· minster maneka gandhi’s proposal • the national council on nutrition (ncn) has unanimously...

www.gradeup.com

1

http://www.gradeup.com/

https://xu75j.app.goo.gl/ETeT?openInBrowser=1

www.gradeup.com

2

Daily Current Affairs for UPSC IAS Preparation

01. 05. 2018

1. Fitch retains India rating at ‘BBB-

’ with stable outlook

• Global credit rating agency Fitch

affirmed India’s sovereign rating at

‘BBB-’ with ‘stable’ outlook, saying

that the country’s medium-term

growth potential is strong.

• ‘BBB-’ rating indicates lowest

investment grade.

• India’s rating balances a strong

medium-term growth outlook and

favourable external balances with

weak fiscal finances and some lagging

structural factors, including

governance standards and a still-

difficult, but improving, business

environment.

• Fitch had last upgraded the rating

from ‘BB+’ to ‘BBB-’ with stable

outlook on August 1, 2006.

• Later, it changed the outlook to

negative in 2012 and then again to

stable in the following year, though it

kept the rating unchanged at the

lowest investment grade.

Related Information

• In November 2017, US-based credit

rating agency Moody's had upgraded

India's sovereign credit rating by a

notch to 'Baa2' form Baa3 with a

stable outlook citing improved growth

prospects driven by economic and

institutional reforms.

• The 'Baa3' rating was the lowest

investment grade just a notch above

'junk' status.

Topic- GS-3-Indian Economy

Source- The Hindu Business Line

2. Nutrition council rejected WCD

Minster Maneka Gandhi’s

proposal

• The National Council on Nutrition

(NCN) has unanimously rejected

Union Minister for Women and Child

Development (WCD) Maneka Gandhi’s

proposal to replace ready-to-eat food

as take-home dry ration with energy-

dense nutrient packets which could be

mixed with food for anganwadi

beneficiaries.

• The National Council on India’s

Nutrition Challenges, headed by Vice-

Chairman of the NITI Aayog Rajiv

Kumar, was constituted in January to

provide policy directions to address

nutritional challenges in the country

and review programmes on a

quarterly basis.

• The Chairman [Nutrition Council]

drew attention to the PMO’s decision

in this regard and the need for

continuance of the existing practice

of-

(a) Hot cooked meals for children (3-

6 years) age group

(b) Take-home ration (THR) for

children (6 months-3 years) and

(c) Pregnant women and lactating

mothers as decided by the State

governments in conformity with the

National Foods Security Act, 2013,

and the Supplementary Nutrition

Rules, 2017.

Different views of WCD Minster Maneka

Gandhi and NITI Aayog

• WCD Minister Makeka Gandi is in the

favour of packaged nutrients and

• NITI Aayog want to substitute food

with cash given to beneficiaries

through direct benefit transfer.

Related Information

• As part of the Integrated Child

Development Scheme, anganwadi

beneficiaries between the age of six

months and three years as well as

pregnant women and lactating

mothers are entitled to take-home

rations, which includes wheat, soya

and sugar.



www.gradeup.com

3

Topic- GS-2- Government policies and

interventions for development in various

sectors and issues arising out of their design

and implementation.

Source- The Hindu

3. India joint 6th in list of doping

violations in WADA report

• India maintained their dubious record

of being among top 10 nations with

regards to doping violations being

joint sixth as World Anti-Doping

Agency (WADA) published its report

as per samples collected in 2016.

• However, India can take solace from

the fact that they have significantly

improved their position to sixth after

being third for three years in a row.

• For three years in a row from 2013-

15, India were ranked third in doping

violations.

• Italy topped the rankings of drug

cases in 2016, accounting for 147

ADRVs, followed by France (86),

United States (76), Australia (75),

Belgium (73).

Related information

WADA (World Anti-Doping Agency)

• WADA is a foundation initiated by the

International Olympic Committee

based in Canada to promote,

coordinate and monitor the fight

against drugs in sports.

• The agency's key activities include

scientific research, education,

development of anti-doping

capacities, and monitoring of the

World Anti-Doping Code, whose

provisions are enforced by the

UNESCO International Convention

against Doping in Sport.

• It is headquartered in Montreal,

Quebec, Canada.

National Anti-Doping Agency (NADA)

• NADA is the national organisation

responsible for promoting,

coordinating, and monitoring the

doping control program in sports in all

its forms in India.

• NADA deals with adopting and

implementing anti-doping rules and

policies which conform with the World

Anti-Doping agency, cooperates with

other anti-doping organisations and

promotes anti-doping research and

education.

• NADA is formed by the Union

Government under the societies

Registration Act.

• NADA includes scientists and

representatives from the Indian

Olympic Association (IOA).

• In September 2017, Drug pricing

regulator NPPA joined hands with

NADA to help athletes understand

medicines that could contain

prohibited substances in sports

through its app 'Pharma Jan

Samadhan'.

Topic- GS-2- Statutory, regulatory and

various quasi-judicial bodies

Source- Times of India

4. Procurement of NAG missile for

army and long-range guns for

Navy cleared

• The Defence Ministry approved

military procurement worth Rs 3,687

crore which included acquiring anti-

tank guided missile NAG for the Army

and long-range guns for the Navy.

• The capital acquisition proposals were

cleared at a meeting of the Defence

Acquisition Council (DAC) chaired by

Defence Minister Nirmala Sitharaman.

• The DAC approved procurement of

thirteen 127 mm calibre guns for the

Navy from BAE Systems of the United

States at a cost of over Rs 3,000

crore.

• The NAG missile has top attack

capabilities that can effectively

engage and destroy enemy tanks

during day and night.

Related Information

Nag Missile System

• It is a third generation "fire-and-

forget" anti-tank missile developed in

India.



www.gradeup.com

4

• It is one of five missile systems

developed by the Defence Research

and Development Organisation

(DRDO) under the Integrated Guided

Missile Development Program

(IGMDP).

NAMICA Version of the missile

• It is a 'lock-on before launch' system,

where the target is identified and

designated before the missile is

launched.

• As the targeting system is based on

visual identification, the range is

limited.

HELINA Version

• The HELINA version on the other hand

will use a 'lock-on after launch'

system extending its range to 7 km.

• In this scenario, the missile is

launched in the general direction of

the target.

• As it approaches the target, images of

the area ahead are sent back to the

operator who will be able to identify

enemy tanks.

Topic- GS-3-Defence

Source- The Hindu

5. Swachh Bharat Mission launched

GOBAR-DHAN scheme to promote

wealth and energy from waste

• Union Minister for Drinking Water and

Sanitation, Sushri Uma Bharti

launched the GOBAR (Galvanizing

Organic Bio-Agro Resources - DHAN

scheme at the National Dairy

Research Institute (NDRI)

Auditorium, Karnal in Haryana.

• The scheme aims to positively impact

village cleanliness and generate

wealth and energy from cattle and

organic waste.

• The scheme also aims at creating new

rural livelihood opportunities and

enhancing income for farmers and

other rural people.

• The scheme envisages the

implementation of 700 bio-gas units

in different states of the country in

2018-19.

• The Swachh Bharat Mission (Gramin)

comprises two main components for

creating clean villages – creating open

defecation free (ODF) villages and

managing solid and liquid waste in

villages.

Topic- GS-2-Welfare Schemes

GS-2- Governance

Source- PIB

02. 05. 2018

1. Government to introduce DNA

profiling Bill in Monsoon Session

• The government informed the

Supreme Court that it would introduce

a DNA profiling Bill in the Monsoon

Session of Parliament.

• The government was responding to a

PIL petition filed by NGO Lok Niti

Foundation in 2012 on the use of DNA

profiling for identifying unclaimed

bodies, especially to match them with

old cases of missing persons.

Law Commission report

• In 2017, the Law Commission of

India, in its 271st report, prepared the

draft Bill named The DNA Based

Technology (Use and Regulation) Bill,

2017 after examining various judicial

pronouncements and constitutional

provisions.

• The exercise was initiated by the

Commission after the Department of

Biotechnology forwarded its draft of

‘The Use and Regulation of DNA based

Technology in Civil and Criminal

Proceedings, Identification of Missing

Persons and Human Remains Bill,

2016’.

Related Information

DNA Profiling (DNA fingerprinting, DNA

testing, or DNA typing)

• DNA profiling is the process where a

specific DNA pattern, called a profile,

is obtained from a person or sample

of bodily tissue.

• Even though we are all unique, most

of our DNA is actually identical to

other people’s DNA.



www.gradeup.com

5

• However, specific regions vary highly

between people. These regions are

called polymorphic.

• Differences in these variable regions

between people are known as

polymorphisms.

• Each of us inherits a unique

combination of polymorphisms from

our parents.

• DNA polymorphisms can be analysed

to give a DNA profile.

Short tandem repeats method for DNA

Profiling

• One of the current techniques for DNA

profiling uses polymorphisms called

short tandem repeats.

• Short tandem repeats (or STRs) are

regions of non-coding DNA that

contain repeats of the same

nucleotide sequence.

• For example,

GATAGATAGATAGATAGATAGATA is

an STR where the nucleotide

sequence GATA is repeated six times.

• STRs are found at different places or

genetic loci in a person’s DNA.

• To produce a DNA profile, scientists

examine STRs at ten, or more, genetic

loci. These genetic loci are usually on

different chromosomes.

Application of DNA Profiling

• Identify the probable origin of a body

fluid sample associated with a crime

or crime scene

• Reveal family relationships

• Identify disaster victims

Topic- GS-3-Biotechnology

Source- The Hindu + Science Learn

2. 14 out of world’s 20 most

polluted cities in India: WHO

• Delhi and Varanasi are among the 14

Indian cities that figured in a list of 20

most polluted cities in the world in

terms of PM2.5 levels in 2016, data

released by the WHO showed.

• In terms of PM10 levels, 13 cities in

India figured among the 20 most-

polluted cities of the world in 2016.

• India accounts for 34% or 2.4 million

of the seven million premature deaths

caused by household and ambient air

pollution together globally every year.

• The PM2.5 includes pollutants like

sulfate, nitrate and black carbon,

which pose the greatest risk to human

health.

With respect to world

• WHO’s global urban air pollution

database measured the levels of fine

particulate matter (PM10 and PM2.5)

from more than 4,300 cities in 108

countries.

• The WHO data said that nine out of 10

people in the world breathe air

containing high levels of pollutants.

• WHO estimates that around 7 million

people die every year from exposure

to fine particles in polluted air that

penetrate deep into the lungs and

cardiovascular system, causing

diseases including stroke, heart

disease, lung cancer, chronic

obstructive pulmonary diseases and

respiratory infections, including

pneumonia.

• According to the report, more than

90% of air pollution-related deaths

occur in low- and middle-income

countries (including India), mainly in

Asia and Africa, followed by low- and

middle-income countries of the

Eastern Mediterranean region, Europe

and the Americas.

