modulation of tgfβ-induced pai -1 expression by changes in

Old Dominion University Old Dominion University

ODU Digital Commons ODU Digital Commons

Theses and Dissertations in Biomedical Sciences College of Sciences

Spring 2006

Modulation of TGFβ-Induced PAI -1 Expression by Changes in Modulation of TGF -Induced PAI -1 Expression by Changes in

Actin Polymerization in Human Mesangial Cells Actin Polymerization in Human Mesangial Cells

Keyur Patel Old Dominion University

Follow this and additional works at: https://digitalcommons.odu.edu/biomedicalsciences_etds

Part of the Cell Biology Commons, and the Molecular Biology Commons

Recommended Citation Recommended Citation Patel, Keyur. "Modulation of TGFβ-Induced PAI -1 Expression by Changes in Actin Polymerization in Human Mesangial Cells" (2006). Doctor of Philosophy (PhD), Dissertation, , Old Dominion University, DOI: 10.25777/x7yh-d092 https://digitalcommons.odu.edu/biomedicalsciences_etds/69

This Dissertation is brought to you for free and open access by the College of Sciences at ODU Digital Commons. It has been accepted for inclusion in Theses and Dissertations in Biomedical Sciences by an authorized administrator of ODU Digital Commons. For more information, please contact [email protected].

https://digitalcommons.odu.edu/

https://digitalcommons.odu.edu/biomedicalsciences_etds

https://digitalcommons.odu.edu/biomedicalsciences_etds

https://digitalcommons.odu.edu/sciences

https://digitalcommons.odu.edu/biomedicalsciences_etds?utm_source=digitalcommons.odu.edu%2Fbiomedicalsciences_etds%2F69&utm_medium=PDF&utm_campaign=PDFCoverPages

http://network.bepress.com/hgg/discipline/10?utm_source=digitalcommons.odu.edu%2Fbiomedicalsciences_etds%2F69&utm_medium=PDF&utm_campaign=PDFCoverPages

http://network.bepress.com/hgg/discipline/5?utm_source=digitalcommons.odu.edu%2Fbiomedicalsciences_etds%2F69&utm_medium=PDF&utm_campaign=PDFCoverPages

https://digitalcommons.odu.edu/biomedicalsciences_etds/69?utm_source=digitalcommons.odu.edu%2Fbiomedicalsciences_etds%2F69&utm_medium=PDF&utm_campaign=PDFCoverPages

mailto:[email protected]

MODULATION OF TGFp-INDUCED PAI-1 EXPRESSION BY CHANGES IN

ACTIN POLYMERIZATION IN HUMAN MESANGIAL CELLS

Keyur Pravinchandra Patel M.B.B.S., January 1999, Gujarat University

A Dissertation Submitted to the Faculty of Eastern Virginia Medical School and Old Dominion University

in Partial Fulfillment of the Requirement for the Degree of

DOCTOR OF PHILOSOPHY

BIOMEDICAL SCIENCES

EASTERN VIRGINIA MEDICAL SCHOOL AND

OLD DOMINION UNIVERSITY May 2006

by

Approved by:

William F. Glass II (Director)

Pamela Harding (MemE^T)"

Tim Bos (Member)

Julie Kerry (Member)

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.

ABSTRACT

MODULATION OF TGFp-INDUCED PAI-1 EXPRESSION BY CHANGES IN ACTIN POLYMERIZATION IN HUMAN MESANGIAL CELLS

Keyur Pravinchandra Patel Old Dominion University, 2006 Director: Dr. William F. Glass II

Chronic renal diseases show increased deposition of extracellular matrix

(ECM) in the glomerulus (glomerulosclerosis). Glomerulosclerosis is associated

with activation of normally quiescent glomerular mesangial cells into

myofibroblast-like cells. The overall objective of this study is to delineate cellular

mechanism/s of myofibroblast-differentiation in disease states. In cultured

mesangial cells certain characteristics of myofibroblast differentiation (a-smooth

muscle actin (a-SMA) and hypertrophy) are associated with an increase in

polymeric actin microfilaments (stress fibers). It is likely that other genes are also

regulated in an actin cytoskeleton-dependent manner during myofibroblast

differentiation. In these studies, we therefore examined the hypothesis that

changes in the actin cytoskeleton regulate myofibroblast differentiation of

mesangial cells.

In vivo, myofibroblasts play a major role in ECM accumulation and tissue

scarring. TGFp increases ECM deposition by increasing plasminogen activator

inhibitor type-1 (PAI-1) expression. PAI-1 inhibits ECM degradation by tissue-

(tPA) and urokinase-type (uPA) plasminogen activators. Additionally, the Rho

family of GTPases is required for TGFp-induced PAI-1 expression. Since,

regulation of actin cytoskeletal organizaton is a major function of Rho, the


hypothesis that Rho-mediated changes in actin cytoskeleton modulate PAI-1

expression in glomerular cells was proposed. The effects of modulating the actin

cytoskeleton on TGFp-induced PAI-1 expression were examined in cultured

human glomerular mesangial cells. Inhibitors of Rho signaling decreased basal

and TGFP-induced PAI-1 mRNA and protein expression. These effects were

mimicked by direct inhibition of actin polymerization by Cytochalasin B (CytB)

suggesting that the effects of Rho on PAI-1 expression are mediated through the

actin cytoskeleton. CytB also inhibited the activity of a PAI-1 promoter.

Conversely, stabilization of actin microfilaments with jasplakinolide (JAS) had the

opposite effect on TGFp-induced PAI-1 expression. These results indicate a bi

directional regulation of PAI-1 by the actin cytoskeleton depending on the state of

actin polymerization. In contrast to inhibition of PAI-1, actin-depolymerizing

agents increased tPA mRNA expression.

In summary, the changes in the actin cytoskeleton mediate the effects of

Rho-GTPases in modulation of PAI-1 and tPA expression in response to TGFp.

Thereby, they may control ECM degradation. Overall, the results suggest that

changes in organization of the actin cytoskeleton regulate myofibroblast

differentiation and ECM accumulation by coordinately modulating expression of

multiple genes.


V

This thesis is dedicated to my wife, Rupal, and, to my parents, Hansa and Pravinchandra Patel. Your unconditional love, silent sacrifices,

continued support and prayers have made my dreams come true.


ACKNOWLEDGMENTS

First and foremost, I express my sincere gratitude to Dr. William F. Glass

for accepting me as his graduate student and supporting me at every step on the

way. His support, patience and guidance over the years have helped me achieve

things I never thought were possible. His undying enthusiasm for the basic

science research, the energy to successfully handle multiple complex

responsibilities and the ability to maintain a wonderful balance between his

personal and professional life, are and will remain my inspirations and guiding

principles in life. He has been a great mentor and role model. Thank you, Dr.

Glass, for everything you have done for me.

I want to express my sincere gratitude to Dr. Pamela Harding for teaching

me how to take baby steps in basic science research and more importantly how

to get up when down. She helped me learn to cope with the frustrating times in

research and in life. I could always turn to her for discussing topics ranging from

a friendly chat to the most complex issues in life and science. She showed me

the importance of spirituality in becoming a good human being. Thank you, Dr.

Harding, for all your kindness.

I also want to express my sincere gratitude to Dr. Julie Kerry for an

extensive review of my thesis. I feel fortunate to have a mentor with such passion

for science and teaching. I am truly indebted for her help. Her commitment to the

biomedical sciences graduate program is exemplary. As the track coordinator,


she has been a constant source of motivation and personalized guidance. Thank

you, Dr. Kerry, for the detailed review of my work.

I also want to thank Dr. Tim Bos for helping me understand the principles

and complexities of molecular biology. His meticulous approach to experimental

designs, attention to details and constructive criticisms during molecular biology

classes, journal club discussions and review of my work have helped me become

a better student and researcher. Thank you, Dr. Bos, for your guidance.

I want to thank all four members of my guidance committee for ensuring

that my work was scientifically sound and professionally presented. I feel

privileged to be your student.

I want to thank Dr. Russell Prewitt for serving as an observer during the

thesis defense, Dr. Nicholas D’Amato for constantly being a source of inspiration

and Dr. George Wright for a rewarding rotation on proteomics. I want to thank my

fellow lab technicians, Lisa Haney and Alexandra Stevens, for their help with the

experimental work and their companionship in the lab. I want to thank the

departmental secretaries, Celia Denton and Vera Potts, for always brightening

my days with their friendly smiles. I want to thank the staff of the molecular

pathology laboratory for allowing me to use the Lightcycler instrument amid a

busy work schedule.

I want to thank Toni Dorn, the graduate program coordinator with

unmatched organization skills, for her continuous support on issues ranging from

registration to immigration. I also want to acknowledge the support of my fellow

graduate students and others whom I may have unknowingly left out.


Special gratitude is owed to all my friends and family for standing by me

through thick and thin. There are too many names to mention and the list of

things you have done for me is endless. I can only say that without your

unconditional love, undying support, silent sacrifices and constant motivation, I

would not have achieved anything in my life. I owe you with everything I have

today.

Last, but not least, I want to humbly thank God for blessing me with

wonderful friends, family and colleagues. Thank you, God.


TABLE OF CONTENTS

Page

LIST OF TABLES....................................................................................................... xii

LIST OF FIGURES...................................................................................................xiii

LIST OF ABBREVIATIONS.....................................................................................xvi

CHAPTER

1. INTRODUCTION.........................................................................................1MESANGIAL CELLS AND GLOMERULOSCLEROSIS................... 1CENTRAL HYPOTHESIS.................................................................... 9ACTIN CYTOSKELETON AND GENE REGULATION .................. 10THE ACTIN CYTOSKELETON.........................................................11PLASMINOGEN ACTIVATOR SYSTEM AND PLASMINOGEN ACTIVATOR INHIBITOR-1 INCHRONIC RENAL DISEASE............................................................ 15TGFp IN RENAL DISEASES.............................................................22RHO AND PAI-1 EXPRESSION....................................................... 23HYPOTHESIS AND AIMS.................................................................24

2. MATERIALS AND METHODS.................................................................26CELL CULTURE................................................................................26DNA ARRAY ANALYSIS................................................................... 26WESTERN BLOT ANALYSIS............................................................31NORTHERN BLOT ANALYSIS.........................................................34IMMUNOCYTOCHEMISTRY............................................................37QUANTITATIVE REAL-TIME POLYMERASECHAIN REACTION (PCR). ...............................................................38CLONING OF PAI-1 PROMOTER.................................................... 44TRANSIENT TRANSFECTION........................................................ 47LUCIFERASE REPORTER ASSAY.................................................47DEVELOPMENT OF CHRONIC GLOMERULONEPHRITISIN EXPERIMENTAL ANIMALS........................................................ 48STATISTICAL ANALYSIS................................................................. 51

3. PROFILING THE EFFECTS OF ACTIN CYTOSKELETON ON EXPRESSION OF MULTIPLE GENES................................................... 52

INTRODUCTION................................................................................52EXPERIMENTAL MODEL................................................................. 53RESULTS............................................................................................54


X

CHAPTER Page

4. EFFECT OF TGF(3 ON PAI-1 EXPRESSION........................................ 61INTRODUCTION................................................................................61EXPERIMENTAL MODEL.................................................................62RESULTS............................................................................................63

5. EFFECT OF CHANGES IN ACTIN POLYMERIZATIONON TGFp-INDUCED PAI-1 EXPRESSION.............................................75

INTRODUCTION................................................................................75EXPERIMENTAL MODEL.................................................................76RESULTS............................................................................................77

6. EFFECT OF ACTIN CYTOSKELETON ON PAI-1PROMOTER..............................................................................................91

INTRODUCTION................................................................................91EXPERIMENTAL MODEL................................................................. 94RESULTS............................................................................................94

7. EFFECTS OF TGFp AND ACTIN CYTOSKELETON ON PLASMINOGEN ACTIVATORS...............................................................98

INTRODUCTION................................................................................98EXPERIMENTAL MODEL.................................................................99RESULTS............................................................................................99

8. DISCUSSION...........................................................................................112MESANGIAL MYOFIBROBLAST ACTIVATIONAS A DISEASE MODEL.................................................................. 112CULTURED MESANGIAL CELLS AS THE EXPERIMENTAL MODEL OF MYOFIBROBLASTDIFFERENTIATION.........................................................................113ACTIN CYTOSKELETON AS A REGULATOR OFGENE EXPRESSION.......................................................................114TGFp-INDUCTION OF PAI-1 EXPRESSION................................ 117INHIBITION OF ACTIN CYTOSKELETON ONTGFp-INDUCED PAI-1 EXPRESSION...........................................119STABILIZATION OF ACTIN CYTOSKELETON ONTGFp-INDUCED PAI-1 EXPRESSION...........................................122THE EFFECT OF ACTIN CYTOSKELETON ONPAI-1 PROMOTER ACTIVITY.........................................................124THE EFFECT OF ACTIN CYTOSKELETON ON PLASMINOGEN ACTIVATORS..................................................... 127


CHAPTER Page

9. CONCLUSIONS AND FUTURE DIRECTIONS...................................131CONCLUSIONS............................................................................... 131ROLE OF MAPK IN TGF|3-INDUCED PAI-1EXPRESSION.................................................................................. 132EFFECT OF RHO-KINASE INHIBITION ON SCLEROSIS IN CHRONIC MESANGIOSCLEROTICGLOMERULONEPHRITIS.............................................................. 139

REFERENCES........................................................................................................147

APPENDIX.............................................. 166PERMISSION OF THE AMERICAN PHYSIOLOGICALSOCIETY .....................................................................................................166

VITA..........................................................................................................................168


LIST OF TABLES

Table Page

1. Actin Binding Proteins....................................................................................... 14

2. Primer Sequences for Real-Time PCR Analysis............................................ 42

3. Summary of Changes in Gene Expression on DNAArray Analysis................................................................................................... 56

4. Calculation of PAI-1 cDNA Concentration by Real-Time PCR......................89

5. Effect of Rho-kinase Inhibitor on ExperimentalGlomerulonephritis..........................................................................................144


xiii

LIST OF FIGURES

Figure Page

1. Normal Glomerulus............................................................................................2

2. Glomerular Morphology in Normal and PathologicStates................................................................................................................... 4

3. Cascade of Events Leading to Chronic Renal Diseases................................7

4. Regulation of Actin Cytoskeleton Organization byRho GTPase......................................................................................................12

5. Regulation of Extracellular Matrix Turnover bythe Plasminogen Activator System................................................................. 16

6. DNA Array Analysis of Effect of Actin Depolymerizationon Gene Expression.........................................................................................55

7. Effect of Actin Depolymerization on PAI-1 mRNAExpression in Human Mesangial Cells............................................................59

8. PAI-1 Standard Curve for Quantitative Real-TimePCR Analysis.................................................................................................... 64

9. UBC Standard Curve for Quantitative Real-TimePCR Analysis.................................................................................................... 66

10. Gel Electrophoresis of Standard Curve PCR Products................................68

11. Representative Images from Quantitative Real-Time PCRof PAI-1 and UBC From Experimental Samples........................................... 69

12. Dose-response Analysis of TGFp Inductionof PAI-1 Expression..........................................................................................72

13. Time-course Analysis of TGFp Induction ofPAI-1 Expression..............................................................................................74

14. Effect of Actin Depolymerization on TGFp-inducedPAI-1 mRNA Expression.................................................................................. 78

15. Effect of TGFp and Actin Depolymerization onPAI-1 Protein Expression................................................................................. 80


xiv

Figure Page

16. Effect of Actin Depolymerization on TGFp-inducedPAI-1 Protein Expression................................................................................. 82

17. Effect of Actin Depolymerization on TGFp-inducedPAI-1 Expression by Immunocytochemistry................................................... 83

18. Effect of Changes in Actin Polymerization onTGFp-induced PAI-1 mRNA Expression........................................................ 85

19. Effect of JAS and Toxin B Mediated Changes in ActinPolymerization on TGFp-induced PAI-1 Protein Expression........................ 86

20. Effect of Changes in Actin Polymerization onTGFp-induced PAI-1 Protein Expression........................................................88

21. Schematic Representation of PAI-1 Promoter..............................................92

22. Time-course Analysis of TGFp on PAI-1Promoter Activity...............................................................................................95

23. The Effects of TGFp and Actin Depolymerizationon Human PAI-1 Promoter Activity.................................................................97

24. tPA Standard Curve for Real-Time PCR Analysis..................................... 101

25. uPA Standard Curve for Real-Time RT-PCR Analysis...............................102

26. Gel Electrophoresis of tPA and uPA StandardCurve PCR Products.......................................................................................103

27. Representative Images From Real-Time PCR oftPA and UBC From Experimental Samples................................................. 104

28. Representative Images From Real-Time PCR ofuPA and UBC From Experimental Samples................................................ 105

29. Time-course Analysis of TGFp-treatment ontPA and uPA mRNA Expression................................................................... 107

30. The Effects of TGFp and Actin Depolymerizationon tPA mRNA Expression.............................................................................. 109

31. The Effects of TGFp and Actin Depolymerizationon uPA mRNA Expression............................................................................. 110


XV

Figure Page

32. Effect of MAPK Inhibition on PAI-1 mRNA Expression.............................. 136

33. Effect of MAPK Inhibition on PAI-1 Protein Expression............................. 137

34. Effect of Rho-kinase Inhibition on Sclerosis in a RatModel of Chronic Glomerulonephritis............................................................143


LIST OF ABBREVIATIONS

a-SMA Alpha-Smooth Muscle ActinADF Actin Depolymerizing FactorAP-1 Activator Protein-1ATS Anti-Thymocyte SerumCytB Cytochalasin BECM Extracellular MatrixEGF Epidermal Growth FactorERK Extracellular Signal Regulated KinaseESRD End-Stage Renal DiseaseFBS Fetal Bovine SerumFGF Fibroblast Growth FactorGAP GTPase Activating ProteinGDI GDP Dissociation InhibitorGDP Guanidine DiPhosphateGEF Guanidine Nucleotide Exchange FactorGRE Glucocorticoid Response ElementsGTP Guanidine TriPhosphateHMC Human Mesangial CellHRE Hypoxia Response ElementsJAS JASplakinolideJNK c-Jun N-terminal KinaseLAP Latency Associated PeptideLatB Latrunculin BL-NAME N-Nitro-L-Arginine Methyl Ester (L-NAME)MAPK Mitogen Associated Protein KinaseMEKK1 Mitogen Associated Protein Kinase Kinase 1MMPs Matrix MetalloProteinasesPAI-1 Plasminogen Activator Inhibitor type-1PCR Polymerase Chain ReactionPKA Protein Kinase APKC Protein Kinase CROCK Rho-KinaseRT Reverse TranscriptionSAPK Stress-Activated Protein KinaseSEM Standard Error of MeanSERPIN SERine Protease INhibitorSRF Serum Response FactorTBS Tris-Buffered SalineTGFp Transforming Growth Factor BetaTPA Tissue-type Plasminogen ActivatorUPA Urokinase-type Plasminogen ActivatorUPAR uPA ReceptorUUO Unilateral Ureteral ObstructionVSMC Vascular Smooth Muscle Cells


1

CHAPTER 1

INTRODUCTION

Over 25 million people in the USA suffer from different forms of chronic

renal diseases, of which approximately 419,000 have end stage renal disease

(ESRD) with an annual increase of 4.6% [1]. Dialysis and organ transplant are

the two mainstays of treatment of ESRD, both of which provide a palliative

treatment at best and are associated with many limitations [2], The current

preventive measures are only effective if instituted early in the disease process,

which is clinically difficult to achieve since early disease is generally

asymptomatic [3]. An annual expenditure of $ 25 billion for treatment of ESRD

and lack of definitive treatment warrant further medical research on mechanisms

leading to end state renal diseases [1].

The information in this chapter is organized into two parts: The role of

activated mesangial cells in pathogenesis of chronic renal diseases and the

observations with cultured mesangial cells leading to the central hypothesis are

described first (sections 1.1 and 1.2). The second part contains information on

actin cytoskeleton and the protein of interest of this study (sections 1.3 to 1.7).

Mesangial cells and glomerulosclerosis

The glomerulus

The renal glomerulus, the primary site of filtration of waste products from

The model journal for this dissertation is Kidney International.


2

Fig. 1. Normal glomerulus. The renal glomerulus is a highly vascular structure formed by invagination of the afferent arteriole into a double-layered Bowman’s capsule and subsequent branching into capillaries (e) lined by endothelial cells (d). A parietal layer of simple squamous epithelium (a) and a visceral layer of podocytes (b) separated by Bowman’s space (c) form the Bowman’s capsule. The efferent arteriole drains the glomerulus. The point at which the two arterioles penetrate Bowman's capsule is called the vascular pole and the point at which ultrafiltrate leaves the glomerulus is called the urinary pole. The space in between the capillary loops is called the mesangium (meso= in between, angium= vessels) (f), which consists of the mesangial cells (g) and extracellular matrix laid by them.


3

the bloodstream, is a highly vascular structure consisting of a network of capillary

loops held together by mesangial matrix (Fig. 1) [4], At the vascular pole, the

afferent arteriole invaginates into the double-layered Bowman’s capsule

consisting of a parietal layer of simple squamous epithelium and a visceral layer

of podocytes separated by the Bowman’s space (urinary space). The afferent

arteriole branches into a tuft of capillaries with multiple loops, collectively called

the glomerulus. The glomerulus is drained by the efferent arteriole, which leaves

near the point of insertion of afferent arteriole. The space in between the capillary

loops is called the mesangium (meso= in between, angium= vessels), which

consists of the mesangial cells and extracellular matrix laid by them.

As the blood flows through the capillary loops, some of its constituents

including the water, waste products and electrolytes are selectively filtered into

the Bowman’s space (Fig. 1) [4], This ultrafiltrate is collected, at the urinary pole,

by the proximal convoluted tubules to be further transferred to a downstream

system of tubules and ducts. After a complex series of absorption, re-absorption

and secretion, the ultrafiltrate is finally converted into the urine.

Glomerulosclerosis

Glomerulosclerosis is a major feature of many renal diseases that

progress to end stage renal disease (ESRD) [5, 6]. Pathologically,

glomerulosclerosis is characterized by increased deposition of extracellular

matrix (ECM) and gradual replacement of functioning renal tissue with non

functioning fibrous tissue (Fig. 2). Different underlying mechanisms lead to a


B. Chronic Glomerulosclerosis

ECM deposition and_ mesangial expansion

C. Global Sclerosis

Replacement of normal glomeruli by ECM —

Fig. 2. Glomerular morphology in normal and pathologic states. (A)Glomerulus showing relatively low amounts of extracellular matrix in the mesangium (arrow), (B) chronic glomerulosclerosis showing increased amount of extracellular matrix deposition and resultant expansion of the mesangium (arrow), (C) end-stage renal disease showing complete replacement of the glomeruli by extracellular matrix (arrow) in a process called global sclerosis.


5

common pathological feature in the form of scarring of renal tissue [7], Increased

formation of extracellular matrix leading to fibrosis begins in the mesangium, the

intercapillary portion of the glomerulus composed of mesenchymal mesangial

cells [8, 9]. Expansion of the ECM occurs as a result of deposition of type IV and

type I collagen, and fibronectin. In chronic renal diseases, fibrosis results from

increased matrix production, decreased matrix breakdown or both. Since filtration

and removal of waste products from the blood are the major functions of

glomerulus, patients with non-functioning glomeruli develop toxicity due to

accumulation of waste products [10],

Renal fibrogenesis

Renal fibrogenesis typically occurs in three distinct phases, with the first

two being similar to physiological wound healing, namely the phase of induction,

the phase of inflammatory matrix synthesis and the phase of post-inflammatory

matrix synthesis [7], The first phase is associated with an influx of mononuclear

cells upon an insult leading to an inflammatory response. The inflammatory cells

liberate cytokines and growth factors, which in turn activate fibroblasts [7], In

particular, transforming growth factor p (TGFp), a pro-fibrotic growth factor, plays

a major role in activating normally quiescent mesangial cells [11], The second

phase of inflammatory matrix synthesis is characterized by increased synthesis

of ECM and de novo expression of proteins, and reduced degradation of ECM.

The structural changes are still potentially reversible throughout this phase [7],

The third phase of post-inflammatory matrix synthesis is marked by autonomous


6

fibroblast proliferation, synthesis of ECM independent of the presence of primary

inflammatory stimulus and perpetuation of the scarring process [7],

The mesangial myofibroblast

During the three phases described above, glomerular mesangial cells

contribute to excess matrix deposition in multiple ways. Besides providing

structural support to the mesangium, mesangial cells both secrete and respond

to growth factors and inflammatory mediators, thereby regulating the glomerular

microenvironment [12]. TGFp activates otherwise quiescent mesangial cells

which now start proliferating and expressing proteins that contribute to ECM

deposition (Fig. 3). These activated mesangial cells also express a-smooth

muscle actin (a-SMA) de novo, which is normally seen in smooth muscle cells,

[13-20]. Consequently, these activated mesangial cells with smooth muscle cell

like properties are referred to as myofibroblasts. a-SMA expression and

myofibroblast-like differentiation are also seen elsewhere in tissues such as

heart, lung, liver and skin [21-24],

Along with a-SMA, activated myofibroblasts start expressing profibrotic

plasminogen activator inhibitor-1 (PAI-1) de novo, which in turn inhibits ECM

degradation and favors ECM deposition [19, 25], Thus, TGFp-mediated

myofibroblast-like differentiation is associated with increased PAI-1 expression

and excess ECM deposition that eventually leads to glomerulosclerosis and end-

stage renal disease (Fig. 3).

The overall objective of this study is to characterize the mechanisms of

mesangial myofibroblast-like differentiation in order to obtain useful insights into


7

(end result)

(disease phenotype)

(effector molecules)

(effector cells)

(initiating insult)

M esangial Cells

Glomerular Sclerosis

Chronic Renal D isease

Plasminogen Activator System

- More than 25 million patients- Annual health care cost 25 billion

- Major feature of chronic and end stage renal diseases- Excess deposition of extracellular matrix- Glomerulus replaced by non-functional fibrous tissue

- Profibrotic growth factor, associated with renal fibrosis- Increases matrix production directly- Decreases matrix degradation by increasing PAI-1.

- Regulates the rate of matrix turnover- Components:

- Activating: tPA and uPA; anti-fibrotic- Inhibitory: PAI-1; profibrotic

- Mesangial = meso + angium = between blood vessels- Structural support of glomerulus and capillary loops- Site of production & action of growth factors & cytokines- Express PAI-1 de novo in disease states

Fig. 3. Cascade o f events leading to chronic renal diseases. TGFp is a profibrotic growth factor that increases production of PAI-1 by glomerular mesangial cells. Increased production of PAI-1 leads to decreased degradation and increased deposition of extracellular matrix in mesangium resulting in glomerulosclerosis. Replacement of normal glomeruli by non-functional fibrous tissue in glomerulosclerosis leads to clinical presentation in the form of chronic and end-stage renal diseases, both currently irreversible disease processes.


8

renal fibrogenesis. The specific aim of this study was to examine regulation of

TGFp-induced PAI-1 expression in human mesangial cells.

Cultured mesangial cells as a model of myofibroblast phenotype

Cultured mesangial cells provide a useful in vitro model of myofibroblast

phenotype. The phases of fibrogenesis can be mimicked in vitro by altering the

culture conditions. Cell culture in the presence of serum provides cytokines and

growth factors as seen in the phase I to activate mesangial cells (refer to section

1.1.3). Cell culture in the absence of serum mimics phase III, which is marked by

the absence of cytokines, development of the myofibroblast-like phenotype (a-

SMA expression) and increased ECM production (refer to section 1,1,3). Thus,

initial culturing in the presence of serum, followed by serum deprivation, mimics

the growth factor and cytokine milieu of myofibroblast activation and

differentiation. Primary cultures of human and rat mesangial cells were used in

this study to understand mechanisms of myofibroblast differentiation.

Regulation of g-SMA expression in cultured mesangial cells

As a part of an overall focus on understanding the myofibroblast-like

phenotype, our laboratory previously examined the regulation of a-SMA,

expressed de novo upon myofibroblast differentiation, in cultured mesangial

cells. Stephenson et al showed that serum-deprivation caused mesangial cells to

spread, form abundant stress fibers, express more a-SMA and undergo

hypertrophy [26]. Likewise, proliferating dermal fibroblasts are initially devoid of

microfilaments [24], but their appearance and subsequent disappearance

paralleled the expression of a-SMA. The observations of Stephenson et al and


9

the in vivo data regarding dermal fibroblasts, suggested that clearance of growth

factors increases actin polymerization thereby controlling myofibroblast

differentiation. Since, expression of a-SMA paralleled changes in actin

cytoskeleton organization, it was hypothesized that changes in actin

polymerization regulate a-SMA expression and hypertrophy in mesangial cells.

The Rho family of small GTPases regulate actin polymerization through the

downstream effector, Rho-kinase (ROCK), in a variety of cell types [21]. Inhibition

of actin polymerization by agents that inhibit Rho-kinase (Y-2632, HA-1077), as

well as by the agents that directly bind to actin and affect its degree of

polymerization (CytB, LatB), inhibited a-SMA expression and promoter activity

[28]. On the other hand, stabilization of actin polymerization by JAS and

phalloidin increased a-SMA expression and promoter activity. Similarly,

mesangial cell hypertrophy was blocked by actin depolymerization. These results

confirmed the hypothesis that changes in actin polymerization regulate a-SMA

expression and hypertrophy in mesangial cells [28].

Central hypothesis

Like a-SMA expression and hypertrophy, de novo expression of PAI-1 is

also seen with myofibroblast differentiation [29]. It is possible that a-SMA, PAI-1

and multiple other genes are regulated by a common underlying mechanism that

regulates overall myofibroblast differentiation. Therefore, a central hypothesis

that changes in actin polymerization regulate myofibroblast-like phenotype by

simultaneously regulating expression of multiple genes was proposed.


10

The following sections contain information on the actin cytoskeleton,

regulation of its organization, its role in gene expression, introduction to

plasminogen activator system, regulation of PAI-1 expression and the specific

hypothesis for this study.

Actin cytoskeleton and gene regulation

Traditionally, actin cytoskeletal organization is considered important for

controlling processes such as cell shape and cell motility [30-32], At the same

time there is increasing evidence suggesting that the actin cytoskeleton and cell

shape are important regulators of gene expression and cell function. Early

observations of Folkman and Moscona, showing an association between

inhibition of cell spreading and decreased DNA synthesis, proposed that cell

shape regulates cell function [33]. Over the past 20 years, studies by Ingber have

supported the idea that mechanical transduction through cytoskeletal elements

affect cell functions [34-38], Recent studies have shown that networks of actin

polymers, also known as stress fibers, provide a highly specific and organized

network of fibers for processes such as signal transduction and gene regulation.

Localization of signaling molecules at specific cytoskeletal locations allows

integration of signaling pathways and effective transmission of a signal [39, 40].

For example, MEKK1 that activates JNK mitogen associated protein kinase is

associated with the actin cytoskeleton [41]. During keratinocyte differentiation,

cytoskeletal association facilitates coupling of ErbB1 and ERK [42], Also,

expression of genes such as a-SMA seems to be regulated by the state of actin

polymerization [28]. Localization of mRNA and protein translation machinery at


11

highly specific intracellular pockets of actin stress fibers have also been identified

[43], Thus, current evidence points towards regulation of gene expression by

actin cytoskeleton.

The actin cytoskeleton

The actin cytoskeleton, also known as the microfilament system, is an

important structural component of all eukaryotic cells. Actin, a 42-kDa globular

polypeptide, is the building block of the microfilamentous cytoskeletal system.

Monomeric actin (G-actin) molecules polymerize via non-covalent interactions

into filamentous actin also known as F-actin or stress fibers [44], Actin filaments

cross-link with each other and with various cellular and membranous structures

to form a highly organized network. The actin filaments traverse the cytoplasm

and provide structural support to the cells. They transmit tension and resist

deformation of the cells. Other cellular functions regulated by the actin

cytoskeleton include but are not limited to cell shape, cell motility, cell division,

cell-cell and cell-substrate interaction, transmembrane signaling, endocytosis,

secretion and muscle contraction [45, 46],

The actin filaments are very dynamic structures undergoing constant

growth in length at one end (barbed end, plus end) and attrition at the opposite

end (pointed end, minus end). The rates of growth and attrition determine the

amounts of monomeric and polymeric actin in the cell. Actin polymerization is

regulated at multiple levels in response to extracellular stimuli or intracellular

needs; and involves various cell-signaling pathways, actin binding and

associated proteins (Fig. 4) [46],


12

Rho-kinase

(-)<* .

