 6. TGF b -1 (R&D Systems). 7. ITS + 3 (Sigma). 8. Sodium pyruvate (Gibco Invitrogen). 9. L -ascorbic acid 2-phosphate (Sigma). 10. Trypan blue (Sigma).

Osteogenic Reagents

Chondrogenic Reagents


11. 24-Well plates. 12. V-bottom 96-well plates.

1. DMEM high glucose (4.5 g/L glucose, Gibco Invitrogen) sup-plemented 100× ITS + 3 (insulin–transferrin–selenium), 200 m M L -ascorbic acid 2-phosphate, 1 mM sodium pyruvate, and 10 ng/mL human transforming growth factor b -3 (TGF b -3).

2. DPBS 1× sterile, without calcium and magnesium (PAA). 3. 0.05% Trypsin-EDTA (PAN Biotech GmbH). 4. TGF b -3 (R&D Systems). 5. ITS + 3 (Sigma). 6. Sodium pyruvate (Gibco Invitrogen). 7. L -ascorbic acid 2-phosphate (Sigma). 8. Trypan blue (Sigma). 9. V-bottom 96-well plates (Sigma).

1. DMEM low glucose (1 g/L glucose, Gibco Invitrogen) supplemented with 10% FBS.

2. DPBS 1× sterile, without calcium and magnesium (PAA) supplemented with 10% FBS.

3. 0.05% Trypsin-EDTA (PAN Biotech GmbH). 4. FBS (ICN Biomedicals). 5. 1% Paraformaldehyde (Sigma) PFA in 1× DPBS. 6. Antibodies (see Tables 1 and 2 ). 7. Trypan blue (Sigma). 8. Propidium iodide solution, 1.5 mM (PI, Sigma). 9. FACS tubes (Sarstedt). 10. Cell culture centrifuge. 11. FACSCalibur fl ow cytometer (Becton Dickinson).

Hypertrophy Enhancing Reagents

BMSC Characterization by FACS Analysis ( 3, 12, 13 )

Table 1 Surface antigens for identi fi cation of human MSC (recommendation of ISCT ( 12 ) )

Positive ( ≥ 95% +) Negative ( £ 2% +)

CD73 CD14 or CD11b

CD90 CD34

CD105 CD45 CD79 a or CD19 HLA-DR


1. Poly(ethylene glycol) dimethacrylate (PEGDM, Shearwater Polymers).

2. Poly(lactic acid)- b -poly(ethylene glycol)- b poly(lactic acid) with acrylate end groups (PEG-LA-DA), synthesized as described by Vacanti et al. ( 14 ) .

3. UV sterilizer. 4. Long-wave UV lamp (Model B100AP, Blak-Ray). 5. 12-Well plates. 6. The UV photoinitiator 2-hydroxy-1-[4-(hydroxyethoxy)

phenyl]-2-methyll-propanone (D2959, Ciba-Geigy).

1. Aprotinin solution (Trasylols, Bayer). 2. Fibrin glue Tissucols (Baxter). 3. Thrombin (as a part of Tissucols). 4. Thrombin dilution buffer (as a part of Tissucols).

Biomaterial-Assisted Chondrogenesis

Chondrogenesis in a Fibrin Glue

Table 2 Classical surface antigens used for identi fi cation of human MSC

Cell surface epitope Human MSC Synonyme Antibody source

CD29 Pos. b 1 integrin Becton Dickinson

CD44 Pos. Phagocytic glycoprotein-1; HA-receptor

Acris Antibodies

CD73 Pos. Ecto-5 ¢ -nucleotidase Acris Antibodies

CD90 Pos Thy-1 Acris Antibodies

CD105 Pos. Endoglin Acris Antibodies

CD106 Pos. VCAM-1 Becton Dickinson

CD166 Pos. ALCAM Acris Antibodies

STRO-1 Pos. Unde fi ned antigen R&D Systems

HLA-I Pos. MHC I Acris Antibodies

CD11b Neg. ITGAM Acris Antibodies

CD14 Neg. E ndotoxin receptor (LPS) R&D Systems

CD19 Neg. B lymphocyte antigen Acris Antibodies

CD34 Neg. Cell–cell adhesion, binds to selectins

Becton Dickinson

CD45 Neg. Leukocyte common antigen Becton Dickinson

CD79 a Neg. Immunoglobulin-associated a Acris Antibodies

HLA-II Neg. MHC II Acris Antibodies


5. Bovine fi brinogen (Sigma-Aldrich). 6. Calcium chloride (Sigma-Aldrich). 7. Silanized glass ring with an inner diameter of 5 mm. 8. 12-Well plates.

1. Sponge scaffold with de fi ned pore size (350–450 m m). 2. 24-Well plates.

1. Biodegradable PCL polymer (Sigma). 2. Tetrahydrofuran (Fisher). 3. N , N -dimethylformamide (Fisher). 4. 20-mL glass syringe. 5. 18G needle (Braun). 6. 24-Well culture plates (Corning Glass Works). 7. Poly(2-hydroxyethyl methacrylate) (Polysciences). 8. Hanks’ Balanced Salt Solution (BioSource International). 9. Aluminium foil. 10. Vacuum chamber. 11. Electrospinning setup (12-kV electric fi eld).

1. DMEM (MEM alpha) (Gibco Invitrogen). 2. FBS (Sigma-Aldrich). 3. DPBS 1× sterile, without calcium and magnesium (PAA). 4. Penicillin–streptomycin (PAA). 5. GLUTAMAX-1 (Gibco, Invitrogen). 6. 18, 20, and 23G needles (Braun). 7. Antibodies (see Table 3 ). 8. Magnetic column (Miltenyi Biotec’s LS-MACS columns). 9. Goat anti-mouse secondary antibodies coupled with magnetic

beads (Miltenyi Biotec’s). 10. Sheep serum (Abcam). 11. Propidium iodide (Sigma-Aldrich). 12. Bovine serum albumin (Biomol).

1. DMEM high glucose (4.5 g/L glucose, Gibco Invitrogen). 2. Dexamethasone (Sigma-Aldrich). 3. Ascorbate 2-phosphate (Sigma -Aldrich). 4. Sodium b -glycerophosphate (Sigma-Aldrich). 5. Alizarin Red (Sigma-Aldrich). 6. 10% Formaldehyde (Sigma-Aldrich).

Chondrogenesis in a Sponge Scaffold

Chondrogenesis in a Nano fi brous Poly Epsilon-Caprolactone Scaffold

2.2.2. Rat

Basic Reagents

Osteogenic Reagents


7. Silver nitrate solution (Sigma-Aldrich). 8. Sodium thiosulphate solution (Sigma-Aldrich). 9. Safranin-O (Merck GmbH). 10. 6-Well plates (Sigma-Aldrich).

1. Alginate sodium salts (Sigma-Aldrich). 2. Calcium chloride (Sigma-Aldrich). 3. Sodium citrate (Sigma-Aldrich). 4. Sodium chloride (AppliChem). 5. ITS + premix (BD Bioscience). 6. Sodium pyruvate (Sigma-Aldrich). 7. Proline (Sigma-Aldrich). 8. TGF b -3 (R&D Systems). 9. Dexamethasone (Sigma-Aldrich). 10. Ascorbate 2-phosphate (Sigma-Aldrich). 11. BMP-2 (R&D Systems). 12. Collagen-GAG scaffolds (Sigma-Aldrich). 13. Ammonium hydroxide.

1. DMEM (MEM alpha) (Gibco Invitrogen). 2. DPBS 1× sterile, without calcium and magnesium (PAA,

Pasching). 3. Hanks-balanced salt solution (HBSS+) (Gibco Invitrogen). 4. HEPES (Gibco Invitrogen). 5. Cell strainer (70 m m) (BD Bioscience).


2.2.3. Murine

Basic Reagents

Table 3 Classical surface antigens used for identi fi cation of murine and rat MSC

Cell surface epitope Murine/rat MSC Synonyme Antibody source

CD45 Neg. Leukocyte common antigen Millipore, USA

CD11b Neg. ITGAM BD Bioscience, Germany

CD34 Neg. Cell–cell adhesion, binds to selectins

BD Bioscience, Germany

CD14 Neg. Endotoxin receptor (LPS) BD Bioscience, Germany

CD90 Pos. Thy-1 BD Bioscience, Germany

Sca-1 Pos. Ly6.2 Miltenyi Biotec, Germany

CD73 Pos. Ecto-5 ¢ nucleotidase BD Bioscience, Germany


6. #11 Scalpel (Feather). 7. 16G needle (Braun). 8. Collagenase (Roche). 9. 70% v/v EtOH (Fisher Scienti fi c). 10. Biotin anti-mouse antibodies (eBioscience). 11. Dynabeads M-280 Streptavidin superparamagnetic polystyrene

beads (Invitrogen). 12. Antibodies (see Table 3 ). 13. Incomplete chondrogenesis induction medium (LONZA). 14. McCoy’s 5A media (Lonza). 15. MesenCult ® Mesenchymal Stem Cell Stimulatory Supplements

(Mouse) (StemCell Technologies).

1. Osteogenic induction medium (LONZA). 2. DMEM (MEM alpha) (Gibco Invitrogen). 3. Dexamethasone (Sigma-Aldrich). 4. Ascorbate 2-phosphate (Sigma-Aldrich). 5. Sodium b -glycerophosphate (Sigma-Aldrich). 6. 6-Well plates (Corning).

1. Incomplete chondrogenesis induction medium (LONZA). 2. ITS + premix (BD Bioscience). 3. Sodium pyruvate (Sigma-Aldrich). 4. Proline (Sigma-Aldrich). 5. Dexamethasone (Sigma-Aldrich). 6. Ascorbate 2-phosphate (Sigma-Aldrich). 7. TGF b -3 (R&D Systems).

1. Low-glucose DMEM (Gibco, Invitrogen). 2. Ketamine (P fi zer). 3. Xylazine solution (Sigma-Aldrich). 4. Heparin (Sigma-Aldrich). 5. 16G needle (Braun). 6. 10-mL syringe (Braun). 7. Cell strainer (40 m m) (BD Bioscience). 8. Penicillin–streptomycin (Gibco Invitrogen). 9. FBS (Sigma-Aldrich). 10. Antibodies (see Table 4 ).

Osteogenic Reagents


2.2.4. Rabbit

Basic Reagents


1. Low-glucose DMEM (Gibco, Invitrogen). 2. 12-Well plates (Corning). 3. Dexamethasone (Sigma-Aldrich). 4. Ascorbate 2-phosphate (Sigma-Aldrich). 5. Sodium b -glycerophosphate (Sigma-Aldrich).

1. 0.05% Trypsin-EDTA (PAN Biotech GmbH). 2. DMEM (Gibco, Invitrogen). 3. ITS + Premix (insulin (6.25 mg/mL), transferrin (6.25 m g/mL),

selenous acid (6.25 m g/mL), linoleic acid (5.35 m g/mL), with BSA (1.25 m g/mL)).

4. Pyruvate (1 mM) (Sigma-Aldrich). 5. Ascorbate 2-phosphat (37.5 m g/mL) (Sigma-Aldrich).

Osteogenic Reagents


Table 4 Surface and cytosolic antigens generally used for identi fi cation of rabbit MSC

Cell surface epitope

Rabbit MSC

Rodent/human MSC Synonyme Antibody source

CD14 Neg. Neg. Endotoxin receptor (LPS)

Thermo Scienti fi c Pierce, USA (human and rabbit)

CD29 Pos. Pos. b 1 integrin Abcam, USA (human, monkey and rabbit)

CD44 Pos. Pos. Phagocytic glycoprotein-1; HA-receptor

LifeSpan BioSciences, USA (human, rat, rabbit)

CD45 Neg. Neg. Leukocyte common antigen

Santa Cruz, USA (H-230 (human), L12/201 (rabbit))

CD90 Neg. +/− a Thy-1 Acris Antibodies, USA (human); Thermo Scienti fi c Pierce, USA (rabbit)

HLA-1 Neg. +/− b MHC I Thermo Scienti fi c Pierce, USA (human and rabbit)

HLA-2 Neg. Neg. MHC II Abgent, USA (human); Thermo Scienti fi c Pierce, USA (rabbit)

Cell cytosolic protein Vimentin Pos. Pos. Vimentin Abcam, USA (human and rabbit) Desmin Pos. Pos. Desmin Abcam, USA (human and rabbit) a -Smooth-actin Pos. Pos. a -Smooth-actin LifeSpan BioSciences, USA

(human and rabbit) Cytokeratin Neg. Neg. Cytokeratin Abcam, USA (human and rabbit)

a Negative in mouse b MHCI +/− phenotype was found in human umbilical cord perivascular cells, according to ref. ( 48 )


6. Dexamethasone (10 −7 M) (Sigma-Aldrich). 7. TGF b -1 (0.5–10 ng/mL) (R&D Systems).

1. Minimum essential alpha-MEM medium (Invitrogen) supple-mented with 10% FBS.

2. DPBS 1× sterile, without calcium and magnesium (PAA). 3. FBS (ICN Biomedicals). 4. 0.25% Trypsin-EDTA (PAN Biotech GmbH). 5. Histopaque 1083 (Sigma). 6. DMSO (Sigma). 7. 20G needle (BD Bioscience). 8. Antibodies (see Table 5 ).

2.2.5. Porcine

Basic Reagents

Table 5 Classical surface antigens used for identi fi cation of porcine MSC

Cell surface epitope Human MSC Porcine MSC Synonyme Antibody source

CD29 Pos. Pos. b 1 integrin Becton Dickinson

CD44 Pos. Pos. a Human CD44, phagocytic glycoprotein-1

Acris Antibodies

CD46 ? Pos. MCP Becton Dickinson

CD49 CD49a Pos. a 1-6 integrin Becton Dickinson

CD73 Pos. ? Ecto-5 ¢ -nucleotidase Acris Antibodies

CD90 Pos Pos Thy-1 Acris Antibodies

CD105 Pos. Pos. Endoglin Acris Antibodies

CD106 Pos. Pos. VCAM-1 Becton Dickinson

CD166 Pos. ? ALCAM Acris Antibodies

STRO-1 Pos. ? Unde fi ned antigen R&D Systems

HLA-I Pos. ? MHC I Acris Antibodies

CD11b Neg. Neg. ITGAM Acris Antibodies

CD14 Neg. Neg. Endotoxin receptor (LPS) R&D Systems

CD19 Neg. ? B lymphocyte antigen Acris Antibodies

CD31 ? Neg. PECAM-1 Becton Dickinson

CD34 Neg. Neg. Cell–cell adhesion, binds to selectins

Becton Dickinson

CD45 Neg. Neg. Leukocyte common antigen Becton Dickinson

CD79 a Neg. ? Immunoglobulin-associated a Acris Antibodies

CD133 ? Neg. (Haematopoietic) PROML1 Becton Dickinson

HLA-II Neg. Neg. MHC II Acris Antibodies


1. DMEM low glucose (1 g/L glucose, Gibco Invitrogen) sup-plemented with 100 nM dexamethasone, 10 mM sodium b -glycerophosphate, 0.05 mM ascorbic acid.

2. Dexamethasone (Sigma). 3. Sodium b -glycerophosphate (Sigma). 4. Ascorbic acid (Sigma). 5. Trypan blue (Sigma). 6. 6-Well plates (Corning).

1. Minimum essential alpha-MEM medium (Invitrogen) supple-mented with 100 nM dexamethasone, 1% 100× ITS + 3 (insulin–transferrin–selenium), 200 m M L -ascorbic acid 2-phosphate, 1 mM sodium pyruvate, and 10 ng/mL human transforming growth factor b -1 (TGF b -1).

2. Dexamethasone (Sigma). 3. TGF b -1 (R&D Systems). 4. ITS + 3 (Sigma). 5. Sodium pyruvate (Gibco Invitrogen). 6. L -ascorbic acid 2-phosphate (Sigma). 7. Trypan blue (Sigma). 8. V-bottom 96-well plates (Corning).

1. Essential medium (MEM) alpha medium (Sigma) supple-mented with 10% FBS.

2. DPBS 1× sterile, without calcium and magnesium (PAA). 3. FBS (ICN Biomedicals). 4. 1% PFA (Sigma) in 1× DPBS. 5. Antibodies (see Table 5 ). 6. Trypan blue (Sigma). 7. Propidium iodide solution, 1.5 mM (PI, Sigma). 8. FACS tubes (Sarstedt). 9. Cell culture centrifuge. 10. FACSCalibur fl ow cytometer (Becton Dickinson).

1. DMEM low glucose (1 g/L glucose, Gibco Invitrogen) sup-plemented with 10% FBS, 100 U/mL penicillin-G, 100 m g/mL streptomycin, 0.25 m g/mL amphotericin B, 2.4 mg/mL HEPES, and 3.7 mg/mL NaHCO 3 .

Osteogenic Reagents


BMSC Characterization by FACS Analysis ( 15– 17 )

2.2.6. Bovine

Basic Reagents


2. DPBS 1× sterile, without calcium and magnesium (PAA). 3. FBS (ICN Biomedicals). 4. Penicillin-G (Sigma). 5. Streptomycin (Sigma). 6. Amphotericin B (Sigma). 7. 0.25% Trypsin-EDTA (PAN Biotech GmbH). 8. Ficoll (Sigma). 9. DMSO (Sigma). 10. 20G needle (BD Bioscience). 11. Antibodies (see Table 6 ).

Table 6 Classical surface antigens used for identi fi cation of bovine MSC

Cell surface epitope Human MSC Bovine MSC Synonyme Antibody source

CD29 Pos. Pos. b 1 integrin Becton Dickinson

CD44 Pos. Pos. Phagocytic glycoprotein-1, HA-receptor

Acris Antibodies

CD73 Pos. ? Ecto-5 ¢ -nucleotidase Acris Antibodies

CD90 Pos ? Thy-1 Acris Antibodies

CD105 Pos. ? Endoglin Acris Antibodies

CD106 Pos. ? VCAM-1 Becton Dickinson

CD166 Pos. Pos. ALCAM Acris Antibodies

STRO-1 Pos. ? Unde fi ned antigen R&D Systems

HLA-I Pos. ? MHC I Acris Antibodies

CD11b Neg. ? ITGAM Acris Antibodies

CD14 Neg. Neg. Endotoxin receptor (LPS) R&D Systems

CD19 Neg. ? B lymphocyte antigen Acris Antibodies

CD31 ? Neg. PECAM-1 Acris Antibodies


Becton Dickinson

CD45 Neg. Neg. Leukocyte common antigen Becton Dickinson

CD79 a Neg. ? Immunoglobulin-associated a Acris Antibodies

CD117 ? Neg. (Haematopoietic) PROML1 Acris Antibodies

HLA-II Neg. ? MHC II Acris Antibodies


1. DMEM low glucose (1 g/L glucose, Gibco Invitrogen) supplemented with 100 nM dexamethasone, 10 mM sodium b -glycerophosphate, 0.05 mM ascorbic acid.