Major Source of Air Pollutant

• Inefficient use of energy by

households, industry, agriculture and

transport sectors, and coal-fired

power plants.

• In some regions, sand and desert

dust, waste burning and deforestation

are additional sources of air pollution.

Related Information

Classification of pollutants

• WHO classifies particulate matter into

two broad types, PM10 and PM2.5,

with the numbers indicating the

diameter of the particles in microns.



www.gradeup.com

6

• Chronic exposure to both PM10 and

PM2.5 can lead to the “risk of

developing cardiovascular and

respiratory diseases, as well as of lung

cancer.

Topic- GS-3-Environment

Source- The Hindu

3. ‘76% of Lake Victoria’s endemic

biodiversity is at risk of

extinction’ - IUCN

• IUCN has come out with a new report

in which it warns that 76 percent of

the biodiversity endemic to Africa’s

Lake Victoria is at the risk of becoming

extinct.

• It found that a full 20% of these

species were threatened with

extinction.

• Lake Victoria is the world’s second

largest freshwater lake by surface

area.

• Its catchment area includes parts of

Kenya, Tanzania, Uganda, Burundi

and Rwanda.

• Also referred to as “Darwin’s

Dreampond”, the lake is known for its

high levels of unique biodiversity.

• The report cited the example of the

African Lungfish (Protopterus

aethiopicus).

• The fish, the report said, was

declining in the lake basin largely due

to overfishing, poor fishing practices.

Major Problems

• The purple flowered Water Hyacinth

(Eichhornia crassipes) was

accidentally introduced to Lake

Victoria from South America in the

1980s, and at its peak covered close

to 10 percent of the lake surface.

• It reduces the oxygen and nutrient

availability in the water column, which

negatively affects native biodiversity.

Topic- GS-3- Environment

Source- Down to Earth

4. NASA twin Satellites “GRACE-FO”

mission Will Track Changes in

Earth's Water and Ice

• NASA is gearing up for the upcoming

launch of its Gravity Recovery and

Climate Experiment Follow-On

(GRACE-FO) mission, which will map

changes in water and ice around the

world by detecting variations in

Earth's gravity.

• The mission involves two identical

spacecrafts that will orbit the Earth in

tandem.

• The satellites are currently scheduled

to lift off from Vandenberg Air Force

Base in California atop a SpaceX

Falcon 9 rocket on May 19.

• As the name implies, GRACE-FO is a

follow-on mission to the original

GRACE mission, which mapped

Earth's gravity field from 2002 to

2017.

• Both missions are joint projects

between NASA and the GFZ German

Research Center for Geosciences in

Potsdam, Germany.

• After the first GRACE mission

operated well beyond its planned five-

year life span, the spacecraft's

batteries eventually succumbed to

their age, and the mission came to an

end.

How it works?

• As that ice melts- whether the water

becomes a part of the ocean or seeps

into the soil — it changes how mass is

distributed on our planet.

• And when Earth's mass distribution

changes, so does its gravity field.

• By measuring those changes, the

GRACE missions can track Earth's

water cycle and how climate change

affects oceans, glaciers, sea ice,

groundwater and even moisture in the

atmosphere.

Topic- GS-3-Science and Technology

Source- Space.com

5. Exercise “Vijay Prahar” of South

Western Command



www.gradeup.com

7

• About 20,000 troops of strike

formation of the Army's South

Western Command (SWC) are

carrying out 'Vijay Prahar' exercise

with cutting-edge equipment and

state-of-the-art force multipliers in

the Mahajan Field Firing Ranges close

to Suratgarh in Rajasthan.

• The exercise is aimed to orchestrate

wide spectrum of threats which are

planned to be tackled through high

tempo joint air and land operation

involving hundreds of aircrafts,

thousands of tanks and artillery pieces

supported by real time intelligence,

surveillance, reconnaissance and just

in time logistic support.

Topic- GS-3- Defence

Source- PIB

03.05.2018

1. Global military spending rises to

USD 1.739 trillion, India among

top 5 spenders

• According to the recent report of

SIPRI, India and China were among

the five biggest military spenders

which together accounted for 60

percent of the total global defence

expenditure of USD 1.739 trillion in

2017.

• India spent USD 63.9 billion on its

military in 2017, an increase of 5.5

per cent compared with 2016 and of

45 per cent since 2008.

• The five top military spenders in 2017

were the US, China, Saudi Arabia,

Russia and India.

• It said the total global military

spending rose to USD 1.739 trillion

which is an increase of 1.1 percent

compared to the expenditure in 2016.

• The total global military expenditure

accounted for 2.2 per cent of global

gross domestic product in 2017.

Related Information

Stockholm International Peace

Research Institute (SIPRI)

• SIPRI is an international institute,

dedicated to research into conflict,

armaments, arms control and

disarmament.

• It was established in 1966.

• It is based in Stockholm, Sweden.

• SIPRI provides data, analysis and

recommendations, based on open

sources, to policymakers,

researchers, media and the interested

public.

Topic- GS-2- Important International

institutions, agencies and fora- their

structure, mandate.

Source- Indian Express

2. Supreme Court asked high courts

to fast-track trial under POCSO

Act

• The SC directed all high courts to

ensure that the cases of sexual

assault of children to be fast-tracked

and decided by special courts.

• The apex court also asked the high

courts to instruct the trial courts not

to grant unnecessary adjournments

during trial of cases under the

Protection of Children from Sexual

Offences (POCSO) Act.

Related Information

Also in News

• The Union cabinet on April 21 cleared

the ordinance on POCSO act whereby

death penalty will be given to those

convicted of raping a child up to 12

years of age.

• Centre has cleared the criminal law

amendment ordinance and POCSO Act

is a part of this amendment.

• The Centre has increased minimum

punishment in case of rape of women

from 7 years to 10 years, extendable

to life imprisonment.

• It said that in case of gang rape of a

girl below 12 years, punishment will

be life imprisonment or death

sentence.

POCSO (The Protection of Children from

Sexual Offences) Act 2012



www.gradeup.com

8

• POCSO Act 2012 was established to

protect the children against offences

like sexual abuse, sexual harassment

and pornography.

• It was formed to provide a child-

friendly system for trial underneath

which the perpetrators could be

punished.

• The Act defines a child as any person

below eighteen years of age.

• It also makes provisions for avoiding

the re-victimisation of the child at the

hands of the judicial system.

• The Act defines different forms of

sexual abuse which includes

penetrative and non-penetrative

assault.

• It makes it the legal duty of a person

aware of the offence to report the

sexual abuse. In case he fails to do so,

the person can be punished with six

months’ imprisonment or fine.

• The Act further states that the

evidence of the child should be

recorded within a period of thirty

days.

• The Special Court taking cognizance

of the matter should be able to

complete the trial within the period of

one year from the date of taking

cognizance of the abuse.

Topic- GS-2-Indian Polity


3. Multi-sectoral Development

Programme for minorities is

renamed as Pradhan Mantri Jan

Vikas Karyakram

• The Cabinet Committee on Economic

Affairs renamed the Multi-sectoral

Development Programme (MsDP) as

Pradhan Mantri Jan Vikas Karyakram.

• The programme is aims at building

infrastructure in minority

concentration areas currently covers

196 districts.

• The restructured programme aims to

provide better socioeconomic

infrastructure facilities to the minority

communities, particularly in the field

of education, health and skill

development.

• The criteria for identification of

minority concentration towns and

clusters of villages has been

rationalised by lowering the

population percentage criteria from

50 percent to 25 per cent.

• This would result in a 57 percent rise

in area covered under the

programme.

Topic- GS-2-Welfare Schemes


4. Cabinet approves continuation of

Umbrella Scheme ‘Green

Revolution- Krishonnati Yojana’

in Agriculture Sector

• The Cabinet Committee on Economic

Affairs has given its approval for the

Umbrella Scheme, "Green Revolution

– Krishonnati Yojana" in agriculture

sector beyond 12th Five Year Plan for

the period from 2017-18 to 2019-20.

• The Umbrella scheme comprises of 11

Schemes/Missions. These are-

Mission for Integrated

Development of Horticulture

(MIDH)

2. National Food Security Mission

(NFSM), including National

Mission on Oil Seeds and Oil Palm

(NMOOP)

3. National Mission for

Sustainable Agriculture (NMSA)

4. Submission on Agriculture

Extension (SMAE)- to strengthen

the ongoing extension mechanism of

State Governments, local bodies etc

5. Sub-Mission on Seeds and

Planting Material (SMSP)

6. Sub-Mission on Agricultural

Mechanisation (SMAM)- to

increase the reach of farm

mechanization to small and marginal

farmers



www.gradeup.com

9

7. Sub Mission on Plant Protection

and Plan Quarantine (SMPPQ)- to

minimize loss to quality and yield of

agricultural crops from the ravages of

insect pests etc.

8. Integrated Scheme on

Agriculture Census, Economics

and Statistics (ISACES)- to

undertake the agriculture census


Agricultural Cooperation

(ISAC)- to provide financial

assistance for improving the economic

conditions of cooperatives, remove

regional imbalances etc.


Agricultural Marketing (ISAM)- to

develop agricultural marketing

infrastructure

11. National e-Governance Plan

(NeGP-A) - to bring farmer centricity

& service orientation to the

programmes

Topic- GS-3-Agriculture

Source- PIB

5. Cabinet approved accession to the

Protocol under WHO

• The Union Cabinet has given approval

to accede to the Protocol under World

Health Organization (WHO)

Framework Convention on tobacco

control to eliminate illicit trade in

tobacco products.

• It will be applicable to both smoking

and chewing or smokeless tobacco

(SLT) forms as negotiated and

adopted under Article 15 of the World

Health Organization Framework

Convention on Tobacco Control (WHO

FCTC).

• India is a party to WHO FCTC.

Related Information

World Health Organization Framework

Convention on Tobacco Control (WHO

FCTC)

• The WHO Framework Convention on

Tobacco Control (WHO FCTC) is the

first international public health treaty

negotiated under the auspices of the

WHO.

• It is adopted by the 56th World Health

Assembly held in Geneva, Switzerland

on 21 May 2003.

• It became the first World Health

Organization treaty adopted under

article 19 of the WHO constitution.

• The treaty came into force on 27

February 2005.

• It had been signed by 168 countries

and is legally binding in 181 ratifying

countries.

• There are currently 15 United Nations

member states that are non-parties to

the treaty.

• One of the key tobacco supply

reduction strategies contained in

Article 15 of WHO FCTC envisages

elimination of all forms of illicit trade

and tobacco products, including

smuggling, illicit manufacturing and

counterfeiting.

• The protocol is divided into 10 parts

and contains 47 Articles.

Impact

• Elimination of illicit trade in tobacco

products through strengthened

regulation will help in-(a)

Strengthening comprehensive

tobacco control

• (b) Leading to reduction in tobacco

use

which in turn, will result in reduction in

disease burden and mortality associated with

tobacco use.



structure, mandate.

