mir148b is a major coordinator of breast cancer...

The FASEB Journal bull Research Communication

miR148b is a major coordinator of breast cancerprogression in a relapse-associated microRNAsignature by targeting ITGA5 ROCK1 PIK3CANRAS and CSF1

Daniela CiminodaggerDagger1 Cristiano De Pitta1 Francesca OrsodaggerDagger Matteo Zampini

Silvia Casara Elisa Pennadagger Elena Quaglinosect Marco Forni Christian Damasco

Eva Pinatel Riccardo Ponzone Chiara Romualdi Cathrin Briskendaggerdagger

Michele De BortolidaggerDagger Nicoletta Bigliapara Paolo Provero Gerolamo Lanfranchi

and Daniela TavernadaggerDagger2

Molecular Biotechnology Center (MBC) daggerDepartment of Oncological Sciences DaggerCenter forMolecular Systems Biology sectDepartment of Clinical and Biological Sciences Department ofGenetics Biology and Biochemistry and paraDepartment of Gynecology and Obstetrics University ofTorino Turin Italy Department of Biology and Centro Ricerche Interdepartimentale BiotecnologieInnovative (CRIBI) Biotechnology Center University of Padova Padua Italy Institute for CancerResearch and Treatment (IRCC) Candiolo Italy and daggerdaggerNational Centers of Competence in Research(NCCR) Molecular Oncology Institut Suisse de Recherche Expeacuterimentale sur le Cancer (ISREC)School of Life Sciences Eacutecole Polytechnique Feacutedeacuterale de Lausanne (EPFL) Lausanne Switzerland

ABSTRACT Breast cancer is often fatal during its meta-static dissemination To unravel the role of microRNAs(miRs) during malignancy we analyzed miR expressionin 77 primary breast carcinomas and identified 16relapse-associated miRs that correlate with survivalandor distinguish tumor subtypes in different data-sets Among them miR-148b down-regulated in aggres-sive breast tumors was found to be a major coordinatorof malignancy In fact it is able to oppose various stepsof tumor progression when overexpressed in cell linesby influencing invasion survival to anoikis extravasa-tion lung metastasis formation and chemotherapyresponse miR-148b controls malignancy by coordinat-ing a novel pathway involving over 130 genes and inparticular it directly targets players of the integrinsignaling such as ITGA5 ROCK1 PIK3CAp110and NRAS as well as CSF1 a growth factor for stromacells Our findings reveal the importance of the identi-fied 16 miRs for disease outcome predictions andsuggest a critical role for miR-148b in the control ofbreast cancer progressionmdashCimino D De Pitta COrso F Zampini M Casara C Penna E Qua-glino E Forni M Damasco C Pinatel E Pon-zone R Romualdi C Brisken C De Bortoli MBiglia N Provero P Lanfranchi G Taverna DmiR148b is a major coordinator of breast cancer

progression in a relapse-associated microRNA signature bytargeting ITGA5 ROCK1 PIK3CA NRAS and CSF1FASEB J 27 1223ndash1235 (2013) wwwfasebjorg

Key Words microRNA profiling malignancy mammarytumor integrin signaling prognosis

Breast cancer is the most common malignancy inwomen worldwide often fatal because of metastasisdissemination (1) Clinical and pathological parame-ters including tumor size lymph node involvementand histological grade and age (2) as well as moleculartumor markers such as estrogen receptor (ER) andprogesterone receptor (PR) or ERBB2 are routinelyemployed to stratify patients with breast cancer accord-ing to risk assess prognosis and define appropriatetherapies (3) However since patients with similarcombinations of features may often have differentclinical outcomes it is urgent to identify new ways toclassify the disease More recently protein-coding geneexpression profilings have been used to improve tumorclassifications (4) and expression of certain gene setsdefined as ldquosignaturesrdquo were shown to have a prognos-tic andor predictive role for patients (5)

1 These authors contributed equally to this work2 Correspondence MBC and Department Onc Sci Uni-

versity of Torino Via Nizza 52 10126 Torino Italy E-maildanielatavernaunitoit

doi 101096fj12-214692This article includes supplemental data Please visit http

wwwfasebjorg to obtain this information

Abbreviations 3=-UTR 3= untranslated region DFS dis-ease-free survival ER estrogen receptor FDR false discoveryrate HampE hematoxylin and eosin IPA Ingenuity PathwayAnalysis miR microRNA PCA principal component analysisPR progesterone receptor SAM significance analysis ofmicroarray TMRM tetramethylrhodamine methyl ester

12230892-6638130027-1223 copy FASEB

MicroRNAs (miRs) are new players involved in theestablishment and progression of human tumors thatappear to be critical biomarkers of cancer with strongclassification power miRs are a class of small noncod-ing RNAs that negatively regulate protein-coding geneexpression post-transcriptionally by targeting mRNAsmostly at the 3= untranslated region (3=-UTR) andtriggering either translation repression or RNA degra-dation (6) Investigations for miR levels in humantumors showed that miR expression is altered in cancercompared to normal tissues and these changes canhelp to classify tumors more accurately than mRNAexpression profiles according to developmental lineageand differentiation status (7) Recent studies demon-strated that breast cancers can be classified into specifictumor pathological phenotypes (ER PR proliferationstage metastasis ERBB2) as well as subtypes (luminal Aor B basal-like ERBB2 and normal-like) based onmiR expression profiles (8 9) Thus it seems essentialto combine miR and protein-coding gene expressionanalyses to obtain information for prognosis and can-cer treatment miRs such as let-7 miR-9 miR-10bmiR-21 miR-31 miR-34 miR-126 miR-146 miR-155miR-200 miR-214 miR-221222 miR-373 and 520chave been proven to control tumor dissemination Infact alterations of their expression in breast cancercells profoundly affect tumor dissemination (10ndash12)In our work we investigated the relationship betweenaltered miR expression and breast cancer metastasis byanalyzing miR levels in a cohort of patients with breastcancer grouped based on disease relapse In particularwe investigated the biological function and molecularmechanism of a relapse-associated small noncodingRNA miR-148b

MATERIALS AND METHODS

Cell culture

Human MDAMB231 4175 TGL (13) MCF7 and T47D cellsand mouse 4T1 cells were maintained in standard conditionsDulbeccorsquos modified Eaglersquos medium containing 10 mMGlutamax and 45 mgml glucose(DMEM Glutamax GibcoInvitrogen Life Technologies Carlsbad CA USA) supple-mented with 10 heat-inactivated FCS (Biochrom AG Ber-lin Germany) 1 mM sodium pyruvate 25 mM HEPES (pH74) and 100 mgml gentamicin (all from Gibco)

Patients and samples

Frozen primary invasive ductal breast cancer specimens (77)from 25- to 82-yr-old patients were selected from the TumorBank of the Department of Obstetrics and GynecologyUniversity of Torino (Turin Italy primary surgery 1988ndash2001) for a retrospective study There was no distant metas-tasis at diagnosis (M0) Complete clinical-pathological datawere updated by follow-up for 72 mo (up to 100 mo) Allpatients were treated with radical modified mastectomy orquadrantectomy and axillary dissection plus breast irradia-tion High-risk node-negative and node-positive patients re-ceived adjuvant treatments (generally 6 cycles of CMF 600mgm2 cyclophosphamide 40 mgm2 metotrexate 600

mgm2 5-fluorouracil) andor 20 mg tamoxifen daily for 5 yrin ER cases Patient stage distribution was assessed asprescribed by the Union for International Cancer Control(UICC) clinical staging guidelines and tumor grading wasperformed as described previously (14) As normal breastcontrols 17 frozen mammoplastic reductions were includedin the screening Appropriate ethical approval was obtainedfor this study

Reagents and antibodies

miR precursors and inhibitors

Pre-miR miRNA Precursor MoleculesndashNegative Control 1miRNA precursors hsa-miR-148b (PM10264) (000471) hsa-miR-214 (PM12124) Anti-miR miRNA InhibitorndashNegativeControl 1 and miRNA inhibitor hsa-miR-148b (AM10264)were from Ambion (Austin TX USA)

miR detection

TaqMan miRNA assays hsa-miR-148b (000471) hsa-miR-187(000487) hsa-miR-365 (001020) hsa-miR-10a (000387) hsa-miR-19a (000395) hsa-miR-342-3p (002260) hsa-miR-214(002306) hsa-RNU44 (001094) and U6 snRNA (001973)were from Applied Biosystems (Foster City CA USA)