LIM-kinasei

Cofillinstabilization

I -RhoA

(-) Iloxin 1J mDia

Profilm

F-actm

(.'ytochald^in IJ I u trum uiin b

(-) 1olymerization

G-actin

IJ ^?? Other factors

ranscription factors4D>

Regulation of Gene Expression

a-SMA p a h tPA

Fig. 4. Regulation of actin cytoskeleton organization by Rho GTPase. RhoGTPase is a major regulator of actin polymerization. Rho-kinase (ROCK) and mDia are known downstream effectors of Rho that increase polymeric F-actin and decrease monomeric G-actin content by regulating the actions of actin binding proteins such as cofillin and profilin. The hypothesis examined in this thesis proposed that Rho-mediated changes in actin polymerization regulated expression of specific genes through involvement of some yet unknown factors. Agents that increase (Jasplakinolide) or block (Toxin B, HA-1077, Y-2632, Cytochalasin B and Latrunculin B) actin polymerization were used to test the hypothesis by modifying actin polymerization at different levels.


13

Actin binding proteins

The actin cytoskeleton undergoes different stages of organization such as

nucleation, polymerization, cross-linking, folding and movement. As the name

implicates, actin-binding proteins bind to actin monomers or polymers during

different phases of assembly and regulate the rate and the extent of actin

polymerization. The activities of these proteins are in turn regulated by signaling

molecules [46], Major actin-binding proteins are briefly reviewed in Table 1 [47-

49],

RhoA and actin cytoskeleton

Rho is a member of Rho family of small GTPases (Rho, Rac and Cdc42)

that plays a major role in organizing actin cytoskeleton in the form of stress fibers

(Fig. 4) [27, 50, 51]. The Rho GTPases exist in an inactive GDP-bound form

complexed with a GDP-dissociation inhibitor (Rho GDI) and an active GTP-

bound form. In response to stimuli, guanine nucleotide exchange factors (GEFs)

dissociate GDI from Rho and allow Rho to bind to GTP. Activated Rho-GTP in

turn activates downstream effecters. GTPase activating proteins (GAP) inactivate

Rho by catalyzing GTP hydrolysis [52], Rho-kinase or ROCK, is the main

downstream effector of Rho that inactivates proteins that depolymerize actin

such as cofilin and destrin and thereby facilitates actin polymerization. Other

effectors of Rho include PIP-5 kinase and mDia, a 140 kDa protein that increases

actin polymerization through the actin-binding protein profilin [53-55],


Table 1. Actin Binding Proteins

14

Actin Binding Protein/s Effect on Actin Cytoskeleton

Profilin In resting state, sequesters monomeric actinthereby inhibits actin polymerization, In

stimulated state, promotes assembly of actinfilaments

P-thymosin, twinfilin, DNAse I Binds to monomeric actin and sequesters it,

thereby inhibits actin polymerizationCofilin Binds and severs actin filaments, Also

known as actin depolymerizing factor (ADF)Gelsolin, villin, fragmin, adseverin, Bind and sever actin filamentsscinderin

Fascin, villin, fimbrin, a-actinin Cross-link actin filaments, Also known asactin-bundling proteins

Srv2/cyclase-associated protein Stimulate nucleotide exchange on actin(CAP) family proteins monomers and relieve the inhibitory effects

of ADF/cofilin on this exchange

Wiskott-Aldrich Syndrome Protein Increases nucleation of actin monomers(WASP)Arp 2/3 Binds to actin dimers and increases

nucleation of stress fibers


15

Plasminogen activator system and plasminogen activator inibitor-1 in

chronic renal disease

The plasminogen activator system, which controls activation of

plaminogen into plasmin, is the key regulator of matrix degradation (Fig. 5).

Activated plasmin, in turn, not only degrades some matrix proteins itself, but also

amplifies the fibrolytic response by activating another set of powerful matrix

degrading enzymes called matrix metalloproteinases (MMPs) [56]. PAI-1, tissue-

type plasminogen activator (tPA) and urokinase-type plasminogen activator

(uPA) are components of the plasminogen activator system (Fig. 5). PAI-1

inhibits matrix breakdown by inhibiting tPA and uPA. Although tPA and uPA have

a limited capacity to directly degrade ECM proteins, they trigger activation of a

cascade of proteases that lead to ECM degradation (Fig. 5) [56]. The balance

between the anti-fibrotic effects of plasminogen activators and the pro-fibrotic

effects of PAI-1 determines the rate of matrix turnover and the amount of matrix

deposition in the tissue [57, 58]. Transforming growth factor beta (TGFp) is a

major profibrotic growth factor responsible for increased PAI-1 expression and

resulting glomerulosclerosis seen in chronic renal diseases [59]. The

plasminogen activator system also regulates fibrinolysis in the intravascular

space [60].

tPA

Tissue-type plasminogen activator (tPA), Mr of 70,000, is secreted in the form of

a single or double chain enzyme from endothelial and mesangial cells [61].


16

Plasminogen Activators

^Plasminogen' I (Inactive) J

uPAv______

Matrix Metalloproteinases (MMPs)

IExtracellular Matrix Degradation

Fig. 5. Regulation of extracellular matrix turnover by the plasminogen activator system. Plasminogen activator system consists of two activators of plasminogen namely tissue-type (tPA) and urokinase-type (uPA) plasminogen activators and their inhibitor called plasminogen activator inhibitor type I (PAI-1). Both tPA and uPA convert inactive plasminogen into active plasmin. Active plasmin, in turn, stimulates extracellular matrix (ECM) degradation mainly by activating matrix metalloproteinases (MMPs) and to a lesser degree by directly degrading ECM. PAI-1 acts as a gatekeeper of matrix degradation cascade by inhibiting tPA and uPA mediated plasminogen activation.


17

The modular structure of tPA include five domains homologous to those of

fibronectin, epidermal growth factor (EGF), plasminogen and trypsin-like

protease. The extensive homology of domains of tPA to that of components of

ECM, proenzymes and growth factors facilitates the interaction between the

components and effective activation of plasminogen. tPA alone activates

plasminogen at a very low rate. Binding of tPA to proteins of extracellular matrix,

such as thrombospondin and collagen IV, increases the rate of plasminogen

activation. Vascular smooth muscle cells (VSMCs), which are phenotypically

similar to activated mesangial cells, produce the majority of tPA in vivo and

express a tPA binding receptor which not only increases tPA activity but also

decreases the inhibition of tPA by PAI-1 [62],

Administration of recombinant tPA provides a protective effect by

decreasing glomerular matrix accumulation in an anti-Thyl model of glomerular

matrix expansion [63], On the other hand, over-activation of tPA can produce

harmful effects due to increased MMP activation and tubular basement

membrane degradation [64]. Therefore it appears that tPA expression and

activity have to be carefully regulated for normal functioning of renal tissue.

uPA

Urokinase-type plasminogen activator (uPA), Mr of 55,000, having trypsin

like protease activity, was first isolated from urine. Like tPA, uPA is also

composed of domains that facilitate effective activation of plasminogen. Domains

of uPA are homologous to those of EGF, plasminogen and trypsin-like protease.


18

Many cell types express a cystein-rich 65 kDa receptor for uPA (u-PAR)

[62], uPA binds to N-terminal domain of u-PAR with high affinity. Binding of uPA

to uPAR initiates intracellular signal transduction and triggers local proteolysis by

decreasing the Km for plasminogen activation by up to 200-300 fold, both of

which play a critical role in tissue development. Activated plasmin in turn

amplifies the fibrinolytic potential by activating zymogen pro-uPA. Thus an initial

activation of small amounts of plasminogen can generate large amounts of

plasmin through a positive feedback loop [62], Mice expressing an inducible uPA

transgene or following administration of an adenoviral vector containing a uPA

gene had reduced fibrosis [65].

Studies have shown that tPa and uPA are complimentary activators of

plasminogen with a high degree of functional overlap. Conventionally, tPA

regulates plasminogen activation in intravascular compartment, whereas uPA

does so in tissues. [66], Also tPA plays a major role in fibrinolysis, whereas uPA

has been associated with cell migration [67],

PAI-1

PAI-1 (Serpin E1) is a member of the SERPIN (SERine-Protease-lnhibitor)

family of protease inhibitors [68]. It is a single-chain, 379 amino acid, 52-kDa

glycoprotein (~13% carbohydrate) that exists in active, inactive and latent forms.

The active form spontaneously converts to a latent form, which can be partially

reactivated by denaturing agents [56], The reactive center of the inhibitor is

contained within the exposed “strained loop region” at the carboxy terminal of the

molecule. This serves as a pseudosubstrate for the target serine proteases.


19

PAI-1 is not normally expressed in kidneys but is rapidly induced in a

variety of pathological states. Newly synthesized PAI-1 is released into the

extracellular space where it is converted into its inactive latent form in a few

minutes. Binding of PAI-1 to matrix proteins such as vitronectin increases its half-

life >10 times, thus enabling matrix the to resist proteolysis by invading cells [69],

[25], Mesangial cells along with glomerular endothelial and epithelial cells have

been identified as a source of PAI-1 expression under different conditions. [25,

70, 71]. The major function of PAI-1 is to regulate extracellular matrix turnover by

inhibiting the activation of proteases that break down the matrix. PAI-1 does so

by forming a 1:1 stoichiometric reversible complex with tPA and uPA, thereby

inhibiting them [56]. PAI-1-plasminogen activator complexes can be endocytosed

and subsequently degraded by lysosomes, thereby providing a clearance

mechanism for fibrolytic activity [69].

The inhibition of plasminogen activators by PAI-1 is the rate-limiting step

in matrix degradation. Not surprisingly, increased PAI-1 expression has been

associated with increased matrix deposition and tissue fibrosis. PAI-1 is nearly

undetectable in normal kidneys by immunohistochemistry and in situ

hybridization. However, increased PAI-1 expression is seen in many human and

experimental glomerular diseases including acute (thrombotic microangiopathy,

renal vasculitis, proliferative glomerulonephritis and membranous nephritis) and

chronic human diseases (diabetic nephropathy, hypertensive nephropathy, focal

segmental glomerulonephritis and lupus nephritis) and animal models in different

renal cell types including mesangial cells [25]. Studies with knock-out mice


20

clearly established the role of PAI-1 in fibrosis. PAI-1 knock out mice were

resistant to renal injury caused by unilateral ureteral obstruction [71] and

pulmonary fibrosis caused by bleomycin (an antineoplastic drug producing

pulmonary fibrosis as a side effect) [72]. Similarly, PAI-1 knockout mice were

protected against N-nitro-L-arginine methyl ester (L-NAME)-induced perivascular

fibrosis [73]. Conversely, over expression of PAI-1 worsened bleomycin-induced

fibrosis [72]. By virtue of its action on matrix turnover, PAI-1 also plays an

important role in neointima formation, angiogenesis, atherosclerosis, tumor

growth and metastasis, and wound healing. PAI-1 may play a role in cell

adhesion and migration as a result of its high affinity binding to vitronectin.

PAI-1 acts as a gatekeeper guarding against fibrinolysis by inhibiting

unnecessary activation of the plasminogen cascade. Hence it is one of the most

highly regulated components of the plasminogen activation system. The human

PAI-1 gene is located on the long arm of chromosome 7. It is comprised of nine

exons and eight introns, and is ~12.2 kb long. Alternative polyadenylation of PAI-

1 mRNA results in two distinct transcripts, one 2.8 kb long and the other 3.2 kb

long. The PAI-1 gene and its flanking region contain 12 Alu repeat elements and

5 long poly (Pur) repeat elements. Also, the promoter contains a 4G/5G

polymorphism at -675. It is suggested that the presence of 4Gs in the promoter

is associated with increased production of PAI-1 [74],

PAI-1 expression is induced by a variety of factors including growth

factors, coagulation factors, metabolic factors and hormones such as

transforming growth factor-(B (TGF(3), epidermal growth factor (EGF), fibroblast


21

growth factor (FGF), fibrin fragments, thrombin, glucose, insulin, Angiotensin,

hypoxia, glucocorticoids and radiation [25]. Regulation is primarily at the

transcription level, although cyclic nucleotides may regulate PAI-1 message

stability [25, 75]. The PAI-1 promoter has two AP-1 like sites, two SP-1 sites,

three SMAD sites, one NF-kB site, glucocorticoid response elements (GRE) and

hypoxia response elements (HRE) allowing the regulation of promoter by multiple

pathways [76-79], Indeed, inflammatory mediators such as TGF(3, triglycerides,

fatty acids and phorbol esters increase PAI-1 expression. PAI-1 expression is

regulated by signal inputs from many intracellular signaling pathways including

MAPK, Smad, PKA, PKC, nuclear receptors and Rho signaling [76, 80-84],

PAI-1, in turn, inhibits uPA-plasminogen activation, which normally

activates latent TGFp, a major inducer of PAI-1 expression in mesenchymal cells.

Thus TGFp turns off its own production through induction of PAI-1. The

autoregulatory feedback loop between TGFp and PAI-1 plays an important role in

wound healing and in limiting ECM deposition [69]. A detailed understanding of

signal transduction involved in TGFp induced PAI-1 expression is required to

identify potential targets for the intervention of TGFp mediated PAI-1 expression

and fibrosis.

In a previous study we have shown that changes in actin cytoskeleton

regulate a-SMA gene expression and hypertrophy in mesangial cells [28]. Like a-

SMA expression and hypertrophy, de novo expression of PAI-1 is also seen with

myofibroblast differentiation [85, 86], It is possible that regulation of both the

genes share common or similar underlying regulatory mechanisms, suggesting


22

regulation of PAI-1 by actin cytoskeleton. Also, recently Schnaper et al have

shown that the inhibition of actin polymerization blocks TGFP-mediated collagen

expression [87]. It is logical to think that changes in actin cytoskeleton may also

similarly modulate expression of PAI-1, another TGFp-dependent gene and a

regulator of ECM. Thus two independent lines of evidence suggest regulation of

PAI-1 expression by changes in actin polymerization.

TGFp in Renal Diseases

Transforming Growth Factor-p (TGFp) regulates extracellular matrix

production by increasing the production of matrix components such as collagen,

fibronectin, laminin and heparan sulfate proteoglycans, and simultaneously

decreasing matrix degradation by increasing production of plasminogen activator

inhibitor-1 (PAI-1) [88]. The net result is an increase in extracellular matrix

production and glomerulosclerosis [89, 90]. TGFp regulates a range of cellular

processes including the cell cycle, differentiation, wound healing, extracellular

matrix production and the immune response [91-94], TGFp circulates in an

inactive form bound with latency-associated peptide (LAP) and is activated

locally when LAP binds to integrin avp6 and TGFp is cleaved.

Not surprisingly, TGFp is present in human glomeruli in several

glomerular diseases including diabetic nephropathy [95] and is associated with

increased mesangial matrix production [96]. During pathogenesis of these renal

diseases, TGFp signaling causes tubular atrophy, podocyte depletion, loss of

capillary endothelial cells, mesangial cell activation and epithelial-to-

mesenchymal transdifferentiation. The combination of these multiple pathogenic


23

events leads to loss of functioning renal tissue [91]. The role of TGFp in renal

fibrosis has also been proven in a variety of animal models [97, 98]. Integrin av|36

knockout mice, which are unable to release LAP inhibition of TGFp, were

protected against pulmonary fibrosis [99], Administration of anti-TGFp antibody

protected against scarring in an animal model of chronic renal disease confirming

the role of TGFp in fibrosis [100].

Rho and PAI-1 expression

Rho proteins regulate gene expression by increasing activity of

transcription factors such as c-jun, ATF2a, ELK and STAT3 through intracellular

signaling pathways such as MAPK and src [101]. Recently, the protective effects

of Rho-kinase inhibitors against tissue fibrosis have established the role of Rho in

the pathogenesis of tissue fibrosis. The Rho-kinase (ROCK) inhibitor Y-27632

markedly decreased bleomycin-induced pulmonary fibrosis and collagen

accumulation in mice [102], Similarly, Y-27632 protects against hepatic fibrosis

[103]. The inhibition of Rho-kinase also protects against tubulointerstitial fibrosis

in mouse kidneys with unilateral ureteral obstruction [104]. The basis for the

protective effects of Rho-inhibition is not fully understood. Inhibition of expression

of profibrotic molecules such as PAI-1 appears to be a potential mechanism.

Inhibition of Rho by C3 exoenzyme decreases PAI-1 production in rat proximal

tubules [105] and aortic endothelial cells [106]. Co-transfection with dominant

negative RhoA decreases PAI-1 promoter activity, whereas constitutively-active

RhoA increases PAI-1 in chicken atrial cells [107], ROCK inhibition blocks PAI-1

expression in response to Angiotensin II. [108], Also, ROCK inhibition blocks


24

PAI-1 promoter activity [81]. Thus, both inhibition of Rho activation and inhibition

of signaling downstream of Rho lead to inhibition of PAI-1 expression.

Collectively, these facts suggest that inhibition of Rho protects against fibrosis

through inhibition of PAI-1.

Although the role of Rho in the regulation of PAI-1 expression is becoming

increasingly clear, the mechanism for this effect has not been examined. Since

actin polymerization is one of the major functions of Rho-ROCK signaling (Fig.

3), it is plausible that the effect of Rho-inhibition is mediated by depolymerization

of actin. Taken together, these observations suggest that Rho-mediated

changes in actin cytoskeletal structure modulate PAI-1 expression. Given the

diversity of signaling pathways that interact with Rho, it is possible that Rho

mediates and integrates the effect of these pathways on PAI-1 expression by

modulating actin cytoskeleton organization.

Hypothesis and aims

The Central hypothesis is that changes in actin polymerization regulate

the myofibroblast-like phenotype of kidney mesangial cells by simultaneously

regulating expression of multiple genes.

The overall objective is to characterize the mechanisms of mesangial

myofibroblast-like differentiation.

The working hypothesis is that Rho-mediated changes in actin

cytoskeletal structure modulate PAI-1 expression in glomerular mesangial cells.

My specific aims are to examine the role of Rho in the regulation of TGF[3-

induced PAI-1 expression in human mesangial cells as follows:


25

Specific Aim 1:

Specific Aim 2:

Specific Aim 3:

Specific Aim 4:

Specific Aim 5:

To profile the effects of actin cytoskeleton on the expression

of multiple genes in human mesangial cells.

To examine the effect of TGFp on PAI-1 expression

To examine the role of Rho and actin cytoskeleton in TGFp-

induced PAI-1 expression.

To examine the role of Rho and actin cytoskeleton in TGFp-

induced PAI-1 promoter.

To examine the effect of TGFp and actin cytoskeleton on

plasminogen activators.


26

CHAPTER 2

MATERIALS AND METHODS

Cell culture

Human mesangial cells (HMCs) were cultured in RPMI 1640 (Mediatech

Inc., Herndon, VA) with 16.7% fetal bovine serum (Invitrogen, Carlsbad, CA).

from renal glomeruli isolated by the sieving method. HMCs between passages 5

and 9 (P5 -P9) were used for experiments. After plating in serum-containing

media, cells were serum-starved at 60-80% confluence. After 24 hours of serum

starvation, cells were pre-treated with agents that depolymerize (Cytochalasin B:

1.0 nM, Latrunculin B: 0.1 pM, Toxin B: 10 pM, Y-27632: 10 pM, HA-1077: 20

pM) and/or stabilize actin cytoskeleton (Jasplakinolide: 50 nM) for one hour prior

to addition of 10 ng/ml TGFp for the indicated time periods. Cytochalasin B was

purchased from Sigma Chemical Co., St. Louis, MO. The Rho-kinase inhibitor, Y-

27632, was purchased from Welfide Corporation, Osaka, Japan. Another Rho-

kinase inhibitor, HA-1077, was purchased from AG Scientific Inc., San Diego,

CA. Clostridium Difficile Toxin B (Toxin B), Latrunculin B (LatB) and

Jasplakinolide (Jas) were purchased from Calbiochem, San Diego, CA. Human

recombinant TGFp was purchased from R&D Systems, Minneapolis, MN.

DNA Array Analysis

The RNA isolation, DNAse treatment, Poly A+ enrichment, cDNA probe

synthesis, hybridization and analysis of scanned arrays were performed as per

manufacturer’s protocol [109],


27

RNA Isolation

Human mesangial cells were plated on five 10 cm dishes per condition. At

the end of the desired treatment, cells were trypsinized and spun down at 680xg

for 5 minutes. The pellet was resuspended in 1 ml denaturing buffer. A 0.5 ml

aliquot was transferred to sterile 1.5 ml tube and incubated on ice for 5-10 min.

After vortexing briefly, the homogenate was centrifuged at 13,370xg for 15 min at

4°C to remove cellular debris. The supernatant was transferred to a new 2 ml

tube and 1 ml of Tris-EDTA saturated phenol was added to it. The tube was

vortexed for 1 min. After a 5 min incubation on ice, 0.3 ml chloroform was added.

The sample was vortexed vigorously for 1-2 min and then incubated on ice for 5

min. The homogenate was centrifuged at 13,370xg for 10 min at 4°C. The upper

aqueous phase containing RNA was transferred to a new 2 ml tube. A second

round of phenol chloroform extraction using 0.8 ml saturated phenol and 0.3 ml

chloroform was performed. Next, 1 ml isopropanol was added with incubation on

ice for 10 min. The samples were centrifuged at 13,370xg for 15 min at 4°C. The

pellet was washed with 0.5 ml of 80% ethanol. The samples were centrifuged at

13,370xg for 15 min at 4°C. The supernatant was discarded and the pellet was

air-dried. The pellet was re-suspended in 25 pi RNase-free H20.

DNase Treatment of Total RNA

The DNAse treatment reaction was set up in a final volume of 200 pi

containing 100 pg total RNA, DNase (1 unit/pl) and 10 x DNase buffer (400 mM

Tris-HCI (pH 7.5), 100 mM NaCI, 60 mM MgCh). After a 30 min incubation at

37°C, the reaction was stopped by adding 20 pi termination mix (0.1 M EDTA (pH


28

8.0), 1 mg/ml glycogen). The reaction was split into two 1.5 ml tubes. To each

tube, 100 pi of saturated phenol and 60 pi chloroform were added followed by

centrifugation at 16,170xg for 10 min at 4°C to separate phases. Top aqueous

layer was carefully removed and placed in a 2.0 ml tube. To each tube, 1/10

volume of 2 M (10 pi) NaOAc and 2.5 volumes (0.3 ml) of 95% ethanol were

added. The mixtures were vortexed thoroughly and incubated on ice for 10 min.

The tubes were centrifuged in a microfuge tube at 16,170xg for 15 min at 4°C.

The pellets were washed with 100 pi of 80% ethanol followed by centrifugation at

16,170xg for 5 min at 4°C. The supernatant was removed and the pellet was air-

dried. The pellets were dissolved in 50 pi RNase-free H20.

Poly A+ RNA Enrichment and Probe Synthesis

Streptavidin Magnetic Bead Preparation

Magnetic beads were re-suspended by inverting and gently tapping the

tube. Aliquots containing 15 pi of beads per probe synthesis reaction were

transferred into 0.5 ml tubes. Beads were separated on magnetic particle

separator. The supernatant was pipetted off and discarded. Beads were washed

with 150 pi of 1x binding buffer [109] and separated again on a magnetic particle

separator. The supernatant was pipetted off and discarded. The cycle was

repeated three times. The beads were resuspended in 15 pi 1x binding buffer per

reaction.

Poly A+ RNA Enrichment

The PCR thermal cycler was preheated to 70°C. Aliquots of 10-50 pg total

RNA were transferred into 0.5 ml tubes. Deionized H20 was added to make up a


29

final volume of 45 jj.1. To each tube, 1 pi Biotinylated Oligo (dT) was added

followed by incubation at 70°C for 2 min in the preheated thermal cycler. The

reaction was cooled at room temperature for 10 min. To each tube, 45 pi 2x

binding buffer was added. The washed beads were resuspended by pipetting up

and down. Fifteen pi of beads were added to each RNA sample and mixed on a

vortexer or shaker for 30 min at room temperature. Beads were separated using

the magnetic separator. The supernatant was pipetted off and discarded. Beads

were resuspended in 50 ul 1x wash buffer. Beads were again separated and

washed once. Beads were resuspended in 6 pi dH20.

cDNA Probe Synthesis

A master mix containing 5X reaction buffer (250 mM Tris-HCI (pH 8.3),

375 mM KCI, 15 mM MgCh), 10x dNTP mix (5 mM each dCTP, dGTP, dTTP), [a-

32P] dATP (3000 Ci/mmol, 10 pCi/pl, 5 pl/reaction) and 10 mM DTT was

prepared. One pi cDNA synthesis primer mix [109] was added to the

resuspended beads. The beads and primer mix were incubated in the preheated

thermal cycler at 65°C for 2 min. Meanwhile, 2 pi MMLV reverse transcriptase

per reaction was added to master mix. To each reaction tube, 13.5 pi master mix

was added followed by thorough mixing. Tubes were incubated at 50°C for 25

min. The reactions were stopped by adding 2 pi 10x termination mix (0.1 M

EDTA [pH 8.0], 1 mg/ml glycogen).

Column Chromatography

The probe synthesis reaction mixture was diluted to a final volume of 200

pi with Buffer NT2 [109]. The sample was added to a NucleoSpin Extraction Spin


30

Column and centrifuged at 16,170xg for 1 min. The NucleoSpin column was

inserted into a fresh 2-ml collection tube and 400 pi Buffer NT3 [109] was added

to the column. After centrifugation at 16,170xg for 1 min, the collection tube and

the flow-through were discarded. The wash with Buffer NT3 was repeated twice.

The NucleoSpin column to was transferred to a clean 1.5-ml microcentrifuge

tube. One hundred pi of Buffer NE [109] was added to the column for 2 min

followed by centrifugation at 16,170xg for 1 min to elute purified probe. The

radioactivity of the probe was checked by scintillation counting.

Hybridization Procedure

The hybridization solution (BD ExpressHyb + sheared salmon testes DNA

heated at 95°C for 5 min) was prewarmed at 68°C. The membrane was

prehybridized for 30 min with continuous agitation at 68°C. To prepare the probe

for hybridization, 5 pi Cot-1 DNA [109] was added to the entire pool of labeled

probe followed by incubation in a boiling (95-100°C) water bath for 2 min. Next,

the probe was incubated on ice for 2 min. The probe was added to the

membrane and hybridized overnight with continuous agitation at 68°C.

The next day, the array membrane was washed with continuous agitation

at 68°C with Wash Solution 1 (2X SSC, 1% SDS; 3 X30 min washes) and Wash

Solution 2 (0.1X SSC, 0.5% SDS; 1X 30 min wash). The final 5-min wash was

performed in 200 ml of 2X SSC with agitation at room temperature. The blot was

wrapped with plastic and exposed to phosphorimager plates at room

temperature.


31

Analysis

The phosphor imager plates were scanned after a 3 day exposure to

radio-active blots. Atlas Image software (Clontech, Palo Alto, CA) was used to

analyze the scanned blots. According to manufacturer’s instructions, the signals

from cDNA spots were normalized to a panel of three house-keeping genes

(GAPDH, cytoplasmic [3-actin, 60S ribosomal protein L13A) on the same blot.

The software takes into account the changes in the level of multiple house

keeping genes and corrects the test gene signals accordingly. This provides a

more accurate normalization of test genes as compared to using a single house

keeping gene for normalization. Three housekeeping genes that were relatively

unaffected by the treatment were selected to increase the accuracy of

normalization. The ratios of normalized gene-expression values for CytB treated

and untreated control were prepared. Arbitrarily, either more than a 2-fold

increase or more than 50% inhibition in gene-expression were considered

significant. The genes that failed to show a signal in either of the blots or showed

a near-background signal were excluded from the analysis.

Western blot analysis

Western blot analysis was performed using alkaline phosphatase or

enhanced chemiluminescence detection as described below.

Electrophoresis

Since PAI-1 is secreted upon synthesis, conditioned media in which the

cells were cultured was used to detect changes in PAI-1 protein. Equal amounts

of conditioned media were analyzed. After a 1:10 dilution of conditioned media in


32

1X sample buffer (0.12M Tris 1.51 g, 2% SDS, 10% glycerol, pH 6.8), 20 pi of

diluted samples per lane were electrophoresed on reducing polyacrylamide gels

at 4°C. Proteins were separated first on 4% stack gel at 50 V for 30 min and

then on 11 % resolving gel at 200 V for 90 min. The gels were run in tank buffer

(Tris: 3.04 g/l, Glycine 14.4 g/l, SDS 1 g/l) at4°C. An HRP-labeled molecular

weight marker, MagicMark (Invitrogen, Carlsbad, CA) was run on each gel along

with the samples. The samples were transferred onto PVDF overnight at 15 V in

cooled (4°C) Western blot buffer (Tris 3 g/l, Glycine 14.5 g/l, methanol 20%).

Immunodetection

Alkaline-Phosphatase Detection

After overnight transfer, membranes were washed five times with dH20 to

remove excess methanol. Membranes were blocked overnight with 5% milk in

high salt-TBS (Tris 20 mM, NaCI 500 mM). After two 10-min washes with TBS-

Tween (Tris 20 mM, NaCI 500 mM, Tween 20 0.05%, pH 7.5), membranes were

incubated one hour each at room temperature, first with goat anti-PAI-1 antibody

(American diagnostica, Stamford, CT) diluted 1:500 in TBS/Tween and then with

a biotinylated secondary anti-goat antibody (Pierce, Rockford, IL) diluted 1:500 in

TBS-Tween. Between and after incubations with antibodies, membranes were

washed four times for 15 min each with TBS-Tween. After washing, PAI-1

antigen was detected using the Vectastain ABC system (Vector laboratories,

Burlingame, CA). Blots were incubated for one hour with Vectastain ABC reagent

for alkalaline phosphatase detection. Blots were washed twice for 15 min each

wash with high salt TBS-Tween and once for 15 min with high salt TBS. After


33

briefly washing membranes with BCIP-NBT buffer (Tris 0.1 M, MgCI2 0.5 mM, pH

9.5), BCIP-NBT detection reagent (Bromo Chloro Indolyl Phosphate-Nitrozolium

Blue in BCIP-NBT buffer) was added to the membrane. After a sufficient amount

of signal was obtained, blots were washed with dH20 and air-dried.

Enhanced Chemiluminescence Detection

After overnight transfer, membranes were washed five times with dH20 to

remove excess methanol. Membranes were blocked for one hour with NAP-Sure

Blocker (Geno Technology, St. Louis, MO). Membranes were incubated one hour

each at room temperature, first with Goat Anti-PAI-1 antibody (American

diagnostica, Stamford, CT) diluted 1:1000 in TBS/Tween and then with horse

raddish peroxidase (HRP)-labeled secondary anti-goat antibody (Jackson

Immunoresearch, West Grove, PA) diluted 1:20,000 in TBS/Tween. Anti-tPA

antibody (PAM-3 clone, American diagnostics, Stamford, CT) was used at 1:200

dilution and anti-uPa antibody (American diagnostics, Stamford, CT) was used at

1:1000 dilution. HRP-labeled secondary antibodies were used at 1:20,000

dilution. Between blocking and incubations with antibodies, membranes were

washed once for 15 min and twice for 5 min with TBS/tween ( Tris 20 mM, NaCI

500 mM, Tween 20 0.05%, pH 7.5) At the end of the incubation with the

secondary antibody, membranes were washed once for 15 min and four times for

5 min with TBS/Tween. Substrate buffer from Enhanced Chemiluminescence

Western blotting analysis system (Amersham Biosciences, Piscataway, NJ) was

added to the blots for one minute to detect HRP-signal on the membrane. X-ray


34

films were exposed to the blot for varying amounts of time to detect optimum

signal from the blot.

Analysis

X-ray films were scanned on a flatbed scanner with a transparency

adapter and analyzed using NIH Image software, available on the internet at

http://rsb.info.nih.gov/nih-image/Default.html (National Institute of Health,

Bethesda, MD).

Northern Blot Analysis

Northern blot analysis for PAI-1 mRNA was performed using partial a PAI-

1 cDNA as probe (Clontech, Palo Alto, CA).

Electrophoresis

Ten pg total mRNA was incubated with 5.4 pi 6M glyoxal, 16 pi DMSO,

3.0 pi 0.1 M Sodium Phosphate at 50°C in heat block for 1 hr. Samples were

cooled to 0°C on ice. After adding 4 pi loading dye, samples were run on a 1.2 %

agarose gel with ethidium bromide in running buffer (1.9 ml 1M NaH2P04, 6.1 ml

1M Na2HP04,990 ml DEPC H20) at 50 V for 30 min to allow all the samples to

migrate out of the well and into the gel. Next, the gel was run at 75 V for

approximately 3 hours with buffer circulation. A digital photograph of the gel was

taken using Eagle Eye II (Stratagene, LA Jolla, CA) under UV light to document

18S/28S loading in each lane. RNA was transferred onto positively-charged

nylon membrane (Roche, Indianapolis, IN) overnight in 1X TAE (Tris 4.84 g/l,

Glacial Acetic Acid 1.14 g/l, EDTA 0.744) at 25 V and 4°C.


http://rsb.info.nih.gov/nih-image/Default.html

35

UV Cross linking

After overnight transfer, the membranes were air dried for 10 min. RNA

was cross-linked to membranes using UV cross-linker 1800 (Stratagene, LA

Jolla, CA) at 120 m Joules. Hybridization was then performed or the membrane

was stored at -20°C for probing at a later time.