Source- PIB

04.05. 2018

1. How storms and lightning in North

India killed over a hundred people

• Over 100 people were killed in

duststorms, thunderstorms, and

lightning at many places in northern,

central and eastern India.



www.gradeup.com

10

How the storms built up?

• Rainstorms and duststorms arise from

similar meteorological conditions.

• Such events take place due to a local

“instability” arising out of a deviation

from the normal temperature

difference between the upper and

lower atmosphere.

• Thunderstorms or hail occur when the

atmosphere has moisture; when it

doesn’t, duststorms take place.

Example

• Moist easterly winds from the Bay of

Bengal reached up to Himachal

Pradesh, which was also receiving dry

winds from the north-westerly

direction.

• The two systems destabilised the

equilibrium temperature difference

between the upper and lower layers of

atmosphere, leading to conducive

conditions for a thunderstorm.

Reasons for more number of deaths

• In most cases, storms do not kill by

themselves. Even lightning rarely

strikes people directly. But they

trigger incidents that result in deaths.

• Walls or homes collapse, and people

are electrocuted after power lines

snap, or after they are caught in fields

filled with water.

• People in the poorest, most densely

populated areas are the most

vulnerable.

Can such events be predicted?

• Meteorological predictions are for

broad geographical areas and

timeframes.

• It is not yet possible to predict a

thunderstorm or lightning at a precise

location.

• The exact times these events will hit

also cannot be predicted.

Topic- GS-1- Important Geophysical

phenomena such as earthquakes, Tsunami,

Volcanic activity, cyclone etc.


2. Amazon River Dolphins face

extinction risk

• A recent study conducted by Brazilian

researchers has warned that

freshwater dolphins found in the

Amazon River Basin are “dying off

fast” and may face extinction unless

they are more vigorously protected

against fishing.

• The primary reason for the decrease

in numbers is the dolphins’ use of

flesh and blubber as bait for catfish,

which have become widely available

commercially.

• Killing the dolphins endangers their

survival, particularly since the

females bear a single calf on average

every four to five years.

• The International Union for

Conservation of Nature (IUCN)

currently lists these freshwater

dolphins’ status as "data deficient,"

meaning not enough is known about

their numbers in the wild to assess the

degree of threat to the population.

• But the study says that if the IUCN

Red List considered the latest

findings, species would be classified

as “Critically Endangered”.

Related Information

• Freshwater dolphins in other parts of

the world are also facing extreme

pressures.

• In the Indian Subcontinent,

the Gangetic or Indus River

Dolphin found in the Ganga and

Indus River Basins is

considered “Endangered” by the

IUCN.

• In China, the Yangtze River dolphin or

“baiji”, was declared functionally

extinct in 2006 due to human

activities like overfishing, dam

building, pollution and boat traffic.

Topic- GS-2-Biodiversity




www.gradeup.com

11

3. Pay 2% of capital investment for

green clearance: Environment

Ministry to Corporates

• The environment ministry has firmed

up guidelines that will require every

corporate, seeking green clearance,

to set aside up to 2% of its capital

investment for Corporate

Environment Responsibility (CER).

• The guidelines make it mandatory for

companies to set aside funds for CER

over and above what is required for

executing the environment

management plan in a project

affected area.

• While brownfield (expansion) projects

would be required to earmark 0.125%

to 1% of additional capital investment

for CER purposes, the slab for

greenfield projects ranges from

0.25% to 2% of the capital

investment.

• The exact quantum will be decided for

every project by the Expert Appraisal

Committee when it comes up for

green clearance.

• The ministry repeatedly insisting on

creating a separate category for CER

funds and projects, rather than

assuming it to be part of the

implementation of the environment

impact assessment plan.

Related Information

Corporate Environment Responsibility

(CER)

• Corporate Environmental

Responsibility (CER) refers to a

company's duties to abstain from

damaging natural environments. The

term derives from corporate social

responsibility (CSR).

• Corporate Environment Responsibility

(CER) activities will include measures

like pollution control, wildlife and

forest conservation, compensatory

afforestation and rehabilitation and

resettlement of displaced persons.

• Funds can be used for creating

drinking water supply infrastructure,

sanitation, health, education and skill

development, among others.

Issues with CSR

• At present, Section 135 of the

Companies Act lays down Corporate

Social Responsibility (CSR) for every

company with a net worth of Rs 500

crore or more, or turnover of Rs 1,000

crore or more, or net profit of Rs 5

crore in a financial year.

• But CSR does not necessarily cover all

projects.

Environment Impact Assessment (EIA)

• EIA is a tool to anticipate the likely

environmental impacts that may arise

out of the proposed developmental

activities and suggest mitigation

measures and strategies.

• EIA comes under Notification on

Environmental Impact Assessment

(EIA) of developmental projects 1994

under the provisions of Environment

(Protection) Act, 1986.

Topic- GS-3-Environment

Source- Economic Times

4. ‘Glow-in-the-dark algae may be

sign of global warming’

• The phenomenon of Mumbai’s

beaches glowing in the dark maybe a

consequence of global warming and

not industrial pollution, according to a

year-long investigation by Indian and

American scientists.

• The Noctiluca algae, commonly

known as sea tinkle, is a parasite

and occurs in patches or ‘blooms’ in

the Northern Arabian Sea.

• They glow at night due to

bioluminescence and have earned

them the nickname ‘sea sparkle’.

• However, these patches are a sign of

decline because they compete with

fish for food and choke their supply.

• Noctiluca devours one of the most

important planktonic organisms at the

base of the fish-food chain, namely

diatoms, and also excretes large

amounts of ammonia, which is linked

with massive fish mortalities.



www.gradeup.com

12

How Noctiluca algae affects the other

organism

• A warming ocean means greater

temperature differences among layers

of the sea water and this slows the

upward transport of nutrients like

silicate from the ocean bottom,

lowering its concentration at the

surface.

• Diatoms growing in surface water

need both sunlight and silicate to build

their glass skeletons and thus, will fail

to thrive when silicate becomes less

available.

• On the other hand, Noctiluca remains

unaffected by these changes and

additionally will prey on the remaining

diatoms.

• The waters in the study area were

observed to have sufficient oxygen

clearly opposing any linkage between

low oxygen and Noctiluca growth.

Related Information

Bioluminescence

• It is the production and emission of

light by a living organism as the result

of a chemical reaction during which

chemical energy is converted to light

energy.

• Bioluminescence occurs widely in

marine vertebrates and invertebrates,

as well as in some fungi,

microorganisms including some

bioluminescent bacteria and

terrestrial invertebrates such as

fireflies.


Source- The Hindu

5. Indian and French Navy have

begun final phase of Bilateral

Exercise 'Varuna' near Reunion

Island

• The Varuna is an annual naval

exercise between the two navies.

• The Indian Navy and the French Navy

have conducted bilateral maritime

exercises since May 1993.

• Since 2001, the exercises have been

named VARUNA.

• The Indian and French navies are

conducting the last phase of the 2018

“Varuna” naval exercise, from 1st to

7th of May, in the vicinity of Reunion

Island.

Related Information

Reunion Island

• Réunion is an island and region

of France in the Indian Ocean, east

of Madagascar and 175 kilometres

(109 mi) southwest of Mauritius.

Topic- GS-3- Defence

GS-1- World Geography

Source- Business Standard

05. 05. 2018

1. NASA’s portable nuclear reactor

“KRUSTY” could power missions

to Mars

• NASA has said that it successfully

demonstrated a new nuclear reactor

power system that could enable

crewed missions to the Moon, Mars

and destinations beyond.

• NASA announced the results of the

demonstration, called the Kilopower

Reactor Using Stirling Technology

(KRUSTY) experiment at its Glenn

Research Center in Cleveland.

• The Kilopower experiment was

conducted at the US Department of

Energy’s National Nuclear Security

Administration’s Nevada National

Security Site from November 2017

through March.

How it will help?

• This pioneering space fission power

system could provide up to 10

kilowatts of electrical power – enough

to run two average households –

continuously for at least 10 years.

• When astronauts someday venture to

the Moon, Mars and other

destinations, one of the first and most

important resources they will need is

power.



www.gradeup.com

13

• The pioneering power system is ideal

for the Moon, where power generation

from sunlight is difficult because lunar

nights are equivalent to 14 days on

Earth.

• Passive sodium heat pipes transfer

reactor heat to high-efficiency Stirling

engines, which convert the heat to

electricity.

Topic- GS-3-Science and Technology


2. New species of shieldtail snake

“Bhupathy’s shieldtail”

discovered in Western Ghats

• Scientists have discovered an entirely

new species of shieldtail snake from

the Western Ghats in Tamil Nadu.

• Scientists have named the newly

discovered species as Bhupathy’s

shieldtail snake in honor of Dr

Subramanian Bhupathy who was a

noted Indian herpetologist.

Related Information

• At present, there are 45 known

species of shieldtail snakes in the

world, of which 30 are endemic to

India and 15 to Sri Lanka.

• The name ‘shieldtail’ comes from their

heavily keeled tails that terminate in

disk-like shields or multiple spines in

most species.

• They are small sized snakes, typically

25 to 50 cm in length and live in loose

soil among plant roots or under

decaying vegetation.

• They are inoffensive, non-venomous,

and easy-to-handle owing to their

inability to bite because they have

short head and mouth.

• The snake species is known to occur

in a single small locality and there is

limited information about its natural

history, so it is categorised as ‘data

deficient’ in the IUCN Red list of

threatened species as of now.

• The news species faces threats from

road traffic, habitat loss, and a

possible fungal infection that leads to

deformed heads.

Topic- GS-3- Biodiversity


3. Kabul river’s famous “Sher Mahi”

fish in danger

• The Sher Mahi, an indigenous fish of

Khyber Pakhtunkhwa, is facing

serious threats to survival.

• It is found in river basins adjacent to

Afghanistan.

• Experts have observed a decrease in

the population of Sher Mahi in its main

habitat, the Kabul river.

What are the causes behind the

depletion of “Sher Mahi”

• Climatic changes: The rise in

temperature of the Kabul river due to

global warming has reduced oxygen

dissolution in water which has

affected the Sher Mahi.

• Water pollution

• Overfishing



4. National Resource Centres for

online refresher programmes for

Higher Education faculty through

SWAYAM

• The Ministry of Human Resource

Development has launched a major

and unique initiative of online

professional development of 1.5

million higher education faculty using

the MOOCs (Massive open online

courses) platform SWAYAM.

• In the first phase, 75 discipline-

specific National Resource Centres

have been identified which are tasked

to prepare online training material

with focus on latest developments in

the discipline.

• Faculty can benefit from this initiative

as it is highly flexible and can be done

at one’s own pace and time.