ECM

Collagen IV and fibronectin were from Sigma-Aldrich (StLouis MO USA)

Apoptosis reagents

FITC-conjugated annexin V was provided by BoehringerMannheim (Indianapolis IN USA) PE-conjugated annexinV was provided by BD Biosciences (Bedford MA USA)Tetramethylrhodamine methyl ester (TMRM) was providedby Molecular Probes (Invitrogen Life Technologies) Pacli-taxel (Onco-Tain brand) was from Mayne Pharma (Mel-bourne Australia) cisplatin was from Ebewe Italia Srl(Rome Italy) and doxorubicin was from Sigma-Aldrich

RNAi

si ITGA5 (Hs_ITGA5_5 siRNA) and All Stars Negative ControlsiRNA were purchased from Qiagen (Stanford CA USA)

Primary antibodies

Anti-N-RAS mAb F155 anti-hsp90 mAb F-8 anti-ROCK1 pAbH-85 and anti-actin pAb I-19 were from Santa Cruz Biotech-nology (Santa Cruz CA USA) Anti-PIK3CA (4255) was fromCell Signaling Technology (Danvers MA USA) Anti-ITGA5pAb RM10 was kindly provided by G Tarone (University ofTorino Turin Italy ref 15) Anti-CSF1 mAb M01-1A9 wasfrom Abnova (Taipei Taiwan) and anti--tubulin mAb B5-1-2was from Sigma-Aldrich

Secondary antibodies

Goat anti-mouse and goat anti-rabbit HRP-conjugated IgG werefrom Santa Cruz Biotechnology All antibodies were used at theproducerrsquos suggested concentrations Matrigel used for in vivotumor growth experiments (BD Matrigel Basement MembraneMatrix High Concentration) was from BD Biosciences

1224 Vol 27 March 2013 CIMINO ET ALThe FASEB Journal wwwfasebjorg

Primers

Cloning oligonucleotides employed in this study are listed inTable 1 RT-PCR assays (Qiagen) employed in this study arelisted in Table 2

Plasmid construction and lentiviral infections

Luciferase reporter vectors containing the partial 3=-UTR ofthe indicated miR-148b target genes were generated follow-ing PCR amplification of the 3=-UTR from human cDNA andcloned into the firefly luciferase reporter pMIR-Report vector(Ambion) When indicated the 3=-UTRs were mutagenized atmiR-148b recognition sites using the QuickChange Site-Di-rected Mutagenesis kit (Stratagene Cedar Creek TX USA)according to the manufacturerrsquos instructions The miR-148bsensor was obtained by annealing purifying and cloningshort oligonucleotides containing 3 perfect miR-148b bindingsites into the SpeI and HindIII sites of the pMIR-Report vectorThe human pre-miR-148b sequence (a 306-bp fragment con-taining the pre-miR sequence) was amplified from genomicDNA (MDAMB231) and cloned into pLemiR-tRFP (OpenBiosystems Huntsville AL USA) vector to obtain pLemiR-148b (still containing tRFP) vector The human pre-miR-187sequence (a 251-bp fragment containing the pre-miR se-quence) was amplified from genomic DNA (MDAMB231)

and cloned into pWPT (Addgene Cambridge MA USA)vector to obtain pWPT-miR-187 vector Stable cell lines weregenerated by lentiviral infection Lentiviruses were producedby calcium phosphate transfection of 293T cells with 20 g ofspecific vector together with 15 g packaging (pCMVdR874)and 6 g envelope (pMD2G-VSVG) plasmids according toD Tronorsquos laboratory protocol (Eacutecole Polytechnique Feacute-deacuterale de Lausanne Lausanne Switzerland httptronolabepflch) Supernatant was harvested 48 h post-transfectionfiltered with 045-m filters diluted and used to infect 35 105 cells in 6-well plates in presence of 8 gml Polybrene(Sigma-Aldrich) ITGA5 overexepression was obtained bytransfecting pEGFP-N3-ITGA5 expression vector (plasmid15238 Addgene ref 16)

RNA isolation from tissues or cells

After surgical removal tumor samples were macrodissectedby pathologists quickly frozen and stored at 80degC TotalRNA was isolated with Concert cytoplasmic RNA reagent(Invitrogen Life Technologies) from 20 to 50 mg tumortissues according to the manufacturerrsquos guidelines Frozentumors were then homogenized using a ball mill (MM200Retsch Duumlsseldorf Germany) The suspension was centri-fuged at 14000 g for 5 min at 4degC and then lysed with 01 mlof 10 SDS followed by 03 ml of 5 M sodium chloride and

TABLE 1 Cloning oligonucleotides employed in this study

Primer ID Sequence 5= iexcl 3=

miR-148b_forw (miR-148b overexpression) TTTCATAGGCACCACTCACTTTACmiR-148b_rev (miR-148b overexpression) CCCTTTCCCCTTACTCTCCAmiR-187_forw (miR-187 overexpression) GTCGAGTCCCTCAGGACAAGmiR-187_rev (miR-187 overexpression) TTAGGCTGAACGACACGTAGmiR-148b_sensor_forw (luciferase miR-148b sensor) CTAGTCCACTGCCTGTCTGTGCCTGCTGTCGTAGGATCTACTG

CCTGTCTGTGCCTGCTGTTGGACCTGACACTGCCTGTCTGTGCCTGCTGTCCCA

miR-148b_sensor_rev (luciferase miR-148b sensor) AGCTTGGGACAGCAGGCACAGACAGGCAGTGTCAGGTCCAACAGCAGGCACAGACAGGCAGTAGATCCTACGACAGCAGGCACAGACAGGCAGTGGA

ROCK1-3=UTR_forw (ROCK1 3=-UTR cloning) GCACTAGTGTTCCATCTTCGGACGTTGAROCK1-3=UTR_rev (ROCK1 3=-UTR cloning) ATACGCGTCTTCAACAGACCATGCTCCCITGA5-3=UTR_forw (ITGA5 3=-UTR cloning) ATACTAGTAGGCTGACCGACGACTACTGITGA5-3=UTR_rev (ITGA5 3=-UTR cloning) TAACGCGTTTTTGCATACAAACTGGGAGCPIK3CA-3=UTR_forw (PIK3CA 3=-UTR cloning) CTCGACTAGTATGATGCTTGGCTCTGGAATPIK3CA-3=UTR_rev (PIK3CA 3=-UTR cloning) CTCGACGCGTATGCTGTTCATGGATTGTGCCSF1-3=UTR_forw (CSF1 3=-UTR cloning) CTCGACTAGTTGGACGCACAGAACAGTCTCCSF1-3=UTR_rev (CSF1 3=-UTR cloning) CTCGACGCGTTGTTCAGCAGGCAGGTACAGNRAS-3=UTR_forw (NRAS 3=-UTR cloning) CTCGACTAGTTAAGTTTTGTCAGAAAAGAGCCACNRAS-3=UTR_rev (NRAS 3=-UTR cloning) CTCGACGCGTCAAAACAGGCCTCTGGAAAAITGA5-3=UTR-mut-site a_forw (ITGA5 3=-UTR mutagenesis) CTGGGGATCCCTCCCCCCCACGTATTATGAAGGACCCTTGTTTAITGA5-3=UTR-mut-site a_rev (ITGA5 3=-UTR mutagenesis) TAAACAAGGGTCCTTCATAATACGTGGGGGGGAGGGATCCCCAGITGA5-3=UTR-mut-site b_forw (ITGA5 3=-UTR mutagenesis) GGGTTCTGCCTGCCAGCCGTAATTATGCTGCCCCTCATCTCITGA5-3=UTR-mut-site b_rev (ITGA5 3=-UTR mutagenesis) GAGATGAGGGGCAGCATAATTACGGCTGGCAGGCAGAACCCROCK1-3=UTR-del_forw (ROCK1 3=-UTR mutagenesis) CATTAAGTTAACAAACATATAAGAAATGTATGTTTGAAATGTA

