mir-637 interferes ctsb in cholangiocarcinoma · expression of mir-637 and ctsb in cca tissues and...

1265

Abstract. – OBJECTIVE: To investigate the role of mir-637 on the proliferation, migration and apoptosis in human cholangiocarcinoma (CCA) cell line QBC939, and the impact of mir-637 on Cathepsin B (CTSB) expression.

MATERIALS AND METHODS: Expression of mir-637 and CTSB in CCA tissues and adjacent non-tumor tissues were measured by Real-time PCR. CTSB expression in human CCA cell lines was detected with or without mir-637 exogenous overexpression through fluorescent quantita-tive reverse transcriptase polymerase chain re-action (qRT-PCR) method. The efficiency of len-tivirus-mir-637 vector infection, and the effect of mir-637 on the proliferation, migration abili-ty, apoptosis and cell cycle of CCA cell were de-tected, respectively. The possibility of mir-637 targeting CTSB was also tested by bioinformat-ics method, correlation analysis and molecular biology method.

RESULTS: Decreased mir-637 and increased CTSB expression were observed in CCA tis-sue compared with adjacent non-tumor tissues. CTSB expression in mir-637 exogenously over-expressed QBC939 cells decreased compared with negative control. Mir-637 overexpression caused significant decrease of proliferation and migration ability of QBC939 cell. In addition, mir-637 overexpression induced that the cell cy-cle was blocked in G0/G1 phase, and cell apop-tosis rate increased significantly.

CONCLUSIONS: mir-637 and CTSB play an important role in the proliferation and migration of CCA cells. Mir-637 could inhibit CTSB expres-sion significantly, which in-turn down-regulates the proliferation, migration and invasion abili-ty of QBC939 cell, and promotes apoptosis in QBC939 cell line.

Key Words:Cathepsin B, RNAi, Cholangiocarcinoma cell, Prolif-

eration, Apoptosis.

Introduction

Cholangiocarcinoma (CCA) is a malignant tumor originating from bile duct epithelial cells, and is a rare tumor accounting for less than 2% of all cancers1. The incidence rate of CCA accounts for 3% to 5% of gastrointestinal can-cer and 10% to 15% of hepatobiliary tumors reported globally2,3. CCA is not common in Eu-rope and USA with recorded incidence ranging from 0.8 to 2 per 100,000; it has shown highest prevalence in Southeast Asia4. CCA incidence is gradually increasing in recent years and its com-mon risk factor is chronic biliary inflammation5. Based on its location and surgical intervention, CCA is divided into intrahepatic bile duct and extrahepatic bile duct cancers6. The extrahepatic bile duct carcinoma is more common in CCA and is divided into upper third (hilar), middle third and lower third7. Similarities are seen be-tween intrahepatic and extrahepatic CCA, but they hold distinct epidemiological and clinical features, especially their etiopathogenetic path-ways8. The anatomical location and the occult clinical presentation make CCA to be diagnosed at a very late stage, thus making treatment of CCA difficult. The presentation of clinical symptoms often means that CCA has entered

European Review for Medical and Pharmacological Sciences 2018; 22: 1265-1276

J.-X. LI1,2, X.-M. DING1,3, S. HAN1, K. WANG1, C.-Y. JIAO1, X.-C. LI1

1Liver Transplantation Center, The First Affiliated Hospital of Nanjing Medical University, Key Laboratory of Living Donor Liver Transplantation, Nanjing, Jiangsu Province, China2Department of General Surgery, Danyang Hospital Affiliated to Nantong University, Zhenjiang, Jiangsu Province, China3Department of Hepatopancreatobiliary Surgery, Subei People’s Hospital, Yangzhou, Jiangsu Province, China

Jia-xin Li, Xiang-min Ding and Sheng Han contributed equally

Corresponding Author: Xiang-cheng Li, MD; e-mail: [email protected]

mir-637 inhibits the proliferation of cholangiocarcinoma cell QBC939 throughinterfering CTSB expression

J.-X. Li, X.-M. Ding, S. Han, K. Wang, C.-Y. Jiao, X.-C. Li

1266

the advanced stage, and the prognosis is very poor. Surgical treatment for CCA is effective only in the early stages9, and CCA is not sen-sitive to chemotherapy. The recurrence rate of CCA in postoperative patients could reach to 50% within 2 years10. Reports indicate that more than 50% of CCA patients receive only palliative treatment due to metastasis and the advanced progression of CCA11. The 5-year survival rate of CCA is about 5% to 15% 12. The invasiveness and metastatic features of CCA is an important factor affecting the survival of patients. Gener-ally, surgical approach remains the best treat-ment option, and the normal life expectancy for patients with unresectable intrahepatic CCA is < 5% at 5 years, but increases to 20-44% at 5 years for patients having early stage disease (T1-T2) undergoing surgical intervention13.