• The NRCs will revolutionize

professional development of faculty

by catering to massive numbers by

leveraging ICT and online technology

platform of SWAYAM.



www.gradeup.com

14

Related Information

SWAYAM (Study Webs of Active–

Learning for Young Aspiring Minds)

• SWAYAM is a programme initiated by

Government of India and designed to

achieve the three cardinal principles

of Education Policy viz., access, equity

and quality.

• The objective of this effort is to take

the best teaching learning resources

to all, including the most

disadvantaged.




and implementation.

Source- PIB

5. Scientists say Chinese-backed

dam risks “orangutan” habitat

• Scientists are calling for cancellation

of a Chinese-backed hydroelectric

dam in Indonesia that threatens the

habitat of a newly discovered

“orangutan” species numbering only

800 animals.

• The experts say the 510-megawatt

dam in Sumatra will flood or otherwise

alter part of the habitat and likely

make it impossible to take a crucial

step toward ensuring the species

survives reconnecting fragmented

forests the primates are spread

across.

Related Information

Orangutan

• The orangutans are three extant

species of great apes native to

Indonesia and Malaysia.

• Three Extant species are-

(a) Bornean orangutan

(b) Sumatran orangutan

(c) Tapanuli orangutan

• Orangutans currently inhabit lowland

forests on Borneo, an island shared by

Indonesia, Malaysia and Brunei, and

Indonesia's island of Sumatra.


Source- The Hindu

6. 'Go to Village' mission launched in

Manipur

• Manipur Chief Minister N. Biren Singh

launched 'Go to Village' mission

throughout the state.

• The mission was launched in 60

villages of all the 60 Assembly

constituencies.

• The mission is aimed at identifying the

eligible and deserving beneficiaries in

every corner of the state and

delivering government services at

their doorstep.

Topic- Important for PCS Exams

Source- Business Standard

7. Dakota aircraft

• A restored Dakota aircraft has joined

the Indian Air Force more than four

decades after the fleet was phased out

following an illustrious service record.

• The aircraft was flown back to India

from UK by a joint crew of IAF and

Reflight Airworks.

Background

• The Dakota popularly known as

the Gooney Bird was the first major

transport aircraft inducted in the

fledgling Indian Air Force.

• It was at the forefront of operations

from 1947 to 1971.

• The aircraft played a crucial role in

Kashmir operations in 1947 war and

Bangladesh war.

• After 1971, the Dakota was replaced

by Avro HS-748.

Topic- Important for PCS Exams

Source- AIR

07.05.2018

1. Govt to set up marine observation

system, buy polar research

vehicle- Ministry of Earth Science

• India will establish a Marine

Observation System Along the Indian

Coast (Mosaic).

• At least six observatories – three

along the east coast and an equal

number along with the west coast –

will be established.



www.gradeup.com

15

• The project, to be launched later this

year is intended to carry out

monitoring, especially the marine

coastal pollution.

• The Hyderabad-based INCOIS will be

the implementing agency.

Polar research vehicle

• The Ministry, which has five ships to

conduct research, exploration and

surveys, is firming up plans to buy its

first polar research vehicle (PRV).

• The polar research vehicle is

important to undertake intensive

studies in the Antarctica and Arctic

regions as well as to carry out a range

of ocean studies.

• The Goa-based National Centre for

Antarctic and Ocean Research

(NCAOR), which is focused on

research in the Antarctic region, will

play an important role in the purchase

of the vessel.

• The Ministry, which has been

conducting Antarctica expeditions

from the early 1980s, has been

contracting vessels for the purpose.

Related Information

Research Stations in the Arctic

• Himadri

Research Stations in Antarctica

• Maitri

• Bharati

Note- Dakshin Gangotri Antarctic research

base superseded by the Maitri base from

1990.

Topic- GS-3- Science and Technology


2. NASA launched its latest mission

“InSight” to Mars

• NASA has launched its latest Mars

lander, InSight, designed to perch on

the surface and listen for

"Marsquakes" ahead of eventual

human missions to explore the Red

Planet.

• Its name, InSight, is short for Interior

Exploration using Seismic

Investigations, Geodesy and Heat

Transport.

• It was launched from a United Launch

Alliance (ULA) Atlas V rocket in

California on May 6.

• The lander should settle on the Red

Planet on November 26.

• The project aims to expand human

knowledge of interior conditions on

Mars, inform efforts to send human

explorers there, and reveal how rocky

planets like the Earth formed billions

of years ago.

How will it help?

• InSight will study the deep interior of

Mars to learn how all rocky planets

formed, including Earth and its Moon.

• The lander's instruments include a

seismometer to detect marsquakes,

and a probe that will monitor the flow

of heat from the planet's interior.

• After the lander settles on the Martian

surface, a robotic arm is supposed to

emerge and place the seismometer

directly on the ground.


Source- DD News

3. GravityRAT, a malware that spies

on computers

• GravityRAT, a malware allegedly

designed by Pakistani hackers, has

recently been updated further and

equipped with anti-malware evasion

capabilities.

• It is designed to infiltrate computers

and steal the data of users and relay

the stolen data to Command and

Control centres in other countries.

• The RAT was first detected by Indian

Computer Emergency Response

Team, CERT-In, on various computers

in 2017.

• The ‘RAT’ in its name stands

for Remote Access Trojan, which is

a program capable of being controlled

remotely and thus difficult to trace.

How will it work?

• It lies hidden in the system that it

takes over and keeps penetrating

deeper.



www.gradeup.com

16

• The latest update to the program by

its developers is part of GravityRAT’s

function as an Advanced Persistent

Threat (APT), which, once it infiltrates

a system, silently evolves and does

long-term damage.

How did it enter into the system?

• GravityRAT infiltrates a system in the

form of an innocuous-looking email

attachment, which can be in any

format, including MS Word, MS Excel,

MS Powerpoint, Adobe Acrobat or

even audio and video files.

How is it different from other malware?

• Generally, malware activity is

detected by the ‘noise’ it causes inside

the Central Processing Unit, but

GravityRAT is able to work silently.

• It can also gauge the temperature of

the CPU and ascertain if the device is

carrying out high-intensity activity,

like a malware search, and act to

evade detection.

How can we escape from this?

• One such technique is ‘sandboxing’, to

isolate malware from critical

programs on infected devices and

provide an extra layer of security.

Note- A sandbox is a security mechanism for

separating running programs, usually in an

effort to mitigate system failures or software

vulnerabilities from spreading.

• The problem, however, is that

malware needs to be detected before

it can be sandboxed.


Source- The Hindu

4. Govt launched National Water

Informatics Centre to maintain

data on water resources

• The government has set up a central

body - National Water Informatics

Centre (NWIC) - to maintain a

comprehensive water resources data.

• The NWIC will work under the Union

water resources ministry as its

subordinate office.

• It’ll be headed by a joint secretary

level officer.

• It will be a single window source of

updated data on water resources in

India.

• The NWIC will also collaborate with

leading national and international

research institutes to provide

technical support to central and state

organisations dealing with water

emergency response of hydrological

extremes.

Why do we need it?

• Since scientific data is needed to take

any decision, the Union cabinet had

recently approved setting up such a

body which can provide value-added

products and services to all

stakeholders for management and

sustainable development of water

resources in the country.

• It will help by updating regularly a

comprehensive ‘Water Resources

Information System’ (WRIS) in public

domain for awareness and

involvement of all concerned for

effective integrated water resources

management.

Topic-GS-2- Statutory, regulatory and

various quasi-judicial bodies


5. Cochlear Implant Programme

• Cochlear Implant is a modern

technology to help young children

who have severe to profound

deafness in both ears.

• Because of hearing impairment, they

are not able to speak.

• Cochlear Implant provides such

children to hear normally in one ear

and with post-surgical rehabilitation,

they are able to speak also.

• The government has introduced

Cochlear Implant programme under

revised Scheme of Assistance to

Disabled Persons for Purchase/Fitting

of Aids and Appliances (ADIP) for the

poor and needy young children.

Topic-GS-2- Welfare Schemes

Source-PIB



www.gradeup.com

17

6. Sujalam Sufalam Jal Abhiyan

biggest water conservation drive

of India- Gujarat CM

• Gujarat CM Vijay Rupani claimed that

the ongoing Sujalam Sufalam Jal

Abhiyan was the biggest water

conservation drive of the country and

that it will help tackle shortage of

water for irrigation and drinking

purposes in Gujarat.

Background

• The Sujalam Sufalam Jal Abhiyan

started on May 1 will continue

throughout this month.

• During the month-long drive, the

government targets to remove 1,100

crore cubic metre of silt from beds of

water bodies.

• It will significantly augment storage

capacity of these reservoirs and help

make the shortage of drinking and

irrigation water a thing of the past in

the state.

Topic-GS-2- Government policies and



and implementation.


08.05.2018

1. Indian teen’s satellite “Anitha-

SAT” soars in Mexico sky

• Anitha-SAT, a lightweight satellite

developed by Villet Oviya, a 17-year-

old student of Tiruchi, to measure the

effects of air pollution and global

warming, was launched from Aztra

Labs in Mexico City.

• The satellite weight is around 500

grams.

• It is fitted with global positioning

system and a camera, the satellite

was pushed into troposphere, to a

height of 15 km, in a helium balloon.

• Thereafter, the balloon exploded and

the capsule began its descent towards

the sea, measuring the temperature,

air quality and concentration of gases

in the strata of the atmosphere.


Source- The Hindu

2. First record of invasive “aphid” in

Kashmir Valley

• The brown peach aphid – an insect

that attacks temperate fruit trees –

has been recorded in Kashmir Valley

for the first time.

• The spread of the aphid could affect

the local economy which is dependent

on fruit trees to a large extent.

• Aphids feed on the saps of plants,

attacking plant tissues that transport

food to all different plant parts.

• The brown peach aphid

"Pterochloroides perscae" is a

notorious pest of peach and almond

trees in the Mediterranean regions.

• In India, the aphid was recorded for

the first time in the 1970s from

Himachal Pradesh and Punjab.

• Though they were most ‘prolific’

between 20 and 22 degrees Celsius,

write the scientists, the brown-and-

white patched insects were active in

temperatures as low as 3 degrees C.

• Peach trees were the preferred plants.

How can we control?

• Several combinations and

concentrations of natural chemicals

including neem plant extracts and

lavender oil can help control aphid

numbers.

• The scientists also note that while the

blood-red ant extracted honeydew

from the aphid for food, wasps and

several other parasites also preyed on

the aphids.


Source- The Hindu

3. The carbon footprint of tourism

revealed

• The carbon footprint of tourism is

about four times larger than

previously thought, according to a

world-first study published in Nature

Climate Change.



www.gradeup.com

18

• This includes transportation,

accommodation, food and beverages,

souvenirs, clothing, cosmetics and

other goods.

• Put together, global tourism produces

about 8% of global greenhouse gas

emissions, much more than previous

estimates.

• Tourism is a trillion-dollar industry

and is growing faster than

international trade.