AATTATTCTTAGAACACTTTCROCK1-3=UTR-del_rev (ROCK1 3=-UTR mutagenesis) GAAAGTGTTCTAAGAATAATTTACATTTCAAACATACATTTCT

TATATGTTTGTTAACTTAATGPIK3CA-3=UTR-mut_forw (PIK3CA 3=-UTR mutagenesis) GCTCACTCTGGATTCCACACGGTACGGTTAATAACTCTCAGCAGGCPIK3CA-3=UTR-mut_rev (PIK3CA 3=-UTR mutagenesis) GCCTGCTGAGAGTTATTAACCGTACCGTGTGGAATCCAGAGTGAGCNRAS-3=UTR-del_forw (NRAS 3=-UTR mutagenesis) GCCACTTTCAAGCTGTGACACCCTGGTCCTNRAS-3=UTR-del_rev (NRAS 3=-UTR mutagenesis) AGGACCAGGGTGTCACAGCTTGAAAGTGGCCSF1-3=UTR-del-site a_forw (CSF1 3=-UTR mutagenesis) GACCTGCTGGTCTGTGACAGCCTGAAGGCSF1-3=UTR-del-site a_rev (CSF1 3=-UTR mutagenesis) CCTTCAGGCTGTCACAGACCAGCAGGTCCSF1-3=UTR-del-site b_forw (CSF1 3=-UTR mutagenesis) CATGAAGGAAGCCATTGTGTGAACACTGTACCTGCSF1-3=UTR-del-site b_rev (CSF1 3=-UTR mutagenesis) CAGGTACAGTGTTCACACAATGGCTTCCTTCATG

1225miR-148b CONTROLS BREAST CANCER PROGRESSION

02 ml of chloroform per milliliter of reagent The lysate wascentrifuged at 14000 g for 15 min at 4degC and the upperaqueous phase was removed and combined with 08 vol ofisopropyl alcohol for 10 min at room temperature Total RNAwas recovered by centrifugation washed with 75 ethanoland finally dissolved in RNase-free water Total RNA fromnormal samples or cells in culture was isolated with TRIzolreagent (Invitrogen Life Technologies) Frozen samples werehomogenized using an Ultra Turax T50 Basic homogenizer(Bioclass Pistoia Italy) and extracted with an acid-phenolchloroform solution according to the manufacturerrsquos guide-lines RNA quantitation was performed using the NanoDrop1000 spectrophotometer (Nanodrop Wilmington DE USA)Total RNA integrity and the percentage content of miRs ineach sample were assessed by capillary electrophoresis usingthe Agilent Bioanalyzer 2100 with the RNA 6000 Nano andthe Small RNA Nano LabChips respectively (Agilent Tech-nologies Palo Alto CA USA) Only total RNA samples withan RNA integrity number (RIN) 6 and 30 of smallRNAs were used for miR microarray analysis

miR and gene expression profilings

The miR and protein-coding expression profilings were car-ried out using the Human MicroRNA Microarray kit (V2 723miRs) and the Whole Human Genome Oligo Microarray(41000 60-mer oligonucleotide probes) respectively bothfrom Agilent Technologies For miR analysis total RNA (200ng) was labeled with pCp-Cy3 according to the Agilentprotocol (17) and probes were hybridized at 55degC for 22 hFor protein-coding investigations total RNA (800 ng) waslabeled by the Agilent One-Color Microarray-Based GeneExpression protocol according to the manufacturerrsquos instruc-tions The synthesized cDNA was transcribed into cRNA andlabeled with Cy3 Labeled cRNA (165 g) was used forhybridization at 65degC for 17 h Slides were scanned on anAgilent microarray scanner Raw miR and gene expressiondata are available in the US National Center for Biotechnol-ogy Information Gene Expression Omnibus (GEO) database(GSE26666 httpwwwncbinlmnihgovgeoqueryacccgitoken_jveltssyquiywvoampacc_GSE26666) Interarray normalizationwas performed with cyclic Lowess for miRs and with quantile forprotein-coding expression profilings (18 19) and the aver-age of replicates was used To perform differential geneexpression analysis the level of each miR was calculated aslog2 of tumor samplemammoplastic reduction median Theidentification of differential expression for miRs or protein-coding genes was performed using the 2-class significanceanalysis of microarray (SAM) algorithm (20) SAM uses a

permutation-based multiple testing algorithm and associates avariable false discovery rate (FDR) to the significant genes FDRrefers to the percentage of error that can occur in the identifi-cation of the statistically significant differentially expressedgenes in multiple comparisons it can be manually adjusted

Statistical analysis of miR and gene expression data

For miRs Feature Extraction software (Agilent Technologies)was used to obtain spot quality measures in order to evaluate thequality and the reliability of the hybridization In particular theflag glsFound (set to 1 if the spot has an intensity valuesignificantly different from the local background 0 otherwise)was used to filter out unreliable probes flag equal to 0 will benoted as not available (NA) So in order to perform a morerobust and unbiased statistical analysis probes with a highproportion of NA values were removed from the dataset NA(40) was used as threshold in the filtering process obtaining atotal of 237 available human miRs Principal component analysis(PCA) cluster analysis and profile similarity searches wereperformed with Multi Experiment Viewer 451 (TMev) of theTM4 Microarray Software Suite (21) All heath maps wereobtained by TMeV software using an unsupervised 2-dimen-sional hierarchical clustering approach with average linkagemethod and Pearson correlation

Statistical analyses of biological samples

Data are presented as means sem or sd and 2-tailedStudentrsquos t test was used for comparison analysis with valuesof P 005 considered to be statistically significant Box andwhisker plots were prepared based on Liu (22) The bottomand top of the box are respectively the first (bottom) andthird (top) quartile the line in the middle corresponds to themedian and circles label outliers

Statistics for survival analysis

Survival association analyses were performed using the SPSS 180statistical software (SPSS Inc Chicago IL USA) and the Biocon-ductor suite of software tools (httpwwwbioconductororg) Thereceiver operating characteristic (ROC) method (23) wasused to categorize samples according to miR or mRNAexpression Kaplan-Meier survival curves were used to esti-mate time-to-event models in the presence of censored casesRisk differences between the two groups were assessed usingthe Mantel-Haenszel log-rank test (24) Survival analysis wascarried out in both univariate and multivariate setting usingCoxrsquos proportional hazard model (25) ITGA5 survival asso-ciation was evaluated in GSE2034 (26) gene expressionvalues were calculated as described previously (27) andresults were divided into two categories according to geneexpression levels

Analysis of human breast cancer data sets

Blenkiron et al (8) and Enerly et al (9) miR expression valuesand sample phenodata were obtained from GSE7842 andGSE19536 respectively and from the supplemental materialsof the publications

Target prediction and pathway analysis

The TargetScan 51 algorithm (28) was used to predict miRtargets The Ingenuity Pathways Knowledge Base (httpwwwingenuitycom) is currently the worldrsquos largest databaseof knowledge on biological networks with annotations orga-

TABLE 2 RT-PCR assays employed in this study

Primer ID Assay ID

COPZ1 QT00087024CSF1 QT00035224CTSA QT00087381CXCL5 QT00203686DYRK2 QT01011073GRB2 QT00065289ITGA5 QT00080871MMP15 QT00014063NRAS QT00076874NRP1 QT00023009PIK3CA QT00014861ROCK1 QT00034972RRN18S QT00199367


nized by experts We exploited this database to look forenrichments in specific pathways among the relapse (or othercategory)-associated miR putative targets Enrichment signif-icance in pathways analysis is shown as the negative log10 ofthe P value The P value is calculated with the right-tailedFisherrsquos exact test Ingenuity networks are scored based onthe number of network eligible molecules they contain Thenetwork score is based on the hypergeometric distributionand is calculated with the right-tailed Fisherrsquos exact test Thescore is the negative log of this P value

Additional cell transfections and infections qRT-PCRsapoptosis luciferase assays protein preparation immuno-blotting and in vitro and in vivo biological studies were allperformed as indicated in detail in Penna et al (12)