Cathepsin B (CTSB) belongs to a family of lysosomal cysteine proteases and it plays an important role in intracellular proteolysis. It is encoded by the CTSB gene in humans. As one of the members of the cathepsin family, CTSB could alter the microenvironment of tumor by activating, processing or degrading different growth factors, cytokines and chemokines, fur-ther remodeling extracellular matrix (ECM)14,15. Through activation of MMP2, MMP3 and pro-moting the degradation of extracellular matrix by CTSB and urokinase plasminogen activator (uPA), the generation, migration and metastasis of new “parent tumor vessels” were promoted16. CTSB protein is usually located in the lyso-somes, and acts on laminin, type I collagen, type IV collagen and other extracellular matrix components after these matrix proteins have been transferred or secreted to cytoplasm or extracellular. The over expression of CTSB is correlated with development and progression of a variety of tumors, especially in gastric cancer, lung cancer, liver cancer, head and neck cancer, breast cancer, prostate cancer, and ovarian cancer, etc.17. The expression of CTSB in CCA tissue tends to be significantly higher than that in adjacent tissues, and the expression of serum CTSB was inversely related to the prognosis of cholangiocarcinoma18,19.

There were reports demonstrating that mir-637, a primate specific miRNA, could inhibit the proliferation of hepatoma carcinoma cell (HCC) by disrupting the activation of signal transducer and activator of transcription 3 (STAT3)20. mir-637 expression negatively correlates with the prognosis of glioma, and mir-637 also inhib-

its the occurrence, development and metastasis of glioma through regulating Akt expression21. Meanwhile, the activation of cathepsin B may be via Akt/PTEN pathway22. Caspases are a family of protease enzymes that play essential role in programmed cell death and inflamma-tion. Reports23 indicate that CTSB, caspase-3 and caspase-9 are correlated with the apoptosis in cancer cells.

We speculated that mir-637 might inhibit the proliferation and migration of CCA cell by reg-ulating CTSB and play an inhibitory effect on the viability of CCA cells. We used resected CCA tumor sample to investigate the expression of mir-637 and CTSB in tumor tissues, further using CCA cell line by exogenous overexpres-sion of mir-637. Also, we investigated the role of mir-637 and CTSB on CCA proliferation and cell cycle distribution, further study their relationship in vitro.

Materials and Methods

Samples and Cell Lines41 cases of resected CCA tissues and adjacent

tissues (all were confirmed by pathology) were obtained from CCA patients from June 2014 to August 2015 in Jiangsu Province People’s Hos-pital. The using of these tissues was approved by the Ethics Committee of the hospital. The informed consent form was signed by all the patients. All tissues were immediately frozen in liquid nitrogen after resection and stored at -80°C in refrigerator.

Human CCA cell lines QBC939, RBE, HuCCT1 normal bile duct cells HIBEpiC were purchased from Cell Bank of Type Culture Col-lection (CTCC), Chinese Academy of Sciences (Shanghai, China). All cells were cultured in Ros-well Park Memorial Institute-1640 (RPMI-1640) medium with 10% fetal bovine serum (FBS) (Ausbian, VS500T) with 100 IU/ml penicillin and 100 μg/ml streptomycin at 37°C in 5% CO2 incubator.

Expression of mir-637 and CTSB in CCA Tissues and Cells

The tissue samples were cut into 3 mm × 3 mm × 3 mm cube in dry ice, and added into a 1.5 mL Eppendorf (EP) tube containing 1 mL TRIzol lysate. The RNA enzymes were inactivated for 5-10 s. After grinding, the tissue suspension was centrifuged at 5000 rpm at 4°C for 3 min. The

mir-637 interferes CTSB in cholangiocarcinoma

1267

supernatant was transferred into a new 1.5 mL Eppendorf (EP) tube. The cultured cells (6-well plate, 80% cell density) were centrifuged at 2000 rpm for 5 min, the supernatant was removed and 1 mL of TRIzol was added. After they were fully mixed for 5 min at room temperature, the suspen-sion was transferred to a new 1.5 mL Eppendorf (EP) tube.

The total RNAs was extracted using a RNA Isolation Kit (Pufei Biotech, Shanghai, China). cDNA was reverse transcripted. Human glyc-eraldehyde -3- phosphate dehydrogenase (GAP-DH) was used as the internal reference gene. SYBR Green I (qPCR SYBR-Green Master Mix, Vazyme Biotech, Nanjing, CHN) was used as fluorescent dye. The miRNA U6 was used to standardize miRNA-637 expression. The ampli-fied sequence of U6 was: 5‘UUCUCCGAACGU-GUCACGUUU3’; miRNA-637: 5’ACUGGGG-GCUUUCGGGCUCUGCGU3’. The expression level of CTSB mRNA was detected by RT-PCR method. Total RNA was extracted using methods described above. Used primers for amplifica-tion (designed and synthesized by Gene Chem Biotech, Shanghai, China) were: CTSB (F)5’ TACAGCCCGACCTACAAAC 3’, (R) 3’GAG-CAGGAAGTCCGAATACAC 5’; GAPDH (F) 5’ TGACTTCAACAGCGACACCCA 3’; GAPDH (R) 3’ CACCCTGTTGC TGTAGCCAAA 5’. The relative expression of target gene was calculated by 2-ΔCt method (ΔCt = CT target gene-CTGAPDH).