• By combining a detailed international

trade database with accounts tracking

what goods and services tourists

bought, we identified carbon flows

between 160 countries from 2009 to

2013.

• The study shows that tourism-related

emissions increased by around 15%

over that period, from 3.9 giga tonnes

(Gt) of carbon-dioxide equivalent

(CO₂-e) to 4.5Gt.

• The growing appetite for travel and a

business-as-usual scenario would

increase carbon emissions from global

tourism to about 6.5Gt by 2025.

• This increase is largely driven by

rising incomes, making tourism highly

income-elastic and carbon-intensive.

Related Information

Carbon Footprint

• Total emission of Greenhouse

emissions over a period of time by any

individual, group, organization etc.



4. ISRO Develops Atomic Clock for

Indigenous Navigation Satellites

• ISRO has developed an atomic clock

that will be used in navigation

satellites to measure precise location

data.

• The space agency currently imports

atomic clocks from European

aerospace manufacturer Astrium for

its navigation satellites.

• Ahmedabad-based Space Applications

Centre (SAC) of ISRO has developed

an indigenous atomic clock and this

clock is currently undergoing a series

of qualification tests.

• With the development of the desi

atomic clock, ISRO has become one of

the few space organisations in the

world which have gained the

capability to develop this highly

sophisticated technology.

• All seven navigation satellites

launched earlier as part of Indian

Regional Navigation Satellite System

(IRNSS) or NaVIC have three

imported Rubidium atomic clocks

each.

• The time difference between the

atomic clocks of different satellites

positioned at different orbits are used

to measure the accurate positioning of

a navigation receiver or an object on

the Earth.

• Besides atomic clocks, a navigation

satellite also has crystal clocks but

they are not accurate as atomic

clocks.



5. What is the reason behind the fall

in water reserves?

What is it?

• According to a sample assessment in

2011, groundwater in 19 of India’s 71

districts were exploited, meaning that

nearly as much or more water was

being pulled out than their reservoirs’

natural rechargeability.

• Groundwater is exploited unequally.

The maximum overdraft is in the

northwestern States of Rajasthan,

Punjab and Haryana.

• The latter two are key wheat

granaries and, despite developed

canal-networks, rely extensively on

groundwater.



www.gradeup.com

19

• The overall contribution of rainfall to

the country’s annual groundwater

resource is 68%, and the share of

other resources, such as canal

seepage, return flow from irrigation,

recharge from tanks, ponds and water

conservation structures, taken

together is 32%.

• Moreover, the population increase has

meant that the national per capita

annual availability of water has

reduced from 1,816 cubic meters in

2001 to 1,544 cubic metre in 2011, a

15% reduction.

How has this come about?

• Over the last two decades, an overall

decline in the quantum of pre-

monsoon rainfall has increased

dependence on groundwater.

• The immediate signs of deficit are

visible in water storage.

• According to figures from the Central

Water Commission, India’s key

reservoirs are, as of this week, 10%

short of their decadal average for this

time of the year.

Why does this matter?

• Other than groundwater being a

reserve to be used judiciously, over-

exploitation poses health risks.

• West Bengal, Odisha, Uttar Pradesh,

Bihar and Jharkhand face severe

problems of arsenic contamination,

and one of the causes is drawing

water from increasingly greater

depths.

• Punjab and Haryana have for years

reported a spike in cancer cases owing

to chemical fertilisers leaching into

the soil.

What lies ahead?

• There have been several attempts to

get the States to use groundwater

more responsibly.

• The Centre has a ‘model’ groundwater

Bill that is not binding on the States.

• However, 11 States and four Union

Territories have adopted it.

• But the legislation has had limited

impact on groundwater exploitation.

• Currently, the owner of a piece of land

is deemed the owner of the

groundwater below it.

• This Bill attempts to put the State as

the custodian of the groundwater.

Topic- GS-1- Distribution of key natural

resources

Source- The Hindu

6. First organised census for Indus

dolphins to be carried out in India

• For the conservation of Indus dolphins

- one of the world’s rarest mammals -

the Punjab government along with

WWF-India are conducting the first

organised census on their population.

• It is found only in India and Pakistan,

the Indus dolphins are confined to

only a 185 km stretch between

Talwara and Harike Barrage in India’s

Beas river in Punjab.

• The most flourishing population of the

Indus dolphin, platanista gangetica

minor, is found across.

• In India, a tiny population survives in

this small stretch of the Beas river.

• Dolphins are a key indicator of river

health.

• A blind species that communicates

through echo like bats do, Indus

dolphins are one of the seven

freshwater dolphins found across the

world.

• It is categorized as Endangered in

RED data list of IUCN.


Source- Hindustan Times

09.05.2018

1. India ranked 4th in Asia-Pacific

on power index

• India has ranked 4th out of 25 nations

in the Asia-Pacific region on power

index.

• The index is measured by The Lowy

Institute, an Australian think tank.



www.gradeup.com

20

• A country’s overall power is its

weighted average across eight

measures of power - economic

resources, military capability,

resilience, future trends, diplomatic

influence, economic relationships,

defence networks and cultural

influence.

What overall report says?

• Japan and India share major power

status.

• The United States remains the pre-

eminent power in Asia, while China,

the emerging superpower, is rapidly

closing in on the United States.

• Three of the world’s four largest

economies are in Asia, and the fourth,

the United States, is a Pacific power.

What report says specifically about

India?

• India is ranked fourth on the

parameters economic resources,

military capability, diplomatic

influence and fifth on resilience.

• It scores well on the parameters of

cultural influence and future trends,

ranking third in both.

• India ranks third for its aggregate

resources score and is set to become

the fastest-growing economy in the

region, predicted to grow 169 percent

between 2016 and 2030.

• However, it scores low on the

measure of economic relationships,

ranking 7th and in defence networks,

ranking 10th.

Topic- GS-3- Economic Development


2. 'One Stop Centres (OSCs)' for

women in 100 more districts

• Ministry of Women and Child

Development approved 100 additional

One Stop Centres for the states of

Haryana, Himachal Pradesh, Madhya

Pradesh, Maharashtra, Mizoram,

Nagaland, Odisha, Tamil Nadu and

Uttar Pradesh.

• The objectives of the Scheme are:

(i) To provide integrated support and

assistance to women affected by

violence, both in private and public

spaces under one roof.

(ii) To facilitate immediate,

emergency and non-emergency

access to a range of services including

medical, legal, psychological and

counselling support under one roof to

fight against any forms of violence

against women.

• The scheme is implementing through

States through the Nirbhaya Fund.

• The Central Government provide

100% financial assistance.

• The Ministry is implementing Scheme

for setting up One Stop Centre since

1st April 2015.

Topic- GS-3- Welfare Schemes

Source-PIB

3. China launched new satellite

“Gaofen-5” to monitor air

pollution

• China successfully launched a

hyperspectral imaging satellite for

comprehensive observation of the

atmosphere, including air pollution

which is one of the country's major

problems.

• The Gaofen-5 satellite was launched

from a March 4C rocket from the

Taiyuan Satellite Launch Center in

northern Shanxi Province.

• The satellite can be used for

comprehensive environmental

monitoring.

• Gaofen-5 is able to obtain spectral

information from ultraviolet to long-

wave infrared radiation.

• It is the world's first full-spectrum

hyperspectral satellite for

comprehensive observation of the

atmosphere and land.


Source- DD News



www.gradeup.com

21

4. Government signed the $200mn

loan agreement with World Bank

for POSHAN Abhiyaan

• The government signed loan deal

worth 200 million dollars with World

Bank for the National Nutrition Mission

POSHAN Abhiyaan.

• The loan will help in achieving its goal

of reducing stunting in children up to

6 years of age from 38.4 percent to

25 percent by 2022.

Related Information

POSHAN (PM’s Overarching Scheme for

Holistic Nourishment) scheme

• POSHAN Abhiyaan was launched by

the Prime Minister in Jhunjhunu on

8th March 2018.

• It is a scheme under Ministry of

Women and Child Development.

• The Executive Committee is the Apex

body under the POSHAN Abhiyaan.

• National Council on India’s nutritional

challenges under, NITI Aayog, also

has been set up under the POSHAN

Abhiyaan.

• The scheme aims to ensure holistic

development and adequate nutrition

for pregnant women, mothers and

children.

• It also targets to reduce the level of

stunting, under-nutrition, anaemia

and low birth rate.

• The following nutrition strategies and

interventions include under Abhiyaan-

(a) Supplementary nutrition

(b) Adolescent nutrition

(c) IYCF (Infant and Young Child

Feeding) immunisation

(d) Maternal health etc.


Source- DD News

5. NABH (Nextgen Airports for

Bharat) Nirman initiative

• Shri Suresh Prabhu, Minister for Civil

Aviation said that the government is

committed to the building of airport

capacity as part of NABH (NextGen

Airports for Bharat) Nirman initiative.

• The three key aspects of NABH

Nirman are-

(1) Fair and equitable land acquisition

(2) Long-term master plan for the

airport and regional development and

(3) Balanced economics for all

stakeholders.

• Other objectives are-Improving

passenger amenities, promoting

cargo handling facilities and early

operationalisation of 56 new airports

under UDAN scheme.




and implementation.

Source-PIB

6. Rajasthan Institute comes up

with new sheep insemination

technique

• Scientists at the Central Sheep and

Wool Research Institute (CSWRI),

Avikanagar, have come up with a new

laparoscopic-assisted insemination

technique for sheep.

• The new technique has resolved the

difficulties involved in the freezing of

semen and inability to transit the

tortuous reproductive tract of the

ruminant mammals kept as livestock.

• The minor invasive laparoscopic

technique involves passing a rigid

fibre-optic laparoscope into the

abdomen through a small incision.

• The new technique would help achieve

up to 60% survival in the birth of

lambs and would have an immense

potential for rapid multiplication of

elite germplasm.

Related Information

Central Sheep and Wool Research

Institute

• The Central Sheep and Wool Research

Institute is a premier institute of

Indian Council of Agricultural

Research engaged in research,

training and extension activities on

sheep and rabbits.



www.gradeup.com

22

• It is located in Avikanagar in district

Tonk of Rajasthan.

Important ICAR institutions

Indian Agricultural

Research Institute New Delhi

Indian Veterinary

Research Institute

Bareilly, Uttar

Pradesh

National Dairy Research

Institute Karnal, Haryana

Central Institute of

Fisheries Education

Mumbai,

Maharashtra

Central Institute for

Research on Buffaloes Hissar, Haryana

Central Institute of Cotton

Research

Nagpur,

Maharashtra

Central Sheep and Wool

Research Institute

Avikanagar,

Rajasthan

Indian Institute of

Horticultural Research

Bengaluru,

Karnataka

Indian Institute of Spices

Research Calicut, Kerala

Indian Institute of

Sugarcane Research

Lucknow, Uttar

Pradesh

Insemination

• It is the deliberate introduction of

sperm into a female animal or plant

for the purpose of impregnating or

fertilizing the female for sexual

reproduction.