2. Dexamethasone (Sigma). 3. Sodium b -glycerophosphate (Sigma). 4. L -ascorbic acid 2-phosphate (Sigma). 5. Trypan blue (Sigma). 6. T60 culture dishes (Corning).

1. DMEM low glucose (1 g/L glucose, Gibco Invitrogen) sup-plemented with 6.25 m g/mL insulin, 6.25 m g/mL transferin, 6.25 m g/mL selenious acid, 1.25 mg/mL bovine serum albu-min, 1 mM pyruvate, 5.35 m g/mL linoleic acid, and 50 m g/mL ascorbate 2-phosphate, 5 ng/mL TGF b -1.

2. DMEM high glucose (4.5 g/L glucose, Gibco Invitrogen) supplemented with 6.25 m g/mL insulin, 6.25 m g/mL trans-ferin, 6.25 m g/mL selenious acid, 1.25 mg/mL bovine serum albumin, 1 mM pyruvate, 5.35 m g/mL linoleic acid, and 50 m g/mL ascorbate 2-phosphate, 5 ng/mL TGF- b 1.

3. Insulin (Sigma). 4. Transferin (Sigma). 5. Selenious acid (Sigma). 6. Bovine serum albumin (Sigma). 7. Pyruvate (Sigma). 8. Linoleic acid (Sigma). 9. Ascorbate 2-phosphate (Sigma). 10. TGF b -1 (R&D Systems). 11. Trypan blue (Sigma). 12. 6-Well plates (Corning). 13. 15-mL Falcon tubes (V-bottom 96-well plates).

1. DMEM low glucose (1 g/L glucose, Gibco Invitrogen) sup-plemented with 10% FBS, 100 U/mL penicillin-G, 100 m g/mL streptomycin, 0.25 m g/mL amphotericin B, 2.4 mg/mL HEPES, and 3.7 mg/mL NaHCO 3 .

2. DPBS 1× sterile, without calcium and magnesium (PAA). 3. FBS (ICN Biomedicals).

Osteogenic Reagents


2.3. BMSC Characterization by FACS Analysis ( 18 )


4. Penicillin-G (Sigma). 5. Streptomycin (Sigma). 6. Amphotericin B (Sigma). 7. 0.25% Trypsin-EDTA (PAN Biotech GmbH). 8. 1% PFA (Sigma) in 1× DPBS. 9. Antibodies (Table 6 ). 10. Trypan blue (Sigma). 11. Propidium iodide solution, 1.5 mM (PI, Sigma). 12. FACS tubes (Sarstedt). 13. Cell culture centrifuge. 14. FACSCalibur Flow Cytometer (Becton Dickinson).

1. Minimum essential alpha-MEM supplemented with 10% FBS, 100 U/mL penicillin, 100 m g/mL streptomycin (Perbio Science).

2. Alpha-MEM supplemented with 10% FCS, 50 U/mL penicil-lin, 50 m g/mL streptomycin sulphate, 2 mM L -glutamine, 1 mM sodium pyruvate (all SAFC Biosciences), 100 m M L -ascorbate-2-phosphate (WAKO Pure Chemical Industries).

3. DMEM (Gibco) supplemented with 10% FCS, 1% penicillin–streptomycin (Biochrom AG).

4. Ficoll (Biochrom AG). 5. Percoll (Biochrom AG). 6. Lymphoprep density gradient (Axis Shiled or Nycomed). 7. Heparin (500 IU/mL) (Ratiopharm). 8. Monovettes with coagulation activator (Sarstedt). 9. Tissue culture fl asks, T75 and T125 (Corning). 10. 0.05 or 0.25% (w/v) Trypsin (Gibco). 11. 0.5 mM EDTA (Merck). 12. DPBS 1× sterile, without calcium and magnesium (PAA). 13. Antibodies (see Table 7 ). 14. 19G needles (Braun). 15. 7G trephine needle (Rocket Medical). 16. Toluidine Blue (Sigma-Aldrich). 17. Giemsa solution (Sigma-Aldrich).

1. DMEM supplemented with 10% FBS, 0.1 m M dexamethasone, 50 m g/mL L -ascorbic acid 2-phosphate, and 3 mM NaH 2 PO 4 (all, Sigma) ( 19 ) .

2.3.1. Ovine

Basic Reagents

Osteogenic Reagents


2. DMEM supplemented with 10% FBS, 0.1 m M dexamethasone, 10 mM b -glycerophosphate, 0.05 mM L -ascorbic acid-2-phos-phate (all Sigma) ( 20 ) .

1. DMEM high glucose supplemented with 1% ITS (standard supplement containing insulin, transferrin, selenous acid; BD Bioscience), 100 m M ascorbate-2 phosphate, 0.1 m M dexame-thasone, and 10 ng/mL TGF- b 1 (Sigma).

2. DMEM high glucose supplemented with 1% ITS (standard supplement containing insulin, transferrin, selenous acid), 210 m M ascorbate-2 phosphate, 0.01 m M dexamethasone, and 10 ng/mL TGF- b 1 (all Sigma).

3. 100 ng/mL BMP-7 (ProSpec-Tany TechnoGene Ltd). 4. 10 ng/mL TGF- b 3 (R&D Systems or Lonza).

1. DMEM-Ham’s F12 medium supplemented with 10% FBS, 1% antibiotic/antimycotic solution (MP Biomedicals).

2. DMEM supplemented with 10% FCS (Biochrom). 3. DMEM (low glucose supplemented with 10% FBS (Invitrogen),

pyruvate, 1% PenStrep, amphotericin, and fungizone).


2.3.2. Equine

Basic Reagents

Table 7 Classical surface antigens used for identi fi cation of ovine MSC

Cell surface epitope Ovine MSC Synonyme Antibody source

CD14 Neg. a Ovine CD14; endotoxin receptor (LPS) Serotec

CD29 Pos. a Ovine CD29, b 1 integrin Dr. A. Zannettino a

CD31 N.A. a Ovine CD31, PECAM-1 Serotec

CD34 Neg. a Human CD34; cell–cell adhesion, binds to selectins

Immunotech

CD44 Pos. a Human CD44, phagocytic glycoprotein-1; HA-receptor

Immunotech

CD45 Neg. a Ovine CD45, leukocyte common antigen

Serotec

CD105 Pos. a Human CD105, endoglin Santa Cruz

CD106 Pos. a Ovine CD106, VCAM-1 Dr. R. Krishnan b

CD166 Pos. ALCAM BD Bioscience

STRO-1 Pos. Unde fi ned antigen DSHB c

a Dr. A Zannettino, Institute of Medical and Veterinary Science, Adelaide, Australia b Dr. R. Krishnan, Queen Elisabeth Hospital, Adelaide, Australia c Developmental Studies Hybridoma Bank, University of Iowa, USA


4. Minimum essential alpha-MEM supplemented with 10% FBS and 1 ng/mL FGF-2.

5. DMEM-Ham’s F12 medium supplemented with 10% FBS, 50 m g/mL ascorbic acid, 30 m g/mL alpha-ketoglutaric acid, 300 m g/mL L -glutamine, 100 U/mL sodium penicillin, 100 m g/mL streptomycin sulphate, and 25 mM HEPES buffer.

6. 2% Mepivacaine hydrochloride (Intervet). 7. 1 ng/mL FGF-2 (R&D Systems). 8. Jamshidi bone marrow biopsy needles (VWR Scienti fi c). 9. Silverman BM biopsy needle. 10. 2% Lidocaine. 11. Heparinized (1,000 IU/10 mL) syringes. 12. 19G needle (Braun). 13. Gey’s Solution (Gibco). 14. Tyrode’s solution (Gibco). 15. Ficoll-Paque PLUS (Stem Cell Technologies). 16. Percoll (Biochrom). 17. DPBS 1× sterile, without calcium and magnesium (PAA,

Pasching). 18. Antibodies (see Table 8 ). 19. 0.5% Trypsin-EDTA (Biochrom). 20. 5100 Cryo 11°C Freezing Container (Wessington Cryogenics,

Tyne and Wear). 21. For cryopreservation: 10% DMEM supplemented with 10%

DMSO and 80% FBS.

1. DMEM (low glucose supplemented with 0.1 m M dexametha-sone, 10 mM b -glycerophosphate, 0.1 mM L -ascorbic acid 2-phosphate).

2. DMEM-Ham’s F12 supplemented with 10% FBS, 1% antibi-otic/antimycotic solution, 10 mM sodium b -glycerophos-phate, 20 mM dexamethasone, 50 m g/mL sodium 2-phosphate ascorbic acid.

1. DMEM, ITS + 1 (10 mg/L insulin, 5 mg/L transferrin, 5 m g/L selenium, 0.5 mg/mL bovine serum albumin, and 4.7 m g/mL linoleic acid), 1 mM sodium pyruvate, 100 nM dexametha-sone, 0.35 mM proline and 0.17 mM L -ascorbic acid-2-phosphate (all Sigma), 10 ng/mL TGF- b 1 (R&D Systems).

2. DMEM high glucose supplemented with 1% ITS+ (Sigma-Aldrich), 0.1 m M dexamethasone (Sigma-Aldrich), 37.5 m g/mL ascorbate-2-phosphate (WAKO Chemicals), and 10 ng/mL TGF b -3 (R&D Systems).

Osteogenic Reagents



3. DMEM/high glucose (10%), 1% antibiotic/antifungal solu-tion, dexamethasone (100 nM), L -ascorbic acid 2-phosphate (50 g/mL) and ITS+ (culture supplement containing bovine insulin, transferrin, selenous acid, linoleic acid, and BSA; BD Biosciences, Bedford, MA), TGF b -3 (human recombinant TGF b -3, R&D Systems Inc.) (10 ng/mL), and BMP-6 (human recombinant BMP-6, R&D Systems Inc.) (10 ng/mL).

4. 2% (w/v) Low melting agarose (Invitrogen).

1. 3% Acetic acid solution: 3 mL glacial acetic acid and 97 mL distilled water.

2. Alcian Blue solution (pH 2.5): 1 g Alcian blue, 8GX; 100 mL acetic acid, 3% solution; mix well and adjust pH to 2.5 using acetic acid.

3. 0.1% Nuclear fast red solution: 0.1 g Nuclear fast red; 5 g aluminium sulphate; 100 mL distilled water. Dissolve aluminium sulphate in water. Add nuclear fast red and slowly heat to boil and cool down. Filter and add a grain of thymol as a preservative.

2.4. Reagents for Analysis (for All Species)

2.4.1. Histology

Alcian Blue Staining ( www.ihcworld.com )

Table 8 Classical surface antigens used for identi fi cation of equine MSC

Cell surface epitope Human MSC Equine MSC Synonyme Antibody source

CD29 Pos. Pos. b 1-Integrin Biomol

CD44 Pos. Pos. Phagocytic glycoprotein-1; HA-receptor

AbD Serotec, Molecular Probes

CD73 Pos. ? Ecto 5 ¢ nucleotidase

CD90 Pos. Pos. Thy-1 Molecular Probes

CD105 Pos. Pos. Endoglin Abcam, AbD Serotec

CD106 Pos. ? VCAM

CD166 Pos. ? ALCAM

MHC I Pos. Pos. HLA I Pierce

CD11b Neg. ? ITGAM

CD14 Neg. Neg. Endotoxin receptor (LPS)

CD19 Neg. ? B lymphocyte antigen


Santa Cruz

CD45 Neg. Neg. LCA B220

CD79 a Neg. Neg. Immunoglobulin-associated a Acris, Pierce, AbD Serotec

MHC II Neg. Neg. HLA II AbD Serotec

http://www.ihcworld.com


1. Weigert’s iron haematoxylin solution: Stock solution A: 1 g haematoxylin; 100 mL 95% alcohol. Stock solution B: 4 mL 29% ferric chloride in water; 95 mL distilled water; 1 mL hydrochloric acid, concentrated. Working solution: Mix equal parts of stock solution A and B. This working solution is stable for about 4 weeks.

2. 0.1% 1,9-Dimethylmethylene blue (DMMB) solution: 0.1 g DMMB (Sigma); 100 mL distilled water.

1. Weigert’s iron haematoxylin solution: Stock solution A: 1 g haematoxylin; 100 mL 95% alcohol. Stock solution B: 4 mL 29% ferric chloride in water; 95 mL distilled water; 1 mL hydrochloric acid, concentrated. Working solution: Mix equal parts of stock solution A and B. This working solution is stable for about 4 weeks.

2. 0.001% Fast green (FCF) solution: 0.01 g Fast green, FCF, C.I. 42053; 1,000 mL distilled water.

3. 1% Acetic acid solution: 1 mL acetic acid, glacial; 99 mL distilled water.

4. 0.1% Safranin O solution: 0.1 g Safranin O, C.I. 50240; 100 mL distilled water.

1. 10 mM citrate buffer: 1.92 g citric acid (anhydrous); 1,000 mL distilled water. Mix to dissolve. Adjust pH to 6.0 with 1 N NaOH mix well. Store this solution at room temperature for 3 months or at 4°C for longer storage.

2. Pepsin digestion buffer: pH 7.4 McIlvaine buffer; 9.15 mL 0.1 M citric acid in 1× phosphate-buffered saline (PBS) 90.85 mL 0.2 M Na 2 HPO 4 in 1× PBS. Prepare working solution by dis-solving 3 mg/mL pepsin in pH 7.4 McIlvaine buffer.

3. H 2 O 2 blocking buffer: 1 mL 100% MeOH; 1 mL 30% H 2 O 2 , 8 mL 1× PBS.

4. Blocking buffer: 8 mL 1× PBS; 1 mL FCS; 1 mL serum of secondary antibody host.

Bone marrow aspirates (10–20 mL) were obtained via Jamshidi puncture from the iliac crest of healthy donors aged 18–65 years prior to bone graft harvest for back surgery.

DMMB Staining ( 21 )

Safranin O Staining ( www.ihcworld.com )

Immunohistochemistry ( 7, 22– 24 )

3. Methods

3.1. Isolation

3.1.1. Human BMSC

Bone Marrow Extraction



All steps under clean bench (Fig. 2a , b).

1. Prepare 50-mL Falcon tubes each containing a 15 mL Ficoll density gradient (four Falcon tubes per 20 mL bone marrow sample).

2. Dilute bone marrow sample 1:6 with proliferation medium (DMEM low glucose with supplements).

3. Carefully pipette 30 mL of diluted bone marrow sample to the surface of Ficoll density gradient. Devoid mixing!

4. Centrifuge Falcons at 450 × g (!accelerating: level 2, slowing down: level 1) for 35 min at room temperature (RT).

At the end of centrifugation, an opaque layer of mononu-clear cells (MNCs) ( r = 1.077 g/mL) should be inserted in between the Ficoll layer and “serum layer”. This layer of MNCs includes lymphoblasts, lymphocytes, and BMSC ( 25 ) .

MSC Isolation ( 22 )

Fig. 2. BMSC yield calculation for classic and density gradient protocols (Percoll and Ficoll). ( a ) In the classic protocol, the BMSC yield was calculated as the ratio of the number of BMSC recovered after 14 days of culture to the number of (MNC) mononuclear cells plated (14 days BMSC count/number of MNC plated). ( b ) Density gradient protocols involve two steps (centrifugation of sample with a density gradient solution and expansion of the recovered cells after centrifugation); the BMSC yield was calculated as the multiplication of cell yield of steps 1 and 2. Step 1: MNC separated/MNC in a 10 mL bone marrow sample. Step 2: 14 days BMSC count/number of MNC plated. Figure modi fi ed according to ref. ( 43 ).


5. Carefully discard upper layer up to the 20 mL mark. 6. Using a 5-mL pipette tip, carefully remove the opaque layer

and transfer to new 50-mL Falcon tubes. 7. Spin at 200 × g for 10 min at RT. 8. Discard the supernatant and re-suspend the MNCs in an

appropriate volume (10–20 mL) of fresh proliferation medium. Cells from several tubes can be combined.

9. Mix the cell suspension thoroughly, pipette 20 m L cell suspen-sion and 20 m L 4% acetic acid into an Eppendorf cup and mix well (acetic acid treatment results in haemolysis of residual erythrocytes).

10. Determine the cell number in a Neubauer hemocytometer. 11. According to requirements seed (see step 12) or freeze (see

step 13) the cells. 12. Prepare 75-cm 2 cell culture fl asks with each 15 mL with prolif-

eration medium (DMEM low glucose with supplements, see Subheading 2.2) and seed 2 × 10 6 cells per fl ask and incubate at 37°C in a humidi fi ed atmosphere containing 5% CO 2 .

13. To freeze the cells, supplement proliferation medium with 10% FCS and 10% DMSO in a cryo-cup and apply 5–10 × 10 6 cells per cup. Store frozen cells at −80°C up to 2 weeks or in liquid nitrogen up to few years.

The International Society for Cellular Therapy (ISCT) proposes following minimal criteria to de fi ne human MSC:

1. Adherence to plastic 2. Speci fi c surface antigen expression (see Tables 1 and 2 ) 3. Multipotent differentiation

1. Trypsinize 80–90% con fl uent BMSC, wash with DMEM (low glucose) containing 10% FBS.

2. Mix the cell suspension thoroughly, pipette 20 m L cell suspen-sion and 20 m L Trypan blue into an Eppendorf cup and mix well (Trypan blue allows to detect dead and dying cells by staining these blue).

3. Determine the cell number and viability in a Neubauer hemocytometer.

4. Transfer 1 × 10 6 cells into a FACS tube (starting from now, perform every step on ice!).

5. Centrifuge cell suspension at 550 × g for 5 min at RT. 6. Fix cells with 1% PFA in 1× DPBS for 5 min on ice. 7. Centrifuge cell suspension at 550 × g for 5 min at RT. 8. Wash cells with 1 mL 1× DPBS containing 10% FBS on ice.

Characterization of Human Bone Marrow-Derived Stem Cells ( 3, 12, 13 )

FACS Analysis


9. Centrifuge cell suspension at 550 × g for 5 min at RT. 10. Re-suspend cells with 1 mL 1× DPBS containing 10% FBS on

ice. 11. Centrifuge cell suspension at 550 × g for 5 min at RT. 12. Discard supernatant carefully. 13. Re-suspend and incubate cells with 1× DPBS containing 10%

FBS supplemented with 10 m g/mL of the respective antibody (see Tables 1 and 2 ) for 30 min in the dark on ice. Incubate negative control without antibody and isotype control with the respective isotype control antibody (10 m g/mL). Brie fl y vortex samples.

