Vol. 173, No. 10JOURNAL OF BACTERIOLOGY, May 1991, p. 3191-31980021-9193/91/103191-08$02.00/0Copyright C 1991, American Society for Microbiology

Molecular Cloning, Nucleotide Sequence, and Characterization ofthe Bacillus subtilis Gene Encoding the DNA-Binding Protein HBsu

BIRGIT MICKA,' NICOLAS GROCH,2 UDO HEINEMANN,2 AND MOHAMED A. MARAHIELl*Fachbereich Chemie/Biochemie, Philipps-Universitdt Marburg, Hans-Meerwein-Strasse, D-3550 Marburg,' and Institut

fur Kristallographie, Freie Universitat Berlin, D-1000 Berlin 33,2 Federal Republic of Germany

Received 5 October 1990/Accepted 15 March 1991

A homologous class of histonelike proteins which are believed to wrap the DNA and to condense thechromosome into highly folded nucleoid structures has been identified in different bacterial species. Bacillussubtilis encodes a homodimeric DNA-binding protein called HBsu. We have cloned the corresponding gene(hbs) on a 3.8-kb fragment. The gene was subcloned to a 1-kb fragment, sequenced, and characterized. Itencodes a 92-amino-acid protein with a predicted molecular mass of 9,884 Da. Fortunately, analysis of the DNAsequence downstream of the 3' end of hbs revealed the location of the first 19 amino acid residues of MtrA. Thisfinding located the hbs gene unequivocally to the 5' end of the mtr operon at about 2040 on the standard geneticmap of B. subtilis. Northern (RNA) blot analysis and primer extension studies indicated the presence of twodistinct hbs transcripts, which were found to be initiated at two different sites located about 160 bases apart.Several attempts to replace the hbs gene in the B. subtilis chromosome with a cat-interrupted copy (hbs::cat)through marker replacement recombination were unsuccessful. In order to study whether hbs is an essentialgene, we have constructed a strain containing a truncated copy of the gene behind its own promoter andanother intact copy under control of the isopropyl-,-D-thiogalactopyranoside (IPTG)-inducible spac-1 pro-moter. In this strain (BM19), normal growth was found to depend on IPTG, whereas in the absence of IPTG,growth was severely affected. These results suggest an essential role for the hbs gene product for normal growthin B. subtilis.

In procaryotes, a number of abundant, small, basic, andheat-stable proteins have been identified. These proteinswrap DNA without obvious sequence specificity and are nothomologous with the eucaryotic histones (for reviews, seereferences 6, 11, 37, 41, and 46). Among bacteria, theprimary structures are highly conserved. They have beendesignated as histonelike DNA-binding proteins (41). Thebest-studied and most abundant protein is HU, present inEscherichia coli. It exists predominantly as a heterodimer(HU2 and HU1) encoded by the genes hupA and hupB (25,26, 30, 32). The two subunits consist of 90 amino acidresidues each and have 70% identical residues. Since HUprotein alters the structure and topology of bound DNA (3,6, 7, 37, 38), it affects several cellular processes by binding toDNA. Its role in DNA replication is especially well docu-mented (5, 10, 35, 42). Also, a function as an accessoryprotein stimulating DNA recognition by other proteins hasbeen postulated (9). In addition, recent studies of hupA andhupB null mutants revealed that growth, lysogeny, transpo-sition, and cell division are affected in the absence of HUprotein (19, 35).

Several proteins with properties and structures highlyhomologous to those ofHU protein have been isolated fromother bacteria and bacteriophages. Among some Bacillusspecies (B. caldolyticus, B. globigii, B. stearothermophilus,and B. subtilis), a protein highly homologous to HU, classi-fied HB, was isolated and characterized (1, 4, 21, 27). Incontrast to HU, HB exists as a homodimeric protein (44).This protein binds to both single-stranded and double-stranded DNA and RNA (4, 21, 22, 48). The HB protein ofB.subtilis, HBsu, consists of 92 amino acid residues and differsonly in one sequence position from the B. globigii HB

* Corresponding author.

protein (49). The identity of other nucleoid proteins of B.subtilis (34, 39) with HBsu remains unproven.As an initial step towards understanding the physiological

role of the B. subtilis protein, we have cloned, sequenced,and characterized the corresponding gene. The gene wasidentified from a genomic library constructed in Lambda ZapII by using a radiolabeled DNA probe synthesized by thepolymerase chain reaction (PCR).

MATERIALS AND METHODS

Bacterial strains, plasmids, and culture media. Bacterialstrains are listed in Table 1. Plasmid pDH88 has beendescribed by Henner (16). 2xYT and NZY media as well asSM buffer were described by Short et al. (43).