Topic- GS-3- Agriculture

Source- The Hindu

10.05.2018

1. Bogibeel, India's longest road-rail

bridge

• In a major boost to defence logistics

along the border with China, India's

longest road and railway

bridge connecting Dibrugarh in

Assam to Pasighat in Arunachal

Pradesh is likely to be inaugurated

later this year by Prime Minister

Narendra Modi.

• The bridge will be the second longest

in Asia.

• It will be the longest combined rail

and road bridge in India and second

longest bridge over the Brahmaputra

after Dhola-Sadiya Bridge which is a

road bridge of length 9.15 km.

• The bridge is 32 metres above the

water level of the Brahmaputra.

Related Information

• India and China share a nearly 4,000

km border, with almost 75 percent in

Arunachal Pradesh.

• As of now, the rail and road link to

Arunachal is through three Assam

bridges -- Jogighopa in Bongaigaon

district, Saraighat near Guwahati, and

Kolia-Bhomora between Sonitpur and

Nagaon.

• The other alternative is crossing by

ferry, but it is not suitable for heavy

cargo.

• Bogibeel is part of infrastructure

projects planned by India to improve

logistics along the border in Arunachal

Pradesh.

Topic- GS-3- Infrastructure: Energy, Ports,

Roads, Airports, Railways etc.


2. What Donald Trump’s pull-out

from Iran deal means for India?

• Recently, President Donald Trump

announced US withdrawal from the

2015 landmark nuclear deal with Iran.

What is the nuclear deal from which

President Donald Trump on Tuesday

pulled the United States?

• It is officially called the Joint

Comprehensive Plan of Action

(JCPOA), and informally the ‘Iran

nuclear deal’.

• It was signed between Iran and the P5

(the five permanent members of the

United Nations Security Council — US,

China, France, Russia, and the UK),

plus Germany and the European

Union, in Vienna on July 14, 2015.



www.gradeup.com

23

• The deal, aimed at preventing Iran

from building a nuclear weapon,

involved lifting of international

sanctions in return for Tehran curbing

its nuclear programme.

Why the US withdraw from the deal?

• The Trump administration says the

deal did not target-

(a) Iran’s ballistic missile programme

(b) Its nuclear activities beyond 2025

and

(c) Its role in conflicts in Yemen and

Syria.

Why is India concerned?

• Iran is India’s third-largest oil supplier

after Iraq and Saudi Arabia.

• India is developing Chabahar as the

beginning of a route to strife-torn,

landlocked Afghanistan that bypasses

Pakistan, and as a gateway to Central

Asia. It is both a financial and a

strategic investment.

• Destabilise the region where over 8

million Indian migrants live and work.

Topic-GS-2- Effect of policies and politics of

developed and developing countries on

India’s interests, Indian diaspora.


3. Uttar Pradesh plans to raise Rs

12,000 crore for India’s longest

expressway

• The UP govt is looking to raise Rs

12,000 crore to fund the construction

cost of the country’s longest

expressway, the upcoming 341-

km Poorvanchal Expressway from

Lucknow to Ghazipur.

• It is one of the most expensive

expressways in the country, pegged

at a total of Rs 23,349 crore with

construction cost alone estimated at

Rs 11,718 crore.

• The expressway will connect nine

agriculturally predominant districts to

the state capital, is expected to be

completed in 2021.

Topic- GS-3- Infrastructure: Energy, Ports,

Roads, Airports, Railways etc.


4. Madhya Pradesh launched India's

First Smart Cities Control Centre

• The Madhya Pradesh government

launched the country's first

Integrated Control and Command

Centre (ICCC) for all seven smart

cities of the state in Bhopal.

• The ICCC would enable the authorities

to monitor the status of various smart

civic amenities in real-time through

the sensors connected to it.

• Bhopal, Indore, Ujjain, Gwalior,

Jabalpur, Satna, and Sagar are the

seven smart cities under SCM (Smart

Cities Mission) in Madhya Pradesh.

• Ninety cities of the country have been

selected under the SCM.

Related Information

Integrated Control and Command Centre

(ICCC)

• ICCC is a cloud-based Universal

Internet of Things (UIoT) platform

developed by Hewlett Packard

Enterprise (HPE).

Smart City Mission

• Smart Cities Mission is an urban

renewal and retrofitting program by

the Government of India with the

mission to develop 100 cities across

the country making them citizen

friendly and sustainable.

• The Union Ministry of Urban

Development is responsible for

implementing the mission in

collaboration with the state

governments of the respective cities.

• Ninety cities of the country have been

selected under the SCM.

• The objective is to promote cities that

provide core infrastructure and give a

decent quality of life to its citizens, a

clean and sustainable environment

and application of ‘Smart’ Solutions.

Topic- GS-3- E-governance

Source- NDTV

5. MeitY launched internship scheme

‘Digital India Internship Scheme’

for Tech students



www.gradeup.com

24

• Ministry of Electronics and

Information technology (MeitY) has

launched ‘Digital India Internship

Scheme’ portal in which a token of

₹10,000 will also be offered to interns

as remuneration per month.

• The portal will facilitate students to

apply online for internship and its aim

is to provide an opportunity to secure

first hand and practical work

experience under the guidance of a

mentor.

• The internship scheme will enable the

young students to learn closely about

working of the transformative

initiative of Digital India.

• It will also give exposure to the

students about technology policy and

decision making of the government of

India.




and implementation.

Source- The Hindu Business line

6. A whale of a conservation effort

• The whale shark, the largest living

species of fish, comes under the

category ‘endangered’ in The

International Union for Conservation

of Nature (IUCN) Red List.

• In India, the migratory species is

listed in Schedule I (Part IIA) of the

Indian Wildlife (Protection) Act, 1972,

which is the highest protection status

for any living species in the country.

• But the fishing community in Kerala

seems to have no clue about these

facts, their unregulated practices

causing a significant decline in the

whale shark population.

• They will be educated on how to save

the fish from regional extinction as

part of a campaign jointly launched by

the Wildlife Trust of India (WTI) and

Cochin Shipyard Limited (CSL).


Source- The Hindu

11.05.2018

1. Creation of Directorate General of

Trade Remedies (DGTR) in

Department of Commerce

• The Government of India carried out

an Amendment to the Government of

India (Allocation of Business) Rules,

1961 on May 7, 2018, substituting

“DGTR” in place of “DGAD” in

Department of Commerce.

• This has paved way for the creation of

an integrated single umbrella National

Authority to be called the Directorate

General of Trade Remedies (DGTR)

for providing comprehensive and swift

trade defence mechanism in India.

• The amendment of Allocation of

Business Rules has also mandated

Department of Commerce with work

pertaining to the recommendation of

Safeguard measures.

What is the current scenario?

• Presently, the trade defence

mechanism in India lacks optimality

and takes more than a year to

complete proceedings in cases

pertaining to unfair trade practices.

• Currently-

(a) The Directorate General of Anti-

dumping and Allied Duties (DGAD)

deals with anti-dumping and CVD

cases

(b) Directorate General of Safeguards

(DGS) deals with safeguard measures

and DGFT deals with quantitative

restriction (QR) safeguards.

How will it improve the system?

• The DGTR will bring DGAD, DGS and

Safeguards (QR) functions of DGFT

into its fold by merging them into one

single national entity.

• DGTR will deal with Anti-dumping,

CVD and Safeguard measures.

• It will also provide trade defence

support to our domestic industry and

exporters in dealing with increasing

instances of trade remedy

investigations instituted against them

by other countries.



www.gradeup.com

25

• The creation of DGTR will provide a

level playing field for the domestic

industry.

How will it work?

• The DGTR will function as an attached

office of Department of Commerce.

• The recommendation of DGTR for the

imposition of Anti-dumping,

countervailing & Safeguard duties

would be considered by the

Department of Revenue.

• The DGTR will be a professionally

integrated organisation with multi-

spectrum skill sets emanating from

officers drawn from different services

and specialisations.

Topic- GS-3- Indian Economy

Source-PIB

2. India all set for a deep dive into

the ocean

• India’s ambitions to send humans into

the deep sea and explore resources in

the depths is gathering momentum.

• A ‘Manned Submersible’, which can

take a three-member scientific crew

down below, is taking shape.

• The project is part of the overall, long-

term “Deep Sea Mission” and efforts

to tap into the blue ocean economics.

• The Union Ministry of Earth Sciences,

which has embarked on this project,

expects to have an operational vehicle

ready in 2-3 years.

• The design for making the

submersible from titanium material

that will have two hemispheres

welded together in the form of a

spaceship has been made by the

ESSO-National Institute of Ocean

Technology (NIOT), Chennai.

Current Initiative

• The Department has been conducting

surveys for polymetallic nodules and

hydrothermal sulphides in volcanic

plumes in designated areas of the

Indian Ocean with the International

Seabed Authority.

• The Oceanographic Ship,

‘SagarKanya’, has been operating for

several years now in the explorations.

• The targeted depth to be reached is 5-

6 km into the sea, where the resource

availability, living organisms,

environmental conditions, etc, are to

be studied. and understood.

• The development of the Submersible

with the capacity to carry one pilot

and two scientists will be taken up

with a joint venture partner. Initially,

the Submersible will reach up to a km

for preliminary studies.

Scope for India

• With 95 percent of the deep sea

remaining unexplored, the venture is

promising and India can have an

early-mover advantage.

• At present, a few countries, such as

the US, Russia, China and Japan are

said to possess the technology and

submersible.

• They have also undertaken some

expeditions.

Topic-GS-1- Distribution of key natural

resources across the world (including South

Asia and the Indian subcontinent)


3. Bonn climate meet ends amid

concern over lack of urgency in

accelerating negotiations

• Government representatives from

over 190 countries, including India

met in Bonn, Germany for next round

of UN climate change negotiations, to

develop guidelines for implementing

the 2015 Paris Agreement post-2020.

What are the outcomes of Bonn Climate

meet?

• The main agenda of the recently

concluded talks was to put together

the contents of a negotiating text that

would be presented for political

discussions at the 24th session of the

Conference of Parties in December

2018 Katowicze, Poland.



www.gradeup.com

26

• With respect to the agenda, the

outcome at the end of the two weeks

has been a lukewarm one.

• While progress has been made

regarding the ‘rule book’ or

implementation guidelines, much

remains to be done.

Related Information

UNFCC (United Nations Framework

Convention on Climate Change)

• The United Nations Framework

Convention on Climate Change

(UNFCCC) is an international

environmental treaty adopted on May

9, 1992 and opened for signature at

the Earth Summit in Rio de Janeiro

from 3 to 14 June 1992.

• The UNFCCC objective is to "stabilize

greenhouse gas concentrations in the

atmosphere at a level that would

prevent dangerous anthropogenic

interference with the climate system".

