mf workshop 08 © ron shamir 1 motif finding workshop project chaim linhart january 2008
Post on 21-Dec-2015
218 views
TRANSCRIPT
![Page 1: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/1.jpg)
1 MF workshop 08 © Ron Shamir
Motif Finding WorkshopProject
Chaim LinhartJanuary 2008
![Page 2: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/2.jpg)
2 MF workshop 08 © Ron Shamir
Outline
1. Some background again…2. The project
![Page 3: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/3.jpg)
3 MF workshop 08 © Ron Shamir
1. Background
Slides with Ron Shamir and Adi Akavia
![Page 4: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/4.jpg)
4 MF workshop 08 © Ron Shamir
DNA Pre-mRNA
protein
transcription translation
Mature
mRNA
splicing
Gene: from DNA to protein
![Page 5: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/5.jpg)
5 MF workshop 08 © Ron Shamir
DNA• DNA: a “string” over the alphabet of 4 bases (nucleotides): { A, C, G, T }
• Resides in chromosomes
• Complementary strands: A-T ; C-G
Forward/sense strand: AACTTGCG
Reverse-complement/anti-sense strand: TTGAACGC
• Directional: from 5’ to 3’: (upstream) AACTTGCGATACTCCTA (downstream)
5’ end 3’ end
![Page 6: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/6.jpg)
6 MF workshop 08 © Ron Shamir
Gene structure (eukaryotes)
Transcription start site (TSS)
Promoter
Transcription (RNA polymerase)
DNA
Pre-mRNAExon ExonIntron
Splicing (spliceosome)
Mature mRNA
5’ UTR 3’ UTR
Start codon Stop codonCoding region
Translation (ribosome)
Protein
Coding strand
![Page 7: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/7.jpg)
7 MF workshop 08 © Ron Shamir
Translation• Codon - a triplet of bases, codes a specific
amino acid (except the stop codons); many-to-1 relation
• Stop codons - signal termination of the protein synthesis process
http://ntri.tamuk.edu/cell/ribosomes.html
![Page 8: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/8.jpg)
8 MF workshop 08 © Ron Shamir
Genome sequences• Many genomes have been sequences,
including those of viruses, microbes, plants and animals.
• Human: – 23 pairs of chromosomes– 3+ Gbps (bps = base pairs) , only ~3% are
genes– ~25,000 genes
• Yeast:– 16 chromosomes– 20 Mbps– 6,500 genes
![Page 9: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/9.jpg)
9 MF workshop 08 © Ron Shamir
Regulation of Expression
• Each cell contains an identical copy of the whole genome - but utilizes only a subset of the genes to perform diverse, unique tasks
• Most genes are highly regulated – their expression is limited to specific tissues, developmental stages, physiological condition
• Main regulatory mechanism – transcriptional regulation
![Page 10: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/10.jpg)
10 MF workshop 08 © Ron Shamir
•Transcription is regulated primarily by transcription factors (TFs) – proteins that bind to DNA subsequences, called binding sites (BSs)
•TFBSs are located mainly (not always!) in the gene’s promoter – the DNA sequence upstream the gene’s transcription start site (TSS)
•BSs of a particular TF share a common pattern, or motif
•Some TFs operate together – TF modules
TFTF
Gene5’ 3’
BSBSTSS
Transcriptional regulation
![Page 11: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/11.jpg)
11 MF workshop 08 © Ron Shamir
•Consensus (“degenerate”) string:
TFBS motif models
gene 7
gene 9
gene 5
gene 3gene 2
gene 4
gene 6
gene 8
gene 10
gene 1AACTGT
CACTGTCACTCT
CACTGT
AACTGT
AC ACT
CGT
•Statistical models…•Motif logo representation
![Page 12: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/12.jpg)
12 MF workshop 08 © Ron Shamir
Human G2+M cell-cycle genes:The CHR – NF-Y module