Hybridization

The blots were incubated at 42°C for 1 hr to overnight in pre-hybridization

solution (5%Formamide, 5X SSPE, 5XDenhardt’s, 0.1 mg/ml Salmon Testes

DNA, 0.5% SDS) in a Techne Hybridizer HB-2D hybridization oven (Burlington,

NJ). After sufficient pre-hybridization, 25-50 ng/ 2 pi PAI-1 cDNA probe (0.5 pi in

case of 18S fragment) (Clontech, Mountain View, CA) was brought up to 15 pi

using DEPC H20. Probe was denatured in boiling H20 for 15 min. While probe

was denaturing, the following reagents from Random Primer DNA Labeling

System ( Invitrogen, Carlsbad, CA) were combined in a final volume of 49 pi on

ice: 2 pi dATP, 2 pi dGTP, 2 pi dTTP, random primer buffer solution (0.67 M

HEPES, 0.17 M Tris-HCI, 17 mM MgCI2, 33 mM 2-mercaptoethanol, 1.33 mg/ml

BSA, 18 OD260 units/ml oligodeoxyribonucleotide primers, pH 6.8), 32P-dCTP

(approximately 50 pCi or 20pCi for the 18S probe). The denatured probe was

immediately transferred to ice and the probe added to the preassembled labeling

mix. To the probe mix, 1 pi Klenow fragment (3U/pl) was added and mixed

gently. Probe synthesis was allowed at 37°C for 30 min and then stopped with 5

pi stop buffer (0.5 M EDTA, pH 8.0). Radio-labeled probe was denatured by


36

boiling at 100°C for at least 10 min. While the probe was being labeled, the pre

hybridization solution was replaced by 10 ml hybridization solution per blot (50%

Formamide, 5X SSPE (NaCI 43.8 g/l, Na phosphate (mono) 6.9, EDTA 1.9 g/l,

pH 7.4), 5X Denhardt’s (Ficoll 1 g/l, polyvinylpyrrolidone 1 g/l, BSA 1 g/l), 0.11

mg/ml Salmon Testes DNA, 0.5% SDS, 4% Dextran Sulfate). Radio-labeled

probe was carefully added to the tube and the probe was hybridized with the blot

in hybridization oven overnight at 42°C.

Washing

After overnight hybridization, blots were washed twice for 10 min each with 100

ml 5X SSPE (NaCI 43.8 g/l, Na phosphate (mono) 6.9, EDTA 1.9 g/l, pH 7.4) and

0.5 % SDS to remove non-specific binding. Blots were washed for 5 min at 65°C

in 0.5% SSPE and 1% SDS. If the blots were still radioactive at the edges, an

additional wash with 0.1X SSPE and 1% SDS was performed for 5 min at 65°C.

The blots were wrapped in saran wrap and exposed to a phosphor-imaging

cassette (Molecular Dynamics-Amersham, Piscataway, NJ). For PAI-1 mRNA

detection, the phosphorimager plates were scanned after 2-3 days.

The membranes were stripped before probing for 18S. The blots were

washed in 50-100 ml nearly boiling DEPC H20 for 15 min 2-3 times.

18S Hybridization

The membranes were probed with radio-labeled 18S fragment using the

Northern blot protocol described above. The blots were exposed to phosphor

imager plates for 30 min to few hours.


37

Analysis

The blots were scanned using phosphor imager scanner. The densitometric

analysis for PAI-1 bands was performed using Image Quant Software (Molecular

Dynamics-Amersham, Piscataway, NJ).

Immunocytochemistry

Adherent cells on coverslips were immunofluorescently stained using a

two-day protocol. For PAI-1 staining, cells were plated on serum-coated dishes in

serum-free media.

At the end of desired period of treatment, cells were washed 3 times with

2 ml Hank’s balanced salt solution. Cells were fixed with 2 ml 3.7%

paraformaldehyde in PBS ( monobasic sodium phosphate 0.5 g/l, dibasic sodium

phosphate 2.3 g/l, NaCI 8.5 g/l) at room temperature for 10 min.

Paraformaldehyde was washed off with 3x 2 ml washes with TBS. Cells were

permeabilized with 2 ml 0.5% Triton X-100 in TBS (Tris 25 mM, NaCI 0.9%, pH

7.5) for 5 min at room temperature, after which they were washed 3x with 2 ml

TBS. Cells were incubated with 5% blocking milk (centrifuged at 13,370 G for 1

hour) in TBS for at least one hour at room temperature. Coverslips were

incubated with primary goat anti-PAI-1 antibody diluted 1:100 in milk-TBS

overnight at 4°C in a humidified chamber.

After overnight incubation, coverslips were washed 1x with milk and 2x

with TBS for 10 min each. Coverslips were incubated with secondary antibody

Biotinylated anti-Goat diluted 1:100 in milk-TBS for 2 hr at 37°C in a humidified

box. Excess antibody was washed off once with milk and twice with TBS for 10


38

min each. Coverslips were incubated with mixture of FITC-avidin and Texas red

phalloidin diluted 1:200 in TBS at 37°C for 1 hr. Cells were washed 3x with TBS

briefly and then once with 1 iM TBS-Biotin (10 ml TB S /1 00jj.I 1mM biotin).

Finally after washing once with dH20, excess water was drained off. Coverslips

were air dried and mounted on glass slide with 25 (j,l gelvatol.

Images were captured using a Spot digital camera attached to a

fluorescent microscope.

Quantitative Real-time Polymerase Chain Reaction (PCR)

Principle of Quantitative real-time PCR

In real-time PCR, amplification of DNA is monitored during each cycle

allowing accurate quantitative estimation of nucleic acid concentration. The cycle

number at which the signal starts to increase exponentially over the background

is called the crossover point. Comparison of crossover points of samples with

those of known concentrations of standard cDNAs gives the concentration of a

particular template in the sample. Relative quantification with external standards

as a method for comparing gene expression was used in this study. In this

method of quantification, a reference, typically a house-keeping, gene is used to

normalize the concentration of the target gene. First, the concentrations of target

and reference genes are obtained by using an external standard curve of known

amounts of nucleic acid. The results are expressed as target/reference ratio. The

use of an endogenous control, corrects for the factors affecting PCR efficiency.

Following is the protocol used in this study.


39

RNA Isolation and Quantification

Total cellular RNA was isolated using TRIzol method as described earlier

and quantified using a UV spectrophotometer.

DNAse treatment

The protocol for real time PCR analysis was modified from a previous

protocol [110]. Briefly, 1 pg total RNA sample was DNAse treated and

subsequently reverse transcribed using specific anti-sense primers for PAI-1 and

Ubiquitin (UBC, reference gene) in the same reaction (Table 2). In a typical

reaction, a total of 4 pg mRNA was treated with 4 pi of 1 U/pl DNAse I

(Invitrogen, Carlsbad, CA) in the presence of 2 pl of 10 x reaction buffer in a total

reaction volume of 20 pl. After a 15-minute incubation at room temperature,

DNAse treatment was stopped by incubating the mixture at 65° C for 10 min with

2 pl of 25 mM EDTA. DNAse-treated total RNA was stored at -80° C until further

use in the reverse transcription (RT) reaction.

RT reaction

DNAse treated mRNA was reverse-transcribed using a thermocycler (MJ

Research, Reno, NV). The test gene and housekeeping gene were reverse-

transcribed simultaneously using their specific anti-sense primers in the same

reaction. Performing RT for both genes, the gene of interest and the reference

gene, in the same reaction minimizes the error due to the efficiency of the RT

reaction and hence provides a good way of normalizing for a reference gene in

the RT reaction. 1 pg of DNAse treated RNA (1 pg/5 pl) was reverse transcribed

in a final reaction volume of 25 pl. The reaction mix also contained RT buffer


40

(Promega, Madison, Wl), 60 U RNAse inhibitor, 3 pM anti-sense primer for

sample gene, 3 pM anti-sense primer for Ubiquitin, 10 pM DTT and 500 pM

dNTPs. Reverse transcription reaction was performed at 37°C for one hour in a

thermocycler followed by heat inactivation of the enzyme at 70°C for 10 min. RT

products were immediately used for real-time PCR analysis on the Roche

lightcycler PCR instrument.

Preparation of cDNA standards for real time PCR

The standards for the quantification were prepared as described

previously [110], by amplifying 10-fold serial dilutions of known concentrations of

templates for each gene. Briefly, cDNA was prepared for each gene from 1 pg

human mesangial cell total RNA using specific anti-sense primers and amplified

using a PCR reaction for 35 cycles. PCR products from 5 identical reactions for

the same gene were pooled in a single tube. An aliquot of PCR products was run

on 8% acrylamide to confirm the product size. PCR products were purified using

“High pure PCR products purification kit” (Roche Diagnostics, Indianapolis, IN).

The concentration of purified PCR products was measured using picoGREEN

dsDNA quantification kit (Molecular probes, Eugene OR) [111]. Briefly, a 2 pg/ml

stock solution of lambda dsDNA standard was prepared in TE (10 mM Tris-HCI,

2 mM EDTA, pH 7.5). The stock solution was diluted in duplicate vials with TE to

provide 0, 1.25, 2.5, 6.25, 12.5, 18.75 and 25 pg/pl concentration of standard.

Duplicate vials containing 1 jal or 2 pl of test sample in a final volume of 1000 pl

TE were prepared. To each vial 1 ml of PicoGreen dsDNA quantitation reagent

[111] was added for 5 min. The vials were incubated in dark. After incubation,


41

fluorescence from the standards and the samples were measured using a

fluorometer using an excitation wavelength of 480 nm and emission wavelength

of 520 nm. The values for standard concentrations were plotted on a graph. The

concentration values for samples (pig/pil) were derived using the linear graph

equation.

After fluorometric measurement, the concentration of purified product was

adjusted to 5000 pg/pl. Ten-fold serial dilutions of PCR products were prepared

to cover a range from 0.001 pg to 1 ng for the standard curve. These serial

dilutions were amplified on lightcycler using specific parameters for each gene.

Melting curve analysis was performed at the end of the PCR run to ensure the

purity of the product and to eliminate the possibility of primer-dimers. Roche

Lightcycler software was used to prepare a standard curve. The identities of

PAI-1 and ubiquitin cDNAs were confirmed by sequencing (Midland Sequencing,

Midland, TX)

Real-time PCR

After diluting RT products 1:10 in dH20, 2 pl of diluted sample was

amplified using the LightCycler (Roche, Indianapolis, IN). Each gene of interest

and the reference gene were analyzed in separate glass capillaries. The

reactions were set up in the capillaries in a final volume of 20 pl, which contained

2 pl of standard or diluted sample, MgCL (4 mM for PAI-1 or uPA, 1 mM for tPA),

1 pM each of both the primers (table 2) and 10 pl of 2x SYBR green PCR mix

(Qiagen, Valencia, CA). The hot start method was used to initiate PCR reaction


42

Table 2. Primer sequences for real-time PCR analysis

Gene Sense Primer (5’-3’) Anti-Sense Primer (5’-3’)

PAI-1 TGCTGGTGAATGCCCTCTACT CGGTCATTCCCAGGTTCTCTA

UBC ATTTGGGTCGCGGTTCTTG TGCCTT GACATT CT CGAT GGT

TPA CCCCAGGCAAACTTGCAC GCCTTT GCAGT GT CTT CT GAA

uPA CACGCAAGGGGAGATGAA ACAGCATTTTGGT GGT GACTT


43

by heating the samples at 95° C for 15 min prior to PCR cycling. The following

cycling parameters were used for the amplification: denaturation at 95° C for 15

s, annealing at 60° C (PAI-1, uPA) or at 56° C (tPA) for 5 s, and extension at 72°

C for 18 s. Samples were amplified for 35 (PAI-1, tPA) or 40 cycles (uPA). Gene

amplification was monitored in real-time with SYBR green dye. The crossing

points of sample genes were compared against the crossing points of known

standards to determine the absolute concentration of a gene in a particular

sample. Values for the gene of interest were normalized to Ubiquitin amplified

from the same sample. At the end of PCR cycling, the melting curve of the

products was analyzed to ensure the specificity of the reaction. PCR products

from representative experiments were run on the gel and visualized by ethidium

bromide staining to further ensure the specificity of the reaction.

Table 2 shows the primers used for real-time PCR analysis of PAI-1, tPA,

uPA and Ubiquitin. The primers for PAI-1, uPA and Ubiquitin were purchased

from a commercial vendor (Midland Reagents, Midland, TX) using previously

published primer sequences [110]. The protocol for tPA detection was developed

in our lab using the primers designed and synthesized by TIB Molbiol LLC

(Adelphia, NJ).

Melting curve analysis

Melting curve analysis was performed at the end of each run to ensure

specific amplification of a single product in three steps:

a. Rapid heating to 95°C to denature all the DNA present in the mixture


44

b. Cooling to below annealing temperature to allow formation of double

stranded DNA.

c. Gradual heating to 95°C to melt double stranded DNA

Melting curve analysis showed a single peak suggesting a pure population

of PAI-1, tPA, uPA and UBC cDNA in PCR products. The PCR products were run

on a gel to confirm the size of the product and to detect the purity of the reaction.

Subsequently, products from representative experiments were run on a gel to

ensure amplification of single template of expected size.

Cloning of PAI-1 promoter

PCR cloning of the promoter

The PAI-1 promoter containing major regulatory elements as listed in chapter 6

was cloned from human mesangial cells using specific primers. Human genomic

DNA was isolated from primary culture human mesangial cells using a DNA

isolation kit (Clontech, Palo Alto, CA). Primers for a 1106 bp promoter (- 973 to

+133) were purchased from a commercial vendor (Midland Reagents, Minland,

TX) as published by Grenette et al [112].

Forward primer: 5’-CGATCGGTACCTAAAAGCACACCCTGCAAAC-3’

Reverse primer: 5’-CGATCAGATCTCAGAGGTGCCTTGCGATTG-3’

A total of three reactions were set up with 2 pg genomic DNA, 4 pg DNA or no

DNA. The reactions were set up in a 100 pl reaction mix containing 150 pmol of

sense and anti-sense primers, 1.5 mM MgC^and 1 pl platinum taq polymerase.

PCR reaction was performed for 30 cycles using the following parameters:


45

denaturation at 94°C for 45 seconds, primer annealing at 58°C for 45 seconds

and primer extension at 72°C for 45 seconds. An additional 5-min incubation at

72°C was performed to complete the reaction. PCR products from all three

reactions were run on a 1% agarose gel in TAE buffer (Tris 4.84 g/l, Glacial

Acetic Acid 1.14 g/l, EDTA 0.74 g/l) to ensure the product size. Bands were seen

at the expected sizes of 1100 bp. No bands were seen in the negative control,

which contained no DNA.

Ligation

Next, pGL3 basic vector (restriction sites at 5 and 36) and PCR products

(restriction sites in cloning primers) were cut with Kpnl and Bgl II restriction

enzymes. Digested fragments were cleaned with geneclean spin kit (Qbiogene,

Carlsbad, CA). The approximate concentration of digested fragments was

determined by comparing the densities of bands with the density of ladder.

Sticky ends of PAI-1 promoter were ligated into pGL3 basic vector at an insert:

vector ratio of 1:3 using either 2 pl or 4 pl DNA ligase (1 U/pl) in a final volume of

15 pl at room temperature overnight. Top 10 competent E. coli were transformed

with pGL3 vectors to select the plasmid containing the PAI-1 promoter. The

transformed Top 10 competent cells were grown on ampicillin plates overnight.

Representative colonies of bacteria were inoculated into 10 ml of LB media

(Bacto-tryptone 10 g, Bacto-yeast extract 5 g, NaCI 5 g, dH20 1 L, pH 7.0)

containing 125 pg/ml ampicillin and incubated overnight at 37°C with vigorous

shaking. The tubes were incubated on ice for 30 minutes. Bacteria were

harvested by centrifugation at 1540 G for 15 min at 4° C. The pellet was washed


46

in 1 ml ice-cold STE buffer (100 mM NaCI, 10 mM Tris, 1 mM EDTA, pH 8.0)

followed by centrifugation at 281 Oxg for 15 min at 4°C. The pellet was

resuspended in 300 pl of Buffer P1 (50 mM Tris, 10 mM EDTA, pH 8.0). Next,

300 pl of Buffer P2 (200 mM NaOH, 1 % SDS) was added with gentle mixing.

Finally, 300 pl Buffer P3 (2.55 M Potassium Acetate adjusted to pH to 4.8 with

acetic acid) was added with gentle mixing. The tubes were centrifuged at

15,000xg for 15 min at 4° C. The supernatant was transferred to a fresh, sterile

microfuge tube. Plasmid DNA was precipitated by incubation with 800 pl of 100%

isopropanol at room temperature for 30 minutes. The tubes were centrifuged at

16,000 G for 10 min at 20° C. The pellet was washed twice with 70% ethanol

followed by centrifugation at 16,000xg for 10 min at 20°C. The pellet was dried

under vacuum and resuspended in 100 pl of sterile dH20 containing 1 pl of

RNAse A (1 pg/pl). The plasmid concentration was measured by measuring

260/280 absorbance with a UV spectrophotometer.

A restriction enzyme digest of the isolated plasmid with Kpnl and Bglll was

set up to ensure that the isolated plasmid contained the desired PAI-1 promoter.

The digested products were run on the gel. The preparation that showed a band

corresponding to expected size of PAI-1 promoter (1106 bp) was presumed to be

the successful cloning of PAI-1 promoter. Sequencing of the insert in this plasmid

confirmed successful cloning of 1100 bp human PAI-1 promoter in pGL3 basic

vector.


47

Transient Transfection

Human and rat mesangial cells were co-transfected with 1 jjg pGL3 vector

containing PAI-1 promoter and 1 pg renilla luciferase vector per well (control for

transfection efficiency). Control cells were co-transfected with empty pGL3 basic

vector and renilla luciferase vectors. Fugene 6 (Roche, Indianapolis, IN) was

used to transfect cells in 6-well pates with PAI-1 promoter. Cells were transfected

at 60-80% confluence with 1 pg PAI-1 promoter-containing plasmid and 1 pg

renilla luciferase plasmid. The cells were serum-starved at the time of

transfection. First, 4 pl Fugene 6 per pg DNA was incubated with 100 pl serum-

free media/well for 15 minutes. Next, 2 pg DNA/well was added to the tube. The

resulting transfection mixture was incubated at room temperature for 30 min.

Meanwhile, the cells were washed and the media was changed to 1 ml fresh

serum-free media. To each well 100 pl Fugene-DNA complexes were added

drop wise. After three hours of transfection, CytB was added to appropriate wells.

After 24 hours, cells were treated with 10 ng/ml TGF(3 for 6 hours.

Luciferase Reporter Assay

Upon completion of the experiments, transfected cells were washed 3

times with ice-cold PBS and 150 pl 1X passive lysis buffer (Promega, Madison,

Wl) was added to each well. Plates were wrapped in Parafilm and frozen at

-80°C for at least 1 hour. Cells were scraped after thawing the plates at room

temperature for 3 min. Lysates were centrifuged at 13,370xg for 1 min at 4°C to

remove cellular debris. After equilibrating to room temperature, 20 pl of

supernatant was added quickly to 100 pl of reporter assay reagent containing


firefly luciferase substrate. Luciferase activity was measured by using TD 20/20

luminometer (Turner Diagnostics, Sunnyvale, CA) set for dual luciferase

detection mode. The sensitivity of the detection was maintained at

manufacturer’s default level (50.9%) for all the assays. The samples were read

after a delay of 2 seconds to allow luciferase activity to begin. The samples were

read for a total of 15 seconds. Stop n Glo buffer (Promega, Madison, Wl) was

added to stop the firefly luciferase activity and to provide substrate for the renilla

luciferase activity. The activity of renilla luciferase was measured on the

luminometer using the same parameters as firefly luciferase on luminometer. In

rat cells, the values for firefly luciferase activity for each sample were normalized

to the values for renilla luciferase for the same sample. In human cells, the

values for renilla luciferase were not detected above the baseline and hence a

different method of normalization was necessary. For human cells, protein

concentration of each sample was determined by BCA protein assay kit (Pierce,

Rockford, IL). Luciferase activity was normalized for the protein concentration of

each sample to get the activity in counts/mg protein for each sample. For each

treatment, cells were transfected at least in duplicates.

Development of chronic glomerulonephritis in experimental animals

The following protocol was approved by the institutional animal care and

use committee of Eastern Virginia Medical School under the title “Prevention of

glomerulosclerosis by rho-kinase inhibition" (Approval # 02-010).


49

Production of injury

Repeated Injections of anti-thymocyte serum (ATS) were used to induce

chromic glomerulonephritis in experimental rats. In three experimental groups,

six male Sprague-Dawley rats were injected with 25 mg/kg sheep anti-thymocyte

serum (30 mg/ml) through tail vein injections. Four weekly injections of ATS were

given to the animals. The ATS injections were immediately followed by injection

of 1.2 ml normal sheep serum as a source of complement. The doses of ATS

were adjusted each week according for the weight gain. A control group (Group

1) of six animals was injected with equal volumes of normal saline.

Treatment

Out of the three groups that received ATS-complement, one group did not

receive any treatment and hence served as the injury group (Group 2). The

remaining two of the three ATS-complement groups received 30 mg/kg/day HA-

1077 in drinking water. The concentration of the drug in the drinking water was

determined according to the average weight of the animal and average daily

water consumption. Within the two treatment groups, one group (Group 3) was

treated from one day before the first injection to see if the treatment prevents the

onset of the injury, whereas the other group (Group 4) was treated one week

after the injury to see if the progression of the disease was altered. The animals

were fed normal rat diet and were allowed to drink ad lib. After four weekly

injections, animals were treated and observed for 6 more weeks (total of 4+6=10

weeks) to allow progression of the chronic disease. At the end of the tenth week,

animals were killed and samples were collected for analyses.


50

Study groups

1: Normal saline injection alone

2: ATS-complement injection

3: ATS-complement+ HA-1077 treatment started 1 day before the first injection

4: ATS-complement+HA-1077 treatment started 1 week after the first injection

Sample collection

Urine

After 24-hour acclimatization in metabolic collection chambers, urine

samples representing next 24-hour urine collection were collected one day

before the first injection and at the end of 2, 4, 6, 8, 10 weeks. The first two

collections showed contamination by food particles and hence, the food was

removed from the chambers for the later set of collections.

Blood pressures

The tail-cuff method was used to measure blood pressure at the end of

the study.

Serum

At the end of the study animals were anesthetized with intraperitoneal

injection of sodium pentobarbital (Nembutal). Blood was collected from

abdominal aorta for serum preparation.


51

Tissue samples

Kidneys were harvested in ice-cold Hanks’s balanced salt solution.

Animals were killed by removal of the heart. One kidney from each animal was

pooled with others from the same group for isolation of glomeruli through

differential sieving method. Most of the glomeruli (90%) were suspended in Trizol

for isolation of RNA and the remaining glomeruli were suspended in

electrophoresis sample buffer for SDS-PAGE and Western Blot analysis. The

second kidney was bisected and one half was cut into thin slices, some of which

were fixed in paraformaldehyde (4% in PBS) overnight, and then snap frozen for

immunohistochemistry. The remaining slices were fixed in 10% buffered formalin

for paraffin section preparation. The other half was cut into multiple thin slices

and snap frozen in Tissue-Tek OCT compound (Sakura Finetek, Torrance, CA)

for immunohistochemistry or laser capture microdissection (LCM).

Histology and Immunohistochemistry

The sections from formalin-fixed tissue were stained with mason trichrome

staining to visualize ECM deposition. The sections from snap frozen tissue were

stained with a-SMA antibody as described in immunocytochemistry section.

Statistical Analysis

The statistical significance of the results was determined using Student’s

paired t-test. A p-value of <0.05 was considered statistically significant.

Experimental variation is reported as standard error of the mean in the bar

graphs (except where indicated differently).


52

CHAPTER 3

PROFILING THE EFFECTS OF ACTIN CYTOSKELETON ON EXPRESSION

OF MULTIPLE GENES

Introduction

As described in chapter 1, studies in this lab showed that changes

in actin polymerization regulate a-SMA expression and hypertrophy in cultured

mesangial cells suggesting that the actin cytoskeleton may regulate

myofibroblast differentiation [28]. The role of the cytoskeleton as an important

regulator of gene expression has also been supported by many other studies.

Studies by Folkman and Moscona on cell-spreading [33], and Ingber on

mechanical transduction and cell functions [34, 113, 114] provided early

evidence for the role of actin cytoskeleton in the gene regulation. More recently

specialized actin cytoskeleton locations have been identified for integration of

signaling such as JNK signaling [39-42], The importance of localization of mRNA

in effective protein translation has also become evident [43], The collective

evidence suggests that the actin cytoskeleton is a highly specialized network of

fibers that precisely regulate multiple cellular responses. But the precise

regulatory pathways and mechanisms have not been characterized. Also the list

of genes that are affected by actin polymerization is far from complete.

The regulatory effect of actin cytoskeleton on a-SMA expression in

myofibroblast differentiation and the evidence from the literature suggested that


53

other genes could also be regulated in a similar manner. Also, the inhibition of

hypertrophy suggested that multiple genes could be simultaneously regulated by

the actin cytoskeleton. It was therefore hypothesized that other genes associated

with the myofibroblast phenotype are also regulated by changes in actin

polymerization. The aim of the next experiment was to identify the effect of the

actin cytoskeleton on a panel of genes related to myofibroblast differentiation.

Experimental model

Recently, DNA arrays consisting of multiple genes spotted on a glass

coverslip or a nylon membrane have become available to facilitate rapid and high

throughput analysis of large populations of genes. Commercially available arrays

contain functionally related genes on the same array allowing a highly relevant,

focused, and time- and cost-effective analysis of gene expression.

Since myofibroblasts are largely responsible for extracellular matrix

production in fibrotic diseases, one such array (cell interaction array) containing

genes related to cell-interaction and extracellular matrix was used to study the

role of actin cytoskeleton in myofibroblast differentiation. The Cell Interaction

array (Clontech, Palo Alto, CA) contains a total of 265 cDNAs immobilized on a

nylon membrane. The genes on this Cell-lnteraction array include extracellular

matrix proteins; cell-cell adhesion receptors; matrix adhesion receptors; growth

factors, chemokines, cytokines and their receptors; neuropeptides; cell surface

antigens; extracellular transporters and carrier proteins; metalloproteinases;

serine proteases; protease inhibitors, oncogenes and tumor suppressor genes;

intracellular transducers, effectors and modulators; G proteins; cell-cycle related


54

proteins and house-keeping genes covering a broad range of relevant gene

population. A detailed list of these genes can be found on the internet at

http://www.clontech.com/clontech/atlas/genelists/7746-1_HuCelllnt.pdf. The gene

expression profile of cells with depolymerized actin cytoskeleton (CytB treated

cells) was compared with that of cells containing intact actin cytoskeleton

(untreated serum-starved cells) as described in Chapter 2.

Results

Actin depolvmerization affects expression of multiple genes

Between control and CytB-treated cells a total of 74 genes were detected

on a 265-gene cell-interaction array, out of which 65 genes were detected in both

the conditions and 9 genes were detected under only control conditions (Fig. 6).

Using an arbitrarily defined criteria of either more than a 2-fold increase or more

than 50% inhibition as a significant change, 10 genes were decreased and 4

genes were increased upon CytB treatment. All 9 genes expressed only under

control conditions were excluded from the final analysis since their expression

was very close to the base-line. Table 3 shows the ratio of signal intensities in

CytB treated cells and untreated control cells in serum-free media. The genes

that decreased after CytB treatment, mainly represented extracellular matrix

components or other molecules that favor increased matrix deposition. In

contrast, 3 of the 4 genes that increased after CytB treatment, decrease matrix

deposition either by direct fibrolysis (tPA, MMP11) or by inhibiting pro-fibrotic

growth factors (decorin). These changes suggest that the overall effect of actin


http://www.clontech.com/clontech/atlas/genelists/7746-1_HuCelllnt.pdf

55

I. Serum-free control

lHouse

keepingGenes"

Negative; control

Figure Key

A. UBCB. KCEP1 C H P R T iD. G A PD HE. T U B A !F. H LA CG. AC TBH. RPL13AI. RPS9

Fig. 6. DNA array analysis of effect of actin depolymerization on gene expression. Serum-starved human mesangial cells were treated with 1.0 pM CytB for 24 hours in serum-free media. 32P-labeled gene-specific probes prepared from cellular poly A mRNA were hybridized with the membrane overnight. After washing, membranes were exposed to phosphorimager plates for 3 days. Scanned blots were analyzed by Atlaslmage software for differences in gene expression (n=1). The top blot represents gene expression profile of cells in serum-free media, whereas the bottom panel represents gene expression profile of cells treated with 1.0 pM CytB. The panel on left shows house-keeping genes and negative control spots. The spots corresponding to PAI-1 (oval) and tPA (rectangle) genes are highlighted for comparison on both the blots.


56

Table 3. Summary of changes in gene expression on DNA array analysis

Gene CytB:S- ratio

A. Genes showing decreased expression after Cytochalasin B treatment

Endothelial plasminogen activator inhibitor-1 precursor (PAI-1) 0.093

Insulin-like growth factor binding protein 5 precursor (IGFBP5) 0.210

Fibronectin receptor alpha subunit (FNRA) 0.310

Insulin-like growth factor binding protein 3 precursor (IGFBP3) 0.314

Tumor metastatic process associated protein (NM23) 0.326

Fibronectin precursor (FN) 0.339

Hypoxanthine-guanine phophoribosyltransferase (HPRT) 0.370

Collagen 3 alpha 1 subunit precursor (COL3A1) 0.382



B. Genes showing increased expression after Cytochalasin B treatment

Tissue-type plasminogen activator precursor (tPA) 2.840

Bone proteoglycan II precursor (PGS2), decorin (DCN) 3.250

Junction plakoglobin (JUP); desmoplakin 3 (DP3) 3.875

Matrix metalloproteinase 11 (MMP11), stromelysin 3 9.000


57

depolymerization favors increased matrix degradation and decreased matrix

accumulation. The net effect may be a decrease in extracellular matrix.

Confirmation of DNA array results using Northern and Western Blotting

The results obtained by the initial screening experiments required both

confirmation and more accurate quantification of the changes using conventional

methods such as Northern blot analysis. The changes in protein expression were

also examined to confirm similar effects on mRNA and protein expression. Out of

14 genes identified by the array experiment, PAI-1 and tPA, the members of

plasminogen activator system, are particularly relevant to the overall objective of

understanding mechanisms of myofibroblast-like differentiation and regulation of

ECM accumulation. PAI-1 is a natural inhibitor of the plasminogen activation by

tPA. CytB not only decreases PAI-1 expression, but also increases tPA

expression. These changes may result in increased and unopposed actions of

tPA leading to more activation of plasminogen into plasmin. Activated plasmin in

turn degrades ECM. Consequently, the balance between tPA and PAI-1

determines the rate of ECM turnover. A relative increase in tPA leads to

increased degradation of ECM. In contrast, a relative increase in PAI-1 leads to

inhibition of ECM degradation and increased ECM deposition as seen in renal

fibrosis. Such an increase in PAI-1 expression and resulting ECM deposition are

associated with myofibroblast-like activation of mesangial cells. Thus, changes in

tPA and PAI-1 expression on gene array are directly pertinent to myofibroblast

differentiation and fibrosis.


58

Therefore, the changes in PAI-1 and tPA expression seen on DNA array

were confirmed first using conventional methods such as Northern blot and

Western blot analyses. mRNAs from cells treated with actin depolymerizing

agents CytB (direct inhibitor of actin polymerization) and Y-27632 (inhibitor of

signal-mediated actin polymerization) were analyzed. The Northern blot analysis

showed two PAI-1 transcripts at 2.8 kb and 3.2 kb positions resulting from two

polyadenylation sites in the PAI-1 gene [115]. The results showed that in

presence of serum (S+ conditions), inhibition of actin polymerization with CytB

decreased PAI-1 mRNA expression in a time and dose dependent manner (Fig.

7). The effect of CytB was apparent at 24 hours and continued at 48 and 72

hours (Fig. 7A). The dose response shows that the minimum dose of CytB

required to produce a visible effect on PAI-1 mRNA was 0.4 pM at 24 hours.