Establishment of Exogenous mir-637 Transfected Cell

Aimed to exogenous overexpressing mir-637 in CCA cells, mir-637 lentiviral vectors with green fluorescent protein (GFP) was constructed by Tiangen Biotech (Beijing, China). The vector was digested by restriction endonuclease I and EcoR I, the mir-637 vector was termed as LV-hsa-mir-637. The scramble sequence (TTCTC-CGAACGTGTCACGT) was chosen as the neg-ative control. The virus titer (MOI, 10) was detected before the experiment. The expression of GFP was observed under the inverted fluores-cence microscope. CCA cells were collected 16 h after infection, then centrifuged at 2000 rpm for 2 min, and the supernatant was discarded. The rest was gently mixed and cultured in plate. The cells were processed by Puromycin (2 µg/ml) 48 h after infection. The infection efficiency was detected 96 h after infection. Most infected cells showed green fluorescence under the fluo-rescence microscope (Axiovert 200, Carl Zeiss,

Göttingen, Germany). Image Pro Plus software was used to analyze the effect of infection rate. The follow-up study was performed when fluo-rescence rate reached to 70-80%, and the cells confluence rate reached to 80%.

Effect of Exogenous mir-637 on the Cell Growth and Cell Migration

QBC939 cells containing higher overex-pressed miR-637 were named as QBC939-KD group, cells containing negative virus packag-ing (LVpsc-scramble plasmid) were named as QBC939-NC group. The growth of the cells was tested by MTT method. OD value was detected by microplate reader (Multiskan Ascent 354, Labsystems, Dragon, Finland) at 490/570 nm; the cells growth were detected at 24 h, 48 h, 72 h, 96 h and 120 h. Scratch test was used to evaluate cell migration ability evaluation: 3 × 104 infected cells were inoculated in each well and they reached 90% fusion after culturing overnight. Scratch tester was used for scratching in 96-well plate. Images were obtained 0 h, 8 h, 16 h and 24 h after the scratch; after that, the migration rate (width) of cells in each group was calculated.

Effect of Exogenous mir-637 on Cell Cycle and Cell Apoptosis

Cell cycle distribution (G1, S and G2/M) was analyzed with flow cytometry 5 days af-ter infection. The logarithmically growing cells were trypsinized and resuspended in Dulbecco’s Modified Eagle Medium (DMEM) with 10% fetal bovine serum (FBS), then rinsed with pre-cold D-Hanks. After centrifugation, the su-pernatant was removed, cells were fixed in 70% cold ethanol for 1 h. Fixed cells were rinsed with D-Hanks and permeabilized with 0.1% Triton X-100 and 2 mg/ml RNase A in D-Hanks for 30 min. Cells were rinsed with D-Hanks and stained with 50 mg/ml of propidium iodide (PI) (Sigma-Aldrich, St. Louis, MO, USA). Stained cells were analyzed with the Guava easyCyte HT flow cytometry system (Millipore, Billerica, MA, USA). Cell apoptosis was measured 5 days after lentivirus transfection. Cells were stained with 200 μl cell suspension containing 10 μl Annexin V-APC (Cat. 88-8007, eBioscience, Thermo Fisher scientific, Waltham, MA, USA) at room temperature in the dark for 10 to 15 min; next, flow cytometry analysis was performed on the Guava easyCyte HT flow cytometry system (Millipore, Billerica, MA, USA).


1268

Western BlottingTotal proteins were extracted from cells and

the protein concentration was determined us-ing the bicinchoninic acid (BCA) assay. To-tal proteins (60 µg) were subjected to 12% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes (EMD Millipore, Billerica, MA, USA). Mem-branes were blocked with 5% skimmed milk for 1 h, and subsequently incubated with the following primary antibodies at 4°C overnight: goat anti human -CTSB (1:1,000; catalog No. sc-163595; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA), goat anti human - caspase-3 (1: 1,000; catalog No. sc-22140; San-ta Cruz Biotechnology, Santa Cruz, CA, USA), goat anti human - caspase-9 (1:1,000; catalog No. sc-8297; Santa Cruz Biotechnology, Santa Cruz, CA, USA) and goat anti human - GAP-DH (1: 5,000; catalog No. sc-20357; Santa Cruz Biotechnology, Santa Cruz, CA, USA). The membranes were washed three times with Tris-buffered saline (TBS) and incubated with rabbit anti goat, IgG-horseradish peroxidase (HRP) (1:5,000; polyclonal; sc-2922; Santa Cruz Biotech, Santa Cruz, CA, USA) at 37°C for 45 min. The proteins were visualized by Pierce™ enhanced chemiluminescence (ECL) re-agent (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The ChemiDoc XRS Imaging system (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and ImageJ software were used to obtain image and semi-quantitative analysis.