CDCA3 (trigger of mitotic entry 1)CTCAGCCAATAGGGTCAGGGCAGGGGGCGTGGCGGGAAGTTTGAAACT -18
CDCA8 (cell division cycle associated 8)TTGTGATTGGATGTTGTGGGA…[25bp]…TGACTGTGGAGTTTGAATTGG +23
CDC2 (cell division control protein 2 homolog)CTCTGATTGGCTGCTTTGAAAGTCTACGGGCTACCCGATTGGTGAATCCGGGGCCCTTTAGCGCGGTGAGTTTGAAACTGCT 0
CDC42EP4 (cdc42 effector protein 4)GCTTTCAGTTTGAACCGAGGA…[25bp]…CGACGGCCATTGGCTGCTGC -110
CCNB1 (G2/mitotic-specific cyclin B1)AGCCGCCAATGGGAAGGGAG…[30bp]…AGCAGTGCGGGGTTTAAATCT +45
CCNB2 (G2/mitotic-specific cyclin B2)TTCAGCCAATGAGAGT…[15bp]…GTGTTGGCCAATGAGAAC…[15bp]…GGGCCGCCCAATGGGGCGCAAGCGACGCGGTATTTGAATCCTGGA +10
BS’s are short, non-specific, hiding in both strands and at various locations along the promoters
TFs: NF-Y , CHR
![Page 13: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/13.jpg)
13 MF workshop 08 © Ron Shamir
The computational challenge
• Given a set of co-regulated genes (e.g., from gene expression chips)
• Find a motif that is over-represented (occurs unusually often) in their promoters
• This may be the TF binding site motif
• Find TF modules – over-represented motifs that tend to co-occur
![Page 14: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/14.jpg)
14 MF workshop 08 © Ron Shamir
The computational challenge (II)
• Motifs can also be found w/o a given target-set – “genome-wide”
• Find a motif that is localized - occurs more often neat the TSS of genes
• Find a motif with a strand bias – occurs more often on the genes’ coding strand
• Find TF modules with biases in their order / orientation / distance
![Page 15: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/15.jpg)
15 MF workshop 08 © Ron Shamir
Motif finding algorithms• >100 motif finding algs• Main differences between them:
– Type of analysis & input: • Target-set vs. genome-wide• Single vs. multi-species (conservation)• Single motifs vs. modules
– Motif model– Score for evaluating motif– Motif search technique:
• Combinatorial (enumeration) vs. Statistical optimization
![Page 16: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/16.jpg)
16 MF workshop 08 © Ron Shamir
Over-represented motifs in the promoters of genes expressed in the G2 and G2/M phases of the human cell cycle:
Example - Amadeus
CHR
NF-Y
![Page 17: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/17.jpg)
17 MF workshop 08 © Ron Shamir
2. The project
![Page 18: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/18.jpg)
18 MF workshop 08 © Ron Shamir
General goals• Develop software from A-Z:
– Design– Implementation– (Optimization) – Execution & analysis of real data
• A taste of bioinformatics• Have fun• Get credit…
![Page 19: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/19.jpg)
19 MF workshop 08 © Ron Shamir
The computational task
• Given a set of DNA sequences• Find “interesting” pairs of motifs:
– Order bias– Other scores…
• Main challenges:– Performance (time, memory)– Output redundancy
![Page 20: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/20.jpg)
20 MF workshop 08 © Ron Shamir
InputFile with DNA sequences in “fasta”
format:>sequence-name1 <space> [header1]ACCCGNNNNTCGGAAATGANN
CGGAGTAAAATATGCGAGCGT
>sequence-name2 <space> [header2]cggattnnnaccgcannnnnnnnaccgtga
>sequence-name3 <space> [header3]agtttagactgctagctcgatcgcta
gcggatnggctannnnnatctag
![Page 21: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/21.jpg)
21 MF workshop 08 © Ron Shamir
Input (II)• Ignore the header lines• Sequence may span multiple lines
or one long line• Sequence contains the characters
A,C,G,T,N in upper or lower case• “N” means unknown or masked
base• Sample input files will be supplied
![Page 22: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/22.jpg)