RESULTS

Sixteen relapse-associated miRs classify breast tumors

In a retrospective study we analyzed miR expression in77 primary human breast ductal tumors as well as 17mammoplastic reductions (Table 3) using microarrays(a 723-miR platform) and a 2-class SAM In particularwhen we compared patients with relapse (n41) orwithout relapse (n36) within 72 mo from surgery16 differentially expressed miRs were identified andexpressed as fold changes or levels relative to themedian of the healthy controls log2 tumorscontrols(Fig 1) Within relapsingnonrelapsing patients vali-dation of microarray data was performed by qRT-PCRanalysis for miR-148b miR-365 and miR-10a using n 10group (not shown) By using the 16 relapse-associ-ated miRs together as a whole (as a group) we identi-fied two groups of patients with different overall sur-vival (OS P0018) and disease-free survival (DFSP0016) independent of the lymph node status (Coxproportional-hazards regression model P0015) inour study The same was found when certain individualspecific miRs were used for instance miR-148b down-regulated in relapsing tumors (OS P0027 DFSP0036) However a correlation with survival was notfound when our 16 relapse-associated miRs were usedas a whole for two other available public datasets (8 9)These studies refer to 100 patients each the primarytumors were used to measure mRNA and miR expres-sion with the goal of identifying tumor subtypes Nota-bly in these datasets our group of 16 relapse-associatedmiRs could identify tumor subtypes and separate moreaggressive (ERBB2 or basal-like) vs less aggressive (luminalAB) cancers (Fig 1C compare solid vs shaded sym-bols) based on the breast cancer classification in Sorlieet al (4) Moreover our 16-miR signature could alsopredict survival in our cohort when only luminaltumors (n53) were considered (DFS P00097) Inaddition some of the 16 miRs such as miR10a miR-101 miR-142-5p miR-148b miR-342-3p miR-342-5pmiR-365 and miR-551b could distinguish tumor sub-types individually (8 9 and data not shown) In sum-mary we identified 16 relapse-associated miRs thatcould be used in the clinics to identify tumor subtypesand to predict disease outcome

miR-148b impairs tumor growth and suppressesmetastasis formation by altering extravasationand survival

A detailed bioinformatics analysis was carried out forthe putative targets of the 16 relapse-associated miRs aspredicted by TargetScan 51 using Ingenuity PathwayAnalysis (IPA) in order to identify pathways and func-tions in which each miR was involved This analysistogether with literature searches let us to conclude thatmiR-148b has the potential to coordinate a very highnumber of pathways relevant for breast cancer and thatits function has still to be elucidated With this in mindwe investigated the biological role of miR-148b in

TABLE 3 Clinical characteristics of the patients summary

Characteristic Value

Tumor samples

Patients (n) 77Age (yr)

Median 54Range 25ndash82

Tumor stage (n)1 20 2602 51 6623 3 394 3 39

Tumor grade (n)1 4 522 35 4543 33 428Unknown 5 65

LN (n)Positive 44 571Negative 33 429

ER (n)a

Positive 53 688Negative 24 312

PR (n)a


Subtype (n)b

Luminal 53 680ERBB2b 14 180Basal 10 120

Relapse 72 mo (n)Yes 41 532

ER 25 61c

ER 16 39c

No 36 467ER 28 78c

ER 8 22c

Normal samples

Patients (n) 17Age (yr) 13


n number LN lymph node status ER estrogen receptor statusPR progesterone receptor status aER and PR are defined positivewhen tumors contain 10 fmol receptorsmg proteins or 10positive tumor cells bSamples were classified according to ERBB2mRNA level combined to ER and PR status cPercentage refers to thetotal of relapsing or nonrelapsing samples


neoplasia by modulating (up or down) its expression inMDAMB231 4175TGL 4T1 T47D and MCF7 mam-mary tumor cell lines with a different level of malig-nancy (independently of ER PR and ERBB2 expres-sion) and of miR-148b as measured by qRT-PCR(Supplemental Fig S1A) Transient modulations wereobtained using miR-148b precursors or inhibitors ornegative controls (pre-miR-148b anti-miR-148b or pre-control or anticontrol) and evaluated 48 or 72 hpost-transfection for expression and biology (Supple-mental Fig S1B C) Instead for stable expression cellswere transduced with pLemiR-empty or pLemiR-148boverexpressing lentivirus vectors and selected with pu-romycin as pools expression evaluation is shown inSupplemental Fig S1C

In vitro proliferation was not affected or only slightlymodulated up to 4 d for MDAMB231 4175TGL and4T1 cells in stable or transient conditions (Supplemen-tal Fig S2A and data not shown) However tumorsderived from transduced pLemiR-148b 4175TGL cellsgrew significantly less compared to controls (pLemiR-EV) when analyzed up to 12 d following injection in thefat pad of immunocompromised NODSCID IL2Rnull

mice (see below) When invasion through fibronectinor Matrigel was evaluated by transwell assays for thesame cell lines reduced cell movement was observed inthe presence of miR-148b overexpression compared to

controls (Supplemental Fig S2B and data not shown)However no effect was observed when cells were trans-duced with pWPT-miR-187 (negative control) lentivirusoverexpression vectors compared to controls (pWPT-EV orprecontrol Supplemental Fig S2B and data notshown) Instead increased cell invasion was observedwhen miR-214 was overexpressed in these cells (Sup-plemental Fig S2B ref 12 and data not shown) Whencell adhesion was investigated increased adhesion onfibronectin and collagen IV was found for MDAMB231cells overexpressing miR-148b compared to controlsConversely down-modulation of miR-148b in MCF7and T47D cells led to decreased adhesion (Supplemen-tal Fig S2C)

To study the role of miR-148b in in vivo metastasisformation we injected miR-148b-overexpressing (pre-miR-148b) 4T1 cells into the tail vein of female BALBcsyngeneic mice and analyzed dissemination in lungs Asignificant reduction in the number of lung colonies orarea occupied by the lesions was found 5 d postinjec-tion compared with controls as measured in hematox-ylin and eosin (HampE)-stained sections (Fig 2A) Morerelevantly when red fluorescent pLemiR-148b-trans-duced 4175TGL cells were injected orthotopically intoNODSCIDIL2Rnull mice and primary tumors formed astriking reduction of malignant cell dissemination fromthe primary tumors to the lungs was observed com-

Figure 1 Expression of 16 miRs in relapse-positive (R) or relapse-negative (R) primary cancers and tumor subtypeidentification A) Clustering (Pearson correlation average linkage) for the 16 most modulated miRs considering relapsing(n41) vs nonrelapsing (n36) tumors Heatmap represents relative miR levels with reference to the median expression acrossall samples rows miR columns tumors B) Summary (left panel) and graph (right panel) showing the levels of expression ofthe 16 most modulated miRs expressed as fold change (FC) of relapsingnonrelapsing median values (left panel) or averagedlevels (log2) in R or R tumor samples vs mammoplastic reductions (controls) Two-class SAM FDR 16 C) PCA plots fortumor subtypes using all 16 miRs in Blenkiron et al (8) and Enerly et al (9) datasets Basal_like basal ERBB2 ERBB2 positiveLum_A luminal A Lum_B luminal B normal_like normal-like breast cancer


pared to controls (Fig 2B) Quantitations refer to thered fluorescent metastatic foci (numberarea) in thelungs at 12 d postinjection (Fig 2B) HampE sections areshown (Fig 2B) Similar results were obtained withpLemiR-148b-transduced 4T1 cells (not shown) Nota-bly when similar experiments were previously per-formed with miR-214-overexpressing 4T1 cells in-creased dissemination was observed (12)

Based on this we assessed the involvement of miR-148b in extravasation and survival in the blood circula-tion two essential steps of the metastatic dissemination

To investigate extravasation in vivo red fluorescentpLemiR-148b-transduced MDAMB231 cells were in-jected into the tail vein of immunocompromised miceand cell seeding and extravasation in the lung wereevaluated at 2 or 48 h postinjection A high percentageof cells lodged in the lung at 2 h (within the vessels oroutside) in the presence or absence of miR-148bHowever extravasation was highly reduced for miR-148b-overexpressing cells compared to controls asquantitation of the area occupied by metastatic cellsshowed (Fig 2C D) Vessels were labeled for CD31

Figure 2 miR-148b impairs metastasis formation in mice by affecting extravasation and survival A) 4T1 cells transientlytransfected with negative controls (pre-control a) or miR-148b precursors (pre-miR-148b b) were used to evaluate lungcolony formation in BALBc mice at 5 d after tail vein injection B) Alternatively 4175TGL cells stably transduced withpLemiR-EV (a c) or pLemiR-148b (b d) overexpression vectors were injected into the mammary gland fat pad ofNODSCIDIL2Rnull mice and primary tumor growth as well as metastasis formation in the lungs were analyzed at 12 dpostinjection A B) Two independent experiments were performed and results were pooled together (n10 micegroup)and shown as box and whisker plots for primary tumor weights (B) or number (or area) of microscopic colonies (A) ormetastasis (B) in the lungs Tumor cell dissemination was evaluated in HampE-stained sections at d 5 (A) or as fluorescentlesions in the whole lung at d 12 (B) Representative HampE stainings are shown C D) In vivo seedingextravasation assaysfollowing tail vein injections in nude mice of red fluorescent MDAMB231 cells stably transduced with pLemiR-EV orpLemiR-148b overexpression vectors C) Representative fields of lung sections at 2 h (a) or 48 h (b) postinjection stainedfor CD31 (black) and containing red fluorescent MDAMB231 cells (here visible in light gray) No cells were found in thevessels at 48 h D) Left panels red fluorescent cells in the whole lungs at 2 h (a b) or 48 h (c d) postinjection Right panelquantitation of the red fluorescent cells (area) at 48 h for n 8 micegroup E) MDAMB231 cells transfected withmiR-148b precursors or their negative controls (pre-miR-148b or control) were grown in presence or absence (anoikis) ofattachment and without serum for 48 h Percentage of apoptotic cells was evaluated by TMRM and annexinV-FITC stainingin a FACS analysis HighTMRM-LowAnnexinV healthy cells LowTMRM-HighAnnexinV apoptotic cells Three independentexperiments were performed in duplicate pooled quantitations are shown as means sem Scale bars 60 m (A Bc d)2 mm (Ba b D) 120 m (C) P 005 P 001 P 0001