Statistical AnalysisAll statistical analyses were performed using Stata

11 software (StataCorp LP, College Station, TX, USA) and presented by GraphPad Prism software (GraphPad Software, Inc. La, Jolla, CA, USA). The continuous variable data were presented as mean with standard deviation (SD). The differences between 2 groups were compared with Student’s t-test. p < 0.05 was consid-ered statistically significant.

Results

Expression of mir-637 and CTSB inHuman CCA Tissue and CCA Cells

As shown in Figure 1A, mir-637 expression in 41 CCA tissues was significantly down-regulated than adjacent non-tumor tissues, while CTSB expression in CCA tissues was significantly higher than adja-

cent non-tumor tissues (Figure 1B, p < 0.05). In addition, CTSB expression negatively cor-relates with mir-637 (Figure 1C). The QBC939 cell line had the lowest mir-637 expression among different CCA cells (Figure 1D), so it was chosen in the following virus infection study.

Virus Infection Efficiency and Possible mir-637 Target Prediction

The sequencing results (supplemental Table I) showed that mir-637 lentiviral vector was suc-cessfully constructed. The titer of the virus was calculated by formula (virus titer = fluorescence cell number/virus solution amount). The calculat-ed titer of LV-hsa-mir-637 virus was 8E 8 TU/ml, according to the relative fluorescence microscop-ic image, and the virus was found successfully infecting QBC939 cells (Figure 2A, 100×) with three parallel experiments, which were named KD1, KD2 and KD3 groups.

The possible target gene for mir-637 on reg-ulating CTSB was predicted by the TargetScan software. Analysis indicated that mir-637 has the potential to regulate CTSB and may be involved in the pathogenesis of cholangiocarcinoma. The potential mir-637 binding domain locates 372-378 of CTSB 3’UTR:

5’..........GUUCCCCCAUCAGUUCCCCCAGU... | | | | | | | | | |

3’UGCGUCUCGGGCUUUC------GGGGGUCA

The relative expression levels of CTSB mRNA were detected in KD 1 group, KD 2 group, KD3 group, and LV-scramble (NC group). The relative expression of CTSB in KD3 group was signifi-cantly lower than other groups (p < 0.05; Figure 2B). KD3 group was selected for subsequent cell function experiments.

mir-637 Overexpression Inhibits Proliferation of QBC939 Cell

The cell growth of virus-infected cells was observed 72 h after infection. Results showed that the morphology of infected cell was unchanged (Figure 3A, 200×). Cell proliferation was tested by MTT assay. The absorption value of KD group and control group (NC) at 490 nm was measured. The OD value was positively correlated with number of viable cells. Comparison showed the growth of KD cells was significantly lower than NC cells. KD cells proliferation was significantly lower than NC cells either (p < 0.01, Figure 3B).


1269

In addition, the colony formation test also showed the number of formed clones of KD cells were significantly lower compared to NC cells (Figure 4, 100×).

mir-637 Overexpression Inhibits Migration Ability of QBC939 Cell

After 3 days’ culture of infected QBC939 cell, the migration ability of cells in NC and KD group were measured with 8 h and 24 h duration, respectively. The migration rate in KD group was decreased in 8 h and 24 h in scratching test (Fig-ure 5) compared with NC group. The migration ability of KD group was significantly lower than NC group at 24 h scratching test (p < 0.05).

Cell Cycle and Apoptosis AnalysisCell cycle was analyzed at 5 days after infection

in KD group and NC group. The distribution of

G1, S and G2/M phase in KD and NC group was listed in Figure 6. The cell numbers in G1 phase of KD group were significantly higher than NC group (p = 0.0069), while the cell numbers in G2/M phase were significantly lower than NC group (p = 0.0098). This indicates that the cells in KD group were suspended in G1 phase and the transition to S, G2/M phase was blocked. Also, the cell apopto-sis rate in KD group was significantly higher than NC group (p = 0.00017, Figure 7).

mir-637 Overexpression Inhibits CTSB Expression, Promotes Caspase-3 and Caspase-9 Expression

Western blot results showed that miR-637 over expression (KD group) inhibited CTSB protein expression, while promoted the caspase-3 and caspase-9 expression. The differences were all statistically significant (Figure 8).

Figure 1. The expression of mir-637 and CTSB in human CCA tissue and CCA cells. A, The expression of mir-637 in 41 CCA tissues were significantly lower than adjacent normal tissues; B, The expression of CTSB in CCA tissues were significantly higher than adjacent normal tissues. C, The expression of CTSB was negatively correlated with mir-637; D, The QBC939 cell has the lowest mir-637 expression among these CCA cells.


1270

Table I. Sequencing results of constructed vectors.


1271

Figure 2. A, The fluorescence microscopic image of QBC939 with LV-hsa-mir-637 virus vector for three parallel groups (100×). B, The relative expression of CTSB in KD3 group was significantly lower than other groups (p < 0.05).

Figure 3. The proliferation of QBC939 cells after LV-hsa-mir-637 infection. A, The infected cells grow normal, and overexpressed mir-637 does not influence the morphology of QBC939 (200×). B, The MTT assay shows that the growth of KD cells was significantly lower than NC cells.