CytB caused >50% inhibition of PAI-1 mRNA expression at 1 pM concentration

(Fig. 7B). We used 1 pM (0.5 pg/ml) CytB for the rest of the study. In serum-

starved cells, inhibition of Rho-signaling by 10 pM Y-27632 also inhibited PAI-1

mRNA expression in a time-dependent manner (Fig. 7C). The effect was evident

as early as 4 hours and continued at 8, 24 and 48 hours. Similar inhibitory effects

of actin depolymerization on PAI-1 protein expression were confirmed in the

laboratory by other investigators. An increase in tPA expression by actin

depolymerization as shown in the array experiment was also confirmed at mRNA

and protein levels by Northern blot and Western blot analyses respectively in the

lab.


59

A

PAi-

B

PAI-

C

PAI-

Fig. 7. Effect of actin depolymerization on PAI-1 mRNA expression in human mesangial cells. (A) Time-course of effect of 1.0 pM CytB (8, 24, 48 and 72 hours) on PAI-1 mRNA expression in serum-fed cells by Northern blot analysis (n=1). CytB treatment blocks PAI-1 expression at 24, 48 and 72 hours, (B) Dose-response analysis of effect of CytB (0.1, 0.2, 0.4, 1 and 2 pM) on PAI-1 mRNA expression in serum-fed cells by Northern blot analysis (n=1). CytB concentrations of 0.4, 1 and 2 pM block PAI-1 mRNA expression. (C) Time- course of effect of 10 pM Y-27632 (8, 24, 48 and 72 hours) on PAI-1 mRNA expression in serum-starved cells by Northern blot analysis (n=1). Y-27632, an inhibitor of Rho-kinase that blocks Rho-mediated actin polymerization, blocks PAI-1 mRNA expression at 24, 48 and 72 hours.

Time (hi 0_ __8_ Cyt B

24 48 72

3.2 kb

2.8 kb

Cyt B (jxM) 0 0.1 0.2 0.4 1 2

1 C3.2 kb

2.8 kb - mm llil

Time (h) 0_ 8Y-27632 - - +

3.2 kb

2.8 kb


60

In summary, the DNA array analysis showed that actin depolymerization

coordinately regulated cell-interaction and ECM-related genes in human

mesangial cells. The inhibition of PAI-1 and increase in tPA expression were

confirmed by Northern blot and Western blot analyses. To further investigate the

mechanisms of actin cytoskeleton mediated regulation of PAI-1 and tPA

expression in pathophysiological context, TGF|3 treatment was used as a model

system as described in the next chapter.


61

CHAPTER 4

EFFECT OF TGFp ON PAI-1 EXPRESSION

Introduction

Results of the array experiment and subsequent confirmation with Northern

and Western blot analysis showed that actin depolymerization changed PAI-1

and tPA in opposite directions. PAI-1 was studied first and in more detail than

tPA because PAI-1 expression has been correlated with myofibroblast

differentiation [19, 25], Moreover, PAI-1 acts as the gatekeeper of the fibrolytic

cascade regulating the activity of plasminogen activators including tPA.

Therefore, functionally changes in PAI-1 expression are more directly related to

tissue fibrosis.

Since transforming growth factor (3 (TGFP) is the major regulator of PAI-1

expression in disease, the ability of actin depolymerization to antagonize its

effect on PAI-1 expression was examined. Also, TGFp was chosen for further

studies particularly since it plays a central role in regulating myofibroblast

differentiation and tissue fibrogenesis [116-120]. In the kidney, expression of

TGFp by mesangial cells increases extracellular matrix (ECM) production and

inhibits matrix degradation [88, 89, 91, 121]. The net result is an increase in

ECM deposition and glomerulosclerosis [90, 122]. Consequently, inhibition of

TGFp signaling was shown to protect against renal fibrosis [88, 123]. It was

therefore important to understand the pathways and mechanisms involved in


62

TGFP-induced fibrosis. Experimentally, serum-free culture conditions were

selected to allow the study of TGFp without other serum-factors.

The overall experimental approach was to induce PAI-1 expression by TGFp

and to determine the effects of changes in actin polymerization on PAI-1

expression in basal as well as TGFp-induced states. Since the effects of growth

factors can vary according to cell-type and cell-culture conditions; the effective

dose, effective time period and the magnitude of effect of TGFP on PAI-1

expression in human mesangial cells were determined first.

Experimental model

Primary cultures of human mesangial cells between passages 5 and 9 (P5-

P9) were used in the study. Initially, the cells were cultured in RPMI media

containing 16.7% fetal bovine serum (FBS). Cells were serum-starved at 60-80%

confluence. After 24 hours of serum starvation, TGFp was added to the cells.

The effects on PAI-1 expression were examined at the indicated time-points.

Serum-free media, being free of other growth factors, allows the study of effects

of TGFp alone. Also, serum starvation increases the stress fiber content of the

cells which is consistent with myofibroblast-like phenotype [26]. The effects of

inhibition of actin polymerization can be easily compared to untreated control

cells that have abundant stress fibers. A culture in serum-free media helps in

studying the regulation of basal expression of PAI-1, where as treatment with

TGFp allows the study of induced PAI-1 expression.

To determine the optimum dose of TGFp and the optimum duration of

treatment, human mesangial cells were treated with increasing doses of TGFp


63

for 0, 1, 2, 4, 8, 24 and 48 hours. At each time point, supernatants (conditioned

media) were stored for detection of PAI-1 protein and the cells were lysed in

TRIzol for RNA isolation. PAI-1 protein was detected from conditioned media

using Western blot analysis with enhanced chemiluminescence detection,

whereas PAI-1 mRNA was detected using quantitative real-time RT-PCR.

Results

Quantification of PAI-1 mRNA using real-time PCR analysis

PAI-1 mRNA from cultured human mesangial cells was successfully

detected by a reverse transcription reaction in a thermal cycler (MJ Research,

Reno, NV) followed by a quantitative real-time PCR analysis on Roche

Lightcycler (Roche Diagnostics, Indianapolis, IN). The Lightcycler instrument

measures fluorescence emitted by SYBR Green I, a double-stranded DNA

binding dye, at the end of each cycle during the log-linear phase of the PCR and

generates an amplification curve by plotting changes in fluorescence intensities

against cycle number (Fig. 8A, Fig. 9A). The cycle at which the fluorescence

signal rises above the background signal is called the crossing point, which is

directly proportional to the concentration of the target DNA. The crossing point for

an unknown sample can be compared to crossing points of known standards for

quantification of sample concentration. The values for PAI-1 concentration were

derived in picograms, which were further normalized to similarly obtained values

for a reference gene, ubiquitin (UBC), in each sample. Ubiquitin was selected as

the reference or house-keeping gene because it is expressed constitutively in the

cells and its level did not change upon the experimental treatments (refer to table


64

Standard CurveAmplification Curve

60-r = -1.00

Slope = -3.77cDNA template0.001 pg -------------

0.01 pg -------------0.1 pg -------------

1 pg ------------ :10 pg — y15-

15 20 25 30 35Cycle Number Log Concentration

Melting PeakMelting Curve

Temperature (°C)Temperature (°C)

Fig. 8. PAI-1 standard curve for quantitative real-time PCR analysis. (A)Amplification of PAI-1 plotted as fluorescence vs. cycle number. Each sample is represented in a uniquely colored line on the real-time PCR software, allowing tracing of amplification of individual samples. (B) PAI-1 standard curve plotted as cycle number vs. log concentration showing a linear standard curve (r= -1). (C) Real-time monitoring of melting curve analysis of PCR products plotted as fluorescence vs. cycle number showing only one PCR product corresponding to PAI-1. (D) Melting curve analysis data plotted as changes in fluorescence signal overtime (dF/dT) vs. temperature. Presence of only one melting peak in this reaction corresponding to melting temperatures of PAI-1 (-85.5 C) indicates specificity of the amplification reaction and absence of primer-dimers.


65

4). Also it is expressed at relatively lower levels, which is a desired property for

real-time PCR analysis allowing detection of smaller changes in the expression

unlike genes that are too abundant in the cells such as 18S.

Standard curves for PAI-1 and UBC were developed by performing real

time PCR on known concentrations of purified cDNA (Fig. 8, Fig. 9). For every

experiment, one purified standard cDNA (0.01 pg for PAI-1 and 100 pg for UBC)

with similar crossing point as a representative experimental sample was also run

with the samples. The sample concentrations were calculated by the software in

a two-step process. First, the software compared the crossing point of the known

standard in each experiment with the previously saved standard curve to account

for the PCR efficiency. Next, the concentrations of the unknown samples were

derived by comparing the sample crossing point to the standard crossing point.

Following completion of the PCR, a melting curve analysis of PCR

products was performed by the instrument to confirm the purity of the reaction.

Melting curve analysis measures changes in fluorescence intensities as the

temperature is gradually increased. Separation of double stranded DNA with

increasing temperature caused an initial gradual fall in the fluorescence signal

followed by a precipitous fall (Fig. 8C, Fig. 9C). When these changes in

fluorescence intensity with time were plotted against the temperature, a melting

peak corresponding to the maximum changes in signal intensity (dF/dT) at

melting temperature (Tm) was seen (Fig. 8D, Fig. 9D). The number of melting

peaks in each reaction indicates the number of target sequences being amplified.

A unique peak at the melting temperature of the target sequence indicated


66

Fluo

resc

ence

o

^

w ti

o ui

o

Amplification Curve A

cDNA template0 1 pg ,

30-J j28 -§2 6 -£ 2 4 -7322-0 2 0 -

18'-1 .

Standard Curve R

r= -1.00 Slope = -3.54

“V

Ip g ----------------------------------►10 pg ------------------------- /■ ’ • - *■

50 pg ---------------------- -----►100 pg -----------------~ 7~ + ’

0 4 8 12 16 20 24 28 32 36

Cycle Number

0 -0.4 0.2 0.8 1.4 2.0 2.6

Log Concentration

Fluo

resc

ence

M M

W 4

Ui

50

00

00

00

......

......

......

......

......

.....

Melting Curve C.... Different concentrations of § 24-

! » -y 16-S 12- 8 8 "

u A -Sx 4o

1 ° -

Melting Peak DMelting temperature (Tm) K

Different concentrations o f / ! i | cDNA templates / ! | |

- ” ■■ ■ — " | V —U I I I I I I

66 70 74 78 82 86 Temperature (°C)

1 1 1 1 1 68 72 76 80 84

Temperature (°C)

Fig. 9. UBC standard curve for quantitative real-time PCR analysis. (A)Amplification of UBC plotted as fluorescence vs. cycle number. Each sample is represented in a uniquely colored line on the real-time PCR software, allowing tracing of amplification of individual samples. (B) UBC standard curve plotted as cycle number vs. log concentration showing a linear standard curve (r= -1). (C) Real-time monitoring of melting curve analysis of PCR products plotted as fluorescence vs. cycle number showing only one PCR product corresponding to UBC. (D) Melting curve analysis data plotted as changes in fluorescence signal over time (dF/dT) vs. temperature. Presence of only one melting peak in this reaction corresponding to melting temperatures of UBC (~82°C) indicates specificity of the amplification reaction and absence of primer-dimers.


67

absence of non-specific amplification and primer-dimers in the reaction. As an

added quality control measure to ensure the size of the product and to rule out

non-specific amplification, the PCR products from standard curve samples and

representative experimental samples were run on 8% agarose gel (Fig. 10, Fig.

11D). Gel electrophoresis was used as a quality control tool only to visualize the

number and size of products in each reaction. It was not used for quantification of

mRNA.

Figures 8 and 9 show standard curves for real-time PCR analysis of PAI-1

and UBC respectively. Figure 10 shows gel electrophoresis of PCR products

from PAI-1 and UBC PCR standard curves.

TGFB dose-response on PAI-1 mRNA expression

The effect of TGFp on PAI-1 mRNA were studied using real-time

quantitative PCR analysis with lightcycler PCR instrument. Figure 11 shows a

representative real-time monitoring of PAI-1 and UBC amplification at the end of

each cycle in panel A. Panels B and C represent melting curve analysis of PAI-1

and UBC at the end of PCR cycling showing a single peak each for both the

genes. Panel D show gel electrophoresis of PCR products showing a single

product for each gene correlating with the expected band size.

To determine the effective dose of TGFp, human mesangial cells were

serum-starved at 60-80% confluence. After a 24-hour serum-starvation, 1, 2, 5,

7.5 or 10 ng/ml TGFp was added to serum-free media for 8 hours. Total cellular

RNA was isolated using TRIzol method. The changes in PAI-1 mRNA expression

were detected using quantitative real-time RT-PCR analysis. In two separate


B UBC

UBC (133 bp)4

concentration ('pg)

Fig. 10. Gel-electrophoresis of standard curve PCR products. Aliquots of PCR products (2 pi out of 20 pi total) were run on 8% acrylamide gel followed by ethidium bromide staining. (A) PAI-1 and (B) UBC PCR products show a single band at expected base-pair location confirming specific amplification of respective templates.


69

Amplification Curve M elting Curve80-70-60-50-40-30-20-

10-

6 0 -5 0 -4 0 - Samples and

standards3 0 -UBC PAI-120 -

10-Crossing points

o-

Temperature (°C)Cycle Number

M elting Peak

u b c A i

Gel Electrophoresis20-

PAI-1

P A I-1 I B(Temperature (°C)

Fig. 11. Representative images from quantitative real-time PCR of PAI-1 and UBC from experimental samples. (A) Amplification of PAI-1 and UBC plotted as fluorescence vs. cycle number. Each line is represented in different color on the real-time PCR software, allowing tracing of amplification of individual samples. The crossing points for both PAI-1 and UBC fall within the bars marking approximately cycles 15 and 22. (B) Real-time monitoring of melting curve analysis of PCR products plotted as fluorescence vs. cycle number showing two PCR products corresponding to PAI-1 and UBC. (C) Melting curve analysis data plotted as changes in fluorescence signal over time (dF/dT) vs. temperature. Presence of only two melting peaks in this reaction corresponding to melting temperatures of UBC (~82°C) and PAI-1 (~85.5°C) indicate specificity of the amplification reaction and absence of primer-dimers. (D) Gel electrophoresis of PCR products from representative experimental samples show a single PCR product of expected base-pair size in each reaction.


70

experiments, treatment with 1, 2, 5, 7.5 and 10 ng/ml TGFp increased average

PAI-1 mRNA expression to 381.9%, 323.1%, 443.3%, 485.1% and 287.9% of

untreated control respectively (Fig. 12A).

TGFB dose-response on PAI-1 protein expression

To determine the effective dose of TGFp on PAI-1 protein expression,

human mesangial cells were serum-starved at 60-80% confluence in 2-wells per

condition in 6-well plates. After 24-hour serum-starvation, 1, 2, 5, 7.5 or 10 ng/ml

TGFP was added to serum-free media for 24 hours. Conditioned media was

analyzed for changes in PAI-1 protein using Western blot analysis. In a single

experiment, treatment with 1, 2, 5, 7.5 and 10 ng/ml TGFp changed average PAI-

1 protein expression to 125.9%, 100.9%, 79.3%, 133.6% and 283.6% of

untreated control respectively (Fig. 12B). The maximum increase in PAI-1 protein

was seen with 10 ng/ml TGFp. Although TGFp showed an effect at lower

concentrations, it was inconsistent. Fan et al. previously showed that renal

tubular epithelial-myofibroblast transdifferentiation in vitro required TGFp at

concentrations between 10 to 50 ng/ml [119]. Others have also shown 10 ng/ml

TGFp as an effective dose [124, 125], The effectiveness of higher concentration

of TGFp correlates with high serum TGFp levels seen in patients with chronic

and end-stage renal disease [126].

Since 10 ng/ml TGFp showed consistent effects on both mRNA and

protein expression, that dose was used in the remaining experiments.

Previously, Motojima et al. also reported 10 ng/ml TGFp to be the most effective

dose for the induction of PAI-1 in rat mesangial cells [82],


71

TGFB time-course of PAI-1 mRNA and protein expression

To determine the optimum length of time of TGF|3-treatment for maximum

PAI-1 mRNA and protein expression, human mesangial cells were serum-starved

at 60-80% confluence and after 24-hours of serum starvation, 10 ng/ml TGF(3

was added to serum-free media for 1,2,4, 8, 24 and 48 hours. At each time

point, conditioned media were saved for protein analysis and cells were used for

RNA analysis. In three separate experiments, treatment with 10 ng/ml TGFp for

1, 2, 4, 8, 24 and 48 hours changed PAI-1 mRNA expression to 180.4±22.8%,

186.0±30.7%, 191.0±23.5%, 100.1 ±13.5% and 90.6±8.7% of respective time-

matched controls (Fig. 13A). At the same time, the basal expression of PAI-1

mRNA at 2 and 4 hours decreased to 90.9±10.9% and 59.7±9.4% (p<0.05) of 0-

time point control. At 8, 24 and 48 hours, basal PAI-1 mRNA expression changed

to 105.0± 7.5%, 134.7±14.7% and 146.2% of 0-time point control.

In the same set of experiments, the effect on PAI-1 protein expression was

examined using Western blot analysis at 8, 24 and 48 hours in conditioned

media. PAI-1 expression could not be detected at 8 hours. At 24 hours TGFp

increased PAI-1 protein to 424 ± 104.6% of time-matched control (Figre 13B). At

48 hours, the increase in PAI-1 protein was 181.9% and 131.7% in two separate

experiments (average 158%). Thus, 10 ng/ml TGFp increased PAI-1 mRNA


72

900 -|

800 -

700 -1—1

£ 600 -ao 500 -o

400 -O N

300 -

200 -

100 -

TGFp (ng/ml) 0

900 -|

800 -

700

^ 600 H

o 500o

400 H0s

300

200

100

0

PAI-1 mRNA

1 2 5 7.5 10

PAI-1 Protein B

TGFp (ng/ml) 0 7.5 10

Fig. 12. Dose-reponse analysis of TGFp induction of PAI-1 expression.Serum-starved human mesangial cells were treated with 0, 1, 2, 5, 7.5 and 10 ng/ml TGFp for 8 (mRNA) or 48 (protein) hours (A) PAI-1 mRNA expression measured by quantitative real-time PCR analysis shows an increase with TGFp treatment. Each bar represents the average increase at corresponding concentration normalized to untreated control (n=2). The ends of error bars show value for each experiment. (B) PAI-1 protein expression was measured in conditioned media using Western blot analysis with chemiluminiscence detection. Treatment with 10 ng/ml TGFp increased PAI-1 protein expression to 283.6% of untreated control (n=1).


73

expression maximally and consistently at 8 hours, whereas it increased PAI-1

protein expression maximally at 24 hours. The maximum increase in PAI-1

protein expression at 24 hours is consistent with previous studies by Matsumoto

et al [127].

In summary, the results of time-course and dose-response analysis of

TGFP on PAI-1 expression showed 10 ng/ml TGFp as the effective dose and, 8-

hour and 24-hour as effective treatment duration for mRNA and protein studies

respectively. The remaining studies were performed using these time points.


74

PAI-1 mRNA

TGFp- - + - + - + - + - +

Time (h) 0 2 4 8 24 48

600 n'o0)JS 500 - ejt3 'o 400 " S ui t i 3 0 0 -MS S 200 -VsO 100 -0s

PAI-1 Protein *

B

TGFp — + +

Time (h) Matchedcontrol

24 48

Fig. 13. Time-course analysis of TGFp induction of PAI-1 expression.Serum-starved mesangial cells were treated with or without 10 ng/ml TGFp for indicated lengths of time. (A) Changes in PAI-1 mRNA were detected using quantitative real-time PCR analysis (n=3 except 48 hours: n=2). (B) Changes in PAI-1 protein expression were measured in conditioned media using Western blot analysis with chemiluminescence detection at 24 (n=3) and 48 (n=2) hours. The vertical bars and the error bars represent the mean PAI-1 values and SEM respectively. The value of either 0-hour (A) or time-matched (B) untreated control is set at 100%. *:p<0.05 compared to time-matched control, f : p<0.05 compared to 0-hr time-point.


75

CHAPTER 5

EFFECT OF CHANGES IN ACTIN POLYMERIZATION ON TGFp-INDUCED

PAI-1 EXPRESSION

Introduction

The results of earlier chapter confirmed induction of PAI-1 by TGFp in

human mesangial cells. The role of actin cytoskeleton in this induction was

examined next. Previous studies in this lab showed that changes in actin

cytoskeleton regulate a-SMA gene expression, a marker of myofibroblast

differentiation, and hypertrophy in mesangial cells [28]. Like a-SMA expression,

de novo expression of PAI-1 is also seen with myofibroblast differentiation. It is

possible that the expression of PAI-1 is also regulated in a cytoskeleton-

dependent manner similar to that of a-SMA.

The Rho family of small GTPases controls organization of the actin

cytoskeleton [27], Rho activates Rho-kinase, a serine-threonine kinase that acts

through downstream kinases to stabilize actin polymers e.g. stress fibers and

adhesion. The small GTPases, Rho and Rac are both involved in the regulation

of PAI-1 expression. Inhibition of Rho by the C3 exoenzyme decreased PAI-1

production in rat proximal tubules [105] and aortic endothelial cells [106]. In

chicken atrial cells, co-transfection with dominant-negative RhoA decreased PAI-

1 promoter activity, whereas dominant-active RhoA increased promoter activity

[107], In smooth muscle cells, Y-27632, a Rho-kinase inhibitor, attenuated

expression of PAI-1 in response to Angiotensin II (Angll) [81]. These suggest a


76

role of Rho GTPases as intracellular mediators of diverse stimuli leading to PAI-1

expression. Rho has also been shown to regulate TGFp-mediated gene

expression. In human mesangial cells, inhibition of Rho and its downstream

effector Rho-kinase blocked TGFp-mediated expression of a1 collagen, a

component of ECM [87]. It is possible that Rho may play a similar role in

regulating TGFp-mediated expression of PAI-1.

Since regulation of actin polymerization is a major function of the Rho

family, the working hypothesis that Rho-mediated changes in actin

polymerization modulate TGFp-induced PAI-1 expression was examined. If Rho-

signaling worked through actin cytoskeleton for regulation of PAI-1 expression,

inhibition of actin cytoskeleton would produce similar results as the inhibition of

Rho.

Experimental model

Pharmacologic agents that stabilize or destabilize the polymeric actin

cytoskeleton by acting at different levels (Fig. 4) were used to test the hypothesis

that Rho GTPase regulates TGFp-induced PAI-1 expression through changes in

actin polymerization. The treatment conditions included (a) inhibition of signal-

mediated actin polymerization by inhibiting Rho GTPase (Clostridium difficile

Toxin B, 10 pM) or its downstream effector Rho-kinase (HA-1077 (20 pM), Y-

27632 (10 pM)) [87, 128, 129]; (b) inhibition of actin polymerization by agents

directly binding to actin polymers (Cytochalasin B, 1 mM) or monomers

(Latrunculin B, 0.1 pM) [130, 131]; and (c) increase in polymeric actin content by


77

stabilizing the actin polymers (Jasplakinolide, 50 nM) [132], The final outcome

was either an increase or a decrease in the actin polymers in the cells.

Results

Actin depolvmerization inhibits TGFB-induced PAI-1 mRNA expression

First, the effect of actin depolymerizing agents on TGFp-induced PAI-1

mRNA expression was examined (Fig. 14). Either Toxin B (Fig. 14A), a direct

inhibitor of Rho, or Y-27632 (Fig. 14B) and HA-1077 (Fig. 14B), both inhibitors of

a downstream effector of Rho, Rho kinase (ROCK), were used to inhibit Rho-

mediated actin polymerization. ToxinB, Y-27632 and HA-1077 decreased basal

PAI-1 mRNA expression to 19.5±5.6%, 52.8±5.4%, 59.3±17.9% of untreated

control respectively, and decreased TGFp-induced PAI-1 expression to

30.1±7.6%, 51.1 ±6% and 55.8±15.6% of TGFp-treated control respectively (Fig.

14A-C). Direct inhibition of the actin polymerization by CytB and LatB decreased

basal PAI-1 expression to 29.9 ±3.3% and 45.3±16% of untreated control

respectively, and decreased TGFp-induced PAI-1 expression to 35.2±6.5% and

49.7±16.5 of TGFp-treated control respectively (Fig. 14D, E). Northern blot

analysis (Fig. 14G) confirmed these results. This observation, that the effects of

Rho-inhibition are mimicked by direct actin depolymerization, suggests that the

effects of Rho on PAI-1 expression are mediated by the changes in actin

cytoskeleton.


78

PAI-1 mRNA

Serum-free media TGFP350 -

* A 300 - sfcsfcsfc B 300

"3 300 - "E 250 ■ r "3 250Im-ws 250 - ImMMs 200 - + a 200© 200 '

4-ou 150 ■ t t t

ou 150

o '150 ‘

T N®O' 100 - —f-| N°100

1UU - T50 - * * *

i—*—i

1 50 - n 50

— + + 0 — — + +Toxin B

300

"E 250 -ImMMa 200 -ou 150 -N?O' 100 ■

50 -

0

iD 300

T tti

^250-§ 2 0 0OU 150

— — + CytB

100

50 -

0

Y 27632

* * E

t

— — + LatB

400 1_ 350 O

300

S 230 oU 200

o ' 150 100

50 -

0

* *

Hhc

*

trh

p h

— — + +H A -1077

* *

+

F f t f

- f -

— — + JAS

p a h -

18S

* * -TGFP — + — + — + — +

S- CylB LalB Y-27632

Fig. 14. Effect of actin polymerization on TGFp-induced PAI-1 mRNA expression. Serum-starved mesangial cells were treated with (A) 10 pM Toxin B, (B) 10 pM Y-27632, (C) 20 pM HA-1077, (D) 1 mM CytB, (E) 0.1 pM LatB or (F) 50 nM JAS for 1-hour prior to 8-hour treatment with 10 ng/ml TGFp (n=3). The changes in PAI-1 mRNA were measured using real-time PCR analysis (A-F) and Northern blot analysis (G). The vertical bar and the error bars represent the mean PAI-1 mRNA values and SEM for the experimental condition. The value for untreated control is set at 100%. The value for untreated control is set at 100%. *:p<0.05, **:p<0.01 and ***:p<0.005 compared to S- control, t : P<0.05 and t t t : p<0.005 compared to TGFP treated control. (G) Representative Northern blot showing inhibition of basal and TGFp-induced PAI-1 expression with actin depolymerization (n=2).


79

Actin depolvmerization inhibits TGFB-induced PAI-1 protein expression

To ensure that the changes in PAI-1 mRNA expression were reflected at

the level of protein expression, the effect of the actin-depolymerization on PAI-1

protein expression was examined using Western blotting.

The effect on cellular PAI-1 protein was examined first (Fig. 15A). Cell-

lysates scraped in 1x sample buffer were used to detect changes in PAI-1

protein. Serum-starved mesangial cells were pre-treated with CytB for one hour

before 24 or 48 hour treatments with TGFp. TGFp had no apparent effect on

PAI-1 expression at 24 or 48 hours. This is possibly due to saturation of PAI-1

binding sites (vitronectin) on the substratum during prior culture [133], CytB

blocked PAI-1 expression in both basal and TGFp-treated conditions. At 24

hours, CytB blocked basal and TGFp-treated PAI-1 expression to 14.4% and

38.8% of their respective controls. At 48 hours, CytB blocked basal and TGFP-

treated PAI-1 expression to 4.2% and 46.1% of their respective controls.

Active PAI-1 is rapidly secreted from the cells upon synthesis [25].

Therefore, the conditioned media was examined for changes in PAI-1 protein

expression in response to TGFp. In the same experiment, changes in PAI-1

levels were clearly apparent in conditioned media (Fig. 15B). At 24 hours, TGFp

increased PAI-1 expression to 273% of control. CytB blocked basal and TGFp-

induced PAI-1 expression to 7.9% and 20.7% of their respective controls. At 48

hours, TGFp increased PAI-1 expression to 217% of control. CytB blocked basal

and TGFp-induced PAI-1 expression to undetectable levels.


80

Cell-Lysates

PAI-1

Conditioned Media

PAI-1

m m m m>» *o o

Fig. 15. Effect of TGFp and actin depolymerization on PAI-1 protein expression. Serum starved mesangial cells were pre-treated with 1 mM CytB prior to 24-hour treatment with 10 ng/ml TGFp. Cell-lysates (A) and Conditioned media (B) were analyzed for PAI-1 detection using Western blot analysis (n=1). An increase in PAI-1 upon TGFp treatment is seen in conditioned media (B) but not in cell lysates (A). CytB blocks PAI-1 expression, under basal and TGFp- treated conditions, in both cell lysates and conditioned media.


81

Next, the effect of a panel of actin cytoskeleton inhibitors on TGFp-

induced PAI-1 expression was examined using conditioned media (Fig. 16). The

changes in PAI-1 protein expression were consistent with the changes seen in

mRNA. Densitometric analysis of the Western blots showed that TGFp maximally

stimulates PAI-1 expression to 304.3±31.4% of control at 24 hours. Toxin B, Y-

27632, FIA-1077, CytB and LatB inhibited basal PAI-1 expression to 31.7±4.4%,

42.2±7.8%, 31±3.7%, 37.3±5.6% and 44.4±7.8% of control respectively, and

inhibited TGFP-induced PAI-1 expression to 26.8±7%, 38.6±4.9%, 33.6±6.9%,

21.1 ±4.1 % and 31±8.3% of TGFp-treated control respectively. A representative

Western blot is shown in Fig. 16A. These results suggest that agents with actin

depolymerizing activity blocks TGFp-induced PAI-1 expression regardless of

their mechanism of action.

Immunocvtochemical analysis of effect of actin depolvmerization on

TGFB-induced PAI-1 expression

In culture, secreted PAI-1 binds to vitronectin on the pericellular

substratum and shows characteristic intracellular and extracellular distribution

[134], Indirect immunofluorescence microscopy was used to visualize the effects

of Y-27632 and CytB on PAI-1 deposition on the substratum (Fig. 17). These

cells were plated and stained at relatively low density. Thus the substratum is not

saturated with PAI-1 and it is possible to visualize the effect of TGFp on PAI-1

protein expression.

Cells were counterstained with Texas Red-phalloidin to allow concurrent

examination of filamentous actin (F-actin) content. PAI-1 staining was seen


82

TGFP - - + + - - + + - - + + - - + +

Serum - CytB LatB Y-27632

B

w8

5Ok*r-t

<Ph

400 -

350 -

300 -

250 -

200 150 100 50

0

TGFp + TGFp

- * - 1

* * * *

n - f -* *

ETL

t t i t

C/5 CQ

U1 s■J

i>

t*-t>o▼H

35

s►»u

CQt §■J £

I><

£l>o

Jl35

Fig. 16. Effect of Actin depolymerization on TGFP-induced PAI-1 protein expression. Serum-starved mesangial cells were treated with 1 mM CytB, 0.1 pM LatB, 10 pM Y-27632 or 20 pM HA-1077 for 1-hour prior to 24-hour treatment with 10 ng/ml TGFp. The effect of actin depolymerization on PAI-1 protein expression was measured in conditioned media using Western blot analysis (n=3). (A) A representative Western blot showing increase in PAI-1 expression with TGFp treatment in serum-free media. (B) Inhibition of actin polymerization by agents using different mechanisms blocks basal and TGFp-induced PAI-1 expression. The vertical bars and the error bard represent mean values for PAI-1 protein and SEM respectively. The value for untreated control is set at 100%.*: p<0.05 compared to S- control, **: p <0.005 compared to S- control, t : P <0.05

compared to TGFp treated control.


83

F-Actin PAI-1

S-

TG Fp

TG Fp+

CytB

TG Fp+

Y-27632

MM^ Mi■1

Fig. 17. Effect of Actin depolymerization on TGFP-induced PAI-1 expression by immunocytochemistry. Serum-starved mesangial cells were treated with 1 mM CytB (E, F) or 10 pM Y-27632 (G, H) before 24-hour treatment with 10 ng/ml TGFp (C-H). Cells were stained with Texas-Red phalloidin to visualize stress fibers (arrow) (A, C, E, G) and PAI-1 antibody (arrowhead) (B, D, F, H).Phalloidin staining shows abundant stress fibers (red staining) in S- control (A) and TGFp treated (C) cells. TGFp treated cells show more intense staining for PAI-1 (green staining) (D) compared to S- control (B). Loss of stress fibers with cytoskeleton inhibitors (E, G) correlates with loss of staining for PAI-1 (G, H)(n=1)-


84

intracellularly and on the substratum. TGFp increased staining for PAI-1 after 24-

hour treatment. Y-27632 and CytB reduced stress fiber content and staining for

PAI-1 in both basal and TGF(3-stimulated conditions (Fig. 17). Thus PAI-1

expression changes in parallel with changes in actin polymerization.