(Fig 2C) To investigate survival in the blood circula-tion we evaluated apoptosis in miR-148b-overexpress-ing MDAMB231 cells kept without serum and with orwithout (anoikis) adhesion for 48 h by cytofluorimetricanalyses and reduced survival was observed comparedto controls (Fig 2E) which suggests a potential role formiR-148b in tumor cell intraluminal viability and initialsurvival All these experiments strongly suggest thatmiR-148b is involved in metastatic cell dissemination bycontrolling tumor growth and cell survival in anoikisbut mostly by inhibiting cell escaping through theendothelial cells of the vessels

miR-148b expression enhances chemotherapy-inducedapoptosis

Considering the relevance of chemotherapy responsefor tumor progression we analyzed the response topaclitaxel doxorubicin and cisplatin following 24 or 48h treatment in miR-148b-overexpressing (MDAMB2314175TGL 4T1) or down-modulated (T47D) cells by cyto-fluorimetric analyses A significant modulation in cellsurvival was found for all cell lines and treatmentscompared to controls (Fig 3) favoring a positive rolefor miR-148b in chemotherapy response

miR-148b modulates multiple genes

To identify genes directly or indirectly modulated bymiR-148b miR-148b-overexpressing MDAMB231 cellswere first used to perform whole human genome geneexpression analysis A total of 129 differentially ex-pressed genes (49 up-regulated 80 down-regulated)were found considering a 15-fold change and a 16FDR (Supplemental Table S1) qRT-PCR analysis wasused to validate expression of the nonmodulatedNRAS ROCK1 PI3KCA COPZ1 GRB2 and CXCL5and of the differentially expressed DYRK2 CSF1CTSA ITGA5 MMP15 and NRP1 (not shown) By

crossing these results with putative miR-148b targets(TargetScan 51) 20 common genes (19 down-regu-lated 1 up-regulated) were found (Fig 4A) amongthem ITGA5 known to modulate apoptosis adhesionmigration and invasion (29 30) and CSF1 involved intumor-stroma interactions (31 32) Using TargetScanpredictions for an IPA GM-CSF and integrin pathwayswere identified as statistically significant (SupplementalFig S3) Therefore we investigated the plausible directregulation of these pathways by miR-148b and theirinvolvement in breast tumor progression Protein ex-pression was evaluated for ITGA5 and its downstreamplayers ROCK1 PI3KCAp110 and NRAS (predictedtargets) and for CSF1 in miR-148b-overexpressingMDAMB231 or 4175TGL cells by Western blot analysisStrong reductions were found compared to controls(Fig 4B) Instead when miR-148b was down-modulatedin MCF7 cells increased levels of ITGA5 proteins wereobserved (Fig 4B) Interestingly ROCK1 PI3KCAp110 and NRAS were not modulated at the mRNAlevel (not shown) Direct modulation of miR-148b onits targets was proven by performing luciferase assays inmiR-148b-overexpressing or control MDAMB231 cellstransfected with reporter vectors containing wild-typeor mutated 3=-UTRs (Fig 4C D) As positive control amiR-148b-sensor construct was used (Fig 4C) Notablywhen we evaluated miR-148b target expression on asubset of relapsingnonrelapsing human tumors dif-ferential expression was found (Fig 5A) Relevantlywhen the 23 predicted and modulated miR-148b targetgenes were used in IPA to look for gene connectionscell-to-cell signaling and interaction tissue develop-ment cellular movement network was identified (Inge-nuity score22 Fig 5B) Given the relevance of theintegrin pathway in our investigations we evaluated thepossibility that the upstream player ITGA5 can be usedto predict survival in a large microarray dataset ofhuman breast tumors (26) Performing hierarchicalclustering and Kaplan-Meier analyses and referring to

Figure 3 miR-148b affects chemotherapy-induced apoptosis MDAMB231 (A) T47D(B) or 4T1 (C) cells transfected with miR-148b precursors or inhibitors or their negativecontrols (pre- and anti-miR-148b or control) or 4175TGL (D) cells stably transducedwith pLemiR-EV or pLemiR-148b overexpression vectors were grown in completemedium with or without paclitaxel or doxorubicin or cisplatin for 24 or 48 hPercentage of apoptotic cells was evaluated by TMRM and annexinV-FITC stainings ina FACS analysis HighTMRM-LowAnnexinV healthy cells LowTMRM-HighAnnexinVapoptotic cells Three independent experiments were performed in duplicate pooledquantitations are shown as means sem ns not significant P 005 P 001


ITGA5 median expression we predicted DFS (Fig 5C)This together with similar results reported previously(33) suggests that repression of ITGA5 correlates withbetter clinical outcome and can be used as a prognosticmarker

Down-modulation of ITGA5 accounts for miR-148bchemotherapy response

The effect of integrin signaling on cell survival andchemotherapy response was evaluated in the absence ofserum and adhesion (anoikis) or in presence of pacli-taxel When ITGA5 was silenced with siRNAs inMDAMB231 cells reduction in cell survival was ob-served in anoikis conditions and for paclitaxel-treatedcells vs controls (Fig 6A) Instead when ITGA5 (cDNAlacking its 3=-UTR) was overexpressed (pEGFP-ITGA5)

together with pre-miR-148b in MDAMB231 or MCF7cells (Fig 6B) and with cells kept in the presence ofpaclitaxel the effect of miR-148b on cell death wasabolished (Fig 3) Figure 6B considers only the differ-ence () observed when comparing the presence orabsence of miR-148b ITGA5 and miR-148b levels wereevaluated by qRT-PCR analysis (Fig 6CndashE) From theseresults we can conclude that ITGA5 directly controlsat least partially miR-148b-driven apoptosis in anoikisconditions and in the presence of paclitaxel

DISCUSSION

In this work we identified a group of 16 miRs that areassociated with bad prognosis in our breast cancer

Figure 4 miR-148b modulates multiple genes MDAMB231 or MCF7 cells transfected with miR-148b precursors or inhibitors or theirnegative controls (pre- and anti-miR-148b or pre- and anti-control) analyzed at 48 or 72 h post-transfection or 4175TGL cells stablytransduced with pLemiR-EV or pLemiR-148b overexpression vectors were used to perform microarray analysis (A) Western blots (B) orluciferase assays (C) A) Clustering (Pearson correlation average linkage) was performed for 20 putative miR-148b targets Heatmaprepresents relative gene expression with reference to the median across all samples row protein-coding gene column cell preparation B)Western blot (WB) analysis was performed for 5 putative miR-148b targets ITGA5 ROCK1 p110 (PIK3CA) NRAS and CSF1 Proteinexpression was calculated relative to controls following miR-148b overexpression or down-modulation normalized on the indicated loadingcontrols (hsp90actintubulin) and expressed as repression percentages C D) Luciferase assays (C) in cells transfected with reporterconstructs containing wild-type or mutant 3=-UTRs (D) for the indicated genes or a synthetic sequence including 3 perfect miR-148b bindingsites (sensor) Results are shown as means sem of firefly luciferase activity relative to controls normalized on Renilla luciferase activity mutmutation del deletion ab a and b binding sites ns not significant Three independent experiments were performed with independentprotein (WB and luciferase) or RNA preparations Representative results are shown in B results are pooled in C P 005 P 001


patient cohort and we revealed the function ofmiR-148b as a metastasis suppressor in mice as wellas its molecular mechanism of action The identifi-cation of a group of miRs that could identify primarytumor subtypes is highly relevant for the clinics Infact it represents a potent molecular tool that clini-cians can use at the time of surgery to attempt themost appropriate therapy for every patient Thestrength of this tool is further marked by the fact thatsingle components of the signature for instancemiR-148b can predict tumor outcome individuallyRelevantly low levels of miR-148b were observedpreviously in basal-like (9) and ERBB2ERPR