14. Centrifuge cell suspension at 550 × g for 5 min at RT. 15. Discard supernatant carefully. 16. Wash cells twice with 1 mL 1× DPBS containing 10% FBS

on ice. 17. Re-suspend cells with 0.5 mL 1× DPBS containing 10% FBS

on ice. Brie fl y vortex samples. 18. Dilute PI stock solution (1.5 mM) 1:1,000 with 1× DPBS

containing 10% FBS on ice. 19. Add 0.5 mL PI to the cells re-suspended with 0.5 mL 1× DPBS

containing 10% FBS on ice (PI stains dead cells). Brie fl y vortex samples.

20. Analyse cell samples with FACSCalibur Flow Cytometer with a minimum of 10,000 cells.

1. Kill the 6-week-old CD rats with CO 2 . 2. Remove the skin from both hind legs. 3. Cut off the legs just above the hip joint and cut off the feet

near the mid-ankle joint. 4. Immerse the legs in MEM alpha medium with 20% FCS, 1%

Pen/Strep, and 2% Glutamax. Next steps under clean bench (Fig. 2a ):

5. Scrap off the residual tissue (muscle, tendon, etc.) from femur and tibia. Dislocate both from the knee joints, and put back in MEM alpha medium with 10% Pen/Strep.

6. Hold the “knee end” of the bone upwards and cut off a little piece of the lower end of the bone.

7. Drill a hole in the centre of the bone marrow cavity of the knee joint end with an 18G needle.

8. The bones were transferred to a sterile Eppendorf cup using a half cut yellow tip, the open end towards the bottom.

9. Spin the bone marrow out of the bone; 2 min at 800 × g .

3.1.2. Rat BMSC

Dissection and Bone Marrow Extraction


1. Collect the bone marrow with 18G needle, re-suspend in 5 mL alpha-MEM medium and transfer to a Petri-dish.

2. Homogenize the bone marrow fi rst with an 18G needle, after-wards with a 20G needle and fi nally with a 23G needle.

3. Collect the bone marrow suspension in a sterile 50-mL Falcon tube and centrifuge at 500 × g for 5 min.

4. Re-suspend the pellet in 2 mL alpha-MEM medium with 20% FCS.

1. Adherence to plastic (distinguish BMSC from haematopoietic stem cells [HSCs])

2. Formation of colony forming units of fi broblast-like cells (CFU-F)

3. Extended proliferation ( 26 )

For identi fi cation of classical surface antigens of rat BMSC see Table 3 .

1. For magnetic associated cell sorting procedure (MACS), incu-bate the cells with the selected fi rst antibody, followed by wash-ing and incubation with anti-mouse secondary antibodies coupled with magnetic beads for 15 min at 4°C. Pass the sus-pension through a magnetic column; retain the labelled cells by the magnetic fi eld and collect the fl ow through containing the unlabelled negative fraction. After removing the column from the magnetic fi eld, fl ush out the antibody-labelled cells (positive fraction). Cells in both fractions are ready for analysis.

2. Perform the fl ow cytometric analyses with BMSC after 7 days of isolation. Block the cell suspension for 15 min at 4°C with sheep/goat serum followed by incubation with the appropri-ate antibodies (Table 3 ) and with corresponding isotype con-trols for 30 min at 4°C. Wash and suspend the cells with PBS containing sodium azide and bovine serum albumin. Prior to the FACS analysis, add propidium iodide to each sample in order to discriminate dead cells, which are excluded from the evaluation ( 24 ) .

1. Sacri fi ce the 6–8-week-old mice by cervical dislocation. 2. Apply 70% v/v EtOH solution liberally to the lower half of the

animal. 3. Excise the tibiae and femurs and clean thoroughly with a sterile

#11 scalpel to remove excess muscle tissue and tendons. 4. Remove epiphyses and place bones into ice-cold PBS con-

taining 2% penicillin–streptomycin prior to further process-ing ( 27 ) .

BMSC Isolation

Characterization

Classi fi cation Parameter of Bone Marrow-Derived Stem Cells

Classical Surface Antigens for Identi fi cation of MSC

3.1.3. Murine BMSC

Dissection


Two alternative methods are used for the preparation of murine bone marrow:

1. Flushing the bone marrow out of the bone shaft: remove the ends of the bones, and extrude the marrow by inserting a 21G needle into the shaft of the bone and fl ushing it with 1 mL of alpha-MEM supplemented with 10% FBS. Disperse the mar-row plugs by passage through a 16G needle and the marrow fi ltered through a 75- m m fi lter ( 10 ) .

2. Crushing the bones and digest with collagenase: Crush the dis-sected femurs and tibias with a pestle. Gently, wash the crushed bones once in HBSS+ (Hanks-balanced salt solution supple-mented with 2% FBS, 10 mM HEPES, and 1% penicillin–streptomycin), and fi lter the cell suspension through a cell strainer (70 m m) and discard. Collect the bone fragments and incubate for 1 h at 37°C in 20 mL of DMEM containing 0.2% collagenase, 10 mM HEPES, and 1% P/S. Filter the suspen-sion with a cell strainer (70 m m) to remove debris and bone fragments, and collect by centrifugation at 280 × g for 7 min at 4°C. Immerse the pellet in 1 mL water for 5–10 s to burst the red blood cells, after which add 1 mL of 2× PBS containing 4% FBS, and fi lter the suspension through a cell strainer ( 28 ) .

Immunodepletion: (increasing the purity of in vitro expanded BMSC by immunodepletion and BMSC subculture).

1. Suspend the cells in 1 mL 0.1% BSA/PBS, followed by an immunodepletion using antibody-conjugated Dynabeads M-280 Streptavidin super paramagnetic polystyrene.

2. Wash the Dynabeads with 0.1% BSA/PBS for fi ve times and then pre-coated with the following biotinylated antibodies, respectively, at appropriate concentration (5–10 m g antibodies per mg Dynabeads M-280 streptavidin) by incubation for 30 min at room temperature using gentle rotation: Biotin anti-mouse IgG.

3. Perform the three consecutive rounds of immunodepletion using antibodies against surface antigens (see Table 3 ) for depleting contaminating HSCs. In each case, thoroughly mix the cells and antibody-conjugated Dynabeads at a ratio of 1 cell per 5 beads and incubate on the rotator for 30 min at 4°C.

4. Then, wash the cells using a Dynal MPC to remove unbound cells. Suspend the immunodepleted cells in medium, plated in one T-25 fl ask at 1,000 cells/cm 2 followed by incubation in a 37°C with 5% CO 2 humidi fi ed incubator ( 30 ) .

Protocol FACS

1. Stain the cells with rat anti-mouse antibodies against cell surface antigens (see Table 3 ) at a concentration of 2 m g/mL at 4°C.


Characterization

Immunodepletion: Negative Selection with Antibodies-Coupled Microbeads ( 29, 30 )

Positive Selection via Flow Cytometry Analysis: CD90, CD73, Sca-1 ( 30 )


Cells stained with corresponding rat anti-mouse IgG served as negative controls. After 30 min, wash the unbound antibody with 2 mL PBS containing 1% human serum albumin.

2. Next, incubate the cells with 10 m L mouse anti-rat fl uorescein isothiocyanate (FITC) antibody at 4°C for 30 min followed by a wash with 2 mL PBS containing 1% human serum albumin. Re-suspend the cell pellets in 600 m L PBS and examine by fl ow cytometry with 5,000 events being recorded for each condi-tion ( 30 ) .

Either rabbits were killed before preparing the bone marrow from the tibia and femur or in most cases bone marrow was aspirated from the proximal anterior aspect of the tibia by a sterile surgical procedure after anaesthesia; general anaesthesia was accomplished by intra-muscular injection of a ketamine (35 mg/kg) + xylazine (5 mg/kg) solution ( 31 ) .

1. Make an incision over the medial anterior aspect of the tibia. 2. Elevate the periosteum and drill a small hole through the cortex. 3. Draw up several millilitre of marrow through silastic tubing

into a syringe coated with 3,000 IU of sodium heparin ( 32 ) .

1. Obtain the bone marrow from the tibias and femurs by either aspirating or fl ushing out with a 16G needle and a 10-mL syringe containing 1 mL of heparin (3,000 U/mL).

2. Alternatively, bone marrow may be fi ltered through a cell strainer (40 m m).

3. Transfer bone marrow to low-glucose DMEM, centrifuge at 600 × g for 10 min to obtain cell pellet.

4. Remove supernatant. 5. Re-suspend cells in 10 mL of low-glucose DMEM containing

10% FBS and 1% antibiotics ( 33, 34 ) .

1. Via FACS analyses: Use primary antibodies: anti-MHC I, anti-MHC II, anti-CD14, anti-CD45, anti-CD44, anti- b -1-integ-rin, and anti-CD90 mouse monoclonal antibodies; as secondary antibody a FITC goat anti-mouse IgG (Table 4 ).

2. Via immunohistochemistry: Use primary antibodies: anti- b 1-integrin, anti-CD90, anti-MHCI, anti-MHCII, anti-vimentin, anti- a -smooth-actin, anti-cytokeratin, anti-desmin. Visualize the reactivity by streptavidine-peroxidase method (Table 4 ).

1. Anesthetise the young adult (~6 months old) pigs with a com-bination of ketamine (2 mg/kg body weight i.m.) and xylazine (10 mg/kg body weight i.m.) and maintain with inhalation anaesthesia (halothane).

3.1.4. Rabbit BMSC

Dissection

Bone Marrow Extraction (Fig. 2a )

Characterization

3.1.5. Porcine BMSC



2. Obtain the bone marrow (~20 mL) from the humeral head with an 11G biopsy aspiration needle attached to a heparinized syringe ( 16 ) .

Perform all steps under clean bench!

1. Prepare 50-mL Falcon tubes each with 15 mL Histopaque 1083 (~3 Falcon tubes per 20 mL bone marrow sample).

2. Dilute bone marrow sample 1:4 with 1× DPBS. 3. Carefully layer 15 mL diluted bone marrow sample onto the

Histopaque 1083 surface. 4. Centrifuge at 550 × g for 30 min at RT (the brake should be in

the off position). 5. At the end of centrifugation, an opaque layer of MNCs should

be observed between Histopaque layer and “serum layer”. This layer of MNCs includes lymphoblasts, lymphocytes, and BMSC.

6. Brie fl y discard upper layer up to the 18–20 mL mark. 7. Carefully transfer the opaque layer with a Pasteur pipette into

a clean 50-mL Falcon tube. 8. Add 30 mL 1× DPBS or Minimum Essential alpha-MEM

medium supplemented with 10% FBS and mix by gentle inver-sion several times.

9. Centrifuge at 300 × g for 10 min. 10. Discard supernatant. 11. Re-suspend cell pellet with 0.5 mL 1× DPBS, then add an

additional 10–15 mL of 1× DPBS or alpha-MEM medium supplemented with 10% FBS, and mix by gentle inversion sev-eral times.

12. Centrifuge at 300 × g for 10 min. 13. Discard supernatant. 14. Repeat steps 11–13 as needed. 15. After fi nal wash, seed (see step 16) or freeze (see step 17)

the cells. 16. Prepare 75-cm 2 cell culture fl asks with each 15 mL MEM alpha

medium supplemented with 10% FBS, seed 5 × 10 5 cells/cm 2 , and incubate at 37°C in a humidi fi ed atmosphere containing 5% CO 2 .

17. To freeze the cells, supplement alpha-MEM medium supple-mented with 10% FBS and 10% DMSO in a cryo-cup and apply 5–10 × 10 6 cells per cup. Store frozen cells at −80°C up to 2 weeks or in liquid nitrogen up to few years.


Sigma-Aldrich Histopaque 1083 Protocol (Fig. 2b )


1. FACS analysis can be done according to protocols for human BMSC (see Subheading 3.1.1 ).

2. For identi fi cation of classical surface antigens of porcine MSC see Table 5 .

1. Obtain the bone marrow from either the carpal bones or the tibia and femur of healthy 3–6 months old calves.

2. Draw the bone marrow into 25-mL syringes containing hepa-rin (1,000 U) ( 35 ) .

Perform all steps under clean bench! (Fig. 2a ).

1. Mix one volume of bone marrow sample with two volumes of 1× DPBS in a 50-mL Falcon tube.

2. Centrifuge the mixture at 250 × g for 10 min. 3. Discard the supernatant. 4. Wash the pellet two times with 30–40 mL DMEM low glucose

without supplements (centrifuge at 250 × g for 10 min). 5. Mix the cell suspension thoroughly, pipette 20 m L cell suspen-

sion and 20 m L 4% acetic acid into an Eppendorf cup and mix well (acetic acid treatment results in haemolysis of residual erythrocytes).

6. Determine the cell number in a Neubauer hemocytometer. 7. According to requirements seed (see step 8) or freeze (see

step 9) the cells. 8. Prepare 75-cm 2 cell culture fl asks with each 15 mL with prolif-

eration medium (DMEM low glucose with supplements, see Subheading 2.2) and seed 2 × 10 6 cells per fl ask and incubate at 37°C in a humidi fi ed atmosphere containing 5% CO 2 .

9. To freeze the cells, supplement proliferation medium with 10% FCS and 10% DMSO in a cryo-cup and apply 5–10 × 10 6 cells per cup. Store frozen cells at −80°C up to 2 weeks or in liquid nitrogen up to few years.

1. FACS analysis can be done according to protocols for human MSC (see Subheading 3.1.1 ).

2. For identi fi cation of classical surface antigens of bovine MSC, see Table 6 .

1. Obtain the fresh bone marrow aspirates from the iliac crest of adult sheep (4 month to 8 years).

2. Extract the marrow using a disposable 7G trephine biopsy nee-dle by suction into a 30-mL syringe containing 500–3,000 IU sterile heparin ( 36 ) .

Characterization of Porcine Bone Marrow-Derived Stem Cells ( 15– 17 )

3.1.6. Bovine BMSC



Characterization of Bovine Bone Marrow-Derived Stem Cells ( 18 )

3.1.7. Ovine BMSC



There are two principle isolation protocols described in literature.

1. Calculate the total number of MNCs (0.5–1.5 × 10 7 cells/mL) after removing aggregates and debris by fi rm aspiration through a sterile 19G needle.

2. Wash cells in DMEM plus 10% FCS (see Note 1). 3. For counting, destruct red blood cells using 2.7% (v/v) acetic

acid ( 36 ) .

1. Isolate the MNCs from heparinized aspirates by either Ficoll density gradient centrifugation (density 1.077 g/mL ( 37 ) ; or Percoll continuous gradient centrifugation ( 20 ) ) or using Lymphoprep density gradient (1.077 g/mL) ( 38 ) .

A CFU limit dilution assay assesses the potential for cell self-renewal—a stem cell’s capacity to divide into two daughter cells, one of which remains in an undifferentiated stem-like state, while the other differentiates into a more speci fi c cell. Each colony derives from the division of a single cell ( 2 ) .

1. Determine the frequency of CFU-F in fresh BMSC samples by plating the MNCs at concentrations of 0.5 × 10 6 , 1 × 10 6 , and 2 × 10 6 cells in a 100-mm culture dish in alpha-MEM plus 20% FCS.

2. Analyse the cells after 10–14 days using two different staining methods: (a) Fix the cells with methanol , stain with Giemsa solution,

and score the colonies (containing at least 50 cells) macroscopically.

(b) The alternative method would be to rinse the cells in PBS and incubate them in 0.1% (w/v) Toluidine blue in 1% PFA in PBS.

3. Score the stain aggregates of >50 cells under the light microscope.

Flow cytometric analysis was used to characterize the cell surface antigen expression of ovine BMSC using markers positively and negatively associated with MSC populations derived from other species (Table 7 ).

1. Harvest the cultured BMSC (passages 1–5) by treatment with 0.05% trypsin and 0.53 mM EDTA in PBS with 0.1% BSA and 0.01% sodium azide.

2. Incubate approximately 1–2 × 10 5 cells with a primary antibody or isotype matched control for 30 min on ice.

3. Wash the cells twice with PBS plus 0.1% BSA to remove the unbound antibodies.

MSC Isolation

Plating of Total Bone Marrow (Fig. 2a )

Density Gradient Centrifugation (Fig. 2b )

Characterization

CFU-F Clonogenic Assay

FACS Analysis of Surface Antigens


4. Incubate for 30 min in a 1:50 dilution with FITC-conjugated secondary antibodies.

5. Typically, for each sample analyse 10,000 events on the Flow Cytometer and store as list mode data for further analysing using WinMDI software. De fi ne the positive fl uorescence as the level of fl uorescence greater than 99% of the corresponding isotype matched control antibody ( 19, 38 ) .

1. Bone marrow aspirates may be obtained aseptically from the sternum, tuber coxae, tibiae, or proximal humerus of horses of different ages.

2. Sedate the horses and prepare the harvest sites aseptically. In fi ltrate the subcutaneous tissue with local anaesthetic (2% lidocaine or 2% mepivacaine hydrochloride).

3. Use Jamshidi or 10G 3 in. Silverman BM biopsy needles to aspirate bone marrow into chilled syringes containing heparin (1,000–8,500 IU/mL in Gey’s or Tyrode’s solution).

4. Aspirate the 5 mL bone marrow into one 20-mL syringe. 5. Perform the BMSC isolation and expansion immediately after

tissue harvest ( 39– 41 ) .

There are two principle isolation protocols described in literature.

1. Wash the bone marrow samples in PBS and then mix with 0.8% ammonium chloride to remove red blood cells.

2. Rinse the remaining nucleated cell pellet with PBS, re-suspend in low-glucose DMEM (plus 10% FCS), and seed at 0.25 × 10 6 cells/cm 2 .

3. Change the medium after 24 h ( 42 ) . 4. Alternatively, re-suspend the 2 mL of aspirate per 1 mL

Tyrode’s solution and centrifuge twice at 300 × g for 15 min to remove red blood cells.

5. Re-suspend the cell pellets in 10 mL of Ham’s F12 medium supplemented with 10% FCS, 50 m g ascorbic acid/mL, 1% penstrep, and 25 mM HEPES. Plate the BMSC in 100 mm plastic culture dishes at a cell density of 1.2 × 10 6 /cm 2 with 10 mL of culture medium (0.13 mL/cm 2 ) ( 43 ) .