• The parties to the convention have

met annually from 1995

in Conferences of the Parties

(COP) to assess progress in dealing

with climate change.

• Example- COP 23- 23rd session of the

Conference of Parties (COP)

Aims of Paris Climate Accord (COP 21)

• Global temperature rises this century

well below 2 degrees Celsius above

the pre-industrial level.

• Pursue efforts to limit the

temperature upsurge even further

to 5 degrees Celsius.

• Strengthen the ability of countries

to deal with the impacts of climate

change.

India’s target in Nationally Determined

Contributions (INDCs)

• India had promised to reduce its

emissions intensity- greenhouse

gas emissions per unit of GDP- by

33 to 35 percent below 2005

levels by the year 2030.

• It had also promised to ensure that at

least 40 percent of its energy in

2030 would be generated from

non-fossil fuel sources, like solar,

wind or biofuels.

• In addition, it had said it would

rapidly increase its forest cover so

that an additional carbon sink

equivalent to 2.5 to 3 billion

tonnes of carbon dioxide is

created by the year 2030.



4. National Technology Day- May 11

• National Technology Day is celebrated

every year on May 11.

• On this day in 1998, India successfully

tested its nuclear bombs in Pokhran,

Rajasthan.

• India conducted five underground

nuclear tests at Pokhran test range in

Rajasthan, on 11th and 13th of May in

1998.

• The tests were conducted under the

leadership of Former President Dr A.

P. J. Abdul Kalam, who was then

DRDO Chief, and Dr R Chidambaran,

then Chairman of Atomic Energy

Commission.

Topic- GS-3- Technology

Source- AIR

5. Telangana CM launches

investment support scheme

“'Rythu Bandhu” for farmers

• Telangana govt. launched an

investment support scheme for

farmers, claimed to be the first such

initiative in the country.

• Under the scheme 'Rythu Bandhu'

(friend of farmers), Rs 8,000 per acre

per year will be given to all farmers

who own land.

• The scheme shall not be extended to

tenant farmers.


Source- Business Standards



www.gradeup.com

27

12.05.2018

1. India diverted 10 million hectares

of productive agri-lands, replaces

them with barren lands for

cultivation

• In the reports of the Committee on

Doubling farmers’ Income, the

Committee has found a systemic

change in land use that has been

hurting farmers’ income.

• According to this report, India has

been diverting large tracts of

productive agricultural lands for other

purposes like making way for new

townships and to accommodate

expanding settlements besides being

given for industrial purposes.

• More and more barren and

uncultivable lands are being brought

under farming.

• This has impacted the farmers’

productivity, income security and also

the viability of cultivation.

Important Facts

• Since 1970-71, the area under non-

agriculture has increased by 10

million hectares (mha).

• On the other hand, during the same

period (1971-2011-12), lands under

the barren and uncultivated category

have declined from 28.16 mha to

17.23 mha.

• The report argues that given India’s

net-cultivated area remaining the

same, this indicates farmers are now

more dependent on barren and

uncultivable lands for survival.

Related Information

Land put to Non-agricultural Uses

• Land under settlements (rural and

urban), infrastructure (roads, canals

etc.), industries, shops, etc. are

included in this category.

• An expansion in the secondary and

tertiary activities would lead to an

increase in this category of land-use.

Barren and Wastelands

• The land which may be classified as a

wasteland such as barren hilly

terrains, desert lands, ravines, etc.

normally cannot be brought under

cultivation with the available

technology.

Area under Permanent Pastures and

Grazing Lands

• Most of this type of land is owned by

the village ‘Panchayat’ or the

Government.

• Only a small proportion of this land is

privately owned.

• The land owned by the village

panchayat comes under ‘Common

Property Resources’.

Culturable Waste-Land

• Any land which is left fallow

(uncultivated) for more than five

years is included in this category.

• It can be brought under cultivation

after improving it through reclamation

practices.

Current Fallow

• This is the land which is left without

cultivation for one or less than one

agricultural year.

• Fallowing is a cultural practice

adopted for giving the land rest.

• The land recoups the lost fertility

through natural processes.

Fallow other than Current Fallow

• This is also a cultivable land which is

left uncultivated for more than a year

but less than five years.

• If the land is left uncultivated for more

than five years, it would be

categorised as culturable wasteland.

Net Area Sown

• The physical extent of land on which

crops are sown and harvested is

known as net

sown area.

Topic- GS-3- Agriculture

Source- Down To Earth + NCERT

2. Govt. approves green licence

plates for e-vehicles



www.gradeup.com

28

• To promote electric vehicles in India,

the government has approved green

licence plates bearing numbers in

white fonts for private e-vehicles and

yellow for taxis.

• The government also plans to allow

youth in the age bracket of 16-18

years to drive electric scooters,

besides mandating taxi aggregators

to have a certain percentage of the e-

vehicle fleet.

• The measure is aimed at promoting e-

vehicle’s use and the government is

considering the exemption from

permits for such vehicles.

• The purpose behind distinctive

number plates is their easy

identification for preferential

treatment in parking, free entry in

congested zones besides other

proposed benefits like the

concessional toll.

Related Information

• India, currently, has four kinds of

number plates-

(a) White licence plates with numbers

on the black font for private cars

(b) Yellow plates with fonts in black

for commercial vehicles

(c) Black plates with yellow font

letters for self-driven rental vehicles

and

(d) Blue plates with white font letters

for Embassies and High Commissions.

• Army vehicles, on the other hand,

follow a different registration system

given by the Defence Ministry, while

vehicles of the President and

governors have red licence plates with

the national emblem.

Topic- GS-2-Government policies and


sectors

Source- The Hindu

3. NFR submits studies to extend rail

connectivity to Bhutan

• The Northeast Frontier Railway has

submitted feasibility studies to the

Ministry of External Affairs to extend

rail connectivity to Bhutan.

• At present, there is no rail link

between the two countries.

• As part of the Centre’s Act East policy

to boost ties with South Asian

neighbours through North Eastern

region, the Indian Railways has

completed groundwork for extending

rail connectivity to Nepal, Bhutan,

Bangladesh and Myanmar.

Topic- GS-3-Bilateral, regional and global

groupings and agreements involving India

and/or affecting India’s interests


4. Exiled asteroid discovered in

outer reaches of solar system

• Scientists have found a carbon-rich

asteroid that was flung into the outer

reaches of the solar system and may

provide new insights into the

formation of the Sun and its planets.

• Astronomers used European Southern

Observatory (ESO) telescopes to

investigate Kuiper Belt Object 2004

EW95 – the first of its kind asteroid to

be confirmed in the cold outer reaches

of the solar system.

• The object likely formed in the

asteroid belt between Mars and

Jupiter and has been flung billions of

kilometres from its origin to its

current home in the Kuiper Belt.

• These models suggest that the Kuiper

Belt – a cold region beyond the orbit

of Neptune – should contain a small

fraction of rocky bodies from the inner

Solar System, such as carbon-rich

asteroids, referred to as

carbonaceous asteroids.

• The study found evidence for the first

reliably-observed carbonaceous

asteroid in the Kuiper Belt, providing

strong support for these theoretical

models of our Solar System’s troubled

youth.





www.gradeup.com

29

14.05.2018

1. India’s global poverty rank

improves

• India’s Multidimensional Poverty

(MDP) has dropped significantly,

largely as a result of the performance

of five key southern States (Kerala,

Tamil Nadu, Karnataka, Telangana

and Andhra Pradesh.)

• Between 2005-06 to 2015-16,

poverty level came down from 55% to

21%, improving the country’s MDP

ranking.

• Following the drop-in poverty levels,

India moved to the 26th rank from its

earlier 54, in a decade, among 102

developing countries with MDP.

Important Facts

• While the national average is 21%, in

the five southern States (Kerala,

Tamil Nadu, Karnataka, Telangana

and Andhra Pradesh) the average

MDP is 9%. However, poverty levels

have dropped in all States.

• Kerala has an MDP of 1%, Tamil Nadu

(6%), Karnataka (11%), Telangana

(14%) and Andhra Pradesh (13%) are

also significantly low.

• Bihar is the poorest State with 43%

incidence of poverty.

• Jharkhand (36%), Uttar Pradesh

(31%), Rajasthan (31%) and Odisha

(29%) are also above the national

average (21%),

• Of 640 districts, 31 districts — all in

eastern or central India — have over

50% MDP.

• The top five districts with the largest

prevalence of MDP are in Shravasti,

Baharaich and Balrampur in Uttar

Pradesh, and Alirajpur and Jhabua in

Madhya Pradesh.

• Chhattisgarh, which is affected by Left

Wing insurgency, has done well,

bringing down its poverty level from

71% to 22%.

Multidimensional Poverty (MDP)

• MDP is “an international measure of

acute poverty” based on three key

categories-

(a) Health

(b) Education and

(c) Living standards

Related Information

Global Multidimensional Poverty Index

(MPI)

• MPI was developed in 2010 by the

Oxford Poverty & Human

Development Initiative (OPHI) and

the United Nations Development

Programme.

• It replaced the previous Human

Poverty Index.

• The global MPI is released annually by

OPHI and the results published on its

website.

• The index uses the same three

dimensions as the Human

Development Index: health,

education, and standard of living.

Topic- GS-2- Issues relating to poverty and

hunger.

Source- The Hindu

2. UNDP to set up Skill development

centre in Hyderabad

• The United Nations Development

Programme (UNDP) will soon set up a

skill development centre at 'Bharosa'

an integrated support centre for

distressed women and children here.

• The Skill development centre aimed at

empowering vulnerable and

marginalised women by imparting

skills training,

• The agreement extends support to

enable these women to learn

marketable skills and connect with

income opportunities.

• 'Bharosa' provides under one roof,

24X7 services related to police,

medical, legal, prosecution, psycho-

therapeutic counselling and relief and

rehabilitation services in completely

private counselling rooms to maintain

confidentiality and privacy.



www.gradeup.com

30

Related Information

• Last year, the Hyderabad Police had

signed an agreement with UNDP

under the 'Disha' project to build

capacities and skills of women

affected by violence to help make

them economically self-sufficient.



sectors

Source- Deccan Herald

3. Nepal to host BIMSTEC 2018

• Nepal's Prime Minister KP Sharma Oli

announced to host the 2018 Bay of

Bengal Initiative for Multi-Sectoral

Technical and Economic Cooperation

(BIMSTEC) summit.

Related Information

BIMSTEC-

• The Bay of Bengal Initiative for Multi-

Sectoral Technical and Economic

Cooperation (BIMSTEC) is an

international organisation involving a

group of countries in South Asia and

South-East Asia.

• These 7 countries are Bangladesh,

India, Myanmar, Sri Lanka, Thailand,

Bhutan and Nepal.

• The BIMSTEC states are among the

countries dependent on the Bay of

Bengal.

• Its secretariat is located in Dhaka,

Bangladesh.