1272

Discussion

We investigated the role of mir-637 in clinical cholangiocarcinoma (CCA) tissues, which was found to have lower expression than the adjacent non-tumor tissues. The results were consistent with previous miRNA chip detection results,

which reported the lower mir-637 expression in several other tumors and cancerous tissues21,24. To further explore the specific function of mir-637 in CCA, QBC939 cell line was selected, as it had the lowest mir-637 expression compared to other CCA cell lines. In our study, over expression of mir-637 significantly inhibited the proliferation and migration of QBC939 cells. Similar pattern was observed when miR-122 was over expressed, and it could inhibit the proliferation and migra-tion of QBC939 cells25.

We predicted that CTSB might be a potential target for mir-637 by bioinformatics analysis us-ing microRNA.org and TargetScan. CTSB is a family member of cysteine protease, which is highly abundant and widely distributed among all the cysteine cathepsins, and has often been implicated in tumor progression26. Mature CTSB, as well as the proteolytically inactive proenzyme, was detected in soluble form within the extracel-lular space and also found to be associated with the plasma membrane27. CTSB can directly de-grade extracellular matrix or indirectly degrade through activating plasminogen activator and matrix metalloproteinase28. By enhancing the mi-gration ability of tumor, CTSB could promote the invasion and metastasis of tumors 29. Expression

Figure 4. The colony formation test. The formed clones of KD cells were significantly lower than NC cell (100×).

Figure 5. Comparison of the migration ability of cells with scratching assay in NC and KD group at 8 h and 24 h after 3 days’ culture of infected QBC939 cells. The migration rate in KD group was decreased in 8 h and 24 h compared with NC group.

Figure 6. Cell cycle analysis of KD group and NC group at 5 days after infection. The distribution of G1, S and G2/M phase in KD and NC group were compared. Mir-637 overexpression induces the G1 arrest in KD group compared with NC group.


1273

of CTSB is correlated with development and evo-lution of many tumors, including gastric cancer, liver cancer, head and neck cancer, and other can-cers 30,31. Studies32 have shown that knocking out CTSB could retard cell proliferation and tumor

growth and significantly reduce the tumor inva-sion. A report33 has indicated that the expression of CTSB in CCA was significantly higher than that in adjacent tissues. CTSB expression nega-tively correlates with the prognosis of cholangio-

Figure 7. The cell apoptosis analysis showed the apoptosis rate in KD group was significantly higher than NC group.

Figure 8. Western blot analysis of CTSB, caspase-3 and caspase-9 protein expression. Expressed CTSB was significantly higher in NC group compared with KD group. Expressions of caspase-3 and caspase-9 protein were significantly lower in NC group compared with KD group.


1274

carcinoma18,19. In a previous mass spectrometry analysis of 4 fresh CCA tissues from patients (da-ta not show), we found out that 37 proteins were up-regulated compared to the proteins in normal adjacent tissues, in which, the CTSB expression was 8.4 times higher than the adjacent tissues. Our further analysis of 41 CCA tissues confirms that CTSB has significantly higher expression in CCA tissue compare with normal corresponding tissues.

Several genes are known to be downregu-lated by mir-637. Zhang et al20 indicated that mir-637 inhibits tumorigenesis in hepatocellular carcinoma by disrupting signal transducer and activator of transcription 3 (STAT3) signaling. They reported that mir-637 overexpression could decrease activated Stat3 levels, suggesting the disruption of Stat3 phosphorylation, and the sup-pressed expression of the antiapoptotic target genes of Stat3, including Cryab and Mcl1 21. mir-637 could regulate the proliferation, development, and metastasis of glioma by regulating Akt1 levels21. Silencing of Akt1 inhibited the growth and invasion of glioma cells by decreasing phos-phorylated Akt, β-catenin, phosphorylated Foxo1 and Cyclin D1 and induced expression of Foxo122. We showed that targeted regulation of CTSB by mir-637 could inhibit the proliferation and mi-gration of CCA cells. The detailed mechanism might be that CTSB alters the microenvironment of tumor through remodeling and degradation of extracellular matrix (ECM), and activating, processing or degrading different growth factors, cytokines and chemokines14,15. Researches34 have shown that knockdown of CTSB in the HBSP-3 cells by siRNA, could significantly reduce the matrix metalloproteinases (MMP)-9 or uPA. The major MMPs involved in tumor angiogenesis are MMP-2, -9, -14, and to a lesser extent MMP-1 and -735. By suppressing the CTSB triggered activation of several matrix metalloproteinases, mir-637 might have reduced the CTSB mediated degradation of extracellular matrix, proliferation of vascular remodeling, and other related process, which, in turn, inhibited the migration and me-tastasis of CCA.