6. Culture the cells for 5 days in T75 fl asks before changing the medium for the fi rst time.

7. Exchange the medium every other day ( 39 ) .

1. Centrifuge at 1,000 × g for 15 min. 2. Aspirate the supernatant and re-suspend the pellet in culture

medium to attain either a 2 × 5 mL (Percoll, in polycarbonate

3.1.8. Equine BMSC


MSC Isolation

Plating of Total Bone Marrow (Fig. 2a )

Density Gradient Centrifugation (Fig. 2b )


tubes) or 15 mL (Ficoll, in a polypropylene tube) stock cell solution.

3. Layer the stock cell solution over two 7 mL preformed con-tinuous Percoll density gradients or one 7 mL Ficoll density gradient, respectively.

4. Centrifuge at 400 × g for 25 min at 20°C. 5. Aspirate the BMSC-enriched MNC population with a Pasteur

pipette (approximately 1.5 and 1 mL for the Percoll and the Ficoll, respectively).

6. Wash the MNC in culture medium by further centrifugation at 350 × g for 10 min at 20°C (modi fi ed from refs. ( 40, 44 ) ).

7. Re-suspend the pellets in 10 mL of culture medium. 8. Then, aspirate the 20 mL aliquots for MNC counts. 9. Determine the viability of the MNC and plate the MNC in

100-mm plastic culture dishes at a cell density of 2 × 10 5 /cm 2 (0.13 mL/cm 2 ).

10. Incubate the cells at 37°C in a humidi fi ed atmosphere contain-ing 5% CO 2 , allow to attach for 5 days, after that change the medium every 2 days.

11. After 80–90% con fl uence was reached (14 days for each group), wash the adherent cells twice in PBS, trypsinize (passage 1) and centrifuge at 350 × g for 10 min at 20°C.

12. Re-suspend the cells then in 10 mL of culture medium. 13. Aspirate a 20 mL aliquot and count the MSC ( 43 ) .

1. Perform the CFU assays at passage 0 (P0 = cells retrieved from the bone marrow and cultured before trypsinization) and pas-sage 1 (P1 = cells retrieved from the fi rst trypsinization), in 100-mm plastic culture dishes in triplicates. As a lower fre-quency of MSC was anticipated at P0, MNC were plated at a higher density than at P1. At P0, MNC were seeded at densi-ties of 5 × 10 4 and 1 × 10 4 cells per plastic culture dish, and incubated in culture medium as described above.

2. After 14 days, wash the adherent cells twice in PBS, fi x and stain with 1% crystal violet 7 in 10% ethanol for 10 min.

3. Count the CFUs per plate macroscopically and record the mean of triplicate dishes for each of the densities.

4. The frequency of CFU at P0 was estimated by dividing the number of CFUs with the number of MNC plated and expressed as a percentage.

5. The global frequency of CFUs at P0 was determined for each protocol as the mean of the frequency of CFUs for the differ-ent densities ( 45 ) .

Characterization

CFU-F Clonogenic Assay


6. At P1, the seeding densities were 100, 50, and 10 cells per plastic culture dish.

7. They were incubated and then washed, fi xed, stained and CFUs, frequency of CFUs, and global frequency of CFUs at P1 determined as described at P0 ( 43 ) .

1. FACS analysis can be done according to protocols for human MSC (see Subheading 3.1.1 ).

2. For identi fi cation of classical surface antigens of equine MSC see Table 8 .

1. Prepare 75-cm 2 cell culture fl asks with 15 mL each using pro-liferation medium (DMEM low glucose with supplements, see Subheading 2.2).

2. Seed 2 × 10 6 cells per fl ask and incubate at 37°C in a humidi fi ed atmosphere containing 5% CO 2 .

3. Remove non-adherent cells from the fl asks after 5–7 days by changing the medium.

4. Thereafter, change medium twice weekly. 5. After reaching 80% con fl uency (after ~4 weeks), trypsinize cells

using 0.05% trypsin-EDTA. 6. Count cells in a Neubauer hemocytometer. 7. Re-plate cells at about 200,000 cells/75-cm 2 cell culture fl ask. 8. Expand cells for 1–2 passages (early passages of BMSC main-

tain the potential for multilineage differentiation). 9. Harvest subcon fl uent cells by trypsinization and use them

immediately for differentiation experiments (see Subheading 3.3 ).

1. Seed the bone marrow cells of one rat (both legs) in 2× T175 fl asks and culture in alpha-MEM medium with 20% FCS and antibiotics.

2. Change the alpha-MEM medium (20% FCS) every 2–3 days (wash solid with PBS before the fi rst medium change).

3. When 80% con fl uency is obtained (9–11 days), freeze the cells in liquid nitrogen with 10% DMSO or further culture with 10% FCS.

1. BMSC (isolated via fl ushing the bone marrow or enzyme treat-ment of bone pieces) can be cultivated at a density of 2–4 × 10 6 cells/cm 2 in a MEM + GLUTAMAX-I supplemented with 10% FBS and antibiotics, incubated at 37°C with 5% CO 2 , and maintained with exchanges of fresh medium every 3–4 days for 2–3 weeks ( 10, 28 ) .

FACS Analysis of Surface Antigens

3.2. Culture

3.2.1. Human BMSC

Expansion ( 22 )

3.2.2. Rat BMSC

Expansion

3.2.3. Murine BMSC

Expansion

Standard Protocol


BMSC, isolated by fl ushing the bone marrow and then crushing and digesting the remaining bones:

1. Collect the cells of both isolations, mix and wash twice with PBS.

2. Plate the cells at 1 × 10 6 cells/cm 2 in McCoy’s 5A medium containing 20% murine MSC stimulatory supplements, 1% L -glutamine, and 1% penicillin–streptomycin.

3. Keep the culture in a humidi fi ed 5% CO 2 incubator at 37°C for 24–48 h, followed by removal of non-adherent cells with PBS and replacement with fresh complete medium ( 30 ) .

Besides these standard protocols for culturing BMSC based on plastic adherence, other culturing methods are established to elim-inate non-MSC from the isolated cell population, i.e. low-density culture ( 46 ) , frequent medium change, and positive ( 47 ) and neg-ative selection ( 29 ) .

1. Plate the 10 5 cells and culture in 10-cm dishes at 37°C in a humidi fi ed atmosphere of 5% CO 2 and 95% air.

2. Remove the non-adherent cells by changing the culture medium for 2 weeks after 5 days of culture ( 33 ) .

3. Alternatively, after 24 h remove the non-adherent cells by washing with PBS and add the fresh medium twice a week up to 90% con fl uence (passage 0) of the cells ( 48 ) .

4. For long-time storage, the cells could be placed in DMEM containing 20% FBS and 10% dimethylsulfoxide (DMSO) and stored in liquid nitrogen prior to use ( 34 ) .

1. Prepare 75-cm 2 cell culture fl asks with each 15 mL alpha-MEM medium supplemented with 10% FBS.

2. Seed 500,000 cells/cm 2 and incubate at 37°C in a humidi fi ed atmosphere containing 5% CO 2 .

3. Remove non-adherent cells from the fl asks after 24 h of cultur-ing by changing the medium.

4. Cultivate adherent fi broblast-like cells for 10–14 days at 37°C in a humidi fi ed atmosphere containing 5% CO 2 .

5. Thereafter, change medium every 3 days. 6. After reaching 80–90% con fl uency, trypsinize cells using 0.25%

trypsin-EDTA. 7. Count cells in a Neubauer hemocytometer. 8. Re-plate cells at about 5,000–6,000 cm 2 in cell culture fl asks. 9. Expand cells for 1–2 passages (early passages of BMSC main-

tain the potential for multilineage differentiation). 10. When cells begin to reach near con fl uent stage, trypsinize them

and use for differentiation experiments.

Modi fi ed Protocol

3.2.4. Rabbit BMSC

Expansion

3.2.5. Porcine BMSC

Expansion ( 16 )


1. Prepare 75-cm 2 cell culture fl asks with each 15 mL with prolif-eration medium (DMEM low glucose with supplements, see Subheading 2.2).

2. Seed 5 × 10 4 cells/cm 2 fl ask and incubate at 37°C in a humidi fi ed atmosphere containing 5% CO 2 .

3. Remove non-adherent cells from the fl asks after 4 days of cul-turing by changing the medium.

4. Thereafter, change medium every 2–3 days. 5. On days 12–13, detach cells using 0.25% trypsin-EDTA. 6. Count cells in a Neubauer hemocytometer. 7. Re-plate cells at a 1:3 or 1:4 dilution (= fi rst passage). 8. When cells begin to reach near con fl uent stage, trypsinize them

and use for differentiation experiments.

1. Plate the washed stromal cells at concentration of 3.6 × 10 5 /cm 2 (see Note 2) in T75 culture fl asks and maintain at 37°C and 5% CO 2 with a bi-weekly medium change.

2. Remove the non-adherent mononuclear and remaining red blood cells during the fi rst few medium changes (see Note 3).

3. Passage the adherent cells just prior to con fl uency by detach-ment using 0.25% trypsin in EDTA ( 36 ) .

4. Subsequently plate the cells at a density of 10 3 cells/cm 2 ( 19 ) . 5. Passage the cells at a density of 1,000 ( 19 ) to 5,000 cells/

cm 2 ( 37 ) .

1. For each sheep, collect the 100 mL of venous blood in mon-ovettes containing coagulation activator.

2. Centrifuge the monovettes for 10 min at 2,500 × g and 20°C. 3. Harvest the serum phase and inactivate by heat (56°C for

30 min) ( 37 ) .

1. Plate the primary cells at a density of 10 5 nucleated cells/cm 2 in T25 culture fl asks using HAM’s F12 stromal culture medium (see Subheading “MSC Isolation”).

2. Incubate the cells for 6 days before the fi rst medium change, allowing MSC adherence and facilitating removal of the non-adherent haematopoietic cell fraction.

3. Thereafter, change the medium every 3–4 days until the adher-ent cell population has reached ~80% con fl uence.

4. At this point, passage the adherent primary BMSC by diges-tion with 0.05% trypsin-EDTA.

5. Count the cells with a hemocytometer and reseed a portion of the cells as “Passage 1” (P1) at 5 × 10 3 BMSC/cm 2 .

3.2.6. Bovine BMSC

Expansion ( 35 )

3.2.7. Ovine BMSC

Expansion

Isolation of Autologous Serum

3.2.8. Equine BMSC

Expansion

Cell Doubling Method


6. For the subsequent passages (P1–10) inoculate the cells in T25 fl asks at 5 × 10 3 BMSC/cm 2 and allow multiplying for 3–4 days to ~70–80% con fl uence before trypsinization and successive passage.

7. Calculate the cell-doubling times (DT) and numbers (CD) from hemocytometer counts and cell culture time (CT) for each passage according to the following two formulae ( 49 ) : f iCD ln( / ) / ln(2)N N= (1); DT = CT/CD (2), where DT is the cell-doubling time, CT the cell culture time, CD the cell-doubling number, N f the fi nal number of cells, N i the initial number of cells.

8. Trypsinize all primary cells and cryo-preserve after they have reached ~80% con fl uence at P0.

9. The cryo-preservation medium contained 80% fetal calf serum, 10% DMEM, and 10% dimethyl sulfoxide (DMSO).

10. Place the cryo-vials containing the BMSC in a 5100 Cryo 11°C freezing container for 24 h at −80°C before being transferred to liquid nitrogen.

11. Before usage, thaw the BMSC at room temperature, count with a haemocytometer to assess viability, and subsequently centrifuge at 260 × g for 5 min before re-suspension in stromal medium. Seed the cells then for P1 at 5 × 10 3 cells/cm 2 ( 41 ) .

1. Use bone marrow nucleated cells from passages 1 to 2 (early passages of BMSC maintain the potential for multilineage differentiation).

2. Trypsinize 80–90% con fl uent bone marrow nucleated cells, wash with DMEM (low glucose) containing 10% FBS.

3. Mix the cell suspension thoroughly, pipette 20 m L cell suspen-sion and 20 m L Trypan blue into an Eppendorf cup and mix well (Trypan blue allows to detect dead and dying cells by staining these blue).


5. Centrifuge cell suspension at 200 × g for 10 min at RT. 6. Re-suspend cell pellet with DMEM (low glucose) containing

10% FBS. 7. Re-plate 3 × 10 3 cells/cm 2 in 6-well culture plates (2 mL/

well). 8. The following day (day 0), induce osteogenesis with osteo-

genic medium. 9. Cultivate cells for 9–28 days at 37°C in a humidi fi ed atmo-

sphere containing 5% CO 2 . 10. Change osteogenic medium twice weekly.

3.3. Differentiation

3.3.1. Osteogenic

Human BMSC ( 50 )


11. According to requirements, harvest supernatants, cell lysates, and perform histological or immunohistochemical staining on different days during differentiation.

1. Use 8% con fl uent bone marrow nucleated cells from passage 1. 2. Remove proliferation medium and wash with 5–10 mL DPBS. 3. Trypsinize bone marrow nucleated cells (3 mL trypsin/75-cm 2

cell culture fl ask). 4. Stop trypsin activity with 6 mL serum-containing proliferation

medium (Coon’s modi fi ed Ham’s F12 medium with chondro-genic supplements) and collect cell suspensions from the fl asks into 50-mL Falcon tubes.

5. Centrifuge at 200 × g for 10 min at RT. 6. Discard the supernatant and re-suspend the MNCs in an

appropriate volume (10–20 mL) (Coon’s modi fi ed Ham’s F12 medium with supplements). Cells from several tubes should be combined.

7. Mix the cell suspension thoroughly, pipette 20 m L cell suspension and 20 m L Trypan blue into an Eppendorf cup and mix well.


9. Centrifuge cell suspension at 200 × g for 10 min at RT. 10. Re-suspend cell pellet (5.71 × 10 5 cells/mL) with chondro-

genic medium (Coon’s modi fi ed Ham’s F12 medium with chondrogenic supplements).

11. To prepare cell pellets, centrifuge aliquots of 2 × 10 5 cells in 350 m L chondrogenic medium in a V-bottom 96-well plate at 900 × g for 5 min at RT.

12. Cultivate pellets in the plate for 14 days at 37°C in a humidi fi ed atmosphere containing 5% CO 2 .

13. Change chondrogenic medium every 2 days. 14. Change medium condition on day 15: remove chondrogenic

medium and cultivate the pellets in osteogenic medium (Coon’s modi fi ed Ham’s F12 medium with chondrogenic supplements) for 14 days (from day 15 to 28).

15. Change osteogenic medium every 2 days. 16. According to requirements, harvest supernatants or/and cell

pellets on different days during differentiation (e.g. day 1, 7, 14, 21, and 28).

1. Scaffold-free systems: 3D micro fl uidic system ( 52 ) 2. Scaffold-based osteogenesis ( 53 ) : poly lactic-co-glycolic acid

( 54 ) ; poly- e -caprolactone ( 55 ) ; collagen scaffold ( 56 ) ; titanium-based scaffolds ( 57, 58 ) ; bioceramic-based scaffolds ( 59– 63 )

3D Pellet Culture ( 51 )

Further 3D Osteogenic Models


1. Seed the cells (passage 3) at a density of 2 × 10 5 cells per well of a 6-well plate.

2. Culture the cells for 3 weeks in DMEM high glucose, 10% FCS, 1% antibiotics, 50 m g/mL L -ascorbate 2-phosphate, 10 nM dexamethasone, and 10 mM sodium b -glycero-phosphate.

3. Con fi rmation of osteogenesis might be done via microscope, by staining of calcium phosphate with Alizarin Red S and the expression of osteogenic marker like osteocalcin (Fig. 3 ).

1. Seed the BMSC (passage 3) at a density of 3 × 10 4 cells per well of a 6-well plate.

2. Ready-to-use osteogenic induction medium containing dex-amethasone, L -glutamine, ascorbate, Pen/Strep, MCGS, and glycerophosphate ( 30 ) .

3. Alternatively, alpha-MEM supplemented with 10% FBS, 10 mM b -glycerophosphate, 50 m g/mL L -ascorbate 2-phosphate, and 10 −8 M dexamethasone can be used to induce osteogenic dif-ferentiation ( 10 ) .

4. Medium should be changed every 3–4 days for 3 weeks.

1. Place the BMSC at passage 3 onto 12-well plates. 2. When the cells reached 60% con fl uency, exchange the control

medium (DMEM- a supplemented medium containing 10% FBS 250 m g fungizone/L, 100 mg ampicillin/L, and 50 mg gentamicin/L) to osteogenic differentiation medium (control media plus 0.1 m M dexamethasone, 50 m g/mL L -ascorbic acid

Rat BMSC

Murine BMSC

Rabbit BMSC

Fig. 3. In vitro osteogenic differentiation of rat BMSC. This fi gure demonstrates the exemplary process of isolation and osteogenic differentiation of rat BMSC.


2-phosphate, 10 mM b -glycerophosphate, 100 m g/mL penicillin, and 100 m g/mL streptomycin).

3. Change the medium every 3 days for 28 days ( 64 ) .

1. Use BMSC from passages 1 to 2. 2. Trypsinize 80–90% con fl uent BMSC, wash with DMEM (low

glucose) containing 10% FBS. 3. Mix the cell suspension thoroughly, pipette 20 m L cell sus-

pension and 20 m L Trypan blue into an Eppendorf cup and mix well.

4. Determine the cell number and viability in a Neubauer haemocytometer.

5. Centrifuge cell suspension at 200 × g for 10 min at RT. 6. Re-suspend cell pellet with DMEM (low glucose) containing

10% FBS. 7. Re-plate 3 × 10 3 cells/cm 2 in 6-well culture plates (2 mL/well). 8. The following day (day 0), induce osteogenesis with osteo-

genic medium. 9. Cultivate cells for 9–28 days at 37°C in a humidi fi ed atmo-

sphere containing 5% CO 2 . 10. Change osteogenic medium twice weekly. 11. According to requirements, harvest supernatants, cell lysates,

and perform histological or immunohistochemical stainings on different days during differentiation.

1. Use BMSC from passages 1 to 2. 2. Trypsinize 80–90% con fl uent BMSC and wash with DMEM

(low glucose). 3. Mix the cell suspension thoroughly, pipette 20 m L cell suspen-

sion and 20 m L Trypan blue into an Eppendorf cup and mix well.