Stabilization of actin cvtoskeleton increases TGFB-induced PAI-1 expression

The results showed that inhibition of actin polymerization inhibited basal

as well as TGFp-induced PAI-1 expression. If the actin cytoskeleton controls PAI-

1 expression, then an increase in actin fibers may increase PAI-1 expression. To

test the possibility that stabilization of actin polymers can increase PAI-1

expression, serum-starved cells were pre-treated for 1 hour with Jasplakinolide

(JAS), an agent that increases the F-actin content of cells by directly binding to

actin polymers and increasing nucleation. Cells were treated with 10 ng/ml TGFp

for indicated time periods, with and without JAS. In contrast to the actin

depolymerizing agents, JAS increased basal and TGFp-mediated PAI-1 mRNA

expression to 154.3±14% and 142.7±10.3% of respective controls as determined

by quantitative real-time RT PCR analysis (Fig. 14F). To ensure that the effects

of JAS were mediated by increased F-actin content, cells were co-treated with

JAS and actin depolymerizing agents in the presence or absence of TGFp (Fig.

18). Co-treatment with CytB, Y-27632 or Toxin B depolymerized actin

cytoskeleton and antagonized the JAS-mediated increase in PAI-1 mRNA to

24.6±4.6%, 52.6±8.9% and 39.1±8.7% of their respective JAS-treated controls.

CytB, Y-27632 or Toxin B also blocked JAS-mediated increase in TGFp-induced


85

— TGFp

<a*

400

3 0 0 “

io o -

JAS - + +

JASY-27632

*

_ * rh- k t t ti 1 i

+ TGFp Att

- + +

3 0 0

g - 200 -

I<Oh

IO O

IO O

Toxin B '

B

Fig. 18. Effect of changes in actin polymerization on TGFp-induced PAI-1 mRNA expression. Serum-starved mesangial cells were treated with 50 nM JAS and, 1 mM CytB (A), 10 pM Y-27632 (B) or 10 pM Toxin B (C) for one hour prior to 8-hour treatment with 10 ng/ml TGFp (n=3). PAI-1 mRNA expression was measured using quantitative real-time PCR analysis. The vertical bars and the error bars represent mean PAI-1 mRNA values and SEM respectively. The value for untreated control is set at 100%. *: p<0.05 compared to S-, **: p<0.01 compared to S-, ***: p<0.005 compared to S-, P< 0.05 compared to TGFp, t t f : p<0.005 compared to TGFp, $: p<0.05 compared to JAS, #: p<0.05 compared to TGFp+JAS, ###: p<0.005 compared to TGFp+JAS.


86

APAI-1

JAS TGF0 Toxin B

B

— +

Co"400 "

a 350 *« rHI

300 -O5-1

Ph 250 -200 -150 -

Pi too -50 -

TG Fp

*

o-JAS

Toxin B

F *—

*n

«*|»

m

— + + + — +

+ + + +

+ TG Fp

i t

#

□— + + + — +

Fig. 19. Effect of JAS and Toxin B mediated changes in actin polymerization on TGFp-induced PAI-1 protein expression. Serum-starved mesangial cells were treated with 50 nM JAS and 10 pM Toxin B for one hour prior to 24-hour treatment with 10 ng/ml TGFp. PAI-1 protein was measures in conditioned media using Western blot analysis. (A) Representative Western blot analysis of conditioned media for PAI-1 detection using Western blot analysis (n=3). (B) The vertical bars and the error bars represent mean PAI-1 protein values and SEM respectively. The value for untreated control is set at 100%. *: p<0.05 compared to S-, f . p< 0.05 compared to TGFp, $: p<0.05 compared to JAS, #: p<0.05 compared to TGFp+JAS.


87

increase in TGFp-induced PAI-1 mRNA expression; decreasing PAI-1 mRNA to

17.9±1.1 %, 51.3±14.8% and 19.1±10.5% of TGFp+JAS-treated controls.

To confirm the effect of JAS on PAI-1 protein expression under the same

conditions, cells were treated with combinations of TGFp, JAS and actin

depolymerizing agents for 24 hours. Western blot analysis of conditioned media

showed JAS increased basal and TGFp-induced PAI-1 protein to 148.5±5 % and

148.1 ±7.1 % of respective control at 24 hours. Inhibition of actin polymerization

by Toxin B (Fig. 19), CytB (Fig. 20) and Y-27632 (Fig. 20) inhibited JAS-

mediated increase in PAI-1 protein to 28.7±4.9%, 19.3±6.2% and 46.4±11.3% of

their respective JAS-treated controls (Figs. 19, 20). At the same time, Toxin B,

CytB and Y-27632 blocked JAS-mediated increase in TGFp-induced PAI-1

protein expression to 18.9±3.4%, 13.1 ±2.9% and 29.1 ±7.6% of their respective

TGFP+JAS-treated controls (Figs. 19, 20).

Table 4 shows representative calculation of the changes in PAI-1 cDNA

concentration by real-time PCR analysis. The software automatically calculates

the concentration based on the crossing point of each sample. The values for

PAI-1 expression were normalized to the values for UBC, which remained

relatively unaffected by the experimental conditions.

In summary, the bi-directional changes in actin polymerization were

followed in the same direction by the changes in TGFp-mediated PAI-1

expression. An increase in stress fiber content of the cells caused an increase in

PAI-1 expression, whereas inhibition of actin polymerization caused inhibition of


JASTGFp

B

/-“Nyn—HO£oo

c* y —«<Do

&

Oh

— + + + — +

“ s=

-T G F p500

400

300

200 *

— 4- + + — +

CytB

— — + +

— + — +

Y-27632

+ TGFpit

*

CO CO m PJ

S* rSo i>^ c ti>h

“ _± ± ±CO CO f f i $

VOO r -c iI

Fig. 20. Effect of changes in actin polymerization on TGFp-induced PAI-1 protein expression. Serum-starved mesangial cells were treated with 50 nM JAS and, 1 mM CytB or 10 pM Y-27632 for one hour prior to 24-hour treatment with 10 ng/ml TGFp. PAI-1 protein expression was measured in conditioned media using Western blot analysis. (A) Representative Western blot analysis of conditioned media for PAI-1 detection using Western blot analysis (n=3). (B) The vertical bars and the error bars represent mean PAI-1 protein values and SEM respectively. The value for untreated control is set at 100%. *: p<0.05 compared to S-, t : P< 0.05 compared to TGFp, p<0.05 compared to JAS, #: p<0.05 compared to TGFp+JAS.


89

Table 4. Calculation of PAI-1 cDNA concentration by real-time PCR

CONDITIONCr.Pt.

PAI-1Calc.Con.(pg)

Cr.Pt.

UBCCalc.Con.(pg)

PAI-1 / UBC(x1 O'5)

%CONTROL

Serum - control 23.2 0.0118 20.2 234.2 5038 100.0TGFp 20.9 0.0427 19.9 289.8 14734 292.4JAS 22.6 0.0167 20.2 237.7 7025 139.4TGFp + JAS 20.6 0.0501 19.9 288.5 17365 344.7CytB 25.1 0.0041 19.8 306.4 1344 26.7TGFp + CytB 23.8 0.0084 20.0 278.0 3025 60.0JAS + CytB 26.3 0.0022 20.1 263.9 814 16.2TGF + JAS + CytB 23.7 0.0087 19.8 301.7 2903 57.6Toxin B 25.2 0.0039 20.1 254.2 1534 30.5TGFp + Toxin B 22.5 0.0177 20.0 280.4 6312 125.3JAS + Toxin B 24.9 0.0047 20.3 220.0 2113 42.0TGFp + JAS + Toxin B 22.7 0.0156 20.2 247.0 6315 125.4PAI-1 standard 23.5 0.0100 - - - -

UBC standard - - 21.5 100.0 - -

Abbreviations are: Cr. Pt, crossing point; Calc. Con, calculated concentration.


90

PAI-1 expression. The inhibition of actin polymerization also prevented actin

stabilization by JAS.


91

CHAPTER 6

EFFECT OF ACTIN CYTOSKELETON ON THE PAI-1 PROMOTER

Introduction

The results discussed in previous chapter showed that the changes in

actin polymerization regulated PAI-1 mRNA and protein expression. The

mechanism of this regulation was examined next.

The expression of PAI-1 is tightly regulated by a variety of cytokines,

growth factors, hormones and other agonists [78], These agents include TGFp,

Angiotensin II, thrombin, glucocorticoids, tumor necrosis factor-a and endotoxin

[78,135]. The regulation of PAI-1 mRNA expression is primarily at the level of

transcription [136, 137], Functional analysis of the regulatory region of the PAI-1

promoter shows the presence of multiple regulatory elements that respond to

diverse stimuli listed above [79]. Schematic representation of selected consensus

sequences in human PAI-1 promoter is shown in fig. 21 [69, 76, 115]. The human

PAI-1 promoter has at least 3 AP-1 sites in its distal promoter region (-800 to -

636) and one in the proximal promoter region (-81 to -75) [78], These AP-1 sites

are critical for induction of PAI-1 by the agents listed above [78, 138]. The

regulation of PAI-1 promoter by TGFp has been extensively studied [135, 78,

139]. Two TGFP-inducible, cis-acting regulatory elements were first identified in

the 5’ flanking DNA of the human PAI-1 gene; a relatively strong element

between -791 and -328, and a weaker element between -328 and -187


Reproduced

with perm

ission of the

copyright ow

ner. Further

reproduction prohibited

without

permission.

■118 SplCTF/NFlcB-730 Smad 3/4 k j L -580 Smad 3/4

VLDL-(E ■280 Smad 3/4-79 to -72 and-58 to -50

P M A -& /T R E-214

CCAATBox■443 Spl CTF/NFkB

AP-1 AP-2 -73 Spl

■42 SplNF-1

CCAAT Box TATAAP-1 AP-1 AP-1

GRE GREtoo

Fig. 21. Schematic representation of PAI-1 promoter. -RE, response element; TGFp, transforming growth factor; VLDL, very low density lipoprotein; CTF, CCAAt box binding transcription factor; NF1, nuclear factor 1; PMA, phorbol 12-myristate 13-acetate; AP, activator protein; TRE, tetradecanoyl phorbol acetate response element;GRE, glucocorticoid response element. Used with permission from Binder et al [69].

CDro

93

[139]. Later, three SMAD-binding sites were identified between -794 and - 532

that were sufficient for induction by TGF(3 [140]. PAI-1 promoter also contains

NF-1 like sequences, one p53 binding site between -139 and -160 [141], two

glucocorticoid response elements (GREs) between -100 and +75, and -800 and

-549 [76], CRE, five Hypoxia Responsive Elements (HREs) [142] and two Sp1

binding site-like sequences at -72 to -67 and -45 to -40 [143]. The rat PAI-1

gene shares many structural similarities with the human PAI-1 gene and contains

similar regulatory elements in the promoter [144], For example, the rat PAI-1

promoter contains binding sites for AP-1 and Sp1, glucocorticoids response

elements and CRE. Although the rat and human PAI-1 promoter are similar, the

number of each type of regulatory elements may be different. For example, the

rat PAI-1 promoter contains five GREs as compared to two contained in the

human PAI-1 promoter. Also, the rat PAI-1 promoter contains two regions that

have at least 80% sequence similarities to its human counterpart. The first is

between -91 and TATA box, and the second between -800 and -549.

The serum response factor (SRF), a transcription factor, has been shown

to mediate effects of changes in actin cytoskeleton on expression of some genes

[145]. AP-1-dependent genes are direct targets of SRF. For example, inhibition of

actin polymerization by inhibitors of direct and Rho-mediated polymerization

blocked inducible nitric oxide gene expression in human epithelial cells [145].

Similarly, inhibition of Rho by C3 toxin blocked activation of AP-1 in rat-1 cells

[146]. TGF(3-mediated SMAD 2/3 activation also required Rho signaling in human

breast carcinoma cells [147]. Thus, the evidence from the literature suggests a


94

role for Rho and actin cytoskeleton in regulation of genes through similar

regulatory elements as contained in PAI-1 promoter. The hypothesis that Rho-

mediated changes in actin polymerization regulate TGFp-induced PAI-1

expression at the promoter level was therefore examined.

Experimental Model

To examine if PAI-1 expression was at the transcriptional level, the human

PAI-1 promoter, spanning -973 to +133 nucleotides, was cloned into a luciferase

vector as described in chapter 2. Human and rat mesangial cells were serum-

starved and transfected with human PAI-1 promoter vector for 24 hours. Cells

were then pre-treated with CytB to inhibit actin polymerization followed by

treatment with TGFp. The effect on promoter activity was determined by

luciferase assay.

Results

TGFS induces PAI-1 promoter activity in rat mesangial cells

The initial time-course analysis of the effect of TGFp on PAI-1 promoter

activity was conducted in rat mesangial cells due to their better transfection

efficiency. Rat mesangial cells (p27) were co-transfected with PAI-1 promoter

vector and renilla luciferase vector in serum-free media. After 24 hours, the cells

were treated in triplicate wells with 10 ng/ml TGFp (dose shown to be effective on

PAI-1 mRNA and protein expression) for varying amounts of time to identify the

time-point for the maximum increase in PAI-1 promoter activity. In a single

experiment, TGFp-treatment for 2, 4, 6, 8 and 24 hours increased PAI-1

promoter activity to 108.4±3.7% 124.2±7.7%, 128.5±3.1%, 109.0±3.9% and


95

140 - i

P 120S : a I g 100u -o

< 1 S 80o> ui/5 -fc j « «t sS3 i£ a 40

60 -

J ‘-3£ 20'w'

0

*& ■

TG Fp - + - + - + - + - + - +

Tim e (h) 0 2 4 6 8 24

Fig. 22. Time-course analysis of TGFp on PAI-1 promoter activity. Ratmesangial cells were co-transfected with PAI-1 promoter plasmid and renilla luciferase plasmid in serum-free media. After 24 hours, 10 ng/ml TGFp was added to the media for the indicated times. Duplicate wells of control cells in serum-free media and triplicate cells of TGFp-tread cells were used for the experiment. Luciferase activities in samples were measured using dual luciferase assay (n=1). Each bar represent average luciferase activity for PAI-1 promoter normalized to renilla luciferase activity in the same sample. The normalized Luciferase activity of time-matched untreated control is set as 100%.


96

116.6±4.2% of their respective time-matched controls. The values for renilla

luciferase activities were above background and hence were used to normalize

for transfection efficiency.

The effect of TGFp was maximum at 6-hours with the minimum variation.

In the following set of experiments, cells were treated with TGFP for 6 hours.

Inhibition of actin polymerization blocks TGFS-induced PAI-1 promoter activity

In rat mesangial cells, the effect of TGFp on PAI-1 promoter (128.5 %)

was much smaller than the effects on PAI-1 mRNA (~250%) and protein (~250%)

in human mesangial cells. Therefore the remaining experiments were performed

in human cells. Serum-starved mesangial cells were transfected with PAI-1 and

renilla luciferase plasmid as described above. After 24 hours, cells were pre

treated with 1 pM CytB followed by 10 ng/ml TGFp for six hours. Since, co

transfection with renilla luciferase was not successful, luciferase counts were

normalized to the protein concentration. Previously, Owens et al showed

normalization for protein concentration as an acceptable method for

normalization for transfection efficiency [148, 149], The treatment with TGFp

increased PAI-1 promoter to 293.6±36.5% of control. CytB inhibited basal as well

as TGFp-induced PAI-1 expression to 45.1 ±6.1% and 34.6±12.7% of their

respective controls. The effects of other cytoskeleton inhibitors could not be

determined due to limited transfection efficiency.


97

o

■ ^ 1> o■5 uU "O< aXflC5 «

£ S«t-i"G s

■J

i<U

350

300

250

200

150

100

50

0

*

*

-J -

f{

TGFp — + — +

CytB — — + +

Fig. 23. The effects of TGFp and actin depolymerization on human PAI-1 promoter activity. Human mesangial cells were co-transfected at 60-80% confluence with 1 pg human PAI-1 promoter-containing plasmid and 1 pg renilla luciferase plasmid. The cells were serum-starved at the time of transfection.After three hours of transfection, CytB was added to appropriate wells. After 24 hours, cells were treated with 10 ng/ml TGFp for 6 hours. Luciferase activity was normalized for the protein concentration of each sample to get the activity in counts/mg protein for each sample. For each treatment, cells were transfected at least in duplicates (n=3). Each bar represent average luciferase activity for PAI-1 promoter normalized to cellular protein concentration. The normalized Luciferase activity of untreated control is set as 100%. *: p<0.05 compared to S-, t : P< 0.05 compared to TGFp.


98

CHAPTER 7

EFFECTS OF TGFp AND ACTIN CYTOSKELETON ON PLASMINOGEN

ACTIVATORS

Introduction

The effects of TGFP and actin cytoskeleton on PAI-1 expression were

determined as shown in chapters 4 to 6. Next, the effects of cytoskeleton

disruption on two other components of plasminogen activator system namely

tissue- (tPA) and urokinase- (uPA) type plasminogen activators were examined.

Two activators (tPA, uPA) and one inhibitor (PAI-1) of plasminogen

activation constitute the plasminogen activator system, which regulates ECM

degradation. The mesangial extracellular matrix determines the physical,

mechanical and functional properties of glomerulus in normal and pathological

conditions [57], Plasminogen activators convert inactive plasminogen into active

plasminogen. Plasmin activates matrix metalloproteinases (MMPs), which then

digest ECM. Plasmin itself has some matrix digesting activity. PAI-1 binds to tPA

and uPA, and blocks the activation of plasminogen into plasmin. Thus, tPA and

uPA favor ECM degradation whereas PAI-1 favors ECM deposition. The balance

between plasminogen activators and PAI-1 thus determines the rate and the

amount of ECM deposition.

The DNA array analysis showed a 2.8-fold increase in tPA expression

upon actin depolymerization (Table 3, Chapter 3), suggesting a coordinated

regulation of the plasminogen activator system by the actin cytoskeleton. The


99

effects on uPA still remained to be examined. Moreover, treatment with TGFp is

shown to have varying effects on the expression of plasminogen activators

depending on the cell-type [61, 124, 150-152], The following set of experiments

was therefore performed to understand the role of TGFP and the actin

cytoskeleton on the regulation of plasminogen activator system as a whole.

Experimental Model

Serum-starved human mesangial cells were treated with 10 ng/ml TGFp

for 4, 8, 24 and 48 hours to determine optimum treatment duration. The changes

in tPA and uPA mRNA expression were examined by real-time quantitative PCR

analysis. In subsequent experiments cells were pre-treated with CytB, LatB or Y-

27632 for one hour to inhibit actin polymerization, followed by 8-hour treatment

with TGFp. These treatment conditions were identical to those used to examine

the effects on PAI-1 expression in earlier chapters. The effect of TGFp and actin

depolymerization on tPA and uPA expression was determined at the mRNA

level. Real-time PCR analysis was used to detect changes in tPA and uPA

mRNA expression. The changes in tPA and uPA protein expression were

examined in conditioned media at 24 hours to match the experimental conditions

used for PAI-1 protein using Western blot analysis.

Results

Quantification of tPA and uPA mRNA expression by real-time PCR analysis

The existing literature show conflicting evidence about production of tPA

and uPA by human mesangial cells and the regulation of plasminogen activator

system by TGFp [61, 89, 152-158]. Therefore, the expression of uPA and tPA


100

mRNA by serum-starved mesangial cells was confirmed first prior to examining

the effect of TGF(3 on tPA and uPA expression. Using real-time PCR detection,

both uPA and tPA mRNAs were successfully detected in human mesangial cells.

Briefly, a reverse transcription reaction on thermocycler (MJ Research, Reno,

NV) was followed by a quantitative real-time PCR analysis on Roche lightcycler

(Roche Diagnostics, Indianapolis, IN). First, standard curves fortPA (Fig. 24) and

uPA (Fig. 25) cDNA were generated using known concentrations of cDNA

templates as described in chapter 2. The products of standard curve polymerase

chain reactions were analyzed by gel electrophoresis to ensure amplification of a

single, specific product (Fig. 26).

Subsequently, one known concentration of standard (0.001 pg for tPA and

0.0001 pg for uPA) was amplified along with experimental samples. The values

for tPA and uPA concentrations were derived in picograms, which were further

normalized to similarly obtained values for a reference gene, Ubiquitin (UBC), in

each sample. The sample concentrations were calculated by the software by

comparing the crossing point of experimental sample with that of the known

standard normalized to previously saved standard curve as described in chapters

2 and 4. Ubiquitin was used as the reference gene to normalize the

concentrations for tPA and uPA. Figures 27 and 28 show amplification (panel A),

melting curve analysis (panel B), melting peak analysis (panel C) and gel

electrophoresis (panel D) of tPA and uPA respectively from representative

experimental samples.


101

2 -

-2 UbCH

Amplification Curve

cDNA template0.0001 pg ________0.001 pg ------------

0.01 pg ------------0-1 Pg -----------7

1 Pg ~

8 12 16 20 24 28 32

Cycle Number

Standard Cnrve B

«32 H

g2 6HI2 0 H u

14

r = -1.00 Slope = -3.79

-4 -3 -2Log Concentration

—r- -1

Melting Cnrve CDifferent concentrations o f

cD NA templates

-cl.O

& 0.8

0.6-1

e0.4V£0.2

!- 0.2

Melting PeakMelting temperature (Tm)-

Different concentrations o f

D

cDNA templates

70 74 78 82Temperature (°C)

70 75 80 85Temperature (°C)

~90

Fig. 24. tPA standard curve for real-time PCR analysis. (A) Amplification of tPA cDNA plotted as fluorescence vs. cycle number. Each sample is represented in a uniquely colored line on the real-time PCR software, allowing tracing of amplification of individual samples. (B) tPA standard curve plotted as cycle number vs. log concentration showing a linear standard curve (r= -1). (C) Realtime monitoring of melting curve analysis of PCR products plotted as fluorescence vs. cycle number showing only one PCR product corresponding to tPA. (D) Melting curve analysis data plotted as changes in fluorescence signal over time (dF/dT) vs. temperature. Presence of only one melting peak in this reaction corresponding to melting temperatures of tPA (~85.5°C) indicates specificity of the amplification reaction and absence of primer-dimers.


102

Amplification Curve A

604)£454>

§30UoJ215 fa

0

cDNA template0.0001 pg ________

0.001 pg ------------0.01 pg ------------0-1 pg ------------;

1 Pg1----------- 1 1 1 1 1 1 1 1

0 4 8 12 16 20 24 28 32 36

Cycle Number

Standard Curve B

U<L>S2%4>

u

3A30-26-22 -

18-1410

-7

r= -1.00 Slope = -3.39

T --6 -5 -4 -3 -2

Log Concentration

Melting CurveDifferent concentrations o f

.cD N A templates

66 70

Melting PeakI

-Melting temperature (Tm)—*.1

78 82 86Temperature (°C)

D

Different concentrations o fcDNA templates

68 75 7§ 85 84 8§ 9?Temperature (°C)

Fig. 25. uPA standard curve for real-time RT-PCR analysis. (A) Amplification of uPA plotted as fluorescence vs. cycle number. Each sample is represented in a uniquely colored line on the real-time PCR software, allowing tracing of amplification of individual samples. (B) uPA standard curve plotted as cycle number vs. log concentration showing a linear standard curve (r= -1). (C) Realtime monitoring of melting curve analysis of PCR products plotted as fluorescence vs. cycle number showing only one PCR product corresponding to uPA. (D) Melting curve analysis data plotted as changes in fluorescence signal over time (dF/dT) vs. temperature. Presence of only one melting peak in this reaction corresponding to melting temperatures of PAI-1 (-83.5 C) indicates specificity of the amplification reaction and absence of primer-dimers.


103

A tPA

tPA (265 bp)

concentration (p i)

B uPA

uPA (3 10 bp)

concentration (pg)

Fig. 26. Gel-electrophoresis of tPA and uPA standard curve PCR products.Aliquots of PCR products (2 pi out of 20 pi total) were run on 8% acrylamide gel followed by ethidium bromide staining. (A) tPA and (B) uPA PCR products show a single band at expected base-pair location confirming specific amplification of respective templates.


104

M elting CurveA m plification Curve

H 40-

40-Samples and standards

a 30-Oq 20 -

tPAUBCCrossing points ,10- 10-

0 ' .


Gel E lectrophoresisM elting Peak

U B cii |tPA

265 bp133 bp

t P A UBCTemperature (°C1

Fig. 27. Representative images from real-time PCR of tPA and UBC from experimental samples. (A) Amplification of tPA and UBC plotted as fluorescence vs. cycle number. Each line is represented in different color on the real-time PCR software, allowing tracing of amplification of individual samples. The crossing points for both tPA and UBC fall within the bars marking approximately cycles 15 and 22. (B) Real-time monitoring of melting curve analysis of PCR products plotted as fluorescence vs. cycle number showing two PCR products corresponding to tPA and UBC. (C) Melting curve analysis data plotted as changes in fluorescence signal overtime (dF/dT) vs. temperature. Presence of only two melting peaks in this reaction corresponding to melting temperatures of UBC (~82°C) and tPA (~85.5°C) indicate specificity of the amplification reaction and absence of primer-dimers. (D) Gel electrophoresis of PCR products from representative experimental samples show a single PCR product of expected base-pair size in each reaction.


105

A m plification Curve M elting Curve

UBC40 -Samples and standards

30 -uPA cA 30-

20 -

10 -

20 -

Crossing points10 - 4lPA


M elting Peak

UBCk IuPA

Gel E lectrophoresis

133 bp

- 2 .

uPATemperature (°C)

Fig. 28. Representative images from real-time PCR of uPA and UBC from experimental samples. (A) Amplification of uPA and UBC plotted as fluorescence vs. cycle number. Each line is represented in different color on the real-time PCR software, allowing tracing of amplification of individual samples. The crossing points for uPA and UBC fall within the bars marking approximately cycles 23-28 and 15-19 respectively. (B) Real-time monitoring of melting curve analysis of PCR products plotted as fluorescence vs. cycle number showing two PCR products corresponding to uPA and UBC. (C) Melting curve analysis data plotted as changes in fluorescence signal overtime (dF/dT) vs. temperature. Presence of only two melting peaks in this reaction corresponding to melting temperatures of UBC (~82°C) and uPA (~83.5°C) indicate specificity of the amplification reaction and absence of primer-dimers. (D) Gel electrophoresis of PCR products from representative experimental samples show a single PCR product of expected base-pair size in each reaction.


106

TGFB has opposite effects on tPA and uPA mRNA expression

In previous experiments, the effective dose of TGFp was determined to be

at 10 ng/ml (chapter 4). In a time- course analysis 10 ng/ml TGFp treatment

increased uPA mRNA levels to 117.8%, 207.2%, 137.9% and 35.4% of

respective time-matched control at 4, 8, 24 and 48 hours (n=1) (Fig. 29).

Whereas, 10 ng/ml TGFp inhibited average tPA mRNA to 89.3%, 69.5%, 70.65

and 28.8% of respective time-matched control at 4, 8, 24 and 48 hours (n=2)

(Fig. 29). Thus, TGFP increased uPA mRNA expression maximally at 8 hours.

On the contrary, TGFp inhibited tPA mRNA expression at most of the time points

examined. Maximum increase in PAI-1 mRNA was seen at 8-hours (chapter 4)

which corresponds to maximum increase in uPA expression and consistent

inhibition of tPA expression at 8 hours. Therefore 8 hours was determined to be

an optimum time-point for TGFp treatment.

Actin depolvmerization regulates tPA and uPA mRNA expression

The rate of plasminogen activation depends on the balance between

plasminogen activators and PAI-1. Therefore the effects of inhibiting actin

polymerization on expression of the plasminogen activators was examined first in

order to understand the potential net effect on plasminogen activation. The

samples from the same experiments in which actin depolymerization had shown

inhibition of TGFp-induced PAI-1 expression were examined for tPA and uPA

mRNA expression using quantitative real-time PCR analysis. In three separate

experiments, TGFp decreased tPA mRNA expression slightly, but significantly, to

80.7 ± 5.5% of untreated control (p<0.05), consistent with the profibrotic effects


107

T3 120<0 100Q

■p 80

i 60

a oo 40

■ 20

0s- 0

oi*-Mso

U

<DA

250 -|

200 -o£ 150 -

14J O 100 -B o

vO 50 -ON 0 -

&oU

tPA

- 4h 24h 48hTGFp treatment

uPAB

24h 48hTGFp treatment

Fig. 29. Time-course analysis of TGFp-treatment on tPA and uPA mRNA expression. Human mesangial cells at 60-80% confluence were serum starved for 24 hours. Cells were treated with 10 ng/ml TGFp for 4, 8, 24 and 48 hours. At each time point, the effect of TGFp treatment on tPA (A) and uPA (B) mRNA was measured by real-time PCR analysis. (A) TGFp inhibited tPA mRNA at all the time-points examined (n=2). Each bar represent mean value for tPA expression. The ends of error bars represent the value for each of the two experiments. (B) TGFp treatment maximally increased uPA mRNA at 8 hours (n=1).


108

of TGFp (Fig. 30). Actin depolymerization by Y-27632, CytB and LatB increased

basal tPA expression to 232 ± 22.3%, 195.4 ± 26.7% and 288.9 ± 29.8% of

untreated controls. Actin depolymerization also effectively reversed the inhibitory

effects of TGFp on tPA expression. Y-27632, CytB and LatB increased tPA

mRNA to 260.9 ± 22.6%, 208.3 ± 33.8% and 244.9 ± 39% of their respective

TGFP-treated controls. This suggests that actin depolymerization coordinately

regulates the plasminogen activator system. Actin depolymerization

simultaneously inhibits PAI-1 expression and increases tPA expression, the net

result of which favors activation of plasminogen activation and degradation of

extracellular matrix. In contrast, TGFp increased uPA expression by

246.7±61.4% of control (p<0.05). Inhibition of actin polymerization by CytB and

Y-27632 changed uPA mRNA expression to 259.1 ± 119% and 115.6 ± 24.5% of

respective controls under serum-free conditions. In the presence of TGFP, CytB

and Y-27632 changed uPA mRNA expression to 95.8 ± 37.7% and 77.7 ± 16.3%

of TGFP-treated control respectively. The effect of CytB and Y-27632 were not

statistically significant (Fig. 31). In summary, TGFp increased uPA mRNA

expression, whereas actin depolymerization did not have a statistically significant

effect on the same.

Effect TGFB and actin depolvmerization on plasminogen activators protein

expression

Since tPA and uPA are secreted upon synthesis, changes in tPA and uPA

were determined by analyzing conditioned media using Western blot analysis.

Neither tPA nor uPA proteins could be detected in conditioned media using


109

350 n

qN 300

— TG F-p

**

■ f

*

*

+ TG F-p

t

ICM & «

uCt v©

l>Ni*

tZ] -w >*» u

t ttti

05'Wc3

nJ

ntnvo»Ni

Fig. 30. The effects of TGFP and actin depolymerization on tPA mRNA expression. Human mesangial cells at 60-80% confluence were serum starved for 24 hours. Cells were then pre-treated for one hour with 1.0 mM CytB, 0.1 pM LatB or 10 pM Y-27632 to inhibit actin polymerization. TGFP (10 ng/ml) was added to the media for next 8 hours. At the end of 8-hour treatment with TGFp, mRNA was isolated and analyzed by quantitative real-time PCR analysis for tPA mRNA expression (n=3). The vertical bars and the error bars represent mean tPA mRNA value and SEM respectively, The value for untreated control is set as 100% *: p<0.05 compared to S-, t : p<0.05 compared to TGFp, t t t - P<0.005 compared to TGFp.


110

400 -INO

< 300 -

\200 ■

<% 100 -

0 '

— TG Fp

iin PQ

*<Nv®r--<Ni

+ TG Fp

*

iin

? iPQ*U

<Nvor--n i

Fig. 31. The effects of TGFp and actin depolymerization on uPA mRNA expression. Human mesangial cells at 60-80% confluence were serum starved for 24 hours. Cells were then pre-treated for one hour with 1.0 mM CytB or 10 pM Y-27632 to inhibit actin polymerization. TGFp (10 ng/ml) was added to the media for next 8 hours. At the end of 8-hour treatment with TGFp, mRNA was isolated and analyzed by quantitative real-time PCR analysis for uPA mRNA expression (n = 5). The vertical bars and the error bars represent mean uPA mRNA value and SEM respectively, The value for untreated control is set as 100%. *: p<0.05 compared to S - .


111

Western blot analysis. Multiple optimization efforts including using smaller

amounts of media for incubation (to reduce dilution of secreted tPA and uPA),

using larger amounts of media for detection, concentrating the media using spin

concentrators and using varying amounts of primary antibodies were

unsuccessful in detecting tPA and uPA proteins in conditioned media. Previously

uPA was successfully detected in this lab in a preparation of substratum attached

extracellular matrix and membrane proteins called adhesion plaques but not in

conditioned media [159, 160].