(34) breast tumors which suggests its involvement inmalignancy

Our functional experiments with metastatic cellsstrongly suggest that miR-148b exerts its metastasis-

suppressing role mostly by controlling cell move-ment In fact while it is true that ectopic expressionof miR-148b in malignant tumor cells leads to de-creased tumor growth this effect is modest and notsufficient to justify the much more pronouncedcontrol of metastasis dissemination On this lineincreased miR-148b levels lead to stronger adhesionand anoikis and reduce invasion in vitro Moreover invivo miR-148b strongly reduces extravasation andlung colonization shortly after injection of the cellsin the blood circulation when proliferation has notime to play a major role Overall it is well acceptedthat miRs have pleiotropic functions and thereforecan act in independent events such as tumor forma-tion and progression via the activationrepressionof a selective and rate-limiting cascade of specificgenes (8 35ndash37)

Figure 5 Analysis of miR-148b-modulated genes in human tumors andby IPA A) Proteins were extracted from relapsing or nonrelapsingprimary breast tumors and Western blot (WB) analysis was performedfor the direct miR-148b targets ITGA5 ROCK1 PIK3CA NRAS andCSF1 miR-148b expression is indicated as low (L) or high (H)according to previous microarray andor qRT-PCR analyses -Tubulinor actin was used as loading control B) Twenty miR-148b down-modulated genes identified in the microarray analysis (Fig 4A) plus the3 direct targets ROCK1 PIK3CA and NRAS were used to perform anIPA searching for gene connections the cell-to-cell signaling andinteraction tissue development cellular movement functional networkwas generated Ingenuity score log10 P 22 Gene products arerepresented as nodes and biological relationships between two nodes asa line Continuous lines indicate direct interactions dashed linesrepresent indirect connections Shapes of nodes symbolize functional

classes of gene products (see legend in panel) Gray symbols indicate down-regulation white symbols indicate genes absentin the input but related with the dataset used C) Kaplan-Meier analyses of the probability of DFS of breast cancer patientsbased on ITGA5 expression (median) in Wang et al (26) dataset for 286 breast tumor samples P value was calculated usingthe log-rank test


Among all the miR-148b-modulated genes identifiedin this study many are known to be relevant in tumorprogression among them CTSA NRP1 CSF1 MMP15and ITGA5 all suppressed by miR-148b By focusing onthe ITGA5 signaling we found that not only ITGA5 butalso ROCK1 PIK3CAp110 and NRAS are directlydown-regulated by miR-148b which suggests a specificcontrol for this miR on a pathway known to be involvedin metastasis dissemination and chemotherapy re-sponse In fact ITGA5 and ROCK1 were found previ-ously to be highly expressed in malignant breast tumorsand are known to increase tumor growth or progres-sion (33 38ndash42) At the same time PIK3CAp110 isrelevant for mammary tumorigenesis and angiogenesis(43) as well as for resistance to endocrine or anti-HER2therapies (44 45) In addition NRAS is a well-knownoncogene and its silencing in tumor cells leads toincreased apoptosis (46) Regarding chemotherapy re-sponse elevated levels and activity of 5131 have previ-ously been implicated in drug resistance (47) andinhibition of 5131fibronectin interactions promotesapoptosis in malignant cells and enhances radiationeffects (33) In addition perturbations of the actincytoskeleton integrity via ROCK1 inhibition commitcells to apoptosis (48) Remarkably ITGA5 and itsdownstream player RHOA a ROCK activator have

been previously found to be suppressed by miR-31another small noncoding RNA that suppresses metastasis(36) In addition ROCK1 and RHOC are also directlytargeted by two other miRs involved in tumor progres-sion miR-146ab and miR-10b (49 50) The fact thatCSF1 is also a direct target of miR-148b opens up a rolefor this small RNA in tumor-stroma cell interactionswhich will be part of a future study In summary ourstudy unravels the association of a group of 16 miRswith bad prognosis tumors and identifies miR-148b as asuppressor of tumor progression and modulator ofchemotherapy response acting via the integrin

This work was supported by grants from the University ofTorino (Local Research Funding 2007 and 2008 DT)Compagnia-San-Paolo (20081054 DT) Programma di Ricerca diRilevante Interesse Nazionale (PRIN 2008 DT and PRIN 2009MDB) Associazione Italiana Ricerca Cancro (AIRC 2008-IG-6014 GL 2009-IG-9408 PP 2010-IG-10104 DT) and Fondoper gli Investimenti della Ricerca di Base (FIRB-giovani2008RBFR08F2FS-002 FO) FO and DC were fellows of theRegione Piemonte The authors thank PP Pandolfi forhelpful discussions V Poli and E Hirsch for critical readingof the manuscript J Massaguegrave (Memorial Sloan-KetteringCancer Center New York NY USA) and L Primo and PCircosta (University of Torino Turin Italy) for providing celllines A R Elia for the FACS analysis A Mana for performing

Figure 6 miR-148b-mediated down-modulationof ITGA5 leads to increased chemotherapy-in-duced apoptosis A) Basal or anoikis- or pacli-taxel-induced apoptosis was evaluated inMDAMB231 cells transiently transfectedwith ITGA5-targeting or negative controlsiRNAs (si ITGA5 or control) B) Alterna-tively MDAMB231 or MCF7 cells were firsttransfected with miR-148b precursors ortheir negative controls (pre-miR-148b orpre-control) and then transfected again (24h later) with empty EGFP or EGFP-ITGA5-overexpressing vectors No 3=-UTR is pres-ent for ITGA5 cDNA Then cells weretreated with paclitaxel and apoptosis wasevaluated 48 h later Cell death was mea-sured by TMRM and annexinV-FITC (A) or

AnnexinV-PE stainings (B) by FACS analysis A) HighTMRM-LowAnnexinV healthy cells LowTMRM-HighAnnexinV apoptoticcells B) LowAnnexinV healthy cells HighAnnexinV apoptotic cells Two or 3 independent experiments were performed induplicate pooled quantitations are shown as means sd CndashE) qRT-PCR analyses were performed to evaluate ITGA5mRNA or miR-148b expression for the cells shown in A and B Two independent experiments were performed in triplicateand a representative one is shown ns not significant P 005 P 001


some experiments L Fuso G M Milano F Maggiorottoand C Robba for the patient datasets and A F Horwitz(University of Illinois Urbana-Champaign IL USA via Add-gene Cambridge MA USA) for the 15238 plasmid Theauthors declare no conflicts of interest

REFERENCES

1 Liu S Clouthier S G and Wicha M S Role of microRNAs inthe regulation of breast cancer stem cells J Mammary Gland BiolNeoplasia 17 15ndash21

2 Dunnwald L K Rossing M A and Li C I (2007) Hormonereceptor status tumor characteristics and prognosis a prospec-tive cohort of breast cancer patients Breast Cancer Res 9 R6

3 Colozza M Cardoso F Sotiriou C Larsimont D andPiccart M J (2005) Bringing molecular prognosis and predic-tion to the clinic Clin Breast Cancer 6 61ndash76

4 Sorlie T Perou C M Tibshirani R Aas T Geisler SJohnsen H Hastie T Eisen M B van de Rijn M JeffreyS S Thorsen T Quist H Matese J C Brown P OBotstein D Eystein Lonning P and Borresen-Dale A L(2001) Gene expression patterns of breast carcinomas distin-guish tumor subclasses with clinical implications Proc NatlAcad Sci U S A 98 10869ndash10874

5 Sotiriou C and Piccart M J (2007) Taking gene-expressionprofiling to the clinic when will molecular signatures becomerelevant to patient care Nat Rev Cancer 7 545ndash553

6 Bartel D P (2009) MicroRNAs target recognition and regula-tory functions Cell 136 215ndash233

7 Lu J Getz G Miska E A Alvarez-Saavedra E Lamb J PeckD Sweet-Cordero A Ebert B L Mak R H Ferrando A ADowning J R Jacks T Horvitz H R and Golub T R (2005)MicroRNA expression profiles classify human cancers Nature435 834ndash838

8 Blenkiron C Goldstein L D Thorne N P Spiteri I ChinS F Dunning M J Barbosa-Morais N L Teschendorff A EGreen A R Ellis I O Tavare S Caldas C and Miska E A(2007) MicroRNA expression profiling of human breast canceridentifies new markers of tumor subtype Genome Biol 8 R214