5. Centrifuge cell suspension at 200 × g for 10 min at RT. 6. Re-suspend cell pellet with osteogenic medium. 7. Plate 5 × 10 4 cells/cm 2 in T-60 culture dishes. 8. Cultivate cells for 24 days at 37°C in a humidi fi ed atmosphere

containing 5% CO 2 . 9. Change osteogenic medium every 3 days. 10. According to requirements, harvest supernatants, cell lysates,


Porcine BMSC ( 50 )

Bovine BMSC ( 65 )


1. For osteogenic differentiation, seed the BMSC with a density of 2,000 cells/cm 2 .

2. After 24 h, exchange the expansion medium by the osteogenic differentiation medium.

3. Culture the cells in monolayer culture for 21–28 days with medium changes every 2–3 days ( 20, 36 ) .

4. For induction of mineralization add 3 mM NaH 2 PO 4 to the osteogenic medium ( 19 ) .

1. For CFU-Ob assays, culture the cells fi rst for 9 days in Ham’s F12 stromal medium (see Subheading “MSC Isolation”) to establish colonies.

2. On day 9, expose the cells to osteogenic induction medium. 3. Maintain the culture in the osteogenic medium for 5–10 days

until nodules are detected under phase contrast microscopy. 4. Feed the cells three times per week. Upon completion, rinse

the cells three times with 150 mM NaCl and then fi x in 70% ethanol and store at 4°C ( 41 ) .

3D-aggregate culture ( 22 )

1. Use 80% con fl uent BMSC from passage 1. 2. Remove proliferation medium and wash with 5–10 mL

DPBS. 3. Trypsinize bone marrow nucleated cells (3 mL trypsin per

75-cm 2 cell culture fl ask). 4. Stop trypsin activity with 6 mL serum-containing proliferation

medium (DMEM low glucose with supplements) and collect cell suspensions from the fl asks into 50-mL Falcon tubes.


appropriate volume (10–20 mL) of DMEM high glucose. Cells from several tubes should be combined.

7. Mix the cell suspension thoroughly, pipette 20 m L cell suspen-sion and 20 m L Trypan blue into an Eppendorf cup and mix well.

8. Determine the cell number and viability in a Neubauer haemocytometer.


genic medium. 11. To prepare cell pellets, centrifuge aliquots of 2 × 10 5 cells in

350 m L chondrogenic medium in a V-bottom 96-well plate at 900 × g for 5 min at RT.

Ovine BMSC

Equine BMSC

3.3.2. Chondrogenic

Human

Chondrogenesis Without Biomaterial



13. Change chondrogenic medium every 2 days. 14. According to requirements, harvest supernatants or/and cell

pellets on different days during differentiation (e.g. days 1, 7, 14, and 21) (Fig. 4 ).

3D-droplet pellet culture ( 66 )

1. Follow the steps 1–9 as above. 2. Re-suspend cell pellet (2 × 10 7 cells/mL) with chondrogenic

medium. 3. Carefully, place droplets (12.5 m L) in each well interior of a

24-well plate. 4. Allow cells to become adherent at 37°C for 2 h in a humidi fi ed

atmosphere containing 5% CO 2 . 5. Add 500 m L chondrogenic medium to each well and cultivate

cells for 21 days at 37°C in a humidi fi ed atmosphere contain-ing 5% CO 2 (after 24 h, the cell droplets become spherical).

6. Change chondrogenic medium every 3 days. 7. According to requirements, harvest supernatants or/and

micromass pellets on different days during differentiation (e.g. days 1, 7, 14, and 21).

1. A number of different biomaterials have been tested regarding chondrogenesis (Table 9 ). At this point, only several types of hydrogel-based protocols (photo-crosslinked poly ethylene glycol (PEG), fi brin glue), a sponge scaffold-based protocol (e.g. esteri fi ed hyaluronan-gelatin polymer composite), and a nano fi brous mesh protocol (poly epsilon-caprolactone scaf-fold) are described as an example.

2. Further possible scaffold-based 3D chondrogenesis models are given as literature reference in Table 9 ( 67, 68 ) .

Biomaterial-Assisted Chondrogenesis (Fig. 5 )

Fig. 4. In vitro chondrogenic differentiation of human BMSC. Schematic overview of the 3D chondrogenesis model of an aggregate culture: after bone marrow aspiration from the iliac crest, BMSC are isolated and subsequently expanded in monolayer. 3D aggregates are formed by centrifugation and cultivated under chondrogenic conditions ( 80 ).


Fig. 5. Esteri fi ed hyaluronan-gelatin polymer composite for BMSC chondrogenesis. Ultrastructure of the esteri fi ed hyaluronan-gelatin polymer composite without cells ( a ) and with BMSCs ( b ). Bar = 50 m m. Histological detection of type II collagen ( c ) and sGAG ( d ) synthesized by BMSCs in the esteri fi ed hyaluronan-gelatin polymer composite. Bar = 200 m m. By courtesy of Dr. Richard Kujat, Department of Trauma Surgery, University Hospital Regensburg, Germany.

3. The protocols described below can be used for BMSC chon-drogenesis of different species.

Chondrogenesis in a photo - crosslinked PEG hydrogel ( 69– 71 )

1. Sterilize solid macromers under UV irradiation for 20 min. 2. Dissolve macromers in sterile DPBS or water at a concentra-

tion of 10, 20, and 30%. 3. Dissolve and fi lter-sterilize photoinitiator in water. 4. Add a small amount of photoinitiator ( fi nal concentration:

0.05%) to the macromer solution. 5. Seed the BMSC at a cell density of 7.5 × 10 7 cells/mL of the

macromer solution. 6. Photopolymerize 40 mL of cell-macromer solution using a

long-wave UV lamp (intensity: 10 mW/cm 2 ) for 10 min.


7. Incubate the resulting cell-hydrogel constructs in DMEM, without phenol red, supplemented with 10 mM HEPES, 0.04 mM L -proline, 50 mg/L L -ascorbic acid, 0.1 M MEM nonessential amino acids, 1% penicillin–streptomycin, 0.5 mg/mL fungizone, and 10% FBS for 4 weeks at 37°C under static conditions in a humid environment with 5% CO 2 in 12-well plates.

8. Change medium twice a week. 9. According to requirements, harvest supernatants or/and cell-

hydrogel constructs on different days during differentiation (e.g. days 1, 7, 14, 21, and 28).

Table 9 Common biomaterials used for matrix-assisted 3D-chondrogenesis

Chemical type Biomaterial References

Protein Collagen ( 89 ) Fibrin ( 72 ) Gelatin ( 90 ) Laminin ( 91 ) Silk fi broin ( 92 )

Polysaccharide Agarose ( 93 ) Alginate ( 94 ) Cellulose ( 95 ) Chitosan ( 96 ) Chondroitin sulphate ( 97 ) Hyaluronic acid (HA) ( 98 )

Synthetic Poly lactic acid (PLA) ( 99 ) Poly glycolic acid (PGA) ( 100 ) Carbon fi bres ( 101 ) Dacron, te fl on ( 102, 103 ) Polyesterurethane (PEU) ( 104, 105 ) Polyhydroxybutyric acid (PHB) ( 104 ) Polyethylmethacrylate (PEMA) ( 106 ) Poly vinyl alcohol (PVA) ( 107 ) Poly a -hydroxy esters (PHEs) ( 108 ) Poly propylene fumarate (PPF) ( 109 ) Poly N -isopropylacrylamide (poly

NiPAAm) ( 110 )

Polyethylene glycol (PEG) ( 69– 71 )

Self-assembling peptides

( 82, 111 )


Chondrogenesis in a fi brin glue ( 72, 73 )

1. According to stability requirements, dissolve 12.5–100 mg/mL puri fi ed fi brinogen containing approximately 60% protein in 10,000 KIE/mL aprotinin solution.

2. Re-suspend BMSC in the fi brinogen solution (0.5–5 × 10 6 cells/40 mL).

3. Mix cell- fi brinogen solutions with the same volume of throm-bin at a concentration of 5 U/mL in 40 mM CaCl 2 (500 U/mL thrombin diluted 1:100 in Baxter dilution buffer contain-ing 40 mM CaCl 2 ).

4. Allow to gel in a silanized glass ring with an inner diameter of 5 mm for 45 min at 37°C (preparation procedure resulted in fi brin gels with a fi nal fi brinogen concentration ranging from 6.25 to 50 mg/mL, and fi nal CaCl 2 and thrombin concentra-tions of 20 mM and 2.5 U/mL, respectively; the pH of the fi nal gels was 7.0).

5. Remove the glass rings. 6. Cover fi brin gels with 4 mL of chondrocyte culture medium in

12-well plates and incubate at 37°C for 3 weeks. 7. Change medium twice a week. 8. According to requirements, harvest supernatants or/and cell–

fi brin gel constructs on different days during differentiation (e.g. days 1, 7, 14, and 21).

Chondrogenesis in a sponge scaffold ( e.g. esteri fi ed hyaluronan-gela-tin polymer composite ) ( 74 )

1. Sterilize cylindrical scaffolds (height 4 mm, ∅5 mm) via beta irradiation (e-beam) with a dose of 25 kGy according to ISO 11137.

2. Carefully inject MSCs into cylindrical polymer scaffolds. 3. Cultivate at 37°C in 5% CO 2 for 21 days in a 24-well plate in

chondrogenic medium. 4. Change medium twice a week. 5. According to requirements, harvest supernatants or/and cell–

fi brin gel constructs on different days during differentiation (e.g. days 1, 7, 14, and 21).

Chondrogenesis in a nano fi brous poly epsilon-caprolactone scaffold ( 75, 76 )

1. Prepare 14 mL of organic solvent mixture composed of tetra-hydrofuran and N , N -dimethylformamide.

2. Dissolve 2 g of PCL polymer in 14 mL of organic solvent mixture.

3. Mix it by vortexing for 24 h at RT.


4. Place polymer solution placed in a vertically fi xed 20-mL glass syringe fi tted with a 10-cm, 8G needle.

5. Apply a 12-kV electric fi eld at a distance of 20 cm between the aluminium foil covering a copper plate and the needle tip to create a 0.6-kV/cm charge density (voltage/distance) on the 0.14 g/mL polymer solution. (After 14 mL of polymer solu-tion was totally consumed at the rate of 0.4 mL/h, an elec-trospun PCL mat measuring 144 cm 2 with a thickness of approximately 1 mm was formed homogeneously on the aluminium foil.)

6. Remove the mat and place it in a vacuum chamber for at least 48 h to remove organic solvent residue, and then store it in a desiccator.

7. Cut the electrospun mat into 1 × 1-cm square shapes. 8. Sterilize scaffolds by ultraviolet irradiation in a laminar fl ow

hood for 30 min. 9. Immerse scaffolds in Hanks’ Balanced Salt Solution for 24 h in

the incubator to produce wetted scaffolds, which provide a hydrophilic surface conducive for ef fi cient cell attachment.

10. Place scaffolds in 24-well culture plates pre-coated with 0.3% poly (2-hydroxyethyl methacrylate) to prevent cell attachment to tissue culture polystyrene (TCPS).

11. Seed BMSC onto the surface of pre-wetted scaffolds placed in 24-well culture plates.

12. Incubate cellular scaffolds at 37°C for 4 h to allow BMSC to diffuse into and adhere to the scaffold.

13. During the 4 h of incubation, apply 20 m L of chondrocyte growth medium to each cellular scaffold every 30 min to pre-vent desiccation of the constructs.

14. Add 2 mL of chondrogenic medium to each well; incubate cel-lular scaffolds at 37°C for 21 days.

15. Replace cell culture medium every 3 days. 16. According to requirements, harvest supernatants or/and cell-

matrix constructs on different days during differentiation (e.g. days 1, 7, 14, and 21).

Induction of hypertrophy (according to ref. ( 77 ) )

1. Steps 1–11 according to 3D-aggregate culture ( 22 ) . 2. Cultivate pellets in the plate for 14 days at 37°C in a humidi fi ed

atmosphere containing 5% CO 2 . 3. Change chondrogenic medium every 2 days. 4. Change medium condition on day 15: remove chondrogenic

medium and cultivate the pellets in hypertrophy-enhancing medium for 14 days (from day 15 to 28).


5. Change hypertrophy-enhancing medium every 2 days. 6. According to requirements, harvest supernatants or/and cell

pellets on different days during differentiation (e.g. days 1, 7, 14, 21, and 28).

1. Culture the cells for up to 21 days in high-density 3D alginate bead cultures.

2. Suspend the 1 × 10 7 cells/mL in 1.2% alginate. 3. Drop the cell-alginate amalgam into 102 mM CaCl 2 solution

via a syringe, which resulted in a formation of beads with a diameter of 2–3 mm containing ~10 5 cells/bead.

4. Culture the cell alginate beads in 2.3 mL chondrogenic medium in 12-well tissue culture plates.

5. Release the cells from alginate by incubation at 37°C for 30 min in 55 mM sodium citrate and 0.15 M sodium chloride buffer followed by cell recovery with a 3 min spin at 750 × g .

1. Pellet the 5 × 10 5 BMSC in chondrogenic medium. 2. Chondrogenic medium was changed three times per week for

21 days ( 78 ) .

1. Fabricate Collagen type I/glycosaminoglycan scaffolds from a collagen-glycosaminoglycan (GAG) suspension using a lyo-philization method.

2. Centrifuge the BMSC cell suspension (2,000 × g , 5 min at 20°C), re-suspend in 2 mL supplemented DMEM, and aspi-rate through a 20G needle to obtain a single cell suspension of 1 × 10 6 cell/mL.

3. Seed the collagen-GAG scaffolds (5 mm 2 ) with 150 m L of cell suspension and incubate for 30 min.

4. Overturn the scaffolds onto agar-coated wells and place a fur-ther 150 m L of cell suspension onto the scaffold. After 30 min, add 2 mL of supplemented DMEM to each well and submerge the scaffold.

5. To induce chondrogenesis, place the scaffold in chondrogenic induction medium.

1. Transfer the 2 × 10 4 to 2.5 × 10 5 cells (P3) into a 15-mL conical tube and wash twice with incomplete chondrogenesis induc-tion medium.

2. Aspirate the supernatant. 3. Sediment the cells by centrifugation at 150 × g for 5 min and

add 0.5 mL complete chondrogenesis induction medium to the cell pellet (complete medium was prepared by adding 5 m L TGF b -3 to 1 mL incomplete medium).

Rat BMSC

Alginate Bead Culture

3D-Micromass Pellet Culture

Scaffold Culture (Example: Collagen Type I Glycosaminoglycan Scaffold) ( 79 )

Murine BMSC


4. Change the chondrogenic medium every 3–4 days. 5. Analyse the pellet after 21 days of culture ( 30 ) .

1. Trypsinise the cells after 14 days of culture. 2. Spin down the aliquots with 2 × 10 5 cells at 500 × g in 15-mL

polypropylene conical tubes. 3. Incubate the pelleted cells at 37°C, 5% CO 2 . 4. Within 24 h of incubation, the cells formed an essentially spher-

ical aggregate that did not adhere to the walls of the tube. 5. Medium needs to be changed every 2–3 days. 6. Harvest the aggregates at time points up to 21 days ( 80 ) .

1. Use 80% con fl uent BMSC from passage 1. 2. Remove proliferation medium and wash with 5–10 mL DPBS. 3. Trypsinize BMSC (3 mL trypsin/75-cm 2 cell culture fl ask . ). 4. Stop trypsin activity with 6 mL serum-containing proliferation

medium (DMEM low glucose with supplements) and collect cell suspensions from the fl asks into 50-mL Falcon tubes.


appropriate volume (10–20 mL) MEM alpha. Cells from sev-eral tubes should be combined.




genic medium. 11. To prepare cell pellets, centrifuge aliquots of 2 × 10 5 cells in

350 m L chondrogenic medium in a V-bottom 96-well plate at 900 × g for 5 min at RT.



pellets on different days during differentiation (e.g. days 1, 7, 14, and 21).

1. Use bone marrow nucleated cells from passages 1 to 2. 2. Trypsinize 80–90% con fl uent bone marrow nucleated cells,

wash with DMEM (low glucose), and count them on a Neubauer hemocytometer.

Rabbit BMSC

Porcine BMSC

3D-Micromass Pellet ( 16 )

Bovine BMSC

2D Monolayer ( 35 )




5. Centrifuge cell suspension at 200 × g for 10 min at RT. 6. Re-suspend cell pellet with proliferation medium. 7. Plate MSCs with a density of 2–5 × 10 3 cells/cm 2 in 6-well

plates. 8. Cultivate cells until subcon fl uence at 37°C in a humidi fi ed

atmosphere containing 5% CO 2 . 9. Discard proliferation medium. 10. Induce chondrogenic differentiation with a chondrogenic

medium. 11. Cultivate cells for 9 days at 37°C in a humidi fi ed atmosphere

containing 5% CO 2 . 12. Change chondrogenic medium every 2 days. 13. According to requirements, harvest supernatants, cell lysates,


1. Use BMSC from passages 1 to 2. 2. Trypsinize 80–90% con fl uent bone marrow nucleated cells,

wash with DMEM (high glucose), and count them on a Neubauer hemocytometer.



5. Centrifuge cell suspension at 200 × g for 10 min at RT. 6. Re-suspend cell pellet (1 × 10 6 cells/mL) with chondrogenic

medium. 7. To prepare cell pellets, centrifuge aliquots of 1 × 10 6 cells in

1 mL chondrogenic medium in a 15-mL Falcon tube at 900 × g for 10 min at RT.

8. Cultivate pellets in the tubes with loosened caps for 20 days at 37°C in a humidi fi ed atmosphere containing 5% CO 2 .


pellets on different days during differentiation.

1. Chondrogenic differentiation was induced by culture in 3D micromass pellets for 21 days in serum-depleted chondrogenic medium.

3D-Micromass Pellet ( 35 )

Ovine BMSC


2. The medium was completely changed every 3–4 days. Micromass pellets were prepared by spinning 2.5 × 10 5 BMSC at 1,000 × g for 5 min in a 15-mL polypropylene conical tube ( 19, 20, 36 ) . Additional to TGF b -1, BMP-7 (OP-1) (100 ng/mL) might be added to the chondrogenic medium ( 38 ) .

1. Perform a chondrogenesis assay as described. 2. P1-MSCs were plated at the density of 5 × 10 3 cells/cm 2 . 3. At 80% con fl uence, chondrogenic differentiation was induced

in monolayer culture. 4. Chondrogenic medium was supplemented with 10 ng/mL

TGF b -1 and 100 nmol/L dexamethasone (0.4 mL/cm 2 ) for 7 days ( 43 ) .

Pellets

1. For chondrogenesis experiments, thaw the primary cells (P0) and expand (P1) to obtain ~12 × 10 6 cells for subsequent P2 pellet cultures.