In summary, the results show an increase in tPA mRNA expression by

actin depolymerization. PAI-1 expression was inhibited under similar

experimental conditions, suggesting a coordinated regulation of these two genes

with opposite functions by actin cytoskeleton.


112

CHAPTER 8

DISCUSSION

Mesangial myofibroblast activation as a disease model

Diverse cells and tissues react to injury with similar responses, including

myofibroblast differentiation and formation of scar tissue from increased

extracellular matrix accumulation [22-24, 29, 161-166]. In the event of tissue

injury, native fibroblasts or mesenchymal cells with fibroblast-like properties can

transdifferentiate into activated myofibroblasts. De novo expression of genes,

possibly required to cope with demands of injury and tissue repair, is seen upon

myofibroblast differentiation [19, 119, 167], For example, the activation of a-SMA

expression, a property associated with smooth muscle phenotype and hence the

name myofibroblast, is a common feature of myofibroblasts regardless of the

tissue affected [168], In the skin, dermal fibroblasts transdifferentiate into

myofibroblast during the process of wound healing and start expressing a-SMA

de novo [11]. Similarly, in the kidneys, glomerular mesangial cells, mesenchymal

cells that hold the capillary tufts of glomeruli together, do not normally express a-

SMA. But in the event of injury, the activated mesangial cells transdifferentiate

into myofibroblasts and start expressing a-SMA [19]. They also undergo

hypertrophy to meet the functional demands in disease states [168]. Hypertrophic

cells also produce more ECM proteins leading to scar tissue formation. Indeed,

myofibroblast differentiation is associated with excess ECM deposition in

glomeruli in chronic glomerulosclerotic diseases [165]. The association of the


113

myofibroblast differentiation with ECM deposition and scarring suggests that the

knowledge of the mechanisms that regulate myofibroblast differentiation may

provide new insights into the cellular processes that control tissue scarring. The

overall objective of the current study was to identify the mechanisms regulating

myofibroblast differentiation. In this study, the role of actin cytoskeleton in the

regulation of gene expression and phenotype changes in glomerular mesangial

cells was examined.

Cultured mesangial cells as the experimental model of myofibroblast

differentiation

Previously, Glass et al showed that cultured mesangial cells mimic in vivo

changes during myofibroblast activation[26]. Initial culture in presence of serum

causes mesangial cell proliferation similar to that seen in early stages of

glomerular injury. Whereas, in the absence of serum, the mesangial cells stop

proliferating, spread more, become hypertrophic, increase their stress fibers, and

express more a-SMA [26], The phenotype seen during the serum-deprivation

closely resembles that of myofibroblasts seen in the later stages of glomerular

injury. Thus, the cultured mesangial cells share similarities both in phenotypes

and in the sequence of phenotype changes with in vivo myofibroblasts.

Therefore, cultured mesangial cells serve as a good model system to study the

myofibroblast phenotype in vitro.

Primary culture human mesangial cells between passages 5 and 9 were

therefore used in the current study to understand the regulation of myofibroblast

differentiation. The serum-free media was used as the basal culture condition to


114

allow the mesangial cells to acquire myofibroblast-like phenotype. The use of

already activated mesangial cells resembles the clinical scenario in chronic

glomerular diseases, where a majority of the patients present with already

established glomerular lesions containing activated mesangial cells. Also, the

role of individual growth factor can be studied when added to the serum-free

media used as the basal culture condition.

Actin cytoskeleton as a regulator of gene expression

The concordant increase in stress fiber formation with a-SMA expression

and hypertrophy in serum-starved mesangial cells lead to the hypothesis that the

actin cytoskeleton regulates a-SMA expression and hypertrophy in mesangial

cells. In a further study, the use of agents that modulate actin cytoskeleton

showed that the changes in actin cytoskeleton regulated both hypertrophy and a-

SMA expression in serum-starved mesangial cells [28], The a-SMA expression

was regulated at the level of transcription and message stability. These findings

were consistent with the regulation of a-SMA mRNA by the actin cytoskeleton in

different cell types [169, 149]. These results showed the evidence for the role of

actin cytoskeleton in gene regulation and myofibroblast-differentiation in

mesangial cells.

Since cellular hypertrophy is associated with an increase in global protein

synthesis, it was hypothesized that the actin cytoskeleton regulates myofibroblast

phenotype by simultaneously regulating the expression of multiple genes. Recent

availability of DNA arrays containing multiple genes with related functions on one

array provides opportunity to study the expression of multiple genes


115

simultaneously. Since the myofibroblast differentiation is associated with

increased ECM, the effects of actin cytoskeleton on a DNA array containing

genes related to ECM and cell-interaction were examined.

The array experiment way performed only once, but the results were

consistent with the hypothesis that cytoskeletal organization coordinately

regulates genes involved in myofibroblast function and sclerosis. Also the results

were confirmed, in particular, for PAI-1 and tPA. The expression of 74 out of 265

genes was detected on the array (Chapter 3). Cell-type specific and/or cell-

culture conditions could account for the detection of limited number of genes.

Alternatively, optimization of the protocol could help detect some of the genes not

detected in this study. Also, repeating the experiment with the same and other

actin depolymerizing agents could show the consistency of changes in pattern of

gene expression.

A noticeable pattern of gene expression was observed among the

detected genes. Out often down-regulated genes, four were precursors of

extracellular matrix components, namely procollagen 3 a1 subunit, procollagen 1

a2 subunit, collagen 4 a2 subunit and fibronectin. Endothelial plasminogen

activator inhibitor-1 (PAI-1) precursor also decreased. Since the role of PAI-1 is

to favor ECM deposition, a decrease in PAI-1 would also decrease ECM. Thus

actin depolymerization decreases both ECM components as well as profibrotic

regulators of ECM turnover. The collective effect is a decrease in ECM

deposition. Thus, actin depolymerization correlates with decreased PAI-1

expression and ECM deposition. Since, PAI-1 expression is an attribute of


116

myofibroblast differentiation and the ECM deposition is an outcome of such

differentiation, these findings support the overall hypothesis that changes in actin

polymerization regulate the myofibroblast phenotype of mesangial cells.

At the same time, out of four genes that increased, three favor

degradation of ECM. These include tissue-type plasminogen activator (tPA),

decorin (DCN) and matrix metalloproteinases 11 (MMP 11). tPA converts inactive

plasminogen into active plasmin with fibrolytic properties [56]. MMP11, although

not a major fibrolytic enzyme, digests ECM under certain conditions [170].

Decorin inhibits profibrotic TGFp and thereby prevents deposition of ECM [122,

171]. Together these genes lead to increased removal of ECM.

The cut-off ratios for increase (>2-fold) or decrease (>50%) in gene

expression set during the DNA array analysis were arbitrarily selected, requiring

further validation of the findings. Also, the experiment was performed only once.

Thus, further validation of the changes in gene expression seen on DNA array

was required. Therefore, the changes in the expression of two genes, relevant to

myofibroblast differentiation and ECM regulation, seen on DNA arrays were

confirmed by Northern blot and Western blot analysis. The components of

plasminogen activator system, PAI-1 and tPA, were selected for the confirmation

first since they are the major regulators of fibrinolysis and are directly related to

ECM turnover. Also they both were regulated in opposite directions by actin

cytoskeleton consistent with their opposite functions on ECM. The findings on

PAI-1 and tPA were confirmed at mRNA and protein levels, providing strong

evidence for coordinated gene regulation by the actin cytoskeleton. Indeed,


117

inhibition of actin depolymerization by CytB and Y-27632 inhibited PAI-1 mRNA

and protein expression, whereas CytB increased tPA protein expression. Thus

the findings of DNA array experiments were reflected at the protein level. These

experiments were set under different cell-culture conditions, some in the

presence of serum and some in the absence of serum, making the comparison of

results difficult. The aim of the next set of experiments was to understand the

significance of regulation of PAI-1 and tPA in the context of their

pathophysiological regulation using a uniform cell culture condition.

TGFp induction of PAI-1 expression

Since PAI-1 is a major mediator of the ability of TGFp to cause fibrosis

[172] and it acts as a gate-keeper of the plasminogen activation cascade by

inhibiting both tPA and uPA, the regulation of PAI-1 expression was studied first

and more extensively than that of tPA or uPA. The cells were treated with TGFp,

a major regulator of PAI-1, plasminogen activator, ECM turnover and

myofibroblast differentiation; to resemble in vivo regulation of plasminogen

activator system. The effect of actin cytoskeleton on TGFp-mediated expression

of the plasminogen activator system was studied in human mesangial cells. The

use of TGFp as an agonist provides a model that mimics in vivo regulation of

plasminogen activators, and helps to understand myofibroblast differentiation and

ECM regulation.

The dose-response analyses of TGFp on PAI-1 mRNA and protein

expression were performed first (Chapter 4). Although treatment with 1 ,2 ,5 and

7.5 ng/ml TGFP increased average PAI-1 mRNA expression to 381.9%, 323.1%,


443.3% and 485.1% of control in two different experiments, the effects on PAI-1

protein were inconsistent at these lower doses. At 10 ng/ml, TGFp increased

both PAI-1 mRNA and protein expression to 287.9% and 283.6% of respective

controls. Additionally, this concentration is very commonly used in published

studies by numerous investigators. In a similar dose-response analysis, Motojima

et al also found 10 ng/ml as the most effective dose of TGFP for PAI-1 induction

in rat mesangial cells [82]. Other researchers in this lab have also used TGFp

successfully at 10 ng/ml for studying effect on COX-2 expression (Harding et al,

unpublished observations). Also, this concentration of TGFp is pathological which

makes the experiments more relevant to an actual pathological state [126]. The

failure to show an increase with lower doses of PAI-1 expression was difficult to

interpret since the experiment was performed only once. It may result from

inefficient translation and/or secretion of PAI-1, inactivation of lower doses of

TGFp in the treatment media at 24-hour treatment or lack of activation of co

stimulatory pathways.

The time-course analysis showed that TGFP increased PAI-1 mRNA

maximally to a value of 191.0 ± 23.5% at 8 hours (Chapter 4). PAI-1 mRNA

decreased to 100.1 ± 13.5% and 90.6 ± 8.7% of time-matched controls at 24 and

48 hours respectively suggesting either loss of TGFP activity or inhibition of

TGFp activity at those time points. Although not tested directly at protein level,

the array experiment did show presence of decorin mRNA, a known inhibitor of

TGFp [122]. The analysis for PAI-1 protein showed maximum activation at 24

hours. At earlier time-points PAI-1 could not be detected in the conditioned


119

media. Since PAI-1 is a secreted protein, there may be a lag period before PAI-1

is synthesized and secreted in sufficient amounts to reach the level of detection

in the culture media. Even using a more sensitive detection method such as

enzyme-linked immunosorbent assay (ELISA), Matsumoto et al found 24 hr

treatment with TGF(3 to maximally induce PAI-1 protein expression [127],

Therefore, the use of more sensitive detection method may still show 24 hours as

optimum duration of treatment. Although PAI-1 is a rapidly secreted protein,

protein synthesis takes longer than mRNA synthesis, partially accounting for the

differences in the time-frame of their detection. Therefore, PAI-1 mRNA reached

a peak at 8 hours and protein reached a peak at 24 hours. At 48 hours, PAI-1

protein was still elevated (146%), whereas mRNA returned to the control levels

(90.6 ± 8.7%). Alternatively, this sustained increase at 48 hours in protein

expression could represent accumulation in the media. Since a consistent and

comparable increase was seen in PAI-1 mRNA at 8 hours and protein at 24

hours, these time points were used for subsequent experiments.

Inhibition of actin cytoskeleton on TGFp-induced PAI-1 expression

In vivo and in vitro evidence suggest that Rho and the actin cytoskeleton

regulate PAI-1 expression and matrix deposition. The small GTPase, Rho, is

known to regulate expression of PAI-1 [81, 108, 173, 174], Also, inhibition of Rho

signaling prevents fibrosis in animal models, an effect consistent with PAI-1

inhibition [102-104], Since one of the major functions of Rho is to regulate actin

polymerization, the effects of Rho on PAI-1 expression could be mediated

through the actin cytoskeleton. Secondly, activated mesangial cells or


120

myofibroblasts express a-SMA and PAI-1 de novo in various forms of renal

fibrosis. Recently this lab showed that Rho-mediated changes in actin

polymerization regulate a-SMA expression and hypertrophy, both attributes of

myofibroblast differentiation, in mesangial cells [28], Although the injurious

agents and cytokines involved are diverse, it is likely that common cellular

mechanisms underlie the regulation of myofibroblast differentiation and increased

ECM deposition common to sclerotic diseases. PAI-1, another attribute of

myofibroblast differentiation, could also be similarly regulated by the changes in

actin polymerization. Thus two separate lines of evidence suggest the role of

actin cytoskeleton in the regulation of PAI-1 expression. Therefore the hypothesis

that Rho GTPase regulates PAI-1 expression by modulating actin polymerization

was examined.

To test the hypothesis, the effects of either inhibition of Rho-mediated

signaling or direct inhibition of actin polymerization was examined on TGFp-

induced PAI-1 mRNA and protein expression (Chapter 5). The inhibition of Rho

blocked both basal and TGF(3-induced PAI-1 mRNA expression in human

mesangial cells. Similarly, direct inhibition of actin polymerization with CytB and

LatB also inhibited basal and TGF(3-induced PAI-1 mRNA expression. The

results seen by real-time PCR were comparable to those seen by conventional

methods such as Northern blot analysis. These confirmed the utility of real-time

quantitative PCR in detecting changes in mRNA expression. Since the effects of

Rho inhibition on PAI-1 mRNA expression are mimicked by direct inhibition of


121

actin polymerization, it suggests that the effects of Rho on PAI-1 mRNA

expression are mediated by changes in actin polymerization.

Surprisingly, TGFP did not show any effect on PAI-1 expression in cell-

lysates. Since PAI-1 is rapidly secreted upon synthesis, the induction by PAI-1

may only be reflected in secreted PAI-1. The secreted PAI-1 binds to the

substratum on tissue culture dishes and saturates the binding sites on the

substratum. The cell-lysates were prepared by scraping adherent cells. The

lysates generated in this manner include both intracellular and substrate-bound

extracellular PAI-1 and hence may not show a true representation of changes in

protein expression. The Western blot showed specific inhibition of the PAI-1 band

with CytB treatment, whereas the other non-specific bands seen on the blot

remained constant. This suggests that CytB is not affecting the secretion of PAI-1

in which case an increased intracellular PAI-1 would have been seen. However,

since the cell scrapings contain both intracellular and the substratum-bound PAI-

1, which is generally saturated at the cell density used in this study, these

differences were masked on cell-scrappings. CytB treatment blocked PAI-1

expression in both cell-lysates and conditioned media suggesting that the

inhibition was at the level of protein synthesis or earlier at the mRNA level.

Subsequently, the conditioned cell culture media containing the secreted proteins

was used to detect the changes in PAI-1 protein expression. The changes in PAI-

1 protein expression upon treatment with agents that increase or decrease actin

polymerization were consistent with the changes in PAI-1 mRNA expression

under similar treatment conditions.


122

The changes in actin cytoskeleton upon treatment under the experimental

conditions examined above were visualized by staining with Texas-red labeled

phalloidin, an agent that binds polymerized F-actin fibers (Chapter 5). Treatment

with Y-27632 and CytB showed loss of abundant stress fibers seen under control

conditions. Simultaneous immunostaining of the same cells for PAI-1 antigen

showed inhibition of PAI-1 expression in cells with less F-actin staining. This

experiment confirmed simultaneous decrease in F-actin content and PAI-1

expression upon treatment with inhibitors of actin polymerization.

Stabilization of actin cytoskeleton on TGFp-induced PAI-1 expression

If the hypothesis that the changes in actin cytoskeleton regulate PAI-1

expression is true and decreased stress fiber content of the cells blocks PAI-1

expression, then an increase in stress fibers should increase PAI-1 expression.

Jasplakinolide stabilizes the stress fibers thereby increasing the cellular stress

fiber content. Jasplakinolide increased basal PAI-1 expression and augmented

the stimulatory effect of TGF(3 on PAI-1 mRNA and protein expression (Chapter

5). Treating the cells with agents that increase the stress fiber content tested the

possibility that enhanced actin cytoskeletal assembly has an effect opposite to

that of disassembly on PAI-1 expression and essentially rules out the possibility

that the observed effects of actin depolymerization are artifacts of the use of

pharmacologic inhibitors The increase in stress fiber content caused by JAS

could not be visualized since it binds to the F-actin fibers and therefore interferes

with binding of phalloidin, the agent that helps to visualize F-actin [175]


123

To ensure that the increase in PAI-1 expression upon JAS treatment was

associated with the stabilization of actin cytoskeleton, the cells were pre-treated

with inhibitors of actin polymerization prior to JAS treatment (Chapter 5). Co

treatment with actin depolymerizing agents such as CytB, Toxin B and Y-27632

blocked the stress fiber formation and reversed the effects of Jasplakinolide on

PAI-1 expression. Thus, the changes in actin polymerization correlate with

changes of PAI-1 expression. Taken together, these results indicate that Rho

modulates the ability of TGFp to regulate PAI-1 expression by controlling the

state of actin polymerization and that the actin cytoskeleton mediated changes in

TGFp-induced PAI-1 expression depend upon the degree of its organization.

The findings of this study are based on pharmacological agents. The

effects of pharmacological inhibitors may show non-specific effects. However,

multiple agents using unique mechanisms of action showed a similar effect

suggesting that the effects are specific to the treatment effect. Still, the use of

constitutively active or dominant negative mutants may provide further

confirmation of the observations.

The opposing effects of actin depolymerization and stabilization on PAI-1

expression are consistent with similar effects on a1 (I) collagen, a component of

ECM, by Schnaper et al [87], They showed inhibition of TGFp-mediated

expression of a1 (I) collagen by actin depolymerization [87], In the same study

they showed that stabilization of stress fibers with JAS antagonized the inhibitory

effect of actin depolymerization. These results also show that the degree of

organization of actin cytoskeleton correlates with net ECM deposition. Since


124

collagen and PAI-1 both contribute to ECM accumulation, it is plausible that both

the genes are regulated by similar or coordinated mechanisms. Studies have

shown that Rho-kinase inhibition also inhibits PAI-1 expression in response to

other agonists such as Ang II [81]. This is consistent with the hypothesis that

changes in actin polymerization may act as a final common pathway that

modulates the effect of multiple extracellular stimuli on gene expression.

The effect of actin cytoskeleton on PAI-1 promoter activity

Once the role of actin cytoskeleton in regulation of PAI-1 expression was

confirmed, the subsequent studies aimed to determine the mechanism of this

regulation. Since PAI-1 expression is mainly regulated at the level of

transcription, the effects of actin cytoskeleton on PAI-1 transcription were

examined using human PAI-1 promoter (Chapter 6).

The mechanism of PAI-1 mRNA regulation by cytoskeleton was

investigated by examining the effects of actin depolymerization on PAI-1

promoter activity. First, an 1100 bp human PAI-1 promoter containing major

regulatory elements was cloned into a luciferase vector. The identity of the

cloned promoter was confirmed by sequencing. Due to difficulties in transfecting

primary cultured human mesangial cells, initial experiments were performed in rat

mesangial cells. The rat and human PAI-1 promoter contain similar regulatory

elements, albeit in different numbers. Dual luciferase assay system containing

firefly luciferase under the control of PAI-1 promoter and renilla luciferase under

minimal thymidine kinase promoter was used to transfect rat mesangial cells.

The renilla luciferase was used to normalize for transfection efficiencies. In the


125

initial time-course experiment with TGFp, no changes in renilla luciferase were

obtained upon different treatments. Normalized PAI-1 values show that TGFp

increases PAI-1 promoter activity marginally in rat mesangial cells. The efforts to

reproduce similar experiment in human mesangial cells failed to show consistent

counts for renilla luciferase activity. Consequently, luciferase values from human

mesangial cells were normalized to the protein concentration of the sample. The

luciferase values were represented as luciferase count/pg protein. Studies with

human mesangial cells show ~250% increase in human mesangial cells. This

effect is consistent with previous studies with the same PAI-1 promoter [112].

This increase is also consistent with the increase in PAI-1 mRNA and protein

expression seen upon TGFp treatment. Since the fold-increase in PAI-1 promoter

and mRNA are similar, the regulation of mRNA seems to be at the transcriptional

level. These findings are consistent with previous reports suggesting PAI-1

mRNA is mainly regulated at the level of transcription [136, 137], Treatment with

CytB blocked basal as well as TGFp-induced PAI-1 promoter activity suggesting

critical requirement of organized actin cytoskeleton for PAI-1 expression.

Although it is not completely known how changes in actin polymerization

regulate PAI-1 promoter activity, there are several possible mechanisms that can

explain this regulation. Since PAI-1 promoter is rich in regulatory elements, it is

possible that actin depolymerization alters the binding of transcriptional factors to

the regulatory elements in PAI-1 promoter. Alternatively, the binding to yet

uncharacterized PAI-1 promoter elements may be altered by actin

depolymerization. As described previously in the thesis, there are potential


126

similarities in the regulation of PAI-1 and a-SMA. The promoter region of a-SMA

contains CArG elements, which are sensitive to changes in actin polymerization

[176], Hautmann et al have shown cooperation between TGFP-responsive

elements and CArG elements for TGFp-induced expression of a-SMA [177],

Although, CArG elements have been shown only in uPA promoter so far, other

yet unidentified cytoskeleton-responsive elements may drive PAI-1 promoter in

concert with TGFp-response elements [178], Another possible mechanism may

involve Nuclear Factor Yin Yang 1 (YY1). In myofibroblasts YY1 represses

expression of a-SMA and TGFP-responsive genes such as PAI-1 [179]. Ellis et al

have shown that YY-1 competes with serum response factor (SRF) for binding to

serum response elements (SRE) in the a-SMA promoter. F-actin inhibits this

repressive effect of YY1 on a-SMA expression, thereby increasing a-SMA

expression [180]. Conversely, G-actin inhibits a-SMA expression by facilitating

repression by YY1. Similarly, YY1 competes with SMAD for binding to the PAI-1

promoter and blocks TGFp-induction of PAI-1 promoter [179]. Although, it is a

potential mechanism of regulation of PAI-1 expression by changes in actin

cytoskeleton, no direct evidence linking actin cytoskeleton and YY1-binding to

PAI-1 promoter has been shown so far. In future studies, this can be examined

by performing an electrophoretic gel mobility-shift assay on the nuclear extracts

from the cells treated with actin depolymerizing or stabilizing agents. Given the

facilitation of YY1 binding to promoter elements by G-actin, an increase in G-

actin content upon actin depolymerization is expected to result in the

displacement of SMAD binding to SMAD-binding sites by YY1, and vice versa by


127

increase in F-actin content. Alternatively chromatin immunoprecipitation (ChIP)

assay can be used to identify interaction of YY1 or other potential regulatory

factors to PAI-1 promoter elements [181].

The effect of actin cytoskeleton on plasminogen activators

Having confirmed the regulation of PAI-1 expression by the actin

cytoskeleton, the regulation of other members of plasminogen activators system

was examined next. The effects of TGFp and actin cytoskeleton on tPA and uPA

expression were examined in the same set of samples that were used to study

PAI-1 expression.

An eight hour treatment with TGF(3 caused a small but statistically

significant inhibition of tPA mRNA expression (Chapter 6). This effect is

consistent with the role of TGF[5 as a profibrotic growth factor. Previously,

however, Baricos et al did not see any significant effect of TGF(3 on tPA protein in

cultured human mesangial cells at 72 hours [89]. The effect of TGF[3 observed on

tPA mRNA expression in the current study was small and remains to be

confirmed at the protein level. This small effect could represent the variability

among different mesangial cell isolates or the effect of differences between the

treatment periods. At the same time, inhibition of actin polymerization increased

basal tPA mRNA expression and reversed the inhibition exerted by TGF(3. This

finding is particularly interesting in that it shows coordinated regulation of the two

genes by the actin cytoskeleton. Simultaneous inhibition of PAI-1 expression and

upregulation of tPA allows tPA to act unopposed by PAI-1 resulting in a fibrolytic

state. These results are in agreement with previous studies showing increased


128

tPA expression and fibrolytic activity by simvastatin, an HMG CoA reductase

inhibitor that inhibits Rho activation in human vascular smooth muscle cells,

endothelial cells and peritoneal mesothelial cells [173, 182, 183], These studies

provide indirect evidence that inhibition of Rho activation increases tPA

expression. The current study provides direct evidence that inhibition of Rho-

mediated actin polymerization increases tPA expression in human mesangial

cells and that there is a coordinated regulation of the plasminogen activation

system by the actin cytoskeleton. If the effect seen at the mRNA levels is

sustained functionally, it favors increased breakdown of ECM by tPA upon

treatment with actin depolymerizing agents, a potential utility in breaking down

ECM from sclerosed glomeruli of diseased kidneys.

The coordinated regulation of PAI-1 and tPA may result from the extensive

homology between 5’ -flanking regions of PAI-1 and tPA genes [115], Bosma et

al observed only six gaps during alignment of 521 positions of 5’ sense strand of

PAI-1 (non-coding) with 5’ antisense strand of tPA (coding). The presence of

extensive nucleotide homology, although on opposite strands, may allow

common regulatory factors to drive the expression of PAI-1 and tPA coordinately.

Accordingly, changes in actin cytoskeleton may change the binding of regulatory

factor to PAI-1 and tPA coordinately. In fact, a coordinated increase in the

expression of expression of PAI-1 and tPA has been shown in vivo in association

with stress, surgery and myocardial infarction; and in vitro by endothelial cells in

response to thrombine, histamine and glucocorticoids [115].


129

On the other hand, uPA expression was increased by TGF(3 (Chapter 7).

The increase seen in uPA by TGFp is consistent with a similar increase shown

by Baricos et al. [89]. However, they showed that although TGFp increased both

uPA and PAI-1 expression, the net effect was inhibition of plasminogen activation

by PAI-1, suggesting that the increase in PAI-1 overcomes the increase in uPA in

human mesangial cells. Therefore, the TGFp-mediated increase in uPA mRNA

may not be functionally significant. In the current study, the net effect of TGFp on

ECM turn over was not examined. The effects of actin depolymerization on uPA

mRNA did not show statistical significance possibly because of too much data

variability.

Human mesangial cells produce smaller amounts of uPA and may not

respond consistently to TGFp-treatment [155]. Alternatively, increasing the

sensitivity of the mRNA detection protocol may minimize the data variation.

Overall, the observation that the actin cytoskeleton regulates tPA and PAI-1 but

not uPA in mesangial cells is consistent with the conclusions of Baricos et. al.

that tPA has a more important role in ECM turnover. They reported that loss of

uPA had no effect on plasminogen activation in mesangial cells from uPA knock

out mice. In contrast, tPA null mesangial cells showed defective plasminogen

activation [61],

The tPA and uPA proteins could not be detected from the conditioned

media using Western blot analysis despite multiple optimization attempts. The

amounts of tPA and uPA expression are much smaller as compared to PAI-1.

Using conditioned media from cultured human mesangial cells, Baricos et al


130

showed a large molar excess of PAI-1 (1.2 ± 0.1 x 10'9 M) over uPA (1.2 ± 0.1 x

10'12 M) and tPA (0.19 ± 0.04 x 10'9M) [155]. The expression levels for PAI-1

mRNA (0.01 pg range) in the current study were also at least 10 fold higher than

those for tPA and uPA (0.001 pg range). These low levels of tPA and uPA protein

expression may be below the level of detection for Western blot analysis. In

future, more sensitive detection methods such as ELISA may be helpful in

detecting tPA and uPA from conditioned media.

Taken together, the results of tPA and uPA analysis show that TGF(3

inhibited tPA mRNA and increased uPA mRNA expression. Actin

depolymerization increased tPA expression under basal and TGF(3-treated

conditions. As discussed earlier, the PAI-1 expression is inhibited under similar

culture conditions. The coordinated regulation of tPA and PAI-1 by actin

cytoskeleton could be useful therapeutically in countering fibrosis.

In summary, this study supports the concept that actin cytoskeleton

can modulate gene expression by regulating intracellular signal transduction. It

provides initial evidence that the inhibition of actin polymerization may

coordinately block the expression of profibrotic genes (such as PAI-1) and

increase the expression of anti-fibrotic genes (such as tPa and uPA). Agents that

inhibit actin polymerization can be potentially beneficial in the treatment of

sclerotic diseases.


131

CHAPTER 9

CONCLUSIONS AND FUTURE DIRECTIONS

Conclusions

In summary, TGFp increased PAI-1 expression in human mesangial cells.

Depolymerization of actin cytoskeleton using inhibitors of Rho and Rho-kinase

inhibited PAI-1 expression. The effects of Rho-inhibition were mimicked by direct

inhibition of actin cytoskeleton suggesting that the effects of Rho-inhibition were

mediated through actin cytoskeleton. On the contrary, stabilization of actin

cytoskeleton increased basal and TGFp-mediated PAI-1 expression. Thus bi

directional changes in the organization of actin cytoskeleton were followed by

changes in the PAI-1 expression suggesting modulation of gene expression by

the actin cytoskeleton. Inhibition of actin polymerization also blocked PAI-1

promoter activity suggesting transcriptional regulation of PAI-1 expression by the

actin cytoskeleton. In contrast to the inhibition of PAI-1 expression, tPA

expression was increased by te actin depolymerization by both direct inhibitors

and inhibitors of Rho-signaling. Thus, changes in actin cytoskeleton mediate the

effects of Rho-GTPases in modulating PAI-1 and tPA expression in response to

TGFp. The opposite regulation of PAI-1 and tPA suggests a coordinated gene

regulation by the actin cytoskeleton whereby they may control ECM degradation.

The results of the current studies with PAI-1 and tPA combined with the previous

work on a-SMA and hypertrophy suggest that changes in organization of the


132

actin cytoskeleton regulate myofibroblast differentiation and ECM accumulation

by coordinately modulating expression of multiple genes.

Among the number of interesting questions that arise from these

observations, two particularly interesting ones were addressed first to explore

future directions. (1) What intracellular signaling pathways are regulated by

changes in actin polymerization during the modulation of TGFp-induced PAI-1

expression? (2) Can agents that inhibit actin polymerization, including inhibitors

of Rho, protect against fibrosis by inhibiting PAI-1 expression in vivo in animal

models? The first question was the logical next step in characterizing the

mechanism of cytoskeleton mediated gene regulation. The second question

addressed the clinical usefulness of the findings of this study.

Role of MAPK in TGFP-induced PAI-1 expression

Introduction

Results discussed in chapters 3 through 7 showed that the Rho-mediated

changes in actin cytoskeleton modulate induction of PAI-1 in response to

extracellular stimulus such as TGFp. The intracellular signaling pathways

involved in this regulation are not known. SMAD proteins, being the primary

intracellular mediators of TGFp, are potential candidates. However Tsuchida et al

recently showed that SMAD4, essential in SMAD-dependent target genes

responses, regulates only the early (2 hours) TGFp-mediated PAI-1 response

and not the sustained PAI-1 response in mesangial cells [184], Thus, it appears

that non-SMAD intracellular signaling pathways may also regulate TGFp-induced

PAI-1 expression. This observation is supported by findings that the effects of


133

SMAD and mitogen-activated protein kinases (MAPKs), a group of serine-

threonine kinases consisting of three sub-families of intracellular signal

transducers, are additive in achieving maximum TGFp-dependent responses in

human mesangial cells [185]. TGFp-induced PAI-1 expression has been shown

to require MAPK in a cell-type specific manner [186-190], TGF(3-mediated PAI-1

expression requires extracellular signal regulated kinase (ERK) in astrocytes and

renal epithelial cells [188, 189], p38 in hepatocytes and fibroblasts [186, 190],

and c-jun-NH2 terminal kinase (JNK) in MvlLu epithelial cells [187], The

requirement of MAPK for TGF-P mediated PAI-1 expression has not been

examined yet in human mesangial cells.

Recently, Schnaper et al have showed that TGFp-induction of collagen

gene expression requires ERK activation [191]. Also, actin depolymerization

blocks TGFp-induced collagen expression [87]. Taken together these studies

suggest that actin depolymerization blocks TGFp-induced collagen expression by

inhibiting ERK activation. Similarly, TGFp may be activating MAPK to induce PAI-

1 in an actin cytoskeleton dependent manner. The hypothesis that the actin

cytoskeleton modulates TGFp-induced PAI-1 expression by modulating MAPK

activation was proposed. As a first step towards examining this hypothesis, the

requirement of MAPKs in TGFp-induced PAI-1 expression was examined in

human mesangial cells.

Working hypothesis

TGFp-induced PAI-1 expression in human mesangial cells requires

activation of MAPK pathway in a cytoskeleton dependent manner.