• BIMSTEC uses the alphabetical order

for the Chairmanship.


institutions


4. India largest remittance-

receiving country in the world

• The report 'RemitSCOPE - Remittance

markets and opportunities - Asia and

the Pacific' said India (USD 69 billion),

China (USD 64 billion) and the

Philippines (USD 33 billion) are the

three largest remittance- receiving

countries in the world in 2017.

• The report said remittances to the

Asia-Pacific region amounted to USD

256 billion last year.

• About 70 percent of remittances sent

to Asia and the Pacific come from

outside the region and in particular

from the Gulf States (32 percent),

North America (26 percent) and

Europe (12 percent).

• Remittances are particularly crucial in

rural areas where poverty is the

highest.

• The report is released by the

International Fund for Agricultural

Development (IFAD).

Related Information

International Fund for Agricultural

Development (IFAD)

• It is an international financial

institution and a specialised agency of

the United Nations dedicated to

eradicating poverty and hunger in

rural areas of developing countries.

• It was established as an international

financial institution in 1977 as one of

the major outcomes of the 1974

World Food Conference.

• Its headquarters is in Rome, Italy, and

is a member of the United Nations

Development Group.

• Through loans and grants, IFAD works

with governments to develop and

finance programmes and projects that

enable rural poor people to overcome

poverty themselves.

• Membership in IFAD is open to all

member states of the United Nations

or its specialised agencies or the

International Atomic Energy Agency.

• The Governing Council is IFAD's

highest decision-making authority,

with the Member States each

represented by a governor and

alternate governor.

Topic- GS-3- Economic Development




www.gradeup.com

31

5. Make India observer in the forum

of Islamic nations: Bangladesh

• Bangladesh has called for reforms in

the Organisation of Islamic

Cooperation that can pave the way for

countries like India, which are not

Muslim majority, to get an observer

seat in the OIC.

• Though Pakistan is unlikely to

welcome the proposal as it uses the

forum to regularly target India.

• China has also put forward the

“inclusion” argument to say that large

Muslim populations should not be

denied a say at the OIC.

• Muslims in India constitute 10% of the

global adherents of the faith.

• In terms of Muslims as a percentage

of the global population, India ranks

third after Indonesia and Pakistan.

Related Information

Organisation of Islamic Cooperation

(OIC)

• It is an international organization

founded in 1969, consisting of 57-

member states, with a collective

population of over 1.6 billion as of

2008.

• The organisation states that it is "the

collective voice of the Muslim world"

and works to "safeguard and protect

the interests of the Muslim world in

the spirit of promoting international

peace and harmony".

• The OIC has permanent delegations

to the United Nations and the

European Union.

• The official languages of the OIC are

Arabic, English, and French.

• Its headquarter is in Jeddah, Saudi

Arabia.



structure, mandate.


6. ISRO making green propellant

• Scientists at the Indian Space

Research Organisation (ISRO) have

reported progress in the development

of an environment-friendly propellant

to power satellites and spacecraft.

• The effort is to replace

the conventional hydrazine rocket

fuel, a highly toxic and carcinogenic

chemical, with a greener propellant

for future missions.

• Initial tests by a research team at the

Liquid Propulsion Systems Centre

(LPSC) have shown promising results

in the formulation and associated

tests of a propellant blend based

on hydroxylammonium nitrate

(HAN).

• Due to its high-performance

characteristics, hydrazine has

dominated the space industry as the

choice of propellant for over six

decades, despite its environmental

and health hazards and the challenges

faced in its manufacturing, storage,

ground handling and transportation.

• The LPSC team formulated the HAN-

based monopropellant and carried out

a variety of tests to investigate its

characteristics, like thermal and

catalytic decomposition and

compatibility with different materials.

Other facts

• The in-house formulation consists of

HAN, ammonium nitrate, methanol

and water.

• While methanol was added to reduce

combustion instability, the choice of

HAN was dictated by its capacity to

control the burn rate and lower the

freezing point of the propellant.

Related Information

Monopropellant

• It is a chemical propulsion fuel which

does not require a separate oxidizer.

• It is used extensively in satellite

thrusters for orbital correction and

orientation control.


Source- The Hindu



www.gradeup.com

32

15.05.2018

1. WHO launched plan 'REPLACE' to

eliminate trans fat in foods by

2023

• The World Health Organization (WHO)

has launched a comprehensive plan to

eliminate industrially-produced

artificial trans fats from the global

food supply by 2023.

• The UN body has released a step by

step guide for the industry to

eliminate trans fats from the food.

• The guide, called REPLACE, has six

actions, which include-

(a) REview of dietary sources of trans

fats

(b) Promoting replacement with

healthier fats

(c) Setting up a regulatory framework

(d) Assessing and monitoring trans

fats content in food

(e) Creating awareness and enforcing

the regulation

(f) Enforce compliance with policies

and regulations.

What are the issues with trans fat?

• For long, industrially-produced trans

fats in food have been linked to health

problems.

• Consumption of trans fats increases

the level of bad LDL-cholesterol which

is an accepted biomarker of

cardiovascular diseases.

• The World Health Organization (WHO)

estimates that trans fats lead to more

than 500,000 deaths due to

cardiovascular disease.

• It has been seen that diets high in

trans fat can increase the risk of heart

disease by 21 percent and deaths by

28 percent.

Why is the industry produced trans fat

are more harmful?

• Though natural trans fats from dairy

products are also part of the

diet, maximum consumption is in

the form of industrially-produced

trans fats.

• Industrially-produced trans fats are

contained in hardened vegetable fats

such as margarine and ghee and are

often present in snack, baked, and

fried foods.

• Manufacturers often use them as they

have a longer shelf life than other

fats.

Related Information

Trans Fats

• There are two broad types of trans

fats found in foods: naturally-

occurring and artificial trans fats.

• Naturally-occurring trans fats are

produced in the gut of some animals

and foods made from these animals

(e.g., milk and meat products) may

contain small quantities of these fats.

• Artificial trans fats (or trans fatty

acids) are created in an industrial

process that adds hydrogen to liquid

vegetable oils to make them more

solid.

Topic- GS-2- Issues relating to development

and management of Social Sector/Services

relating to Health, Education, Human

Resources.

Source- DD News + Down to Earth

2. ‘Samarth’- Scheme for Capacity

Building in Textile Sector

• A meeting of stakeholders on Samarth

– Scheme for Capacity Building in

Textile Sector under the Skill India

Mission was held in New Delhi to

familiarize the stakeholders about the

scheme and its guidelines.

Related Information

Samarth Scheme

• Cabinet Committee on Economic

Affairs approved the scheme on

December 20, 2017.

• The scheme is intended to provide

demand-driven, placement oriented

National Skills Qualifications

Framework (NSQF) compliant skilling

programmes to incentivize and

supplement the efforts of the industry

in creating jobs in the textiles sectors.



www.gradeup.com

33

• The broad objective of the new

scheme is to skill the youth for gainful

and sustainable employment in the

textile sector covering the entire value

chain of textiles, excluding spinning

and weaving.




and implementation.

Source-PIB

3. Government announces national

wind-solar hybrid policy

• The government announced a

national wind-solar hybrid policy,

which seeks to promote new projects

as well as hybridisation of the existing

ones.

• The government has set an ambitious

target of achieving 175 gigawatts

(gw) of installed capacity from

renewable energy sources by 2022,

which includes 100 gw of solar and 60

gw of wind power capacity.

• The policy provides a comprehensive

framework to promote large grid-

connected wind-solar photovoltaic

(PV) hybrid system for optional and

efficient utilisation of transmission

infrastructure and land.

• The policy will help in reducing the

variability in renewable power

generation and achieving better grid

stability.

• The policy provides for the

procurement of power from a hybrid

project on the tariff-based

transparent bidding process for which

government entities may invite bids.

• Under the policy which is first, the

government will extend all fiscal and

financial incentives available to wind

and solar power projects to hybrid

projects.




and implementation.


4. Indo-Pacific infrastructure forum

launched to tap private sector in

India, US, Japan

• An Indo-Pacific trilateral

infrastructure forum has been

launched to find new, creative and

efficient ways of leveraging the power

of the private sector in India, the US

and Japan to fill the massive gap in

infrastructure and connectivity in the

region.

• It is launched by the US Chamber of

Commerce's US-India Business

Council (USIBC) along with US-Japan

Business Council, the Indo-Pacific

Infrastructure Trilateral Forum.

• It is a private sector platform that is

seeking to partner with some

government initiatives.

Topic- GS-2- Bilateral, regional and global

groupings and agreements involving India

and/or affecting India’s interests


5. Wildlife network “SAWEN” of

South Asian countries

• The South Asia Wildlife Enforcement

Network (SAWEN), an inter-

governmental wildlife law

enforcement agency, in its first-ever

meeting in India, adopted many

resolutions to curb wildlife crime in

the region.

• During the meet, six proposals,

including tracking of wildlife

smuggling route, review of existing

laws and a structure for the

organisation were tabled.

Related Information

South Asia Wildlife Enforcement

Network (SAWEN)

• South Asia Wildlife Enforcement

Network (SAWEN) is an inter-

governmental wildlife law

enforcement support body of South

Asian countries namely - Afghanistan,

Bangladesh, Bhutan, India, Maldives,

Nepal, Pakistan and Sri Lanka.



www.gradeup.com

34

• SAWEN was launched in Bhutan in

2011 and in 2016 the Union Cabinet

gave permission to adopt the statute

of SAWEN.

• It focuses on policy harmonization;

institutional capacity strengthening

through knowledge and intelligence

sharing, and collaboration with

regional and international partners to

enhance wildlife law enforcement in

the member countries.

• Its Secretariat is located in

Kathmandu, Nepal.


Source- The Hindu

6. Indian Army Women Officers’

Mountaineering Expedition to Mt.

Bhagirathi-II

• Indian Army Women Officers’

Mountaineering Expedition to Mt.

Bhagirathi-II (6512 metres)

consisting of nine women officers, was

flagged off by Director General of

Military Training on 14 May 2018.

• The expedition aims at encouraging

women in the field of adventure where

dauntless courage, will-power and

determination is put to test. The

Indian Army women officers are

exploring their maximum potential in

the field of adventure sports.

Related Information

• Bhagirathi-II is located in the Garhwal

Himalayas in Gangotri National Park

(Uttarakhand).

Garhwal Himalayas

• The Garhwal Himalayas are mountain

ranges located in the state of

Uttarakhand, India.

• The mountain ranges cross two

regions: Garhwal division and

Kumaon division.

• This range is also a part of Himalaya

Shivalik Hills, the outer most hills of

the Himalaya located in Himachal

Pradesh and Uttarakhand.

Topic- GS-1-Indian Geography

Source-PIB

***



www.gradeup.com

35

***




· minster maneka gandhi’s proposal • the national council on nutrition (ncn) has unanimously...

Documents