9 Enerly E Steinfeld I Kleivi K Leivonen S K Aure M RRussnes H G Ronneberg J A Johnsen H Navon RRodland E Makela R Naume B Perala M Kallioniemi OKristensen V N Yakhini Z and Borresen-Dale A L miRNA-mRNA integrated analysis reveals roles for miRNAs in primarybreast tumors PLoS One 6 e16915

10 Shi M Liu D Duan H Shen B and Guo N Metastasis-related miRNAs active players in breast cancer invasion andmetastasis Cancer Metastasis Rev 29 785ndash799

11 Le X F Merchant O Bast R C and Calin G A The rolesof MicroRNAs in the cancer invasion-metastasis cascade CancerMicroenviron 3 137ndash147

12 Penna E Orso F Cimino D Tenaglia E Lembo AQuaglino E Poliseno L Haimovic A Osella-Abate S DePitta C Pinatel E Stadler M B Provero P Bernengo M GOsman I and Taverna D microRNA-214 contributes to mel-anoma tumour progression through suppression of TFAP2CEMBO J 30 1990ndash2007

13 Minn A J Kang Y Serganova I Gupta G P Giri D DDoubrovin M Ponomarev V Gerald W L Blasberg R andMassague J (2005) Distinct organ-specific metastatic potentialof individual breast cancer cells and primary tumors J ClinInvest 115 44ndash55

14 Simpson J F Gray R Dressler L G Cobau C D FalksonC I Gilchrist K W Pandya K J Page D L and Robert N J(2000) Prognostic value of histologic grade and proliferativeactivity in axillary node-positive breast cancer results from theEastern Cooperative Oncology Group Companion Study EST4189 J Clin Oncol 18 2059ndash2069

15 Tarone G Russo M A Hirsch E Odorisio T Altruda FSilengo L and Siracusa G (1993) Expression of beta 1integrin complexes on the surface of unfertilized mouse oocyteDevelopment 117 1369ndash1375

16 Laukaitis C M Webb D J Donais K and Horwitz A F(2001) Differential dynamics of alpha 5 integrin paxillin and

alpha-actinin during formation and disassembly of adhesions inmigrating cells J Cell Biol 153 1427ndash1440

17 Wang X Tian W and Li Y (2008) Development of anefficient protocol of RNA isolation from recalcitrant tree tissuesMol Biotechnol 38 57ndash64

18 Bolstad B M Irizarry R A Astrand M and Speed T P(2003) A comparison of normalization methods for high densityoligonucleotide array data based on variance and bias Bioinfor-matics 19 185ndash193

19 Risso D Massa M S Chiogna M and Romualdi C (2009) Amodified LOESS normalization applied to microRNA arrays acomparative evaluation Bioinformatics 25 2685ndash2691

20 Tibshirani R Hastie T Narasimhan B and Chu G (2002)Diagnosis of multiple cancer types by shrunken centroids ofgene expression Proc Natl Acad Sci U S A 99 6567ndash6572

21 Saeed A I Bhagabati N K Braisted J C Liang W SharovV Howe E A Li J Thiagarajan M White J A andQuackenbush J (2006) TM4 microarray software suite MethodsEnzymol 411 134ndash193

22 Liu Y (2008) Box plots use and interpretation Transfusion 482279ndash2280

23 Zweig M H and Campbell G (1993) Receiver-operatingcharacteristic (ROC) plots a fundamental evaluation tool inclinical medicine Clin Chem 39 561ndash577

24 Mantel N (1966) Evaluation of survival data and two new rankorder statistics arising in its consideration Cancer Chemother Rep50 163ndash170

25 Gill R (1982) Understanding Coxrsquos regression model ExperSuppl 41 187ndash199

26 Wang Y Klijn J G Zhang Y Sieuwerts A M Look M PYang F Talantov D Timmermans M Meijer-van GelderM E Yu J Jatkoe T Berns E M Atkins D and FoekensJ A (2005) Gene-expression profiles to predict distant metas-tasis of lymph-node-negative primary breast cancer Lancet 365671ndash679

27 Damasco C Lembo A Somma M P Gatti M Di Cunto Fand Provero P A signature inferred from Drosophila mitoticgenes predicts survival of breast cancer patients PLoS One 6e14737

28 Lewis B P Burge C B and Bartel D P (2005) Conservedseed pairing often flanked by adenosines indicates that thou-sands of human genes are microRNA targets Cell 120 15ndash20

29 Mierke C T Frey B Fellner M Herrmann M and Fabry BIntegrin alpha5beta1 facilitates cancer cell invasion throughenhanced contractile forces J Cell Sci 124 369ndash383

30 Desgrosellier J S and Cheresh D A Integrins in cancerbiological implications and therapeutic opportunities Nat RevCancer 10 9ndash22

31 Abraham D Zins K Sioud M Lucas T Schafer R StanleyE R and Aharinejad S Stromal cell-derived CSF-1 blockadeprolongs xenograft survival of CSF-1-negative neuroblastomaInt J Cancer 126 1339ndash1352

32 Aharinejad S Paulus P Sioud M Hofmann M Zins KSchafer R Stanley E R and Abraham D (2004) Colony-stimulating factor-1 blockade by antisense oligonucleotides andsmall interfering RNAs suppresses growth of human mammarytumor xenografts in mice Cancer Res 64 5378ndash5384

33 Nam J M Chung Y Hsu H C and Park C C (2009) beta1integrin targeting to enhance radiation therapy Int J RadiatBiol 85 923ndash928

34 Mattie M D Benz C C Bowers J Sensinger K Wong LScott G K Fedele V Ginzinger D Getts R and Haqq C(2006) Optimized high-throughput microRNA expression pro-filing provides novel biomarker assessment of clinical prostateand breast cancer biopsies Mol Cancer 5 24

35 Ma L and Weinberg R A (2008) Micromanagers of malig-nancy role of microRNAs in regulating metastasis Trends Genet24 448ndash456

36 Valastyan S Chang A Benaich N Reinhardt F and Wein-berg R A Concurrent suppression of integrin alpha5 radixinand RhoA phenocopies the effects of miR-31 on metastasisCancer Res 70 5147ndash5154

37 Tavazoie S F Alarcon C Oskarsson T Padua D Wang QBos P D Gerald W L and Massague J (2008) Endogenoushuman microRNAs that suppress breast cancer metastasis Na-ture 451 147ndash152


38 Valastyan S Benaich N Chang A Reinhardt F and Wein-berg R A (2009) Concomitant suppression of three targetgenes can explain the impact of a microRNA on metastasisGenes Dev 23 2592ndash2597

39 Taverna D and Hynes R O (2001) Reduced blood vesselformation and tumor growth in alpha5-integrin-negative terato-carcinomas and embryoid bodies Cancer Res 61 5255ndash5261

40 Liu S Goldstein R H Scepansky E M and Rosenblatt M(2009) Inhibition of rho-associated kinase signaling preventsbreast cancer metastasis to human bone Cancer Res 69 8742ndash8751

41 Lane J Martin T A Watkins G Mansel R E and JiangW G (2008) The expression and prognostic value of ROCK Iand ROCK II and their role in human breast cancer Int JOncol 33 585ndash593

42 Zheng B Liang L Wang C Huang S Cao X Zha R LiuL Jia D Tian Q Wu J Ye Y W Wang Q Long Z ZhouY Du C He X and Shi Y MicroRNA-148a suppresses tumorcell invasion and metastasis by downregulating ROCK1 ingastric cancer Clin Cancer Res 17 7574ndash7583

43 Renner O Blanco-Aparicio C Grassow M Canamero MLeal J F and Carnero A (2008) Activation of phosphatidyl-inositol 3-kinase by membrane localization of p110alpha predis-poses mammary glands to neoplastic transformation Cancer Res68 9643ndash9653

44 Eichhorn P J Gili M Scaltriti M Serra V Guzman MNijkamp W Beijersbergen R L Valero V Seoane J Ber-nards R and Baselga J (2008) Phosphatidylinositol 3-kinase

hyperactivation results in lapatinib resistance that is reversed bythe mTORphosphatidylinositol 3-kinase inhibitor NVP-BEZ235 Cancer Res 68 9221ndash9230