134

Experimental model

To examine the requirement of MAPK in TGFP-mediated PAI-1

expression, pharmacological inhibitors of MAPK were used block MAPK

signaling. The efficacies of reported effective concentrations of MAPK inhibitors

were confirmed in human mesangial cells in the lab prior to the use. The

literature indicated that the effective doses were 30 pM for PD98059, the ERK

inhibitor [192], 5 pM for SB203580, the p38 inhibitor [193] and 10 pM for

SP600125, the JNK inhibitor [194], These kinase inhibitors were relatively

specific at the doses used in the study. PD98059 and SB203580 were found

specific inhibitors of ERK and p38 respectively with minimal inhibition of other

kinases at doses higher than those used in this study [195], SP600125 was

found >20-fold selective inhibitor of JNK at IC5o of 10 pM, the same dose as used

in this study [196].

To examine if one or more of the three MAPKs were required for TGFp-

induced PAI-1 activation in human mesangial cells, serum-starved mesangial

cells were pre-treated with MAPK inhibitors followed by TGFp-treatment. The

effects on PAI-1 mRNA and protein expression were examined.

Results

Since TGFP activates different MAPK modules depending on the cell type

and the target gene, the requirement of each of the three MAPK for TGFp

mediated PAI-1 expression in human mesangial cells was examined first. Serum-

starved human mesangial cells were pre-treated for one-hour with 30 pM

PD98029, 5 pM SB203580 and 10 pM SP600125 to inhibit ERK, p38 and JNK


135

respectively. Cells were then treated with 10 ng/ml TGFp for 8 hours (mRNA

analysis) or 24 hours (protein analysis). Real-time PCR analysis showed that

inhibition of ERK, p38 and JNK changed PAI-1 mRNA expression in serum-free

media to 94.6 ± 10.8%, 87.2 ± 6.6% and 82.7 ± 14.0% of untreated control

respectively. None of the effects were statistically significant. However, ERK and

JNK inhibition blocked TGFp-induced PAI-1 expression to 64.7 ± 14.7% (p=0.06)

and 52.7 ± 4.7% (p<0.005) of TGFp-treated control respectively. Inhibition of p38

increased PAI-1 expression to 114.9 ± 5.7% of TGFp-treated control (p=0.05)

(Fig. 32).

Western blot analysis of conditioned media (n=3) showed that ERK and

JNK inhibition inhibited basal PAI-1 expression to 70.6 ± 13.2% and 64.3 ±

14.5%of untreated control respectively (p<0.05). Inhibition of p38 had no

significant effect on basal or TGFp-induced The PAI-1 protein expression (96.6 ±

12.4%). However, ERK and JNK inhibition blocked TGFp-induced PAI-1

expression to 49.5 ± 12.6% (p<0.005) and 44.4 ± 12.6% (p<0.001) of TGFp-

treated control respectively. Inhibition of p38 changed PAI-1 expression to

90.7 ± 5.0% of TGFp-treated control (Fig. 33).

From these results both ERK and JNK appear to be required for TGFp-

induced PAI-1 expression whereas p38 is not required for basal or TGFp-induced

PAI-1 expression.

Discussion

The main focus of this study was to identify which, if any, of the MAPK

was being activated by TGFp for PAI-1 regulation. Inhibitors of ERK and JNK


136

— TGFp

250 -i

200 -

+ TGFp

*- t

t

tt

1 sof ■t

3fin

1 oo

so -f

oI

t to \ o m ' ovm 00 N t t ino in o00 O 00ov o o o \Q (S VO QP4 CQ

t tpLHt t Hh

o00infoocsPQt t

m(SooVOp-t t

Fig. 32. Effect of MAPK inhibition on PAI-1 mRNA expression. Serum- starved human mesangial cells were pre-treated for one-hour with 30 pM PD98029, 5 pM SB203580 and 10 pM SP600125 to inhibit ERK, p38 and JNK respectively. Cells were then treated with 10 ng/ml TGFp for 8 hours followed by quantitative real-time PCR analysis of mRNA. The vertical bars and the error bars represent the mean value for PAI-1 mRNA and SEM respectively. The value for untreated control is set at 100%. *: p<0.005 compared to S-, f : p=0.06 compared to TGFp, t t : p=0.05 compared to TGFp, t t t : P<0.05 compared to TGFp (n=3).


137

PAI-1---- ^

TGFp - - + + - - + + - - + + - - + +

s- PD98059 SB203580 SP600125

s. C5

300

250 -

200 -C* r ~ l

<L>|> 150 &

■7 100 H

<jQ

0I

1ft

TG Fp

*

on»f)o000 \

*

+ TG FP* *

tt

if) 11ft

Os00 <s If)if) o

o 00o o Ov<s QPQ % CLift

o00If)o

<3

B

t

if)<stpHooVO

Fig. 33. Effect of MAPK inhibition on PAI-1 protein expression. Serum- starved human mesangial cells were pre-treated for one-hour with 30 pM PD98029, 5 pM SB203580 and 10 pM SP600125 to inhibit ERK, p38 and JNK respectively. Cells were then treated with 10 ng/ml TGFp for 24 hours followed by Western blot analysis of conditioned media (n=3). Repersentative blot is shown in panel A. Panel B shows graphical representation of three separate experiments. The vertical bars and the error bars represent the mean value for PAI-1 protein and SEM respectively. The value for untreated control is set at 100%. *: p<0.05 compared to S-, **: p<0.005 compared to S-, f . p<0.01 compared to TGF(3, t f : p<0.005 compared to TGFp.


138

blocked TGFp-induced PAI-1 mRNA and protein expression suggesting their

involvement in TGFP signaling. The requirement of ERK is consistent with

studies showing involvement of ERK in Angiotensin, vascular endothelial growth

factor and platelet derived growth factor induced PAI-1 expression [81, 197, 198],

Involvement of JNK is consistent with regulation of thrombin-induced PAI-1

expression by JNK [199], Overall, the findings are also similar to the results of

Schnaper et al showing activation of ERK and JNK but not p38 by TGFp in

human mesangial cells [191]. The requirements for ERK and JNK may result

from their roles in regulating AP-1 dependent transcription of PAI-1. In fact, a

study published during the preparation of this thesis showed a requirement of

MAPK/AP-1 activation for TGFp-induced PAI-1 expression in rat mesangial cells

[200]. This published result confirmed the original hypothesis proposed in this

lab.

The treatment with ERK and JNK inhibitors in serum-free media blocked

basal PAI-1 protein expression but did not change PAI-1 mRNA expression. This

finding suggests that under basal condition, post-transcriptional regulation of PAI-

1 may contribute to the reduction in protein levels by ERK and JNK inhibitors.

Conversely, inhibition of p38 resulted in a small but significant increase in TGFP-

induced PAI-1 mRNA expression. The increase may result from increased

activity of ERK and JNK upon p38 inhibition as shown by Ohashi et al [201].

In summary, the results confirm a requirement for ERK and JNK in TGFp-

induced PAI-1 expression in human mesangial cells. However, the specificity of

the effects of pharmacological inhibitors has to be ultimately confirmed using


139

dominant negative mutants of each of the three MAPKs. Although the study is

focused mainly on identifying the role of MAPK as the intracellular mediator of

TGFp signaling, it is appreciated that TGFp signaling may involve other

intracellular signaling molecules such as protein kinase A (PKA) and protein

kinase C (PKC) for the regulation of PAI-1 expression. The activation of ERK and

JNK upon TGFp-treatment can be examined to show a direct evidence for the

role of MAPK in TGFp signaling. The role of actin cytoskeleton in modulation of

ERK and JNK activation can be studied by examining the changes in ERK and

JNK activation upon inhibiting or stabilizing the actin cytoskeleton. The

confirmation of the role of actin cytoskeleton in modulating MAPK activation in

TGFp-induced PAI-1 expression will explain the mechanism of action of

cytoskeleton modifying agents. Overall, the elucidation of specific mechanism of

gene regulation by the actin cytoskeleton will provide avenue for future research

into identifying more specific targets of actin cytoskeleton in the regulation of

intracellular signaling and gene expression.

Effect of Rho-kinase inhibition on sclerosis in chronic mesangiosclerotic

glomerulonephritis

Introduction

The results of cell culture experiments showed coordinated regulation of

two members of plasminogen activator system, PAI-1 and tPA, by the Rho-

mediated changes in actin cytoskeleton (Chapters 3 through 7). The functional

significance of these changes in plasminogen activator system was determined

next by examining the effect on ECM degradation in vivo.


140

Regulation of ECM turnover is one of the major functions of the

plasminogen activator system [56]. Increased intraglomerular deposition of ECM

proteins resulting in glomerulosclerosis is a major feature of chronic renal

diseases. [202], Increased ECM deposition may result from inhibition of ECM

breakdown by TGFp-induced PAI-1 expression in chronic glomerulosclerotic

renal diseases [59]. The in vitro results of this study show that inhibition of Rho-

mediated actin polymerization inhibits TGFp-induced PAI-1 expression. In vivo

inhibition of ROCK by Y-27632 is also shown to protect against tubulointerstitial

fibrosis in a unilateral ureteral obstruction model [104], These observations

suggested the possibility that if Rho-kinase inhibitors had similar inhibitory effect

on PAI-1 expression in vivo, it could protect against ECM deposition and

glomerulosclerosis.

Working Hypothesis

Rho-kinase activation increases expression of PAI-1 compared to tPA and

uPA, and thus causes mesangial matrix expansion. Treatment of rats with Rho-

kinase inhibitor, HA-1077, will block these changes and provide a protective

effect against glomerulosclerosis

Experimental model

A single injection of anti-Thy 1.1 antibody, that reacts with a Thy 1-like

antigen on the surface of glomerular mesangial cells, leads to a disease

characterized by mesangial proliferation and, deposition of collagen and fibrin in

mesangium [203]. However, this injury is self-limited and resolves as early as 6


141

weeks [204], Repeated injections of anti-Thy 1.1 antibody have been reported to

produce a more severe form of glomerulonephritis with unresolved

glomerulosclerosis akin to the lesions seen in chronic glomerulonephritis [202,

205], This model system was used to examine effectiveness of ROCK-inhibitor

in prevention and treatment of ECM accumulation in chronic renal diseases.

In order to cause mesangiaosclerotic glomerulonephritis rats were given

four weekly injections of Thy 1.1 antiserum (ATS) containing anti-Thy 1.1

antibody as described in the chapter 2. Each ATS injection was followed by

injection of goat serum to provide complement for fixation of the antibody. Also,

after four weekly injections, the animals were observed/treated for six more

weeks to produce progressive injury [206]. The Rho-kinase inhibitor HA-1077

was used in this study to treat the animals because of its specificity at the dose

used in the study, water-solubility for ease of administration and lower expense.

Moreover, it is already under clinical trials for the use in human patients suffering

from stroke suggesting its potential use in humans [207, 208], The

glomerulosclerotic injury was visualized by histology and immunohistochemistry.

Twenty-four hour urinary protein excretion and serum creatinine levels were

measured as indicators of glomerular injury.

Results

Histopathologic grading of glomerular ECM deposition and injury

The histological sections were stained by Masson trichrome method. The

slides were coded before the analysis. Sclerosis was graded on a scale of 0 for

normal to 3+ for diffusely increased trichrome-positive (blue) mesangial matrix


142

material. Scores of 2+ and 3+ correspond to focally positive or intermediate

staining intensity of trichrome-positive glomeruli. A practicing renal pathologist

performed grading of trichrome-stained sections. The code was broken only after

completion of the grading. The average score of control rats was 0.8 ± 0.3 (s.e.)

while the group with ATS administration had average score of 1.7 ± 0.6. Rats

treated with HA-1077 had an average score of 1.0 both whether the therapy was

initiated before (s.e. 0.5) or after (s.e. 0.3) the first ATS injection (Table 5). While

these results suggest that the therapy with HA-1077 may have been beneficial,

none of these differences achieved statistical significance at a confidence level of

p < 0.05.

The sections were also stained for smooth muscle a-actin (a-SMA) to

examine myofibroblast differentiation in mesangial cells. For each animal, 100

glomeruli were sequentially analyzed at 40X objective. The glomeruli showing

clear non-hilar staining for a-SMA were counted as positive. The results were

similar to those seen with trichrome staining. The percentage of positive

glomeruli were: 0.8% ± 0.5% in normal control rats, 3.8% ± 2% in ATS-treated

rats and, 2.5% ± 0.6% in rats treated with HA-1077 before and after the ATS

injection (Table 5). Again, none of these results showed any statistically

significant difference between treated and untreated groups.

Effect on urinary protein excretion

Urinary protein results at the end of the study were consistent with production of

mild glomerular injury (Table 5). The control rats excreted 14.6 ± 1.7 mg protein/

24 h, ATS-treated rats excreted 35.0 ± 11.0 mg protein/ 24 h (p<0.05).


143

Fig. 34. Effect of Rho-kinase inhibition on sclerosis in a rat model of chronic glomerulonephritis. Animals were divided into four groups as follows: Group 1: Normal saline injection alone (A), Group 2: ATS-complement injection(B), Group 3: ATS-complement+ HA-1077 treatment started 1 day before the first injection (C), Group 4: ATS-complement+HA-1077 treatment started 1 week after the first injection (D). Trichrome staining of representative glomeruli show increased mesangial sclerosis in group 2 (B) and, a relative decrease in groups 3(C) and 4 (D) suggesting a protective effect of Rho-kinase inhibition. The arrowheads mark mesangial ECM deposition stained blue by trichrome staining.


144

Table 5. Effect of Rho-kinase inhibitor on experimental glomerulonephritis

Group 24-hour urinary protein

(mg)

Serumcreatinine(mg/dL)

Histologicalgrading

(0-3)

a-SMA staining

(% positive)

1.Control 14.6 ± 1.7 1.18 ± 0.16 0.8 ±0.3 0.8 ±0.5

2. Disease, no treatment

35.0 ±11.0 (p< 0.05) 1.41 ±0.2 1.7 ±0.6 3.8 ±2.0

3. Disease, Pre-treatment

19.0 ±2.1 (p=0.09) 1.07 ±0.14 1.0 ±0.5 2.5 ±0.6

4. Disease, post-treatment

24.42 ± 3.9 (p=0.12) 1.21 ±0.18 1.0 ±0.3 2.5 ±0.6


145

Rats started on therapy with HA-1077 before the first ATS injection excreted 19.0

±2.1 mg protein/24 h (p=0.092 as compared to untreated group), whereas rats

started on therapy one week after the first injection had 24.42 ± 3.9 mg

protein/24 h (p=0.193 as compared to untreated group). SDS-PAGE analysis of

urinary proteins showed that albumin was the major urinary protein.

Effect on serum creatinine levels

Serum creatinine measurement at the end of the study followed the same

trends as urinary proteins, but again failed to reach statistical significance for the

treatment effect. These values were: control 1.18 ± 0.16 mg/dl, ATS only 1.41 ±

0.2 mg/dl, HA-1077 started before ATS; 1.07 ± 0.14 mg/dl; and, HA-1077 started

after ATS; 1.21 ± 0.18 mg/dl (Table 5).

Determination of drug efficacy

HA-1077 solutions used in the study effectively inhibited actin

polymerization in cultured human mesangial cells throughout the treatment

period suggesting that the drug was stable in water.

There were no significant differences between groups in kidney to body

weight ratio, blood pressure, daily water consumption and daily urine output.

Discussion

The results of the histologic scoring, a-SMA staining, urinary protein and

serum creatinine values all suggest the same conclusion, that the Rho-kinase

inhibitor, HA-1077 had a beneficial effect on glomerular injury in this chronic

model of mesangial sclerotic glomerulonephritis (Table 5). Although none of

these results individually achieved statistical significance, these studies provide


146

initial evidence that a Rho-kinase inhibitor could be useful in the treatment of

glomerulosclerosis. In future optimization of the disease model may yield

statistically significant results. At this stage, this chronic model is difficult to

reproduce (personal communication between Dr. Glass, the principle

investigator, and other investigators in the field).

Several factors may contribute to the inability of the results to achieve

statistically significant differences between the study groups. First, the degree of

mesangial sclerosis was mild even in the most severely affected rats. Thus a

model with more severe mesangial injury will be necessary. Border et al. allowed

18 weeks (instead of 10 weeks as used in this study) for the progression of the

disease in their study [206]. Alternatively, more experimental models with more

invasive procedures such as surgical renal ablation could be used to produce

severe injury [209, 210]. Second, a larger study with more animals in each group

may help the trends seen in the result achieve a statistical significance. Third, the

effect of treatment was inconsistent, making it difficult to grade the injury even by

an experienced pathologist. Although the drugs used in these studies were active

and effective in blocking stress fiber formation in cell culture, their in vivo

effective dose could not be assessed. Optimization of therapeutic dose in this

particular model system could potentially give more consistent therapeutic

effects.


147

REFERENCES

1. USRDS: United States Renal Data Systems Annual Report. 2004

2. SEHGAL AR: What is the best treatment for end-stage renal disease? Am J Med 112:735-736, 2002

3. HOSTETTER TH: Prevention of the development and progression of renal disease. J Am Soc Nephrol 14:S144-147, 2003

4. DIFIORE MS: Di Fiore's Atlas of Histology With Functional Correlations, 10th ed, Lippincott Williams & Wilkins, 2004

5. WARDLE N: Glomerulosclerosis: the final pathway is clarified, but can we deal with the triggers? Nephron 73:1-7, 1996

6. BORDER WA, OKUDA S, NAKAMURA T: Extracellular matrix and glomerular disease. Semin Nephrol 9:307-317, 1989

7. ZEISBERG M, STRUTZ F, MULLER GA: Role of fibroblast activation in inducing interstitial fibrosis. J Nephrol 13 Suppl 3:S111-120, 2000

8. JANSEN RP: RNA-cytoskeletal associations. FASEB J 13:455-466, 1999

9. KASHGARIAN M, STERZEL RB: The pathobiology of the mesangium. Kidney In tW :524-529, 1992

10. KASPER DL BE, FAUCI A, HAUSER S, LONGO D, JAMESON J: Harrison's Principles of Internal Medicine, 16th ed, McGraw-Hill Professional, 2004

11. DESMOULIERE A, GEINOZ A, GABBIANI F, et al: Transforming growth factor-beta 1 induces alpha-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts. J of Cell Biol 122:103-111, 1993

12. SHULTZ PJ, RAIJ L: The glomerular mesangium: role in initiation and progression of renal injury. Am J Kidney Dis 17:8-14, 1991

13. MACPHERSON BR, LESLIE KO, LIZASO KV, et al: Contractile cells of the kidney in primary glomerular disorders: an immunohistochemical study using an anti-alpha-smooth muscle actin monoclonal antibody. Hum Pathol 24:710-716, 1993


148

14. ALPERS CE, HUDKINS KL, GOWN AM, et al: Enhanced expression of "muscle-specific" actin in glomerulonephritis. Kidney Int 41:1134-1142, 1992

15. ROY-CHAUDHURY P, WU B, MCDONALD S, et al: Phenotypic analysis of the glomerular and periglomerular mononuclear cell infiltrates in the Thy 1.1 model of glomerulonephritis. Lab Invest 72:524-531, 1995

16. ROMANO LA, FERDER L, INSERRA F, et al: Intraglomerular expression of alpha-smooth muscle actin in aging mice. Hypertension 23:889-893, 1994

17. FLOEGE J, BURNS MW, ALPERS CE, et al: Glomerular cell proliferation and PDGF expression precede glomerulosclerosis in the remnant kidney model. Kidney Int 41:297-309, 1992

18. FLOEGE J, JOHNSON RJ, COUSER WG: Mesangial cells in the pathogenesis of progressive glomerular disease in animal models. [Review], Clinical Investigator 70:857-864, 1992

19. JOHNSON RJ, FLOEGE J, YOSHIMURA A, et al: The activated mesangial cell: a glomerular "myofibroblast"? [Review], J Am Soc Nephrol 2:S190-S197, 1992

20. JOHNSON RJ, IIDA H, ALPERS CE, et al: Expression of smooth muscle cell phenotype by rat mesangial cells in immune complex nephritis. Alpha- smooth muscle actin is a marker of mesangial cell proliferation. J Clin Invest 87:847-858,1991

21. ZHANG K, REKHTER MD, GORDON D, et al: Myofibroblasts and their role in lung collagen gene expression during pulmonary fibrosis. A combined immunohistochemical and in situ hybridization study. Am J Path 145:114-125, 1994

22. WILLEMS IE, HAVENITH MG, DE MEY JG, et al: The alpha-smooth muscle actin-positive cells in healing human myocardial scars. Am J Path 145:868-875, 1994

23. ENZAN H, HIMENO H, IWAMURA S, et al: Sequential changes in human Ito cells and their relation to postnecrotic liver fibrosis in massive and submassive hepatic necrosis. Virchows Archiv 426:95-101, 1995

24. DARBY I, SKALLI O, GABBIANI G: Alpha-smooth muscle actin is transiently expressed by myofibroblasts during experimental wound healing. Lab Invest 63:21-29, 1990


149

25. EDDY AA: Plasminogen activator inhibitor-1 and the kidney. Am J Physiol Renal Physiol 283:F209-220, 2002

26. STEPHENSON LA, HANEY LB, HUSSAINI IM, et al: Regulation of smooth muscle a-actin expression and hypertrophy in cultured mesangial cells. Kidney Int 54:1175-1187, 1998

27. BISHOP AL, HALL A: Rho GTPases and their effector proteins. Biochem J 348 Pt 2:241-255, 2000

28. PATEL K, HARDING P, HANEY LB, et al: Regulation of the mesangial cell myofibroblast phenotype by actin polymerization. J Cell Physiol 195:435- 445, 2003

29. UNTERGASSER G, GANDER R, LILG C, et al: Profiling molecular targets of TGF-beta1 in prostate fibroblast-to-myofibroblast transdifferentiation. Mech Ageing Dev 126:59-69, 2005

30. HENSON JH: Relationships between the actin cytoskeleton and cell volume regulation. Microsc Res Tech 47:155-162, 1999

31. BARKALOW K, HARTWIG JH: Actin cytoskeleton. Setting the pace of cell movement. CurrBiol 5:1000-1002, 1995

32. RIDLEY AJ: Rho-related proteins: actin cytoskeleton and cell cycle. Curr Opin Genet Dev 5:24-30, 1995

33. FOLKMAN J, MOSCONA A: Role of cell shape in growth control. Nature 273:345-349, 1978

34. INGBER DE, FOLKMAN J: Mechanochemical switching between growth and differentiation during fibroblast growth/actor-stimulated angiogenesis in vitro: role of extracellular matrix. J Cell Biol 109:317-330, 1989

35. INGBER DE: Mechanical signaling and the cellular response to extracellular matrix in angiogenesis and cardiovascular physiology. Circ Res 91:877-887, 2002

36. WANG N, INGBER DE: Control of cytoskeletal mechanics by extracellular matrix, cell shape, and mechanical tension. Biophys J 66:2181 -2189, 1994

37. SCHWARTZ MA, INGBER DE: Integrating with integrins. [Review] [54 refs]. Mol Biol Cell 5:389-393, 1994


150

38. WANG N, BUTLER JP, INGBER DE: Mechanotransduction across the cell surface and through the cytoskeleton [see comments]. Science 260:1124- 1127, 1993

39. SHAFRIR Y, BEN-AVRAHAM D, FORGACS G: Trafficking and signaling through the cytoskeleton: a specific mechanism. J Cell Sci 113:2747- 2757, 2000

40. JANMEY PA: The cytoskeleton and cell signaling: component localization and mechanical coupling. Physiol Rev 78:763-781, 1998

41. CHRISTERSON LB, VANDERBILT CA, COBB MH: MEKK1 interacts with alpha-actinin and localizes to stress fibers and focal adhesions. Cell Motil Cytoskeleton 43:186-198, 1999

42. KANSRA S, STOLL SW, ELDER JT: Differential cytoskeletal association of ErbB1 and ErbB2 during keratinocyte differentiation. Biochem Biophys Res Commun 295:1108-1117, 2002

43. SINGER RH: The cytoskeleton and mRNA localization. [Review] [41 refs]. Curr Opin Cell Biol 4:15-19, 1992

44. SCHOENENBERGER CA, STEIN METZ MO, STOFFLER D, et al: Structure, assembly, and dynamics of actin filaments in situ and in vitro. Microsc Res Tech 47:38-50, 1999

45. POLLARD TD, AEBI U, COOPER JA, et al: Actin structure, polymerization, and gelation. Cold Spring Harbor Symposia on Quantitative Biology 46 Pt 2:513-524, 1982

46. ANJA SCHMIDT MH: Signalling to the actin cytoskeleton. Ann Rev Cell Dev Biol:305-338, 1998

47. DOS REMEDIOS CG, CHHABRA D, KEKIC M, et al: Actin binding proteins: regulation of cytoskeletal microfilaments. Physiol Rev 83:433- 473, 2003

48. PAAVILAINEN VO, BERTLING E, FALCK S, et al: Regulation of cytoskeletal dynamics by actin-monomer-binding proteins. Trends Cell Biol 14:386-394, 2004

49. SUN HQ, KWIATKOWSKA K, YIN HL: Actin monomer binding proteins. Curr Opin Cell Biol 7:102-110, 1995


151

50. SAH VP, SEASHOLTZ TM, SAGI SA, et al: The role of Rho in G protein- coupled receptor signal transduction. Ann Rev Pharmacol Toxicol 40:459- 489, 2000

51. MAEKAWA M, ISHIZAKI T, BOKU S, et al: Signaling from Rho to the actin cytoskeleton through protein kinases ROCK and LIM-kinase. Science 285:895-898, 1999

52. MACKAY DJ, HALL A: Rho GTPases. J Biol Chem 273:20685-20688,1998

53. KAIBUCHI K, KURODA S, AMANO M: Regulation of the cytoskeleton and cell adhesion by the Rho family GTPases in mammalian cells. Annu Rev Biochem 68:459-486, 1999

54. FRAME MC, BRUNTON VG: Advances in Rho-dependent actin regulation and oncogenic transformation. Curr Opin Genet Dev 12:36-43, 2002

55. ISHIZAKI T: Rho-mediated signal transduction and its physiological roles. Nippon Yakurigaku Zasshi 121:153-162, 2003

56. LIJNEN HR: Elements of the fibrinolytic system. Ann N Y Acad Sci 936:226-236, 2001

57. DAVIES M, MARTIN J, THOMAS GJ, et al: Proteinases and glomerular matrix turnover. Kidney Int 41:671-678, 1992

58. COLLEN D: Ham-Wasserman lecture: role of the plasminogen system in fibrin- homeostasis and tissue remodeling. Hematology (Am Soc Hematol Educ Program): 1-9, 2001

59. TOMOOKA S, BORDER WA, MARSHALL BC, et al: Glomerular matrix accumulation is linked to inhibition of the plasmin protease system. Kidney Int 42:1462-1469, 1992

60. DEITCHER SR, JAFF MR: Pharmacologic and clinical characteristics of thrombolytic agents. Rev Cardiovasc Med 3 Suppl 2:S25-33, 2002

61. BARICOS WH, REED JC, CORTEZ SL: Extracellular matrix degradation by cultured mesangial cells: mediators and modulators. Exp Biol Med (Maywood) 228:1018-1022, 2003

62. BASS R, ELLIS V: Cellular mechanisms regulating non-haemostatic plasmin generation. Biochem Soc Trans 30:189-194, 2002


152

63. FOGO AB: Renal fibrosis: not just PAI-1 in the sky. J Clin Invest 112:326- 328, 2003

64. YANG J, SHULTZ RW, MARS WM, et al: Disruption of tissue-type plasminogen activator gene in mice reduces renal interstitial fibrosis in obstructive nephropathy. J Clin Invest 110:1525-1538, 2002

65. CHUANG-TSAI S, SISSON TH, HATTORI N, et al: Reduction in fibrotic tissue formation in mice genetically deficient in plasminogen activator inhibitor-1. Am J Pathol 163:445-452, 2003

66. DOBROVOLSKY AB, TITAEVA EV: The fibrinolysis system: regulation of activity and physiologic functions of its main components. Biochemistry (Mosc) 67:99-108, 2002

67. MYOHANEN H, VAHERI A: Regulation and interactions in the activation of cell-associated plasminogen. Cell Mol Life Sci 61:2840-2858, 2004

68. SILVERMAN GA, BIRD PI, CARRELL RW, et al: The serpins are an expanding superfamily of structurally similar but functionally diverse proteins. Evolution, mechanism of inhibition, novel functions, and a revised nomenclature. J Biol Chem 276:33293-33296, 2001

69. BINDER BR, CHRIST G, GRUBER F, et al: Plasminogen activator inhibitor 1: physiological and pathophysiological roles. News Physiol Sci 17:56-61, 2002

70. HAMANO K, IWANO M, AKAI Y, et al: Expression of glomerular plasminogen activator inhibitor type 1 in glomerulonephritis. Am J Kidney Dis 39:695-705, 2002

71. ODA T, JUNG YO, KIM HS, et al: PAI-1 deficiency attenuates the fibrogenic response to ureteral obstruction. Kidney Int 60:587-596, 2001

72. EITZMAN DT, MCCOY RD, ZHENG X, et al: Bleomycin-induced pulmonary fibrosis in transgenic mice that either lack or overexpress the murine plasminogen activator inhibitor-1 gene. J Clin Invest 97:232-237, 1996

73. KAIKITA K, FOGO AB, MA L, et al: Plasminogen activator inhibitor-1 deficiency prevents hypertension and vascular fibrosis in response to long-term nitric oxide synthase inhibition. Circulation 104:839-844, 2001


153

74. ERIKSSON P, KALLIN B, VAN 'T HOOFT FM, et al: Allele-specific increase in basal transcription of the plasminogen- activator inhibitor 1 gene is associated with myocardial infarction. Proc Natl Acad Sci U S A 92:1851-1855, 1995

75. TILLMANN-BOGUSH M, HEATON JH, GELEHRTER TD: Cyclic nucleotide regulation of PAI-1 mRNA stability. Identification of cytosolic proteins that interact with an a-rich sequence. J Biol Chem 274:1172- 1179, 1999

76. VAN ZONNEVELD AJ, CURRIDEN SA, LOSKUTOFF DJ: Type 1 plasminogen activator inhibitor gene: functional analysis and glucocorticoid regulation of its promoter. Proc Natl Acad Sci U S A 85:5525-5529, 1988

77. LOSKUTOFF DJ, SAWDEY M, KEETON M, et al: Analysis of PAI-1 gene expression in vivo using in situ hybridization. Ann N Y Acad Sci 714:259- 264, 1994

78. KEETON MR, CURRIDEN SA, VAN ZONNEVELD AJ, et al: Identification of regulatory sequences in the type 1 plasminogen activator inhibitor gene responsive to transforming growth factor beta. J Biol Chem 266:23048- 23052, 1991

79. RICCIO A, LUND LR, SARTORIO R, et al: The regulatory region of the human plasminogen activator inhibitor type-1 (PAI-1) gene. Nucleic Acids Res 16:2805-2824, 1988

80. LUND LR, RICCIO A, ANDREASEN PA, et al: Transforming growth factor- beta is a strong and fast acting positive regulator of the level of type-1 plasminogen activator inhibitor mRNA in WI-38 human lung fibroblasts. Embo J 6:1281-1286, 1987

81. TAKEDA K, ICHIKI T, TOKUNOU T, et al: Critical role of Rho-kinase and MEK/ERK pathways for angiotensin II- induced plasminogen activator inhibitor type-1 gene expression. Artenoscler Thromb Vase Biol 21:868- 873, 2001

82. MOTOJIMA M, KAKUCHI J, YOSHIOKA T: Association of TGF-beta signaling in angiotensin ll-induced PAI-1 mRNA upregulation in mesangial cells: role of PKC. Biochim Biophys Acta 1449:217-226, 1999

83. KOBAYASHI N, NAKANO S, MITA SI S, et al: Involvement of Rho-Kinase Pathway for Angiotensin ll-lnduced Plasminogen Activator Inhibitor-1 Gene Expression and Cardiovascular Remodeling in Hypertensive Rats. J Pharmacol Exp Ther 301:459-466, 2002


154

84. LOPEZ S, PEIRETTI F, MORANGE P, et al: Activation of plasminogen activator inhibitor-1 synthesis by phorbol esters in human promyelocyte HL-60-roles of PCKbeta and MAPK p42. Thromb Haemost 81:415-422, 1999

85. WEILL FX, BLAZEJEWSKI S, BLANC JF, et al: Characterization of a new human liver myofibroblast cell line: transcriptional regulation of plasminogen activator inhibitor type I by transforming growth factor beta 1. Lab Invest 77:63-70, 1997