22 MF workshop 08 © Ron Shamir
(don’t count overlaps, e.g. AAAAAA)
Input (III)
• Search parameters:– Length of motifs (between 5-10)– Min. + Max. distance between the motifs:
ACGGATTGATNNNTGGATGCCAT
distance=9
– Single vs. two strands search– Min. number of occurrences (hits) of pair:
GCGGATTCAGTGATGCCANGNATGCCTCAGGATTGNAATGCCA hit hit hit
– Max. p-value– Additional parameters…
![Page 23: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/23.jpg)
23 MF workshop 08 © Ron Shamir
OutputA. A list of the string pairs with the
best order-bias score (smallest p-values):
Motif A Motif B A→B B→A p-value
ACGTT GGATT 97 17 4.3E-15
ACGTT GATTC 87 16 2.7E-13
TTAAC CAGCC 31 114 1.2E-12
B. A non-redundant list of motif pairs (motif = consensus string):logos, # of hits, additional scores
![Page 24: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/24.jpg)
24 MF workshop 08 © Ron Shamir
Part A: String pairs with order bias
• nA = # of A→B ; nB = # of B→A• WLOG, nA > nB
• n = nA + nB
• H0 = random order: nA ~ B(n, 0.5)• p-value = prob for at least nA
occurrences of A→B = tail of B(n, 0.5) • Normal approximation (central limit
thm.)• Fix for multiple testing: x2
( , , ) (1 )n
j n j
j k
nBinomial tail n p k p p
j
![Page 25: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/25.jpg)
25 MF workshop 08 © Ron Shamir
• Collect similar strings to motif with better score: (motif = consensus)String pair (p-value) Motif pair
ACGTT , GGATT (4.3E-15)ACGAT , GGATT (2.4E-11)AGGAT , GGTTT (1.7E-5)AGGTT , GGTTT (5.9E-5)
• Don’t report similar motif pairs:– Motifs that consist of similar strings – Motif pairs that are small shifts of one another– Palindromes
Part B: Non-redundant list
of motif pairs
, (8.1E-31)
![Page 26: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/26.jpg)
26 MF workshop 08 © Ron Shamir
Option I: Co-occurrence rateN = total # of sequences
sA = # of sequences that contain motif A
sAB = # of sequences that contain motifs A and B
H0 = motifs occur independently and randomly
p-value = prob for at least joint occurrences, given the number of hits of each single motif= tail of hypergeometric distribution
Part B (cont.): Additional score
min( , )
( , , , )A B
AB
BB
AA B AB
A
s s
i s
N ss
s iiHG tail N s s s
N
s
![Page 27: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/27.jpg)
27 MF workshop 08 © Ron Shamir
Option II: Distance biasIs the distance between the two motifs uniform (H0), or are there specific distances that are very common?
Option III: Gap variabilityAre the sequences between the motifs conserved (H0),
or are they highly variable?
Other options??
Part B (cont.): Additional score
![Page 28: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/28.jpg)
28 MF workshop 08 © Ron Shamir
Implementation• Java (Eclipse) ; Linux• GUI: Simple graphical user interface for
supplying the input parameters and reporting the results
• Packages for motif logo and statistical scores will be supplied
• Time performance will be measured only for part A
• Reasonable documentation• Separate packages for data-structures,
scores, GUI, I/O, etc.
![Page 29: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/29.jpg)
29 MF workshop 08 © Ron Shamir
Design document• Due in 3 weeks (Feb 24)• 3-5 pages (Word), Hebrew/English• Briefly describe main goal, input
and output of program• Describe main data structures,
algorithms, and scores for parts A+B
• Meet with me before submission
![Page 30: MF workshop 08 © Ron Shamir 1 Motif Finding Workshop Project Chaim Linhart January 2008](https://reader036.vdocument.in/reader036/viewer/2022062407/56649d595503460f94a3952b/html5/thumbnails/30.jpg)
30 MF workshop 08 © Ron Shamir
Fin