45 Miller T W Hennessy B T Gonzalez-Angulo A M FoxE M Mills G B Chen H Higham C Garcia-Echeverriav CShyr Y and Arteaga C L Hyperactivation of phosphatidylino-sitol-3 kinase promotes escape from hormone dependence inestrogen receptor-positive human breast cancer J Clin Invest120 2406ndash2413

46 Eskandarpour M Kiaii S Zhu C Castro J Sakko A J andHansson J (2005) Suppression of oncogenic NRAS by RNAinterference induces apoptosis of human melanoma cells Int JCancer 115 65ndash73

47 Nista A Leonetti C Bernardini G Mattioni M and San-toni A (1997) Functional role of alpha4beta1 and alpha5beta1integrin fibronectin receptors expressed on adriamycin-resis-tant MCF-7 human mammary carcinoma cells Int J Cancer 72133ndash141

48 Shi J and Wei L (2007) Rho kinase in the regulation of celldeath and survival Arch Immunol Ther Exp (Warsz) 55 61ndash75

49 Lin S L Chiang A Chang D and Ying S Y (2008) Loss ofmir-146a function in hormone-refractory prostate cancer RNA14 417ndash424

50 Ma L Teruya-Feldstein J and Weinberg R A (2007) Tu-mour invasion and metastasis initiated by microRNA-10b inbreast cancer Nature 449 682ndash688

Received for publication July 25 2012Accepted for publication November 13 2012


MicroRNAs (miRs) are new players involved in theestablishment and progression of human tumors thatappear to be critical biomarkers of cancer with strongclassification power miRs are a class of small noncod-ing RNAs that negatively regulate protein-coding geneexpression post-transcriptionally by targeting mRNAsmostly at the 3= untranslated region (3=-UTR) andtriggering either translation repression or RNA degra-dation (6) Investigations for miR levels in humantumors showed that miR expression is altered in cancercompared to normal tissues and these changes canhelp to classify tumors more accurately than mRNAexpression profiles according to developmental lineageand differentiation status (7) Recent studies demon-strated that breast cancers can be classified into specifictumor pathological phenotypes (ER PR proliferationstage metastasis ERBB2) as well as subtypes (luminal Aor B basal-like ERBB2 and normal-like) based onmiR expression profiles (8 9) Thus it seems essentialto combine miR and protein-coding gene expressionanalyses to obtain information for prognosis and can-cer treatment miRs such as let-7 miR-9 miR-10bmiR-21 miR-31 miR-34 miR-126 miR-146 miR-155miR-200 miR-214 miR-221222 miR-373 and 520chave been proven to control tumor dissemination Infact alterations of their expression in breast cancercells profoundly affect tumor dissemination (10ndash12)In our work we investigated the relationship betweenaltered miR expression and breast cancer metastasis byanalyzing miR levels in a cohort of patients with breastcancer grouped based on disease relapse In particularwe investigated the biological function and molecularmechanism of a relapse-associated small noncodingRNA miR-148b

MATERIALS AND METHODS

Cell culture

Human MDAMB231 4175 TGL (13) MCF7 and T47D cellsand mouse 4T1 cells were maintained in standard conditionsDulbeccorsquos modified Eaglersquos medium containing 10 mMGlutamax and 45 mgml glucose(DMEM Glutamax GibcoInvitrogen Life Technologies Carlsbad CA USA) supple-mented with 10 heat-inactivated FCS (Biochrom AG Ber-lin Germany) 1 mM sodium pyruvate 25 mM HEPES (pH74) and 100 mgml gentamicin (all from Gibco)

Patients and samples

Frozen primary invasive ductal breast cancer specimens (77)from 25- to 82-yr-old patients were selected from the TumorBank of the Department of Obstetrics and GynecologyUniversity of Torino (Turin Italy primary surgery 1988ndash2001) for a retrospective study There was no distant metas-tasis at diagnosis (M0) Complete clinical-pathological datawere updated by follow-up for 72 mo (up to 100 mo) Allpatients were treated with radical modified mastectomy orquadrantectomy and axillary dissection plus breast irradia-tion High-risk node-negative and node-positive patients re-ceived adjuvant treatments (generally 6 cycles of CMF 600mgm2 cyclophosphamide 40 mgm2 metotrexate 600

mgm2 5-fluorouracil) andor 20 mg tamoxifen daily for 5 yrin ER cases Patient stage distribution was assessed asprescribed by the Union for International Cancer Control(UICC) clinical staging guidelines and tumor grading wasperformed as described previously (14) As normal breastcontrols 17 frozen mammoplastic reductions were includedin the screening Appropriate ethical approval was obtainedfor this study

Reagents and antibodies

miR precursors and inhibitors

Pre-miR miRNA Precursor MoleculesndashNegative Control 1miRNA precursors hsa-miR-148b (PM10264) (000471) hsa-miR-214 (PM12124) Anti-miR miRNA InhibitorndashNegativeControl 1 and miRNA inhibitor hsa-miR-148b (AM10264)were from Ambion (Austin TX USA)

miR detection

TaqMan miRNA assays hsa-miR-148b (000471) hsa-miR-187(000487) hsa-miR-365 (001020) hsa-miR-10a (000387) hsa-miR-19a (000395) hsa-miR-342-3p (002260) hsa-miR-214(002306) hsa-RNU44 (001094) and U6 snRNA (001973)were from Applied Biosystems (Foster City CA USA)

ECM

Collagen IV and fibronectin were from Sigma-Aldrich (StLouis MO USA)

Apoptosis reagents

FITC-conjugated annexin V was provided by BoehringerMannheim (Indianapolis IN USA) PE-conjugated annexinV was provided by BD Biosciences (Bedford MA USA)Tetramethylrhodamine methyl ester (TMRM) was providedby Molecular Probes (Invitrogen Life Technologies) Pacli-taxel (Onco-Tain brand) was from Mayne Pharma (Mel-bourne Australia) cisplatin was from Ebewe Italia Srl(Rome Italy) and doxorubicin was from Sigma-Aldrich

RNAi

si ITGA5 (Hs_ITGA5_5 siRNA) and All Stars Negative ControlsiRNA were purchased from Qiagen (Stanford CA USA)

Primary antibodies

Anti-N-RAS mAb F155 anti-hsp90 mAb F-8 anti-ROCK1 pAbH-85 and anti-actin pAb I-19 were from Santa Cruz Biotech-nology (Santa Cruz CA USA) Anti-PIK3CA (4255) was fromCell Signaling Technology (Danvers MA USA) Anti-ITGA5pAb RM10 was kindly provided by G Tarone (University ofTorino Turin Italy ref 15) Anti-CSF1 mAb M01-1A9 wasfrom Abnova (Taipei Taiwan) and anti--tubulin mAb B5-1-2was from Sigma-Aldrich

Secondary antibodies

Goat anti-mouse and goat anti-rabbit HRP-conjugated IgG werefrom Santa Cruz Biotechnology All antibodies were used at theproducerrsquos suggested concentrations Matrigel used for in vivotumor growth experiments (BD Matrigel Basement MembraneMatrix High Concentration) was from BD Biosciences


Primers































Primer ID Assay ID





RESULTS







Tumor samples



Tumor stage (n)1 20 2602 51 6623 3 394 3 39



ER (n)a


PR (n)a


Subtype (n)b



ER 25 61c

ER 16 39c

No 36 467ER 28 78c

ER 8 22c

Normal samples





























DISCUSSION


















REFERENCES
























































Primers































Primer ID Assay ID





RESULTS







Tumor samples



Tumor stage (n)1 20 2602 51 6623 3 394 3 39



ER (n)a


PR (n)a


Subtype (n)b



ER 25 61c

ER 16 39c

No 36 467ER 28 78c

ER 8 22c

Normal samples





























DISCUSSION


















REFERENCES







































































Primer ID Assay ID





RESULTS







Tumor samples



Tumor stage (n)1 20 2602 51 6623 3 394 3 39



ER (n)a


PR (n)a


Subtype (n)b



ER 25 61c

ER 16 39c

No 36 467ER 28 78c

ER 8 22c

Normal samples





























DISCUSSION


















REFERENCES


























































RESULTS







Tumor samples



Tumor stage (n)1 20 2602 51 6623 3 394 3 39



ER (n)a


PR (n)a


Subtype (n)b



ER 25 61c

ER 16 39c

No 36 467ER 28 78c

ER 8 22c

Normal samples





























DISCUSSION


















REFERENCES
















































































DISCUSSION


















REFERENCES






































































REFERENCES
























































mir148b is a major coordinator of breast cancer...

Documents