86. LAIHO M, SAKSELA O, ANDREASEN PA, et al: Enhanced production and extracellular deposition of the endothelial- type plasminogen activator inhibitor in cultured human lung fibroblasts by transforming growth factor- beta. J Cell Biol 103:2403-2410, 1986

87. HUBCHAK SC, RUNYAN CE, KREISBERG Jl, et al: Cytoskeletal rearrangement and signal transduction in TGF-beta1-stimulated mesangial cell collagen accumulation. J Am Soc Nephrol 14:1969-1980, 2003

88. SCHNAPER HW, HAYASHIDA T, HUBCHAK SC, et al: TGF-beta signal transduction and mesangial cell fibrogenesis. Am J Physiol Renal Physiol 284:F243-252, 2003

89. BARICOS WH, CORTEZ SL, DEBOISBLANC M, et al: Transforming growth factor-beta is a potent inhibitor of extracellular matrix degradation by cultured human mesangial cells. J Am Soc Nephrol 10:790-795, 1999

90. BORDER WA, NOBLE NA: Transforming growth factor-beta in glomerular injury. Exp Nephrol 2:13-17, 1994

91. BOTTINGER EP, BITZER M: TGF-beta signaling in renal disease. J Am Soc Nephrol 13:2600-2610, 2002

92. RICH J, BORTON A, WANG X: Transforming growth factor-beta signaling in cancer. Microsc Res Tech 52:363-373, 2001

93. BORDER WA, NOBLE NA, KETTELER M: TGF-beta: a cytokine mediator of glomerulosclerosis and a target for therapeutic intervention. Kidney Int Suppl 49:S59-61, 1995

94. WENNER CE, YAN S: Biphasic role of TGF-beta1 in signal transduction and crosstalk. J Cell Physiol 196:42-50, 2003


155

95. YAMAMOTO T, NOBLE NA, COHEN AH, et al: Expression of transforming growth factor-beta isoforms in human glomerular diseases. Kidney Int 49:461 -469, 1996

96. YOSHIOKA K, TAKEMURA T, MURAKAMI K, et al: Transforming growth factor-beta protein and mRNA in glomeruli in normal and diseased human kidneys. Lab Invest 68:154-163, 1993

97. ISAKA Y, FUJIWARA Y, UEDA N, et al: Glomerulosclerosis induced by in vivo transfection of transforming growth factor-beta or platelet-derived growth factor gene into the rat kidney. J Clin Invest 92:2597-2601, 1993

98. AKAGI Y, ISAKA Y, ARAI M, et al: Inhibition of TGF-beta 1 expression by antisense oligonucleotides suppressed extracellular matrix accumulation in experimental glomerulonephritis. Kidney Int 50:148-155, 1996

99. MUNGER JS, HUANG X, KAWAKATSU H, et al: The integrin alpha v beta 6 binds and activates latent TGF beta 1: a mechanism for regulating pulmonary inflammation and fibrosis. Cell 96:319-328, 1999

100. FUKASAWA H, YAMAMOTO T, SUZUKI H, et al: Treatment with anti- TGF-beta antibody ameliorates chronic progressive nephritis by inhibiting Smad/TGF-beta signaling. Kidney Int 65:63-74, 2004

101. AZNAR S, LACAL JC: Rho signals to cell growth and apoptosis. Cancer Lett 165:1-10, 2001

102. SHIMIZU Y, DOBASHI K, IIZUKA K, et al: Contribution of small GTPase Rho and its target protein rock in a murine model of lung fibrosis. Am J Respir Crit Care Med 163:210-217, 2001

103. TADA S, IWAMOTO H, NAKAMUTA M, et al: A selective ROCK inhibitor, Y27632, prevents dimethylnitrosamine- induced hepatic fibrosis in rats. J Hepatol 34:529-536, 2001

104. NAGATOYA K, MORIYAMA T, KAWADA N, et al: Y-27632 prevents tubulointerstitial fibrosis in mouse kidneys with unilateral ureteral obstruction. Kidney Int 61:1684-1695, 2002

105. ESSIG M, VRTOVSNIK F, NGUYEN G, et al: Lovastatin modulates in vivo and in vitro the plasminogen activator/plasmin system of rat proximal tubular cells: role of geranylgeranylation and Rho proteins. J Am Soc Nephrol 9:1377-1388, 1998


156

106. ESSIG M, NGUYEN G, PRIE D, etal: 3-Hydroxy-3-methylglutaryl coenzyme A reductase inhibitors increase fibrinolytic activity in rat aortic endothelial cells. Role of geranylgeranylation and Rho proteins. Circ Res 83:683-690, 1998

107. PARK HJ, GALPER JB: 3-Hydroxy-3-methylglutaryl CoA reductase inhibitors up-regulate transforming growth factor-beta signaling in cultured heart cells via inhibition of geranylgeranylation of RhoA GTPase. Proc Natl Acad Sci U S A 96:11525-11530, 1999

108. KOBAYASHI N, NAKANO S, MITA S, et al: Involvement of Rho-kinase pathway for angiotensin ll-induced plasminogen activator inhibitor-1 gene expression and cardiovascular remodeling in hypertensive rats. J Pharmacol Exp Ther 301:459-466, 2002

109. CLONTECH: Atlas™ cDNA Expression Arrays User Manual. BD Clontech Publishing Protocol # PT3140-1, 2002

110. CASTELLO R, ESTELLES A, VAZQUEZ C, et al: Quantitative real-time reverse transcription-PCR assay for urokinase plasminogen activator, plasminogen activator inhibitor type 1, and tissue metalloproteinase inhibitor type 1 gene expressions in primary breast cancer. Clin Chem 48:1288-1295, 2002

111. PROBES M: PicoGreen® dsDNA Quantitation Reagent and Kits.Molecular Probes User Manuals MP 07581, 2003

112. GRENETT HE, AIKENS ML, TABENGWA EM, et al: Ethanol downregulates transcription of the PAI-1 gene in cultured human endothelial cells. Thromb Res 97:247-255, 2000

113. INGBER DE: Fibronectin controls capillary endothelial cell growth by modulating cell shape. Proc Natl Acad Sci USA 87:3579-3583, 1990

114. SIMS JR, KARP S, INGBER DE: Altering the cellular mechanical force balance results in integrated changes in cell, cytoskeletal and nuclear shape. JC ell Sci 103:1215-1222, 1992

115. BOSMA PJ, VAN DEN BERG EA, KOOISTRA T, et al: Human plasminogen activator inhibitor-1 gene. Promoter and structural gene nucleotide sequences. J Biol Chem 263:9129-9141, 1988

116. MUCHANETAKUBARA EC, ELNAHAS AM: Myofibroblast phenotype expression in experimental renal scarring. Nephrol, Dial, Transpl 12:904- 915, 1997


157

117. ZHANG HY, PHAN SH: Inhibition of myofibroblast apoptosis by transforming growth factor beta(1). Am J Respir Cell Mol Biol 21:658-665, 1999

118. HASHIMOTO S, GON Y, TAKESHITA I, et al: Transforming growth Factor-betal induces phenotypic modulation of human lung fibroblasts to myofibroblast through a c-Jun-NH2-terminal kinase- dependent pathway. Am J Respir Crit Care Med 163:152-157, 2001

119. FAN JM, NG YY, HILL PA, et al: Transforming growth factor-beta regulates tubular epithelial- myofibroblast transdifferentiation in vitro. Kidney Int 56:1455-1467, 1999

120. SERINI G, BOCHATON-PIALLAT ML, ROPRAZ P, et al: The fibronectin domain ED-A is crucial for myofibroblastic phenotype induction by transforming growth factor-betal. J Cell Biol. 142:873-881, 1998

121. CHENG J, GRANDE JP: Transforming growth factor-beta signal transduction and progressive renal disease. Exp Biol Med (Maywood) 227:943-956, 2002

122. BORDER WA: Transforming growth factor-beta and the pathogenesis of glomerular diseases. Curr Opin Nephrol Hypertens 3:54-58, 1994

123. YU L, NOBLE NA, BORDER WA: Therapeutic strategies to halt renal fibrosis. Curr Opin Pharmacol 2:177-181, 2002

124. FALK P, MA C, CHEGINI N, et al: Differential regulation of mesothelial cell fibrinolysis by transforming growth factor beta 1. Scand J Clin Lab Invest 60:439-447, 2000

125. WILSON HM, HAITES NE, BOOTH NA: Opposing effects of interleukin-1 and transforming growth factor-beta on the regulation of tissue-type plasminogen activator and plasminogen activator inhibitor type-1 expression by human mesangial cells. Exp Nephrol 5:233-238, 1997

126. STEFONI S, CIANCIOLO G, DONATI G, et al: Low TGF-beta1 serum levels are a risk factor for atherosclerosis disease in ESRD patients. Kidney Int 61:324-335, 2002

127. MATSUMOTO N, ISHIMURA E, KOYAMA H, et al: Blocking of alpha 5 integrin stimulates production of TGF-beta and PAI-1 by human mesangial cells. Biochem Biophys Res Commun 305:815-819, 2003


158

128. KATOH K, KANO Y, AMANO M, et al: Stress fiber organization regulated by MLCK and Rho-kinase in cultured human fibroblasts. Am J Physiol Cell Physiol 280:C1669-1679, 2001

129. NARUMIYA S, ISHIZAKI T, UEHATA M: Use and properties of ROCK- specific inhibitor Y-27632. Methods Enzymol 325:273-284, 2000

130. MACLEAN-FLETCHER S, POLLARD TD: Mechanism of action of cytochalasin B on actin. Cell 20:329-341, 1980

131. SPECTOR I, SHOCHET NR, BLASBERGER D, et al: Latrunculins-novel marine macrolides that disrupt microfilament organization and affect cell growth: I. Comparison with cytochalasin D. Cell Motil Cytoskeleton 13:127-144, 1989

132. MICHAEL R. BUBB IS, BEYER B, et al: Effects of Jasplakinolide on the kinetics of Actin Polymerization. J Biol Chem 275:5163-5170, 2000

133. SALONEN EM, VAHERI A, POLLANEN J, et al: Interaction of plasminogen activator inhibitor (PAI-1) with vitronectin. J Biol Chem 264:6339-6343, 1989

134. OWENSBY DA, MORTON PA, WUN TC, et al: Binding of plasminogen activator inhibitor type-1 to extracellular matrix of Hep G2 cells. Evidence that the binding protein is vitronectin. J Biol Chem 266:4334-4340, 1991

135. DONG G, SCHULICK AH, DEYOUNG MB, et al: Identification of a cis- acting sequence in the human plasminogen activator inhibitor type-1 gene that mediates transforming growth factor-betal responsiveness in endothelium in vivo. J Biol Chem 271:29969-29977, 1996

136. VASSALLI JD, SAPPINO AP, BELIN D: The plasminogen activator/plasmin system. J Clin Invest 88:1067-1072, 1991

137. SAWDEY M, PODOR TJ, LOSKUTOFF DJ: Regulation of type 1 plasminogen activator inhibitor gene expression in cultured bovine aortic endothelial cells. Induction by transforming growth factor-beta, lipopolysaccharide, and tumor necrosis factor-alpha. J Biol Chem 264:10396-10401, 1989

138. AHN JD, MORISHITA R, KANEDA Y, et al: Transcription factor decoy for activator protein-1 (AP-1) inhibits high glucose- and angiotensin ll-induced type 1 plasminogen activator inhibitor (PAI-1) gene expression in cultured human vascular smooth muscle cells. Diabetologia 44:713-720, 2001


159

139. WESTERHAUSEN DR, JR., HOPKINS WE, BILLADELLO JJ: Multiple transforming growth factor-beta-inducible elements regulate expression of the plasminogen activator inhibitor type-1 gene in Hep G2 cells. J Biol Chem 266:1092-1100, 1991

140. HUA X, MILLER ZA, WU G, et al: Specificity in transforming growth factor beta-induced transcription of the plasminogen activator inhibitor-1 gene: interactions of promoter DNA, transcription factor muE3, and Smad proteins. Proc Natl Acad Sci U S A 96:13130-13135, 1999

141. KUNZ C, PEBLER S, OTTE J, et al: Differential regulation of plasminogen activator and inhibitor gene transcription by the tumor suppressor p53. Nucleic Acids Res 23:3710-3717, 1995

142. FINK T, KAZLAUSKAS A, POELLINGER L, et al: Identification of a tightly regulated hypoxia-response element in the promoter of human plasminogen activator inhibitor-1. Blood 99\2077-2083, 2002

143. MOTOJIMA M, ANDO T, YOSHIOKA T: Sp1-like activity mediates angiotensin-ll-induced plasminogen-activator inhibitor type-1 (PAI-1) gene expression in mesangial cells. Biochem J 349:435-441, 2000

144. BRUZDZINSKI CJ, RIORDAN-JOHNSON M, NORDBY EC, et al: Isolation and characterization of the rat plasminogen activator inhibitor-1 gene. J Biol Chem 265:2078-2085, 1990

145. WITTECK A, YAO Y, FECHIR M, et al: Rho protein-mediated changes in the structure of the actin cytoskeleton regulate human inducible NO synthase gene expression. Exp Cell Res 287:106-115, 2003

146. BELTMAN J, ERICKSON JR, MARTIN GA, et al: C3 toxin activates the stress signaling pathways, JNK and p38, but antagonizes the activation of AP-1 in rat-1 cells. J Biol Chem 274:3772-3780, 1999

147. KAMARAJU AK, ROBERTS AB: Role of Rho/ROCK and p38 MAP kinase pathways in transforming growth factor-beta-mediated Smad-dependent growth inhibition of human breast carcinoma cells in vivo. J Biol Chem 280:1024-1036, 2005

148. SHIMIZU RT, BLANK RS, JERVIS R, et al: The smooth muscle alpha- actin gene promoter is differentially regulated in smooth muscle versus non-smooth muscle cells. J Biol Chem 270:7631-7643, 1995

149. MACK CP, SOMLYO AV, HAUTMANN M, et al: Smooth Muscle Differentiation Marker Gene Expression Is Regulated by RhoA-mediated Actin Polymerization. J Biol Chem 276:341-347, 2001


160

150. RAMONT L, PASCO S, HORNEBECK W, et al: Transforming growth factor-betal inhibits tumor growth in a mouse melanoma model by down- regulating the plasminogen activation system. Exp Cell Res 291:1-10,2003

151. ALLAN EH, ZEHEB R, GELEHRTER TD, et al: Transforming growth factor beta inhibits plasminogen activator (PA) activity and stimulates production of urokinase-type PA, PA inhibitor-1 mRNA, and protein in rat osteoblastlike cells. J Cell Physiol 149:34-43, 1991

152. WILSON HM, REID FJ, BROWN PA, et al: Effect of transforming growth factor-beta 1 on plasminogen activators and plasminogen activator inhibitor-1 in renal glomerular cells. Exp Nephrol 1:343-350, 1993

153. XU Y, HAGEGE J, MOUGENOT B, et al: Different expression of the plasminogen activation system in renal thrombotic microangiopathy and the normal human kidney. Kidney Int 50:2011-2019, 1996

154. LEE HS, PARK SY, MOON KC, et al: mRNA expression of urokinase and plasminogen activator inhibitor-1 in human crescentic glomerulonephritis. Histopathology 39:203-209, 2001

155. BARICOS WH, CORTEZ SL, EL-DAHR SS, et al: ECM degradation by cultured human mesangial cells is mediated by a PA/plasmin/MMP-2 cascade. Kidney Int 47:1039-1047, 1995

156. BROWN PA, WILSON HM, REID FJ, et al: Urokinase-plasminogen activator is synthesized in vitro by human glomerular epithelial cells but not by mesangial cells. Kidney Int 45:43-47, 1994

157. SCHNAPER HW, KOPP JB, PONCELET AC, et al: Increased expression of extracellular matrix proteins and decreased expression of matrix proteases after serial passage of glomerular mesangial cells. J Cell Sci 109:2521-2528, 1996

158. YOSHIKO B, YAMABE H, OSAWA H, et al: Regulation of tissue plasminogen activator production in cultured human fetal mesangial cells. Exp Nephrol 6:508-513, 1998

159. GLASS WF, 2ND, RADNIK RA, GARONI JA, et al: Urokinase-dependent adhesion loss and shape change after cyclic adenosine monophosphate elevation in cultured rat mesangial cells. J Clin Invest 82:1992-2000, 1988

160. GLASS WF, KREISBERG Jl, TROYER DA: Two-chain urokinase, receptor, and type 1 inhibitor in cultured human mesangial cells. Am J Phys 264:F532-F539, 1993


161

161. HALES AM, SCHULZ MW, CHAMBERLAIN CG, et al: TGF-beta 1 induces lens cells to accumulate alpha-smooth muscle actin, a marker for subcapsular cataracts. Curr Eye Res 13:885-890, 1994

162. VYALOV SL, GABBIANI G, KAPANCI Y: Rat alveolar myofibroblasts acquire alpha-smooth muscle actin expression during bleomycin-induced pulmonary fibrosis. Am J Path 143:1754-1765, 1993

163. KUHN C, MCDONALD JA: The roles of the myofibroblast in idiopathic pulmonary fibrosis. Ultrastructural and immunohistochemical features of sites of active extracellular matrix synthesis. Am J Path 138:1257-1265, 1991

164. TANG WW, ULICH TR, LACEY DL, et al: Platelet-derived growth factor- BB induces renal tubulointerstitial myofibroblast formation and tubulointerstitial fibrosis. Am J Path 148:1169-1180, 1996

165. ESSAWY M, SOYLEMEZOGLU O, MUCHANETA-KUBARA EC, et al: Myofibroblasts and the progression of diabetic nephropathy. Nephrol, Dial, Transpl 12:43-50, 1997

166. IMAI E, MORIYAMA T: Myofibroblastosis-importance of transformation of renal cells into myofibroblasts during the renal fibrosis process. Nippon Naika Gakkai Zasshi 86:1470-1474, 1997

167. KATWA LC, CAMPBELL SE, TYAGI SC, et al: Cultured Myofibroblasts generate angiotensin peptides de novo. J Mol Cell Cardiol 29:1375-1386, 1997

168. STRUTZ F, MULLER GA, NEILSON EG: Transdifferentiation: a new angle on renal fibrosis. Exp Nephrol 4:267-270, 1996

169. NOMURA K, TERAOKA H, ARITA H, et al: Disorganization of microfilaments is accompanied by downregulation of alpha-smooth muscle actin isoform mRNA level in cultured vascular smooth muscle cells. J Biochem 112:102-106, 1992

170. VISSE R, NAGASE H: Matrix metalloproteinases and tissue inhibitors of metalloproteinases: structure, function, and biochemistry. Circ Res 92:827-839, 2003

171. BORDER WA, RUOSLAHTI E: Transforming growth factor-beta 1 induces extracellular matrix formation in glomerulonephritis. Cell Differ Dev 32:425-431, 1990


162

172. GONG R, RIFAI A, TOLBERT EM, et al: Hepatocyte growth factor modulates matrix metalloproteinases and plasminogen activator/plasmin proteolytic pathways in progressive renal interstitial fibrosis. J Am Soc Nephrol 14:3047-3060, 2003

173. HASLINGER B, GOEDDE MF, TOET KH, et al: Simvastatin increases fibrinolytic activity in human peritoneal mesothelial cells independent of cholesterol lowering. Kidney Int 62:1611-1619, 2002

174. ISHIBASHI T, NAGATA K, OHKAWARA H, et al: Inhibition of Rho/Rho- kinase signaling downregulates plasminogen activator inhibitor-1 synthesis in cultured human monocytes. Biochim Biophys Acta 1590:123- ISO, 2002

175. BUBB MR, SENDEROWICZ AM, SAUSVILLE EA, et al: Jasplakinolide, a cytotoxic natural product, induces actin polymerization and competitively inhibits the binding of phalloidin to F-actin. J Biol Chem 269:14869-14871, 1994

176. SOTIROPOULOS A, GINEITIS D, COPELAND J, et al: Signal-regulated activation of serum response factor is mediated by changes in actin dynamics. Cell 98:159-169, 1999

177. HAUTMANN MB, MADSEN CS, OWENS GK: A transforming growth factor beta (TGFbeta) control element drives TGFbeta-induced stimulation of smooth muscle alpha-actin gene expression in concert with two CArG elements. J Biol Chem 272:10948-10956, 1997

178. MIRALLES F, IBANEZ-TALLON I, PARRA M, et al: Transcriptional regulation of the murine urokinase-type plasminogen activator gene in skeletal myoblasts. Thromb Haemosf 81:767-774, 1999

179. KURISAKI K, KURISAKI A, VALCOURT U, et al: Nuclear factor YY1 inhibits transforming growth factor beta- and bone morphogenetic protein- induced cell differentiation. Mol Cell Biol 23:4494-4510, 2003

180. ELLIS PD, MARTIN KM, RICKMAN C, et al: Increased actin polymerization reduces the inhibition of serum response factor activity by Yin Yang 1. Biochem J 364:547-554, 2002

181. WANG CY, SHI JD, ZHU Y, et al: Application of chromatin immunoprecipitation assay in deciphering DNA-protein interactions. Yi Chuan 27:801-807, 2005


163

182. HASLINGER B, KLEEMANN R, TOET KH, et al: Simvastatin suppresses tissue factor expression and increases fibrinolytic activity in tumor necrosis factor-alpha-activated human peritoneal mesothelial cells. Kidney Int 63:2065-2074, 2003

183. BOURCIER T, LIBBY P: HMG CoA reductase inhibitors reduce plasminogen activator inhibitor-1 expression by human vascular smooth muscle and endothelial cells. Arterioscler Thromb Vase Biol 20:556-562, 2000

184. TSUCHIDA K, ZHU Y, SIVA S, et al: Role of Smad4 on TGF-beta-induced extracellular matrix stimulation in mesangial cells. Kidney Int 63:2000- 2009, 2003

185. HAYASHIDA T, DECAESTECKER M, SCHNAPER HW: Cross-talk between ERK MAP kinase and Smad signaling pathways enhances TGF- beta-dependent responses in human mesangial cells. FASEB J 17:1576- 1578, 2003

186. AKIYAMA-UCHIDA Y, ASHIZAWA N, OHTSURU A, et al: Norepinephrine enhances fibrosis mediated by TGF-beta in cardiac fibroblasts. Hypertension 40:148-154, 2002

187. ENGEL ME, MCDONNELL MA, LAW BK, et al: Interdependent SMAD and JNK signaling in transforming growth factor- beta-mediated transcription. J Biol Chem 274:37413-37420, 1999

188. GABRIEL C, ALI C, LESNE S, et al: Transforming growth factor alpha- induced expression of type 1 plasminogen activator inhibitor in astrocytes rescues neurons from excitotoxicity. FASEB J 17:277-279, 2003

189. KUTZ SM, HORDINES J, MCKEOWN-LONGO PJ, ef a/: TGF-beta 1- induced PAI-1 gene expression requires MEK activity and cell- to- substrate adhesion. J Cell Sci 114:3905-3914, 2001

190. LIAO JH, CHEN JS, CHAI MQ, et al: The involvement of p38 MAPK in transforming growth factor betal-induced apoptosis in murine hepatocytes. Cell Res 11:89-94, 2001

191. HAYASHIDA T, PONCELET AC, HUBCHAK SC, et al: TGF-beta1 activates MAP kinase in human mesangial cells: a possible role in collagen expression. Kidney Int 56:1710-1720, 1999

192. HAYAMA M, INOUE R, AKIBA S, et al: ERK and p38 MAP kinase are involved in arachidonic acid release induced by H(2)0(2) and PDGF in mesangial cells. Am J Physiol Renal Physiol 282:F485-491, 2002


164

193. IWASAKI S, IGUCHI M, WATANABE K, et al: Specific activation of the p38 mitogen-activated protein kinase signaling pathway and induction of neurite outgrowth in PC12 cells by bone morphogenetic protein-2. J Biol Chem 274:26503-26510, 1999

194. JAVELAUD D, LABOUREAU J, GABISON E, et al: Disruption of basal JNK activity differentially affects key fibroblast functions important for wound healing. J Biol Chem 278:24624-24628, 2003

195. DAVIES SP, REDDY H, CAIVANO M, et al: Specificity and mechanism of action of some commonly used protein kinase inhibitors. Biochem J 351:95-105, 2000

196. BENNETT BL, SASAKI DT, MURRAY BW, et al: SP600125, an anthrapyrazolone inhibitor of Jun N-terminal kinase. Proc Natl Acad Sci U SA 98:13681-13686, 2001

197. WU Y, ZHANG Q, ANN DK, et al: Increased vascular endothelial growth factor may account for elevated level of plasminogen activator inhibitor-1 via activating ERK1/2 in keloid fibroblasts. Am J Physiol Cell Physiol 286:0905-912, 2004

198. KAWANO H, KIM S, OHTA K, et al: Differential Contribution of Three Mitogen-Activated Protein Kinases to PDGF-BB-lnduced Mesangial Cell Proliferation and Gene Expression. J Am Soc Nephrol 14:584-592, 2003

199. PONTRELLI P, RANIERI E, URSI M, et al: jun-N-terminal kinase regulates thrombin-induced PAI-1 gene expression in proximal tubular epithelial cells. Kidney Int 65:2249-2261, 2004

200. GUO B, INOKI K, ISONO M, et al: MAPK/AP-1-dependent regulation of PAI-1 gene expression by TGF-beta in rat mesangial cells. Kidney Int 68:972-984, 2005

201. OHASHI R, NAKAGAWA T, WATANABE S, ef al: Inhibition of p38 mitogen-activated protein kinase augments progression of remnant kidney model by activating the ERK pathway. Am J Pathol 164:477-485, 2004

202. HARENDZA S, SCHNEIDER A, HELMCHEN U, et al: Extracellular matrix deposition and cell proliferation in a model of chronic glomerulonephritis in the rat. Nephrol, Dial, Transpl 14:2873-2879, 1999

203. MANABE N, FURUYA Y, NAGANO N, et al: Immunohistochemical quantitation for extracellular matrix proteins in rats with glomerulonephritis induced by monoclonal anti-Thy-1.1 antibody. Nephron 71:79-86, 1995


165

204. SHIMIZU A, KITAMURA H, MASUDA Y, et al: Apoptosis in the repair process of experimental proliferative glomerulonephritis. Kidney Int 47:114-121, 1995

205. MORITA H, MAEDA K, OBAYASHI M, et al: Induction of irreversible glomerulosclerosis in the rat by repeated injections of a monoclonal anti- Thy-1.1 antibody. Nephron 60:92-99, 1992

206. YAMAMOTO T, NOBLE NA, MILLER DE, et al: Sustained expression of TGF-beta 1 underlies development of progressive kidney fibrosis. Kidney Int 45:916-927, 1994

207. SHIBUYA M, HIRAI S, SETO M, et al: Effects of fasudil in acute ischemic stroke: results of a prospective placebo-controlled double-blind trial. J Neurol Sci 238:31-39, 2005

208. NAGATA K, KONDOH Y, SATOH Y, et al: Effects of fasudil hydrochloride on cerebral blood flow in patients with chronic cerebral infarction. Clin Neuropharmacol '\6:50'\-5'\0, 1993

209. FRIES JW, SANDSTROM DJ, MEYER TW, et al: Glomerular hypertrophy and epithelial cell injury modulate progressive glomerulosclerosis in the rat. Lab Invest 60:205-218, 1989

210. FLOEGE J, ALPERS CE, BURNS MW, et al: Glomerular cells, extracellular matrix accumulation, and the development of glomerulosclerosis in the remnant kidney model. Lab Invest 66:485-497, 1992


166

APPENDIX

PERMISSION OF THE AMERICAL PHYSIOLOGICAL SOCIETY

From: "Patel, Keyur MD" <[email protected]>To: '"pripka@ the-aps.org<[email protected]>Date: 11 /30/2005 5:57:14 AMSubject: Request for permission to use a figure for thesis preparation

Dear Sir/Madam,

I am a graduate student at Eastern Virgnia Medical School, (Norfolk,Virginia, USA)currently preparing my written thesis on " Modulation of TGF-beta induced PAI-1 expression by changes in actin polymerization in human mesangial ceils". I have to present a schematic diagram of PAI-1 promoter elements. I found "Figure 3: The PAI-1 promoter and consensus sequences" from the following articel by Binder et al. very useful."Binder, B.R., et al., Plasminogen activator inhibitor 1: physiological and pathophysiological roles. News Physiol Sci, 2002. 17: p. 56-61." PUBMED id: 11909993.

I have created a modified diagram based on the figure 3 of the article to show information pertinent to my thesis. I am hereby requesting a kind permission to use the modified (not the original) diagram for the thesis.Please find attached the original and modified diagram for your review.Also, I am acknowldeding at several places in my thesis that the diagram was modified from an original publication by Binder et al and giving a reference for the same.

Following is the figure legend I am planning to use with the modified figure pending your approval."Figure 21: Schematic representation of PAI-1 promoter.-RE, response element; TGFβ, transforming growth factor: VLDL, very low density lipoprotein; CTF, CCAAt box binding transcription factor; NF1, nuclear factor 1; PMA, phorbol 12-myristate 13-acetate; AP, activator protein; TRE, tetradecanoyl phorbol acetate response element; GRE, glucocorticoid response element. Adopted with modification from Binder et al [Binder, 2002 ]."

I will really appreciate your prompt and favorable consideration of my request. Your approval will help me immensely in completing my thesis in time for submission in December.

Sincerely,

Keyur Patel, MD (Ph.D. Candidate)

THE AMERICAN PHYSIOLOGICAL SOCIETY 9650 Rockvllk Plkt- BHhesda, \1D 20814-3991

Permission is granted for use of the material specified above provided tbe publication is credited as the source, including the words ’‘used with permission.’’

Haj l a j w g g M 'oPHbliralioiis Manager & Executive Editor

The information contained in this electronic e-mail transmission and any attachments are intended only for the use of the individual or entity to whom or to which it is addressed, and may contain information that is privileged, confidential and exempt from disclosure under applicable law. If the reader of this communication is not the intended recipient, or the employee or agent responsible for delivering this communication to the intended recipient, you are hereby notified that any dissemination, distribution, copying or disclosure of this communication and any attachment is strictly prohibited. If you have received this transmission in error, please notify the sender immediately by telephone and electronic mail, and delete the original communication and any attachment from any




167

computer, server or other electronic recording or storage device or medium. Receipt by anyone other than the intended recipient is not a waiver of any attorney-client, physician-patient or other privilege. Thank you.

CC: "Patel, Keyur MD" <KPatel1 @ LIJ.EDU>


168

VITA

Name: Keyur Pravinchandra Patel

Title: Graduate StudentDepartment of Pathology and Anatomy Eastern Virginia Medical School 700 W Olney Rd Norfolk, VA 23507

Education: 1999-present Ph.D. Candidate,Biomedical Sciences Ph.D. Program(Cell Biology and Molecular Pathogenesis Track)Eastern Virginia medical school, Norfolk, VA, USA 1993-1999 M.B.B.S. (Bachelor of Medicine, Bachelor of Surgery), Smt. N.H.L. municipal medical college, Ahmedabad, India

Awards: Young Pathologist Fellowship, American Society ofClinical Pathologists, 2004Best Graduate Student Poster, Cardiovascular Focal Research Group, Annual Research Day, Eastern Virginia Medical School, 2003

Publications:-Patel K., Harding P., Haney, L.B., and Glass W.F.II (2003) Regulation of the mesangial cell myofibroblast phenotype by actin polymerization. Journal of Cellular Physiology 195(3), 435-445- Vlahou A., Schellhammer P.F., Mendrinos S., Patel K., Kondylis F.I., Gong L., Nasim S., and Wright G.L.Jr. (2001) Development of a novel proteomic approach for the detection of transitional cell carcinoma of the bladder in urine. American Journal of Pathology 158(4), 1491-502Oral Presentation:- Keyur P. Patel, Pamela Harding, William F. Glass II (2002) Regulation of (a- SMA Expression and Hypertrophy by Changes in Actin Polymerization in Mesangial Cells. Annual Virginia Nephrology Retreat, Charlottesville, VA Poster Presentations:- Keyur P. Patel. Pamela Harding. William F. Glass II (2004) Changes in actin polymerization regulate plasminogen activator inhibitor type-1 (PAI-1) expression in human mesangial cells. Experimental Biology, Washington, DC- Keyur P. Patel, Pamela Harding, William F. Glass II (2002) Regulation of (a- SMA expression and hypertrophy by changes in actin polymerization in mesangial cells. American Society of Nephrology Renal Week, Philadelphia, PA- Keyur P. Patel, Pamela Harding, Lisa B. Haney, Ping Kong, William F. Glass II (2001) Regulation of smooth muscle a-Smooth Muscle Actin expression by tyrosine kinases and actin polymerization in human mesangial cells. World Congress of Nephrology Renal Week, San Francisco, CA


modulation of tgfβ-induced pai -1 expression by changes in

Documents