Caspases, or cysteine-dependent aspartate spe-cific proteases, are a family of enzymes cru-cial for initiating and executing apoptosis within a cell, an important biological event especially during organ development. Caspase-3 is a protein that is cleaved and thus activated upon the initia-tion of apoptosis36. Caspase-9 is the main initiator caspases in mammals37. Caspase-9 propagates

a cascade of further caspase processing events by directly cleaving and activating caspase-3 and caspase-7. After that, caspase-3 processes caspases-6 and -2, and in turn, caspase-6 process-es caspases-8 and -10 downstream38. Research-es23,39 have indicated that caspase-3, caspase-9 and cathepsin B (CTSB) are involved in the apoptosis of cells. Studies have shown that CTSB plays a role in an apoptotic ‘rescue’ program in cells undergoing lysosome-mediated cell death by affecting the apoptosis-regulating Bcl-2 fam-ily, i.e by proteolytic activation of Bid (tBid)40. Our results showed that mir-637 could decrease CTSB expression, which, in turn, increased the caspase-3 and caspase-9 expression. Currently, no studies have reported the direct regulatory effect of mir-637 on caspase-3 and caspase-9, so, we speculate that the regulated expression of caspase-3 and caspase-9 is mainly by the action of CTSB40. Our results provide some useful infor-mation for further study on the regulatory role of mir-637 with respect to apoptosis.

We found that CTSB in CCA specimens was significantly higher than that in adjacent non-tu-mor tissues. The expression of mir-637 was neg-atively correlated to CTSB level. Monsouvanh et al33 demonstrated serum cathepsin B to cystatin C ratio could be used as a potential marker for the diagnosis of cholangiocarcinoma. However, whether CTSB and mir-637 can be used as a pre-dictor of prognosis of cholangiocarcinoma needs further study.

Currently, the poor prognosis and lack of effective treatment methods to cholangiocar-cinoma lead to potential new diagnosis and therapeutic methods to be highly urgent. Sev-eral scientific reports indicate that miRNAs are involved in important biological processes of tumors, including cell proliferation, differenti-ation, migration, invasion and apoptosis. The abnormal expression of miRNAs plays an im-portant role in intracellular signaling networks. It promotes the malignant phenotype of CCA in development and evolution process. We believe that more we understand the role of mir-637 in the development of CCA, more will be possible to lead to the potential application of mir-637 in cancer therapy for CCA in the near future. The relationship between the downstream-targeted genes of miRNAs and the regulatory networks of mRNA is complex, and miRNAs locate at the upstream or intermediate link of the regulatory networks. The proliferation and migration of CCA might involve in multiple miRNAs and


1275

multiple biological processes (such as methyla-tion of the promoter). The regulation mechanism of a single abnormal miRNA cannot fully reflect the real situation of gene-regulated network. There is uncertain and limitations in clinical ap-plication of inhibiting tumor growth through ad-justing a miRNA. It still needs to design better, especially through correcting the imbalance of overall miRNAs to inhibit tumor proliferation. At the same time, the mechanism of cholangio-carcinoma is complicated and has not been fully understood. The real action pathway of mir-637 in CCA, involved genes and target proteins, still need further investigation.

Conclusions

We find out down-regulated mir-637 expres-sion and up-regulated CTSB expression in CCA tissue. mir-637 inhibits the expression of CTSB significantly, in turn, reducing the proliferation, migration and invasion ability of QBC939 cells; thereby, it enhances apoptosis in vitro.

Conflict of InterestThe Authors declare that they have no conflict of interests.

References

1) Gibiino G, Fabbri C, FaGiuoli S, ianiro G, Fornelli a, Cennamo V. Defining the biology of intrahepat-ic cholangiocarcinoma: molecular pathways and early detection of precursor lesions. Eur Rev Med Pharmacol Sci 2017; 21: 730-741.

2) menG l, Tian Z, WanG Y, liu Y, liu J. Predictive and prognostic molecular markers for cholangiocarci-noma in Han Chinese population. Int J Clin Exp Med 2015; 8: 13680-13689.

3) SpolVeraTo G, ViTale a, CuCCheTTi a, popeSCu i, marqueS hp, aldriGheTTi l, Gamblin TC, maiThel SK, SandrouSSi C, bauer TW, Shen F, poulTSideS Ga, marSh JW, paWliK Tm. Can hepatic resection pro-vide a long-term cure for patients with intrahepat-ic cholangiocarcinoma? Cancer 2015; 121: 3998-4006.

4) Shaib Y, el-SeraG hb. The epidemiology of cholan-giocarcinoma. Semin Liver Dis 2004; 24: 115-125.

5) ChunG Ye, Kim mJ, parK Yn, Choi JY, pYo JY, Kim YC, Cho hJ, Kim Ka, Choi SY. Varying ap-pearances of cholangiocarcinoma: radiolog-ic-pathologic correlation. Radiographics 2009; 29: 683-700.

6) Ghouri Ya, mian i, bleChaCZ b. Cancer review: cholangiocarcinoma. J Carcinog 2015; 14: 1.

7) YamaSaKi S. Intrahepatic cholangiocarcinoma: mac-roscopic type and stage classification. J Hepato-biliary Pancreat Surg 2003; 10: 288-291.

8) GoreS GJ. Cholangiocarcinoma: current concepts and insights. Hepatology 2003; 37: 961-969.