2. Trypsinize the cells and place an aliquots of 0.25 × 10 6 cells (P2) into racked microtubes and centrifuge for 5 min at 240 × g .

3. Culture the resulting pellets and induce into chondrogenesis using DMEM/high glucose (10%), 1% antibiotic/antifungal solution, dexamethasone (100 nM), ascorbic acid 2-phosphate (50 g/mL), and ITS (culture supplement containing bovine insulin, transferrin, selenous acid, linoleic acid, and BSA); with or without TGF b -3 (human recombinant TGF b -3, 10 ng/mL) and BMP-6 (human recombinant BMP-6, 10 ng/mL).

4. Change the medium every second day in all cultures. Terminate the pellet cultures at days 3, 7, 14, or 21 and then prepare for compositional studies ( 81 ) .

Hydrogel

1. Encapsulate the culture-expanded progenitor cells in 2% (w/v) low melting temperature agarose or 0.36% (w/v) self-assem-bling peptide at a concentration of 10 × 10 6 cells/mL in a 1.6-mm thick fl at slab geometry ( 82 ) .

2. Punch the one 12-mm disk for each medium condition. 3. Culture all hydrogels in high-glucose DMEM supplemented

with 1% ITS, 0.1 mM dexamethasone, and 37.5 mg/mL ascorbate-2-phosphate with or without 10 ng/mL recombi-nant human TGF b -1.

4. Maintain the cultures for 21 days, with medium changes every third day, prior to analysis ( 83 ) .

Equine BMSC

2D-Monolayer

3D Culture-Micromass


1. Wash the cell monolayers with PBS. 2. Stain for 5 min with a 2% (w/v) solution of Alizarin Red S

adjusted to pH 4.1 with ammonium hydroxide. 3. Rinse with water ( 10 ) (Figs. 6 and 7 ).

1. After 21 days of culture, rinse the cells three times with PBS. 2. Fix with 10% formaldehyde at room temperature for 30 min

(respectively 4% PFA for 1 h). 3. Then rinse fi xed cells three times with deionized water. 4. Add 1% (w/v) silver nitrate solution and subsequently expose

to UV light for 45 min. 5. Rinse cells three times with deionized water. 6. Stain cells with 2.5% (w/v) sodium thiosulphate solution for

5 min. 7. Rinse again three times with deionized water. 8. Counterstain with 0.1% of Safranin-O for 10 s. 9. Rinse again with deionized water to remove excess stain. 10. The presence of mineralized calcium deposits is con fi rmed by

purple colour staining, which is readily observable under bright fi eld light microscopy ( 84 ) .

1. For common antibodies used for immunohistochemical analy-sis of chondrogenic differentiation, see Table 10 .

1. ALP catalyzes the hydrolysis of p -nitrophenyl phosphate, a phosphate esters, resulting in the formation of an organic radi-cal ( p -nitrophenol) and inorganic phosphate.

2. Because of this reaction, a yellow coloured product develops that can be measured colorimetrically (maximal absorbance at 405 nm). The rate of the reaction is directly proportional to the enzyme activity.

⎯⎯⎯→ +ALP - Nitrophenylphosphate - nitrophenol phosphatep p

3.4. Analysis (for All Species)

3.4.1. Osteogenic Differentiation

Histology

Alizarin Red S Staining: Visualization of Mineralized Extracellular Matrix

von Kossa Staining: Visualization of Calcium Deposits

Immunohistochemistry

Enzymology

Alkaline Phosphatase (ALP) Activity Can Be Detected Quantitatively via an Enzymatic Reaction


Fig. 6. Morphology of BMSC which were exposed to osteogenic differentiation. Rat BMSC (passage 3) were subjected to osteogenic differentiation for 21 days. ( a ) Shows the fi rst changes in cell morphology from spindle shape to cuboidal shape after 1 week of differ-entiation. ( b ) (2 weeks) and ( c ) (3 weeks) visualize moderate to strong morphological changes and calcium deposition. Magni fi cation: ×40.


Real-time quantitative (q)PCR is the technique of collecting data throughout the PCR process as it occurs, thus combining ampli fi cation and detection into a single step. This is achieved using a variety of different fl uorescent chemistries that correlate PCR product concentration to fl uorescence intensity. One example for a fl uorescence dye commonly used in qPCR is SYBR ® Green (Stratagene). Reactions are characterized by the point in time (or PCR cycle) where the target ampli fi cation is fi rst detected. This value is usually referred to as cycle threshold (Ct), the time at which fl uorescence intensity is greater than background fl uorescence. Consequently, the greater the quantity of target cDNA in the start-ing material, the faster a signi fi cant increase in fl uorescent signal will appear, yielding a lower Ct.

In general, one experimental qPCR reaction is prepared by combining the following components according to the Stratagene SYBR ® Green Manual as one possible example:

1. Nuclease-free PCR-grade water 2. Brilliant II SYBR Green QPCR master mix including nucle-

otide mix 3. Upstream primer (200–600 nM fi nal concentration) 4. Downstream primer (200–600 nM fi nal concentration) 5. Diluted reference dye (ROX) 6. Genomic DNA, cDNA, or plasmid DNA as a template

For templates <150 bp, an appropriate two-step-PCR pro-gramme starts with 1 cycle at 95°C for 15 min, followed by 40 cycles consisting of 10 s at 95°C and 30 s at 60°C.

Two types of real-time quanti fi cation can be used to determine the mRNA level of a gene of interest:

1. Absolute quanti fi cation: Absolute quanti fi cation uses serially diluted standards of known concentrations to generate a stan-dard curve that produces a linear relationship between Ct values

Gene Expression

Expression of Osteogenic Marker (Runx2, Osterix, Msx2, Osteonectin, Osteocalcin, Osteopontin, Bone Sialoprotein, ALP, COL1A1, VDR (Vitamin D Receptor))

Fig. 7. Alizarin Red staining of osteogenic differentiated BMSC. The calcium depositions of differentiated rat BMSC were stained with Alizarin S Red after 7, 14, and 21 days of osteogenic differentiation. Magni fi cation: ×40 ( a ), ×100 ( b ), and ×200 ( c ).


Tabl

e 10

Co

mm

on a

ntib

odie

s us

ed fo

r im

mun

ohis

toch

emic

al a

naly

sis

of o

steo

geni

c di

ffere

ntia

tion

(all

spec

ies)

Antib

ody

(nom

encl

atur

e)

Antig

en

Spec

i fi ci

ty (s

peci

es)

Ig (m

onoc

lona

l/po

lycl

onal

) So

urce

(com

pany

)

Rab

bit

colla

gen

I an

tibod

y (a

b212

85)

Col

lage

n I

Hu,

Mu,

Rt,

Bo,

Eq

Poly

clon

al

Abc

am, U

SA

Mou

se a

nti-

oste

ocal

cin

antib

ody

(OC

4-30

) O

steo

calc

in

Hu,

Rt,

Dg,

Rb,

B

o, O

v, P

o, G

t M

onoc

lona

l Pi

erce

Ant

ibod

ies,

USA

Rab

bit

anti-

oste

onec

tin a

ntib

ody

Ost

eone

ctin

H

u Po

lycl

onal

M

illip

ore,

USA

Rab

bit

anti-

oste

opon

tin a

ntib

ody

(ab8

448)

O

steo

pont

in

Hu,

Mu,

Rt,

Dg,

Po

Poly

clon

al

Abc

am, U

SA

Rab

bit

alka

line

phos

phat

ase

antib

ody

(H-3

00)

AL

P H

u, M

u, R

t Po

lycl

onal

Sa

nta

Cru

z, U

SA

Rab

bit

bone

sia

lopr

otei

n (a

b330

22)

Bon

e si

alop

rote

in

Hu

Poly

clon

al

Abc

am, U

SA

Mou

se a

nti-

BM

P2 a

ntib

ody

(Clo

ne #

1002

21)

BM

P-2

Hu

Mon

oclo

nal

R&

D S

yste

ms,

USA

Mou

se c

olla

gen

I an

tibod

y [C

OL

-1]

(ab6

308)

C

olla

gen

1 H

u, M

u, R

at, B

o, D

e,

Dg,

Mk,

Po,

Rb,

RM

k M

onoc

lona

l A

bcam

, USA

Rab

bit

RA

NK

ant

ibod

y #4

845

RA

NK

H

u, M

u, R

t Po

lycl

onal

C

ell S

igna

lling

, USA

Rab

bit

anti-

RU

NX

2 an

tibod

y (S

533)

R

unx2

H

u Po

lycl

onal

A

BG

EN

T, U

SA

Mou

se a

nti-

SP7/

Ost

erix

ant

ibod

y (a

b573

35)

Ost

erix

H

u M

onoc

lona

l A

bcam

, USA

Rab

bit

anti-

Msx

-2 a

ntib

ody

(sc-

1529

6)

Msx

2

Hu,

Mu,

Rt

Poly

clon

al

Sant

a C

ruz,

USA

Mou

se a

nti-

Dlx

3 an

tibod

y (a

b547

26)

Dlx

3

Hu

Mon

oclo

nal

Abc

am, U

SA

Rat

ant

i-vi

tam

in D

rec

epto

r, cl

one

9A7

VD

R

Hu,

Vrt

M

onoc

lona

l M

illip

ore,

USA

Hu

hum

an;

Po p

orci

ne;

Bo

bovi

ne;

Mu

mur

ine;

Rt

rat;

Rb

rabb

it; E

q eq

uine

; O

v ov

ine;

Dg

dog;

De

deer

; M

k m

onke

y; R

Mk

Rhe

sus

mon

key;

Vrt

ve

rteb

rate

s


and initial amount of RNA or cDNA. A DNA standard for two-step real-time PCR can be synthesized by cloning the target sequence into a plasmid, purifying a conventional PCR product, or directly synthesizing the target nucleic acid.

2. Relative quanti fi cation: During relative quanti fi cation, changes in sample gene expression are measured based on a reference sample, also known as a calibrator. When using a calibrator, the results are expressed as a target/reference ratio, which pro-vides the relative fold change in expression. Normalization of gene expression data is required to correct sample-to-sample variation. Classical normalizers are housekeeping genes, as GAPDH and b -actin, known for their expression stability (more or less). There are numerous mathematical models avail-able to calculate the mean normalized gene expression from relative quanti fi cation assays, i.e. “comparative Ct (2 − D D Ct ) method” or the “Pfaf fl model” ( 85 ) .

Gene and primer sequences for osteogenic marker see Table 11 .

Table 11 Gene and primer sequences for osteogenic markers (sample species: rat)

Gene name Primer sequence (5 ¢ →3 ¢ ) Amplicon length (bp)

Accession number

Msx2 ( rMsx2 ) for.: CCTCGGTCAAGTCGGAAAAT 192 NM_012982 rev.: ACTGTTTCTGGCGGAACTTG

Osteocalcin/BGLAP ( rOC )

for.:CATGAGGACCCTCTCTCTGC 110 NM_013414 rev.:TGGACATGAAGGCTTTGTCA

Dlx5 ( rDlx5 ) for.: CTGGCCGCTTTACAGAGAAG 200 NM_012943 rev.:TAACTCGCCACAGTCACCAG

Type I collagen ( rCol1a1 )

for.: AGTTCCGGGCATAGATGGTA 196 Z78279 rev.: AGGCTCACCAGGTTCTCCTT

Type X collagen ( rCol10a1 )

for.: CCCTATTGGACCACCAGGTA 247 AJ131848 rev.: TCTCTGTCCGCTCTTTGTGA

MMP-13 ( rMmp13 ) for.: ACCTGGGATTTCCAAAAGAGG 93 NM_133530 rev.: TCTTCTCAGGGAACCACGTGT

Vegfa ( rVegfa ) for: TGGCTTTACTGCTGTACCTCCA 72 NM_031836 rev: TTTCTGCTCCCCTTCTGTCGT

GAPDH ( rGapdh ) for.: CACAGTCAAGGCTGAGAATGGGA 290 NM_017008 rev.: GCAATGCATCCTGCACCACCAA

Runx2/Cbfa1 ( rRunx2 )

for.:GAGTCAAGGGTGATCGTGGT 214 XM_346016 rev.:GGCTCTCCAGCTTCTCCTTT

Alkaline phosphatase ( rAlpl )

for.: GACAAGAAGCCCTTCACACGC 118 NM_013059 rev.: ACTGGGCCTGGTAGTTGTTG


1. Osteocalcin ELISA: Osteocalcin (OC) ELISA is a quantitative method for assaying the level of OC (or any other protein) within plasma, serum, cultured cell extracts, and culture supernatants.

Alcian blue stains acid muco-substances and acetic mucins. Strongly acidic muco-substances will be stained blue, nuclei will be stained pink to red, and cytoplasm will be stained pale pink (Fig. 8 ).

1. De-paraf fi nize slides and hydrate to distilled water/remove TissueTek by incubating slides in distilled water.

2. Stain in alcian blue solution for 30 min. 3. Wash in running tap water for 2 min. 4. Rinse in distilled water. 5. Counterstain in nuclear fast red solution for 5 min. 6. Wash in running tap water for 1 min. 7. Dehydrate and through 95% alcohol, two changes of absolute

alcohol, 3 min each. 8. Clear in xylene or xylene substitute. 9. Mount with resinous mounting medium.

The metachromatic dye 1,9-dimethylmethylene blue (DMMB) is used to detect synthesized sulphated glycosaminoglycans (sGAG). The more the blue colour of DMMB changes to purple, the more sGAG is synthesized. The nuclei will be stained black.

1. De-paraf fi nize slides and hydrate to distilled water and remove TissueTek by incubating slides in distilled water.

2. Stain in DMMB solution for 2–5 min. 3. Wash in water for 2 min. 4. Counterstain in nuclear fast red solution for 5 min. 5. Wash in running tap water for 1 min. 6. Dehydrate and through 95% alcohol, two changes of absolute

alcohol, 3 min each. 7. Clear in xylene or xylene substitute. 8. Mount with resinous mounting medium.

This method is used for the detection of cartilage, mucin, and mast cell granules on formalin- fi xed, paraf fi n-embedded tissue sections, and may be used for frozen sections as well. The cartilage and mucin will be stained orange to red, and the nuclei will be stained black. The cytoplasm is stained green.

1. De-paraf fi nize and hydrate slides in distilled water and remove TissueTek by incubating slides in distilled water.

Protein Expression

ELISA

3.4.2. Chondrogenic Differentiation

Histology

Alcian Blue Staining ( www.ihcworld.com )

DMMB Staining ( 21 )

Safranin O Staining ( www.ihcworld.com )





2. Stain with Weigert’s iron haematoxylin working solution for 10 min.

3. Wash in running tap water for 10 min. 4. Stain with fast green (FCF) solution for 5 min. 5. Rinse quickly with 1% acetic acid solution for no more than

10–15 s. 6. Stain in 0.1% Safranin O solution for 5 min.

Fig. 8. Alcian Blue histology of chondrogenic differentiated BMSC. Sections of BMSC kept in micromass pellet culture during after chondrogenic differentiation were stained with Alcian Blue to visualize aggrecan deposition in the extracellular matrix. Bars: 100 m M.


7. Dehydrate and clear with 95% ethyl alcohol, absolute ethyl alcohol, and xylene, using two changes each, 2 min each.

8. Mount using resinous medium.

For common antibodies used for immunohistological analysis of chondrogenic differentiation see Table 12 .

1. De-paraf fi nize and hydrate slides in distilled water and remove TissueTek by incubating slides in distilled water.

2. !Optional (antigen retrieval): e.g. carefully heat slides to 90°C for 40 min in 10 mM citrate buffer (membrane-bound recep-tors in paraf fi n sections) or predigest with pepsin digestion buffer for 15 min at 37°C (to demask collagen fi bres).

3. Wash with 1× PBS 3× for 5 min. 4. !Optional, when HRP-development intended: block endoge-

nous peroxidase with H 2 O 2 blocking buffer at room tempera-ture for 15 min.

5. Wash with 1× PBS 3× for 5 min. 6. Block unspeci fi c binding sides with blocking buffer at RT for

45 min (do not wash after blocking!). 7. Incubate with primary antibody at RT for 3 h or at 4°C

overnight. 8. Wash with 1× PBS 3× for 5 min.

Immunohistochemistry ( 7, 22– 24 ) (Figs. 9 – 11 )

Fig. 9. Collagen immuno fl uorescence of human BMSC embedded in a fi brin gel. The green fl uorescence displays collagens deposited into the extracellular matrix. Blue fl uorescence (DAPI) indicated cell nuclei. ( a ) Staining for collagen I after 7 and 28 days of culture in chondrogenic medium. ( b ) Staining for collagen II after 7 and 28 days of culture in chon-drogenic medium. ( c ) Staining for collagen III after 7 and 28 days of culture in chondro-genic medium. Bar = 25 m M.


9. Incubate with biotinylated/ fl uorochrome-conjugated secondary antibody at RT for 60–90 min.

10. Wash with 1× PBS 3× for 5 min. 11. !Optional, when HRP-development intended: Incubate with

ABC solution at RT for 60–90 min. 12. !Optional, when HRP-development intended: Wash with

1× PBS 3× for 5 min. 13. !Optional, when HRP-development intended: Develop DAB

solution. 14. !Optional, when HRP-development intended: Wash with

1× PBS. 15. !Optional, when HRP-development intended: Dehydrate and

clear with 95% ethyl alcohol, absolute ethyl alcohol, and xylene, using two changes each, 2 min each.

16. According to requirements, nuclei can be stained with Weigert’s iron haematoxylin solution or DAPI.

17. Mount using resinous/ fl uorescent medium.

Fig. 10. COMP expression in rat BMSC embedded in alginate beads. Cartilage oligomeric matrix protein, as a marker for hyaline cartilage, was stained at different days during chondrogenic differentiation of rat BMSC embedded into alginate beads. ( a ) Rat knee cartilage slices (control); ( b ) BMSC embedded into alginate beads at day 0; ( c ) BMSC embedded into alginate beads at day 7; ( d ) BMSC embedded into alginate beads at day 21. Bar = 50 m M.


1. For common primers used for gene expression analysis of chondrogenic differentiation see Table 13 .

Collagen I and II ELISA in monolayer culture

1. For the analysis of newly synthesized type I and II concentra-tions in monolayer culture, follow the instructions described in Native Type I/II Collagen Detection Kit 6009-Protocol.