9) ruZZenenTe a, ConCi S, ValdeGamberi a, pedraZZani C, GuGlielmi a. Role of surgery in the treatment of intrahepatic cholangiocarcinoma. Eur Rev Med Pharmacol Sci 2015; 19: 2892-2900.

10) hYder o, haTZaraS i, SoTiropouloS GC, paul a, alex-andreSCu S, marqueS h, puliTano C, barroSo e, ClarY bm, aldriGheTTi l, Ferrone Cr, Zhu ax, bauer TW, WalTerS dm, GroeSChl r, Gamblin TC, marSh JW, nGuYen KT, TurleY r, popeSCu i, huberT C, meYer S, ChoTi ma, GiGoT JF, menTha G, paWliK Tm. Recur-rence after operative management of intrahepatic cholangiocarcinoma. Surgery 2013; 153: 811-818.

11) miShreKi ap, lim e, CraneField p, paSCoe S, JaCKSon S, STell da. Low rate of active treatment of patients with hilar cholangiocarcinoma. Ann Roy Coll Surg 2013; 95: 349-352.

12) noJi T, TSuChiKaWa T, oKamura K, naKamura T, Tamo-To e, ShiChinohe T, hirano S. Resection and recon-struction of the hepatic artery for advanced peri-hilar cholangiocarcinoma: result of arterioportal shunting. J Gastrointest Surg 2015; 19: 675-681.

13) Squadroni m, Tondulli l, GaTTa G, moSConi S, ber-eTTa G, labianCa r. Cholangiocarcinoma. Crit Rev Oncol Hematol 2017; 116: 11-31.

14) oliVeira CS, pereira h, alVeS S, CaSTro l, balTa-Zar F, ChaVeS Sr, preTo a, CorTe-real m. Cathep-sin D protects colorectal cancer cells from ace-tate-induced apoptosis through autophagy-inde-pendent degradation of damaged mitochondria. Cell Death Dis 2015; 6: e1788.

15) abdulla mh, Valli-mohammed ma, al-KhaYal K, al ShKieh a, Zubaidi a, ahmad r, al-Saleh K, al-obeed o, mCKerroW J. Cathepsin B expression in col-orectal cancer in a Middle East population: po-tential value as a tumor biomarker for late disease stages. Oncol Rep 2017; 37: 3175-3180.

16) Colin C, VouTSinoS-porChe b, nanni i, Fina F, me-TelluS p, inTaGliaTa d, baeZa n, bouVier C, delFino C, loundou a, ChinoT o, lah T, KoS J, marTin p m, ouaFiK l, FiGarella-branGer d. High expression of cathepsin B and plasminogen activator inhibitor type-1 are strong predictors of survival in glio-blastomas. Acta Neuropathol 2009; 118: 745-754.

17) aGGarWal n, Sloane bF. Cathepsin B: multiple roles in cancer. Proteomics Clin Appl 2014; 8: 427-437.

18) eberT mp, KruGer S, FoGeron ml, lamer S, Chen J, proSS m, SChulZ hu, laGe h, heim S, roeSSner a, malFerTheiner p, roCKen C. Overexpression of cathepsin B in gastric cancer identified by pro-teome analysis. Proteomics 2005; 5: 1693-1704.

19) KaWaSe h, FuJii K, miYamoTo m, KuboTa KC, hirano S, Kondo S, inaGaKi F. Differential LC-MS-based pro-teomics of surgical human cholangiocarcinoma tissues. J Proteome Res 2009; 8: 4092-4103.


1276

20) ZhanG JF, he ml, Fu Wm, WanG h, Chen lZ, Zhu x, Chen Y, xie d, lai p, Chen G, lu G, lin mC, KunG hF. Primate-specific microRNA-637 inhibits tumori-genesis in hepatocellular carcinoma by disrupting signal transducer and activator of transcription 3 signaling. Hepatology 2011; 54: 2137-2148.

21) que T, SonG Y, liu Z, ZhenG S, lonG h, li Z, liu Y, WanG G, liu Y, Zhou J, ZhanG x, FanG W, qi S. De-creased miRNA-637 is an unfavorable prognosis marker and promotes glioma cell growth, migra-tion and invasion via direct targeting Akt1. Onco-gene 2015; 34: 4952-4963.

22) amanTini C, morelli mb, SanToni m, Soriani a, Car-dinali C, FarFariello V, eleuTeri am, bonFili l, moZ-ZiCaFreddo m, nabiSSi m, CaSCinu S, SanToni G. Sorafenib induces cathepsin B-mediated apopto-sis of bladder cancer cells by regulating the Akt/PTEN pathway. The Akt inhibitor, perifosine, en-hances the sorafenib-induced cytotoxicity against bladder cancer cells. Oncoscience 2015; 2: 395-409.

23) miTupaTum T, aree K, KiTTiSenaChai S, roYTraKul S, puThonG S, KanGSadalampai S, roJpibulSTiT p. mR-NA Expression of Bax, Bcl-2, p53, Cathepsin B, Caspase-3 and Caspase-9 in the HepG2 cell line following induction by a novel monoclonal Ab Hep88 mAb: cross-talk for paraptosis and apop-tosis. Asian Pac J Cancer Prev 2016; 17: 703-712.