Collagen I and II ELISA in 3D micromass pellet culture 3D pellets should be pre-processed before analysing them with

Native Type I/II Collagen Detection Kit 6009 ( 22 ) :

1. Homogenize ~3–4 pellets in 400 m L 0.05 M acidic acid + 0.5 M NaCl (pH 2.9–3.0) at RT.

Gene Expression

Quantitative RT-PCR (as in Subheading “Gene Expression”)

Protein Expression

Collagen I and II ELISA

Fig. 11. Human BMSC kept in micromass pellets after 21 days of chondrogenic differentiation. ( a ) BMSC aggregate after 21 days of chondrogenesis (macroscopic). ( b ) BMSC aggregate after 21 days of chondrogenesis (DMMB staining). ( c ) BMSC aggregate after 21 days of chondrogenesis (type II collagen). ( d ) BMSC aggregate after 21 days of chondrogen-esis (type I collagen). Bar = 1 mm.


Tabl

e 12

Co

mm

on a

ntib

odie

s us

ed fo

r im

mun

ohis

toch

emic

al a

naly

sis

of c

hond

roge

nic

diffe

rent

iatio

n (a

ll sp

ecie

s)

Antib

ody

(nom

encl

atur

e)

Antig

en

Spec

i fi ci

ty (s

peci

es)

Ig (m

onoc

lona

l/po

lycl

onal

) So

urce

(com

pany

)

Rab

bit

anti-

equi

ne t

ype

I co

llage

n C

olla

gen

I E

q Po

lycl

onal

JO

R 1

9 ( 3

9 )

Ant

i-co

llage

n ty

pe I

clo

ne C

OL

-1

(C 2

456)

H

u, B

o, R

b, D

e, P

g, R

t (c

ross

rea

cts

with

ovi

ne)

Mon

oclo

nal

Sigm

a-A

ldri

ch

Rab

bit

anti-

colla

gen

type

I

Hu,

Mu,

Rt

Poly

clon

al

Cal

bioc

hem

Rab

bit

anti-

hum

an t

ype

II c

olla

gen

Col

lage

n II

H

u (c

ross

rea

ctio

n w

ith e

quin

e)

Poly

clon

al

DPC

Bie

rman

n, G

erm

any

Mou

se m

onoc

lona

l ant

ibod

y C

IIC

1 an

d II

-II6

B3

Ch

(cro

ss r

eact

ion

with

equ

ine,

hu

man

, bov

ine,

rat

, and

mou

se)

Mon

oclo

nal

DSH

B, I

A, U

SA

Rat

ant

i-bo

vine

typ

e II

col

lage

n C

ross

rea

cts

with

equ

ine

Poly

clon

al

M. C

rem

er; V

eter

ans

Adm

inis

trat

ive

Hos

pita

l, M

emph

is, T

N

Mou

se a

nti-

ovin

e ty

pe I

I co

llage

n C

lone

II-

4 C

11

Ov

Mon

oclo

nal

MP

Bio

med

ical

s, S

olon

, OH

Goa

t an

ti-hu

man

col

lage

n II

C

ross

rea

cts

with

ovi

ne

Poly

clon

al

Sant

a C

ruz

Bio

tech

M

ouse

ant

i-co

llage

n ty

pe I

I (A

b-1)

H

u, B

o, R

t, R

b M

onoc

lona

l C

albi

oche

m

Col

lage

n II

I an

tibod

y (F

H-7

A)

Col

lage

n II

I H

u, R

t (c

ross

rea

ctio

n w

ith o

vine

) M

onoc

lona

l A

bcam

Rab

bit

anti-

colla

gen

type

IX

C

olla

gen

IX

Hu,

Bo,

Mu,

Rt

Poly

clon

al

Cal

bioc

hem

R

abbi

t an

ti-co

llage

n ty

pe I

X

Hu,

Mu,

Rt

Poly

clon

al

( 112

)

Col

lage

n ty

pe X

ant

ibod

y (X

53)

Col

lage

n X

M

u, R

t, H

u, G

p, D

g (c

ross

rea

ctio

n w

ith o

vine

) M

onoc

lona

l Q

uart

ett,

Ger

man

y

Rab

bit

anti-

MIA

(H

-70)

M

IA

Hu,

Mu,

Rt

Poly

clon

al

Sant

a C

ruz

Mou

se a

nti-

ovin

e ag

grec

an

Agg

reca

n O

v M

onoc

lona

l A

cris

Ant

ibod

ies,

Her

ford

, Ger

man

y R

abbi

t an

ti-ag

grec

an (

H-3

00)

Hu,

Mu,

Rt

Poly

clon

al

Sant

a C

ruz

Rab

bit

anti-

Sox9

So

x9

Hu,

Rt

Poly

clon

al

Mill

ipor

e, U

SA

Ave

rage

ant

ibod

y di

lutio

n fa

ctor

: 1:5

0–50

0 H

u hu

man

; Po

porc

ine;

Bo

bovi

ne; M

u m

urin

e; R

t ra

t; R

b ra

bbit;

Eq

equi

ne; O

v ov

ine;

Dg

dog;

Gp

guin

ea p

ig; C

h ch

icke

n


2. Digest homogenate with 50 m L pepsin (10 mg/mL) in 0.05 M acidic acid on a rotator (35 U/min) for 48 h at 4°C.

3. Follow the instructions described in Native Type I/II Collagen Detection Kit 6009-Protocol.

4. !Normalize collagen concentration to DNA content of the pellets!

1. Quantify newly synthesized MIA (CD-RAP) in monolayer culture medium or in 3D pellet supernatant by following the instructions of the MIA-ELISA-Protocol.

1. Use pellet digests prepared for collagen ELISA. 2. Digest pellets in Sigma papain digestion solution ( 86 ) at 60°C

overnight. 3. In both cases, chondroitin sulphate A from bovine trachea

should be digested in parallel as standard.

1. Dilute standard and samples as required with 6 mM EDTA in PBS supplemented with 6 mM cysteine HCl (pH 6.0). Highest standard: 80 m g/mL chondroitin sulphate A.

MIA (CD-RAP) ELISA

sGAG-Assay for 3D Micromass Pellet Cultures (=DMMB-Assay, According to Ref. ( 21 ) )

DMMB-Assay

Table 13 Common primers used for qPCR analysis of chondrogenic differentiation (sample species: human)

Gene name Primer sequence (5 ¢ Æ3 ¢ ) Amplicon length (bp)

Accession number

Type I collagen ( hCOL1A1 )

for.: ACGTCCTGGTGAAGTTGGTC 172 NM_000088 rev.: ACCAGGGAAGCCTCTCTCTC

Type III collagen ( hCOL3A1 )

for.:AGGGGAGCTGGCTACTTCTC 267 NM_000090 rev.:TAGGAGCAGTTGGAGGCTGT

Type II collagen ( hCOL2A1 )

for.:TGCTGCCCAGATGGCTGGAAGA 139 NM_001844 rev.:TGCCTTGAAATCCTTGAGGCCC

Type IX collagen ( hCOL9A1 )

for.:AAAGCCGGCAGGCCCAATTG 146 NM_001851 rev.:GCTCATGGCAAGTTTCTCTCCT

Type X collagen ( hCOL10A1 )

for.: CCCTCTTGTTAGTGCCAACC 154 X72580 rev.: TGAGGCCTTTAGTTGCTATGC

MMP-13 ( hMMP-13 ) for.: GACTGGTAATGGCATCAAGGGA 149 NM_002427 rev.: CACCGGCAAAAGCCACTTTA

Sox9 ( hSOX9 ) for: ACACACAGCTCACTCGACCTTG 104 Z46629 rev: AGGGAATTCTGGTTGGTCCTCT

GAPDH ( hGAPDH ) for.: CTGACTTCAACAGCGACACC 120 J04038 rev.: CCCTGTTGCTGTAGCCAAAT

Aggrecan ( hACAN ) for.:CTATACCCCAGTGGGCACAT rev.:GGCACTTCAGTTGCAGAAGG

107 NM_001135.3 NM_013227.3


2. Pipette standards and diluted samples (each 25 m L) into a 96-well plate.

3. Add 250 m L DMMB reagent per well (see Subheading “DMMB Staining”).

4. Measure absorbance at 595 nm in a microplate reader (sGAG concentration is inversely related to the OD!).

5. !Normalize sGAG concentration to DNA content of the pel-lets (see Subheading “Double-Stranded DNA-Assay for 3D Pellet Cultures”).

1. The Quant-iT™ PicoGreen ® dsDNA reagent is an ultrasensi-tive fl uorescent nucleic acid stain for quanti fi cation of double-stranded DNA (dsDNA) in solution.

1. Use pellet digests prepared for collage ELISA. 2. Dilute digests 1:16 to 1:32 ( 87 ) . 3. Follow the instructions described in the Quant-iT™ PicoGreen ®

dsDNA reagent protocol.

4. Notes

1. Samples of FCS from different suppliers need to be batch tested for their ability to allow BMSC proliferation on identical cell populations. To allow quantitative data to be compared, a large quantity of the best batch was then purchased, frozen at −20°C, and stored until usage.

2. There are different cell densities published for initial seeding: from single cell colonies to 2 × 10 4 to 3.6 × 10 5 cells/cm 2 .

3. There are different times published for the fi rst medium change, which ranges from 3 to 5 days after fi rst seeding of the cells.

References

Double-Stranded DNA-Assay for 3D Pellet Cultures

dsDNA-Assay

1. Tuan RS, Boland G, Tuli R (2003) Adult mes-enchymal stem cells and cell-based tissue engi-neering. Arthritis Res Ther 5:32–45

2. Friedenstein AJ, Gorskaja JF, Kulagina NN (1976) Fibroblast precursors in normal and irradiated mouse hematopoietic organs. Exp Hematol 4:267–274

3. Pittenger MF, Mackay AM, Beck SC, Jaiswal RK, Douglas R, Mosca JD, Moorman MA, Simonetti DW, Craig S, Marshak DR (1999) Multilineage potential of adult human mesenchymal stem cells. Science 284:143–147

4. Cancedda R, Dozin B, Giannoni P, Quarto R (2003) Tissue engineering and cell therapy of cartilage and bone. Matrix Biol 22:81–91

5. Caplan AI (2005) Review: mesenchymal stem cells: cell-based reconstructive therapy in orthopedics. Tissue Eng 11:1198–1211

6. Phinney DG, Hill K, Michelson C, DuTreil M, Hughes C, Humphries S, Wilkinson R, Baddoo M, Bayly E (2006) Biological activi-ties encoded by the murine mesenchymal stem cell transcriptome provide a basis for their developmental potential and broad therapeu-tic ef fi cacy. Stem Cells 24:186–198


7. Grassel S, Ahmed N, Gottl C, Grifka J (2009) Gene and protein expression pro fi le of naive and osteo-chondrogenically differentiated rat bone marrow-derived mesenchymal progeni-tor cells. Int J Mol Med 23:745–755

8. Phinney DG, Prockop DJ (2007) Concise review: mesenchymal stem/multipotent stromal cells: the state of transdifferentiation and modes of tissue repair—current views. Stem Cells 25:2896–2902

9. Uccelli A, Moretta L, Pistoia V (2008) Mesenchymal stem cells in health and disease. Nat Rev Immunol 8:726–736

10. Phinney DG, Kopen G, Isaacson RL, Prockop DJ (1999) Plastic adherent stromal cells from the bone marrow of commonly used strains of inbred mice: variations in yield, growth, and differentiation. J Cell Biochem 72:570–585

11. Woodbury D, Schwarz EJ, Prockop DJ, Black IB (2000) Adult rat and human bone marrow stromal cells differentiate into neurons. J Neurosci Res 61:364–370

12. Dominici M, Le Blanc K, Mueller I, Slaper-Cortenbach I, Marini F, Krause D, Deans R, Keating A, Prockop D, Horwitz E (2006) Minimal criteria for de fi ning multipotent mes-enchymal stromal cells. The International Society for Cellular Therapy position state-ment. Cytotherapy 8:315–317

13. Kotobuki N, Hirose M, Takakura Y, Ohgushi H (2004) Cultured autologous human cells for hard tissue regeneration: preparation and characterization of mesenchymal stem cells from bone marrow. Artif Organs 28:33–39

14. Sawhney AS, Pathak CP, Hubbell JA (1993) Interfacial photopolymerization of poly(ethylene glycol)-based hydrogels upon alginate-poly(l-lysine) microcapsules for enhanced biocompatibility. Biomaterials 14:1008–1016

15. Vacanti V, Kong E, Suzuki G, Sato K, Canty JM, Lee T (2005) Phenotypic changes of adult porcine mesenchymal stem cells induced by prolonged passaging in culture. J Cell Physiol 205:194–201

16. Bosch P, Pratt SL, Stice SL (2006) Isolation, characterization, gene modi fi cation, and nuclear reprogramming of porcine mesenchy-mal stem cells. Biol Reprod 74:46–57

17. Rho GJ, Kumar BM, Balasubramanian SS (2009) Porcine mesenchymal stem cells— current technological status and future perspective. Front Biosci 14:3942–3961

18. Kato Y, Imabayashi H, Mori T, Tani T, Taniguchi M, Higashi M, Matsumoto M, Umezawa A, Tsunoda Y (2004) Nuclear trans-fer of adult bone marrow mesenchymal stem

cells: developmental totipotency of tissue-speci fi c stem cells from an adult mammal. Biol Reprod 70:415–418

19. Mrugala D, Bony C, Neves N, Caillot L, Fabre S, Moukoko D, Jorgensen C, Noel D (2008) Phenotypic and functional characterisation of ovine mesenchymal stem cells: application to a cartilage defect model. Ann Rheum Dis 67:288–295

20. Rentsch C, Hess R, Rentsch B, Hofmann A, Manthey S, Scharnweber D, Biewener A, Zwipp H (2010) Ovine bone marrow mesen-chymal stem cells: isolation and characteriza-tion of the cells and their osteogenic differentiation potential on embroidered and surface-modi fi ed polycaprolactone-co-lactide scaffolds. In Vitro Cell Dev Biol Anim 46:624–634

21. Hoemann CD, Sun J, Chrzanowski V, Buschmann MD (2002) A multivalent assay to detect glycosaminoglycan, protein, colla-gen, RNA, and DNA content in milligram samples of cartilage or hydrogel-based repair cartilage. Anal Biochem 300:1–10

22. Jenei-Lanzl Z, Straub RH, Dienstknecht T, Huber M, Hager M, Grassel S, Kujat R, Angele MK, Nerlich M, Angele P (2010) Estradiol inhibits chondrogenic differentia-tion of mesenchymal stem cells via nonclassic signaling. Arthritis Rheum 62:1088–1096

23. Ahmed N, Vogel B, Rohde E, Strunk D, Grifka J, Schulz MB, Grassel S (2006) CD45-positive cells of haematopoietic origin enhance chondrogenic marker gene expression in rat marrow stromal cells. Int J Mol Med 18:233–240

24. Ahmed N, Dreier R, Gopferich A, Grifka J, Grassel S (2007) Soluble signalling factors derived from differentiated cartilage tissue affect chondrogenic differentiation of rat adult marrow stromal cells. Cell Physiol Biochem 20:665–678

25. Sulc K, Neuwirt J, Travnicek T, Kobylka P, Radikovska E (1977) Bone marrow cell sepa-ration on Ficoll gradient. Haematologia (Budap) 11:41–46

26. Bianco P, Riminucci M, Gronthos S, Robey PG (2001) Bone marrow stromal stem cells: nature, biology, and potential applications. Stem Cells 19:180–192

27. Short BJ, Brouard N, Simmons PJ (2009) Prospective isolation of mesenchymal stem cells from mouse compact bone. Methods Mol Biol 482:259–268

28. Morikawa S, Mabuchi Y, Kubota Y, Nagai Y, Niibe K, Hiratsu E, Suzuki S, Miyauchi-Hara C, Nagoshi N, Sunabori T, Shimmura S,


Miyawaki A, Nakagawa T, Suda T, Okano H, Matsuzaki Y (2009) Prospective identi fi cation, isolation, and systemic transplantation of mul-tipotent mesenchymal stem cells in murine bone marrow. J Exp Med 206:2483–2496

29. Baddoo M, Hill K, Wilkinson R, Gaupp D, Hughes C, Kopen GC, Phinney DG (2003) Characterization of mesenchymal stem cells isolated from murine bone marrow by nega-tive selection. J Cell Biochem 89:1235–1249

30. Xu S, De Becker A, Van Camp B, Vanderkerken K, Van RI (2010) An improved harvest and in vitro expansion protocol for murine bone marrow-derived mesenchymal stem cells. J Biomed Biotechnol 2010:105940

31. Roostaeian J, Carlsen B, Simhaee D, Jarrahy R, Huang W, Ishida K, Rudkin GH, Yamaguchi DT, Miller TA (2006) Characterization of growth and osteogenic differentiation of rab-bit bone marrow stromal cells. J Surg Res 133:76–83

32. Young RG, Butler DL, Weber W, Caplan AI, Gordon SL, Fink DJ (1998) Use of mesen-chymal stem cells in a collagen matrix for Achilles tendon repair. J Orthop Res 16:406–413

33. Huang CY, Reuben PM, Cheung HS (2005) Temporal expression patterns and correspond-ing protein inductions of early responsive genes in rabbit bone marrow-derived mesen-chymal stem cells under cyclic compressive loading. Stem Cells 23:1113–1121

34. Park H, Temenoff JS, Tabata Y, Caplan AI, Mikos AG (2007) Injectable biodegradable hydrogel composites for rabbit marrow mes-enchymal stem cell and growth factor delivery for cartilage tissue engineering. Biomaterials 28:3217–3227

35. Bosnakovski D, Mizuno M, Kim G, Ishiguro T, Okumura M, Iwanaga T, Kadosawa T, Fujinaga T (2004) Chondrogenic differentia-tion of bovine bone marrow mesenchymal stem cells in pellet cultural system. Exp Hematol 32:502–509

36. Rhodes NP, Srivastava JK, Smith RF, Longinotti C (2004) Heterogeneity in prolif-erative potential of ovine mesenchymal stem cell colonies. J Mater Sci Mater Med 15:397–402

37. Zscharnack M, Hepp P, Richter R, Aigner T, Schulz R, Somerson J, Josten C, Bader A, Marquass B (2010) Repair of chronic osteo-chondral defects using predifferentiated mes-enchymal stem cells in an ovine model. Am J Sports Med 38:1857–1869