24) leiVonen SK, SahlberG KK, maKela r, due eu, Kallion-iemi o, borreSen-dale al, perala m. High-through-put screens identify microRNAs essential for HER2 positive breast cancer cell growth. Mol On-col 2014; 8: 93-104.

25) liu n, JianG F, he Tl, ZhanG JK, Zhao J, WanG C, Ji-anG Gx, Cao lp, KanG pC, ZhonG xY, lin TY, Cui YF. The roles of MicroRNA-122 overexpression in in-hibiting proliferation and invasion and stimulating apoptosis of human cholangiocarcinoma cells. Sci Rep 2015; 5: 16566.

26) podGorSKi i, Sloane bF. Cathepsin B and its role(s) in cancer progression. Biochem Soc Symp 2003; (70): 263-276.

27) VaSilJeVa o, papaZoGlou a, KruGer a, brodoeFel h, KoroVin m, deuSSinG J, auGuSTin n, nielSen bS, alm-holT K, boGYo m, peTerS C, reinheCKel T. Tumor cell-derived and macrophage-derived cathepsin B promotes progression and lung metastasis of mammary cancer. Cancer Res 2006; 66: 5242-5250.

28) Sendler m, maerTin S, John d, perSiKe m, WeiSS Fu, KruGer b, WarTmann T, WaGh p, halanGK W, SChaSChKe n, maYerle J, lerCh mm. Cathepsin B ac-tivity initiates apoptosis via digestive protease ac-tivation in pancreatic acinar cells and experimen-tal pancreatitis. J Biol Chem 2016; 291: 14717-14731.

29) TeraSaWa Y, hoTani T, KaTaYama Y, TaChibana m, miZu-GuChi h, SaKurai F. Activity levels of cathepsins B and L in tumor cells are a biomarker for efficacy of reovirus-mediated tumor cell killing. Cancer Gene Ther 2015; 22: 188-197.

30) bao W, Fan q, luo x, ChenG WW, WanG Yd, li Zn, Chen xl, Wu d. Silencing of cathepsin B sup-presses the proliferation and invasion of endome-trial cancer. Oncol Rep 2013; 30: 723-730.

31) puiSSanT a, ColoSeTTi p, roberT G, CaSSuTo Jp, raY-naud S, auberGer p. Cathepsin B release after ima-tinib-mediated lysosomal membrane permeabili-zation triggers BCR-ABL cleavage and elimina-tion of chronic myelogenous leukemia cells. Leu-kemia 2010; 24: 115-124.

32) GoCheVa V, ZenG W, Ke d, KlimSTra d, reinheCKel T, peTerS C, hanahan d, JoYCe Ja. Distinct roles for cysteine cathepsin genes in multistage tumori-genesis. Genes Dev 2006; 20: 543-556.

33) monSouVanh a, prounGViTaYa T, limpaiboon T, WonGKham C, WonGKham S, luVira V, prounGViTaYa S. Serum cathepsin B to cystatin C ratio as a po-tential marker for the diagnosis of cholangiocarci-noma. Asian Pac J Cancer Prev 2014; 15: 9511-9515.

34) Chen Wn, Chen JY, Jiao bY, lin WS, Wu Yl, liu ll, lin x. Interaction of the hepatitis B spliced protein with cathepsin B promotes hepatoma cell migration and invasion. J Virol 2012; 86: 13533-13541.

35) ramoS-deSimone n, hahn-danTona e, SipleY J, na-GaSe h, FrenCh dl, quiGleY Jp. Activation of ma-trix metalloproteinase-9 (MMP-9) via a converg-ing plasmin/stromelysin-1 cascade enhances tu-mor cell invasion. J Biol Chem 1999; 274: 13066-13076.

36) mCComb S, mulliGan r, Sad S. Caspase-3 is tran-siently activated without cell death during early antigen driven expansion of CD8(+) T cells in vi-vo. PLoS One 2010; 5: e15328.

37) broKer le, KruYT Fa, GiaCCone G. Cell death inde-pendent of caspases: a review. Clin Cancer Res 2005; 11: 3155-3162.

38) Cullen Sp, marTin SJ. Caspase activation path-ways: some recent progress. Cell Death Differ 2009; 16: 935-938.

39) Yu Zq, Jia Y, Chen G. Possible involvement of cathepsin B/D and caspase-3 in deferoxam-ine-related neuroprotection of early brain injury after subarachnoid haemorrhage in rats. Neuro-pathol Appl Neurobiol 2014; 40: 270-283.

40) de CaSTro ma, bunT G, WouTerS FS. Cathep-sin B launches an apoptotic exit effort upon cell death-associated disruption of lysosomes. Cell Death Discov 2016; 2: 16012.

mir-637 interferes ctsb in cholangiocarcinoma · expression of mir-637 and ctsb in cca tissues and...

Documents