38. McCarty RC, Gronthos S, Zannettino AC, Foster BK, Xian CJ (2009) Characterisation and developmental potential of ovine bone

marrow derived mesenchymal stem cells. J Cell Physiol 219:324–333

39. Worster AA, Brower-Toland BD, Fortier LA, Bent SJ, Williams J, Nixon AJ (2001) Chondrocytic differentiation of mesenchymal stem cells sequentially exposed to transform-ing growth factor-beta1 in monolayer and insulin-like growth factor-I in a three-dimen-sional matrix. J Orthop Res 19:738–749

40. Hegewald AA, Ringe J, Bartel J, Kruger I, Notter M, Barnewitz D, Kaps C, Sittinger M (2004) Hyaluronic acid and autologous syn-ovial fl uid induce chondrogenic differentia-tion of equine mesenchymal stem cells: a preliminary study. Tissue Cell 36:431–438

41. Vidal MA, Kilroy GE, Johnson JR, Lopez MJ, Moore RM, Gimble JM (2006) Cell growth characteristics and differentiation frequency of adherent equine bone marrow-derived mesen-chymal stromal cells: adipogenic and osteo-genic capacity. Vet Surg 35:601–610

42. Kisiday JD, Hale BW, Almodovar JL, Lee CM, Kipper MJ, Wayne MC, Frisbie DD (2010) Expansion of mesenchymal stem cells on fi brinogen-rich protein surfaces derived from blood plasma. J Tissue Eng Regen Med 5:8

43. Bourzac C, Smith LC, Vincent P, Beauchamp G, Lavoie JP, Laverty S (2010) Isolation of equine bone marrow-derived mesenchymal stem cells: a comparison between three proto-cols. Equine Vet J 42:519–527

44. Smith RK, Korda M, Blunn GW, Goodship AE (2003) Isolation and implantation of autologous equine mesenchymal stem cells from bone marrow into the super fi cial digital fl exor tendon as a potential novel treatment. Equine Vet J 35:99–102

45. Arnhold SJ, Goletz I, Klein H, Stumpf G, Beluche LA, Rohde C, Addicks K, Litzke LF (2007) Isolation and characterization of bone marrow-derived equine mesenchymal stem cells. Am J Vet Res 68:1095–1105

46. Eslaminejad MB, Nikmahzar A, Taghiyar L, Nadri S, Massumi M (2006) Murine mesen-chymal stem cells isolated by low density primary culture system. Dev Growth Differ 48:361–370

47. Nadri S, Soleimani M (2007) Isolation murine mesenchymal stem cells by positive selection. In Vitro Cell Dev Biol Anim 43:276–282

48. Lapi S, Nocchi F, Lamanna R, Passeri S, Iorio M, Paolicchi A, Urciuoli P, Coli A, Abramo F, Miragliotta V, Giannessi E, Stornelli MR, Vanacore R, Stampacchia G, Pisani G, Borghetti L, Scatena F (2008) Different media and supplements modulate the clonogenic and expansion properties of rabbit bone marrow mesenchymal stem cells. BMC Res Notes 1:53


49. Rainaldi G, Pinto B, Piras A, Vatteroni L, Simi S, Citti L (1991) Reduction of prolifera-tive heterogeneity of CHEF18 Chinese ham-ster cell line during the progression toward tumorigenicity. In Vitro Cell Dev Biol 27A:949–952

50. Jaiswal N, Haynesworth SE, Caplan AI, Bruder SP (1997) Osteogenic differentiation of puri fi ed, culture-expanded human mesen-chymal stem cells in vitro. J Cell Biochem 64:295–312

51. Muraglia A, Corsi A, Riminucci M, Mastrogiacomo M, Cancedda R, Bianco P, Quarto R (2003) Formation of a chondro-osseous rudiment in micromass cultures of human bone-marrow stromal cells. J Cell Sci 116:2949–2955

52. Ong SM, Zhang C, Toh YC, Kim SH, Foo HL, Tan CH, van Noort D, Park S, Yu H (2008) A gel-free 3D micro fl uidic cell culture system. Biomaterials 29:3237–3244

53. Tortelli F, Cancedda R (2009) Three-dimensional cultures of osteogenic and chon-drogenic cells: a tissue engineering approach to mimic bone and cartilage in vitro. Eur Cell Mater 17:1–14

54. Cuddihy MJ, Kotov NA (2008) Poly(lactic-co-glycolic acid) bone scaffolds with inverted colloidal crystal geometry. Tissue Eng Part A 14:1639–1649

55. Ciapetti G, Ambrosio L, Savarino L, Granchi D, Cenni E, Baldini N, Pagani S, Guizzardi S, Causa F, Giunti A (2003) Osteoblast growth and func-tion in porous poly epsilon-caprolactone matrices for bone repair: a preliminary study. Biomaterials 24:3815–3824

56. Wahl DA, Czernuszka JT (2006) Collagen-hydroxyapatite composites for hard tissue repair. Eur Cell Mater 11:43–56

57. van den Dolder J, Bancroft GN, Sikavitsas VI, Spauwen PH, Jansen JA, Mikos AG (2003) Flow perfusion culture of marrow stromal osteoblasts in titanium fi ber mesh. J Biomed Mater Res A 64:235–241

58. Storrie H, Stupp SI (2005) Cellular response to zinc-containing organoapatite: an in vitro study of proliferation, alkaline phosphatase activity and biomineralization. Biomaterials 26:5492–5499

59. Mastrogiacomo M, Cancedda R, Quarto R (2001) Effect of different growth factors on the chondrogenic potential of human bone marrow stromal cells. Osteoarthritis Cartilage 9(suppl A):S36–S40

60. Mastrogiacomo M, Corsi A, Francioso E, Di Comite M, Monetti F, Scaglione S, Favia A, Crovace A, Bianco P, Cancedda R (2006) Reconstruction of extensive long bone defects

in sheep using resorbable bioceramics based on silicon stabilized tricalcium phosphate. Tissue Eng 12:1261–1273

61. Mastrogiacomo M, Scaglione S, Martinetti R, Dolcini L, Beltrame F, Cancedda R, Quarto R (2006) Role of scaffold internal structure on in vivo bone formation in macroporous cal-cium phosphate bioceramics. Biomaterials 27:3230–3237

62. Mastrogiacomo M, Papadimitropoulos A, Cedola A, Peyrin F, Giannoni P, Pearce SG, Alini M, Giannini C, Guagliardi A, Cancedda R (2007) Engineering of bone using bone mar-row stromal cells and a silicon-stabilized trical-cium phosphate bioceramic: evidence for a coupling between bone formation and scaf-fold resorption. Biomaterials 28:1376–1384

63. Jones AC, Arns CH, Hutmacher DW, Milthorpe BK, Sheppard AP, Knackstedt MA (2009) The correlation of pore morphology, interconnectivity and physical properties of 3D ceramic scaffolds with bone ingrowth. Biomaterials 30:1440–1451

64. Liu H, Fan H, Toh SL, Goh JC (2008) A comparison of rabbit mesenchymal stem cells and anterior cruciate ligament fi broblasts responses on combined silk scaffolds. Biomaterials 29:1443–1453

65. Bosnakovski D, Mizuno M, Kim G, Takagi S, Okumura M, Fujinaga T (2005) Isolation and multilineage differentiation of bovine bone marrow mesenchymal stem cells. Cell Tissue Res 319:243–253

66. Zhang L, Su P, Xu C, Yang J, Yu W, Huang D (2010) Chondrogenic differentiation of human mesenchymal stem cells: a comparison between micromass and pellet culture systems. Biotechnol Lett 32:1339–1346

67. Chung C, Burdick JA (2008) Engineering cartilage tissue. Adv Drug Deliv Rev 60:243–262

68. Vinatier C, Mrugala D, Jorgensen C, Guicheux J, Noel D (2009) Cartilage engineering: a crucial combination of cells, biomaterials and biofactors. Trends Biotechnol 27:307–314

69. Bryant SJ, Nuttelman CR, Anseth KS (2000) Cytocompatibility of UV and visible light photoinitiating systems on cultured NIH/3T3 fi broblasts in vitro. J Biomater Sci Polym Ed 11:439–457

70. Bryant SJ, Anseth KS (2001) The effects of scaffold thickness on tissue engineered carti-lage in photocrosslinked poly(ethylene oxide) hydrogels. Biomaterials 22:619–626

71. Bryant SJ, Anseth KS (2002) Hydrogel proper-ties in fl uence ECM production by chondrocytes photoencapsulated in poly(ethylene glycol) hydrogels. J Biomed Mater Res 59:63–72


72. Eyrich D, Brandl F, Appel B, Wiese H, Maier G, Wenzel M, Staudenmaier R, Goepferich A, Blunk T (2007) Long-term stable fi brin gels for cartilage engineering. Biomaterials 28:55–65

73. Silverman RP, Passaretti D, Huang W, Randolph MA, Yaremchuk MJ (1999) Injectable tissue-engineered cartilage using a fi brin glue polymer. Plast Reconstr Surg 103:1809–1818

74. Angele P, Muller R, Schumann D, Englert C, Zellner J, Johnstone B, Yoo J, Hammer J, Fierlbeck J, Angele MK, Nerlich M, Kujat R (2009) Characterization of esteri fi ed hyaluro-nan-gelatin polymer composites suitable for chondrogenic differentiation of mesenchymal stem cells. J Biomed Mater Res A 91:416–427

75. Li WJ, Laurencin CT, Caterson EJ, Tuan RS, Ko FK (2002) Electrospun nano fi brous struc-ture: a novel scaffold for tissue engineering. J Biomed Mater Res 60:613–621

76. Li WJ, Danielson KG, Alexander PG, Tuan RS (2003) Biological response of chondrocytes cultured in three-dimensional nano fi brous poly(epsilon-caprolactone) scaffolds. J Biomed Mater Res A 67:1105–1114

77. Mueller MB, Tuan RS (2008) Functional characterization of hypertrophy in chondro-genesis of human mesenchymal stem cells. Arthritis Rheum 58:1377–1388

78. Neuhuber B, Swanger SA, Howard L, Mackay A, Fischer I (2008) Effects of plating density and culture time on bone marrow stromal cell characteristics. Exp Hematol 36:1176–1185

79. Farrell E, O’Brien FJ, Doyle P, Fischer J, Yannas I, Harley BA, O’Connell B, Prendergast PJ, Campbell VA (2006) A collagen-glycosaminoglycan scaffold supports adult rat mesenchymal stem cell differentiation along osteogenic and chondrogenic routes. Tissue Eng 12:459–468

80. Johnstone B, Hering TM, Caplan AI, Goldberg VM, Yoo JU (1998) In vitro chondrogenesis of bone marrow-derived mesenchymal progenitor cells. Exp Cell Res 238:265–272

81. Vidal MA, Robinson SO, Lopez MJ, Paulsen DB, Borkhsenious O, Johnson JR, Moore RM, Gimble JM (2008) Comparison of chondro-genic potential in equine mesenchymal stromal cells derived from adipose tissue and bone marrow. Vet Surg 37:713–724

82. Kisiday JD, Jin M, DiMicco MA, Kurz B, Grodzinsky AJ (2004) Effects of dynamic compressive loading on chondrocyte biosyn-thesis in self-assembling peptide scaffolds. J Biomech 37:595–604

83. Kisiday JD, Kopesky PW, Evans CH, Grodzinsky AJ, McIlwraith CW, Frisbie DD (2008) Evaluation of adult equine bone mar-row- and adipose-derived progenitor cell chondrogenesis in hydrogel cultures. J Orthop Res 26:322–331

84. Ye CP, Heng BC, Liu H, Toh WS, Cao T (2007) Culture media conditioned by heat-shocked osteoblasts enhances the osteogenesis of bone marrow-derived mesenchymal stromal cells. Cell Biochem Funct 25:267–276

85. Wong ML, Medrano JF (2005) Real-time PCR for mRNA quantitation. Biotechniques 39:75–85

86. Mueller MB, Fischer M, Zellner J, Berner A, Dienstknecht T, Prantl L, Kujat R, Nerlich M, Tuan RS, Angele P (2010) Hypertrophy in mesenchymal stem cell chondrogenesis: effect of TGF-beta isoforms and chondrogenic con-ditioning. Cells Tissues Organs 192:158–166

87. Angele P, Yoo JU, Smith C, Mansour J, Jepsen KJ, Nerlich M, Johnstone B (2003) Cyclic hydrostatic pressure enhances the chondro-genic phenotype of human mesenchymal pro-genitor cells differentiated in vitro. J Orthop Res 21:451–457

88. Lefebvre V, Smits P (2005) Transcriptional control of chondrocyte fate and differentia-tion. Birth Defects Res C Embryo Today 75:200–212

89. De Franceschi L, Grigolo B, Roseti L, Facchini A, Fini M, Giavaresi G, Tschon M, Giardino R (2005) Transplantation of chon-drocytes seeded on collagen-based scaffold in cartilage defects in rabbits. J Biomed Mater Res A 75:612–622

90. Hoshikawa A, Nakayama Y, Matsuda T, Oda H, Nakamura K, Mabuchi K (2006) Encapsulation of chondrocytes in photopoly-merizable styrenated gelatin for cartilage tis-sue engineering. Tissue Eng 12:2333–2341

91. Bradham DM, Passaniti A, Horton WE Jr (1995) Mesenchymal cell chondrogenesis is stimulated by basement membrane matrix and inhibited by age-associated factors. Matrix Biol 14:561–571

92. Wang Y, Kim UJ, Blasioli DJ, Kim HJ, Kaplan DL (2005) In vitro cartilage tissue engineer-ing with 3D porous aqueous-derived silk scaf-folds and mesenchymal stem cells. Biomaterials 26:7082–7094

93. Diduch DR, Jordan LC, Mierisch CM, Balian G (2000) Marrow stromal cells embedded in alginate for repair of osteochondral defects. Arthroscopy 16:571–577

94. Almqvist KF, Wang L, Wang J, Baeten D, Cornelissen M, Verdonk R, Veys EM, Verbruggen G (2001) Culture of chondrocytes


in alginate surrounded by fi brin gel: character-istics of the cells over a period of eight weeks. Ann Rheum Dis 60:781–790

95. Muller FA, Muller L, Hofmann I, Greil P, Wenzel MM, Staudenmaier R (2006) Cellulose-based scaffold materials for cartilage tissue engi-neering. Biomaterials 27:3955–3963

96. Montembault A, Tahiri K, Korwin-Zmijowska C, Chevalier X, Corvol MT, Domard A (2006) A material decoy of biological media based on chitosan physical hydrogels: application to cartilage tissue engineering. Biochimie 88:551–564

97. Fan H, Hu Y, Li X, Wu H, Lv R, Bai J, Wang J, Qin L (2006) Ectopic cartilage formation induced by mesenchymal stem cells on porous gelatin-chondroitin-hyaluronate scaffold con-taining microspheres loaded with TGF-beta1. Int J Artif Organs 29:602–611

98. Facchini A, Lisignoli G, Cristino S, Roseti L, De Franceschi L, Marconi E, Grigolo B (2006) Human chondrocytes and mesenchymal stem cells grown onto engineered scaffold. Biorheology 43:471–480

99. Dounchis JS, Bae WC, Chen AC, Sah RL, Coutts RD, Amiel D (2000) Cartilage repair with autogenic perichondrium cell and poly-lactic acid grafts. Clin Orthop Relat Res (377):248–264

100. Freed LE, Grande DA, Lingbin Z, Emmanual J, Marquis JC, Langer R (1994) Joint resur-facing using allograft chondrocytes and syn-thetic biodegradable polymer scaffolds. J Biomed Mater Res 28:891–899

101. Carranza-Bencano A, Armas-Padron JR, Gili-Miner M, Lozano MA (2000) Carbon fi ber implants in osteochondral defects of the rabbit patella. Biomaterials 21:2171–2176

102. Messner K (1993) Hydroxylapatite supported Dacron plugs for repair of isolated full-thick-ness osteochondral defects of the rabbit femo-ral condyle: mechanical and histological evaluations from 6-48 weeks. J Biomed Mater Res 27:1527–1532

103. Defrere J, Franckart A (1992) Te fl on/poly-urethane arthroplasty of the knee: the fi rst 2 years preliminary clinical experience in a new concept of arti fi cial resurfacing of full thick-ness cartilage lesions of the knee. Acta Chir Belg 92:217–227

104. Kose GT, Korkusuz F, Ozkul A, Soysal Y, Ozdemir T, Yildiz C, Hasirci V (2005) Tissue engineered cartilage on collagen and PHBV matrices. Biomaterials 26:5187–5197

105. Grad S, Kupcsik L, Gorna K, Gogolewski S, Alini M (2003) The use of biodegradable polyurethane scaffolds for cartilage tissue engineering: potential and limitations. Biomaterials 24:5163–5171

106. Estrada LE, Dodge GR, Richardson DW, Farole A, Jimenez SA (2001) Characterization of a biomaterial with cartilage-like properties expressing type X collagen generated in vitro using neonatal porcine articular and growth plate chondrocytes. Osteoarthritis Cartilage 9:169–177

107. Martens PJ, Bryant SJ, Anseth KS (2003) Tailoring the degradation of hydrogels formed from multivinyl poly(ethylene glycol) and poly(vinyl alcohol) macromers for cartilage tissue engineering. Biomacromolecules 4:283–292

108. Hsu SH, Chang SH, Yen HJ, Whu SW, Tsai CL, Chen DC (2006) Evaluation of biode-gradable polyesters modi fi ed by type II colla-gen and Arg-Gly-Asp as tissue engineering scaffolding materials for cartilage regenera-tion. Artif Organs 30:42–55

109. Holland TA, Tabata Y, Mikos AG (2005) Dual growth factor delivery from degradable oligo(poly(ethylene glycol) fumarate) hydro-gel scaffolds for cartilage tissue engineering. J Control Release 101:111–125

110. Au A, Ha J, Polotsky A, Krzyminski K, Gutowska A, Hungerford DS, Frondoza CG (2003) Thermally reversible polymer gel for chondrocyte culture. J Biomed Mater Res A 67:1310–1319

111. Kisiday J, Jin M, Kurz B, Hung H, Semino C, Zhang S, Grodzinsky AJ (2002) Self-assembling peptide hydrogel fosters chondro-cyte extracellular matrix production and cell division: implications for cartilage tissue repair. Proc Natl Acad Sci USA 99:9996–10001

112. Budde B, Blumbach K, Ylostalo J, Zaucke F, Ehlen HW, Wagener R, Ala-Kokko L, Paulsson M, Bruckner P, Grassel S (2005) Altered inte-gration of matrilin-3 into cartilage extracellu-lar matrix in the absence of collagen IX. Mol Cell Biol 25:10465–10478

[methods in molecular biology] somatic stem cells volume 879 || isolation, culture, and...

Documents