Construction of oligonucleotides. The DNA sequence of the

TABLE 1. Bacterial strains

* ~~~~~~~~~~~~SourceorStrain Genotype rcereference

B. subtilisJH642 trpC2 pheAl J. HochBM04 trpC2 pheAl hbs+ hbs::cat This paperBM19 trpC2 pheAl PhbS-hbs'::cat::Pspac-hbs This paper

hbs+

E. coliXL-1 Blue recAl endAl gyrA96 thi hsdRJ7 (rK- 43

MK+) supE44 relAl X- lac [F'proAB lacIqZAM15 TnJO (Tetr)]

JM105 endAl (lac pro) thi-J strA sbcBJ5 J. MessinghsdR4 (F' traD36 proA+B+lacPZAM15)

3191

on Septem

ber 6, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

3192 MICKA ET AL.

A

kb1 2 3

23 -

9A -6.5 -

4.3-

B1 2 3

kb

5.4'_-4.3 -

2.3-2.0-

FIG. 1. Identification of the hbs gene of B. subtilis. (A) Restric-tion analysis of genomic DNA isolated from B. subtilis JH642.Chromosomal DNA has been digested with the restriction enzymesHindIII (lane 1), EcoRI (lane 2), and PstI (lane 3). The cleavedproducts were separated and visualized on a 0.8% agarose gel. (B)Southern blot analysis revealed one major band after digestion withHindlIl (lane 1), EcoRI (lane 2), and PstI (lane 3) restrictionenzymes and hybridization with the PCR probe. The probe recog-nized one fragment at about 4.3 kb in the HindIll digest and onefragment at about 5.4 kb in the EcoRI and PstI digests.

oligonucleotides used in the PCR is based on the amino acidsequence of HBsu protein (49). The oligomers represent twodistinct parts of the chemically synthesized hbs gene (14).Both oligonucleotides were synthesized on an Applied Bio-systems automatic DNA synthesizer and purified by hydro-phobic interaction and anion-exchange fast protein liquidchromatography. Final purification was achieved by poly-acrylamide gel electrophoresis. One oligomer, a 26-oligonu-cleotide sequence, 5'-CATTAACGCCGTTGCCGAAGCCAGCG-3', matches to the N-terminal HBsu sequence, andthe other oligomer, a 50-mer, 5'-TTTT-lAAAGCTTTGCCCGGTTTAAAGGCCGGTACCTTGCTGGCCGGAATTT-3', matches to the C-terminal amino acid sequence.

Amplification of bacterial DNA by PCR. PCR was used toamplify genomic DNA fragments of B. subtilis. Chromo-somal DNA of JH642 (trpC2 pheAl) was prepared according

to the method of Krause et al. (28). Genomic DNA as atemplate was mixed with the two oligonucleotides as prim-ers. PCR was carried out in a 50-,ul volume containing 1 ,ugof template DNA, 200 pmol of primer (100 pmol of eacholigonucleotide), 50 mM Tris-HCl (pH 9.0 at 25°C), 15 mMammonium sulfate, 7 mM magnesium chloride, 50 mMpotassium chloride, 1 mM (each) deoxynucleoside triphos-phates, 170 ,ug of bovine serum albumin per ml, and 1 U ofThermus aquaticus DNA polymerase (Anglian Biotec). TheDNA was denatured at 93°C for 1 min, annealed at 50°C for3 min, and extended at 72°C for 3 min. Following 30 cyclesof amplification, 2 ptl of the 50-pld reaction mixture waselectrophoresed through a 1% agarose gel. The product ofamplification was a DNA fragment 241 bp in length.

Hybridization conditions of PCR product. Nitrocellulosefilters were prehybridized in 6x SSC (lx SSC is 0.15 MNaCl plus 0.015 M sodium citrate)-10 mM EDTA (pH8.0)-100 p,g of denatured salmon sperm DNA per ml for 1 hat 65°C. The PCR probe was labeled with the MultiprimeDNA-labeling system (Amersham). The probe was added tothe prehybridization mix and hybridized for 5 h at 65C.Southern blots and plaque- and colony-screening mem-branes were subjected to two washes: one in 2x SSC and0.5% sodium dodecyl sulfate (SDS) for 15 min at roomtemperature and one in 2x SSC and 0.1% SDS for 15 min at65°C. Filters were exposed to Kodak X-Omat film.

Construction of a genomic library. Genomic DNA of B.subtilis JH642 was partially digested with the restrictionenzyme Sau3A. Bacteriophage Lambda Zap II was used asa vector to clone genomic DNA according to the instructionsof the supplier (Stratagene). Ten micrograms of vector DNAwas linearized by the restriction enzyme XhoI.To ligate complementary ends, dCTP and dTTP were used

to fill in the XhoI-digested vector, whereas dATP and dGTPwere used to fill in Sau3A-digested chromosomal DNA.After polymerization, 1 pLg of Lambda Zap II vector and 0.6jig of insert DNA were packaged in Gigapack II Goldpackaging extract (Stratagene). The ratio of nonrecombinant(blue) to recombinant (white) plaques was determined byplating 0.1 pu of the 500-pdl DNA library with 200 pl of XL-1Blue host cells on NZY plates containing 10 mM isopropyl-,B-D-thiogalactopyranoside (IPTG) and 6.25 mg of X-Gal(5-bromo-4-chloro-3-indolyl-p-D-galactopyranoside) per ml(43). The JH642 library contained 4. 106 PFU/pug of DNAwith 1. 10' blue background plaques.The library was amplified, and phages were transferred to

nitrocellulose filters. Phage DNA was released from thephage head and denatured by standard procedures (2).Methods of hybridization and wash conditions are described

A pHBS1.C

4s

I=4T._cB pHBS2 =

_ .

--51 ' #'AS

121

313

2

3I"3.8kb

¢0ok

1kbFIG. 2. Restriction map of DNA in the vicinity of the hbs gene. (A) Restriction map of the 3.8-kb DNA insert of plasmid pHBS1. (B)

Restriction map of the 1.0-kb DNA insert of subcloned plasmid pHBS2. The location and orientation of the hbs coding sequence are indicated.

J. BACTERIOL.

on Septem

ber 6, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

DNA-BINDING PROTEIN OF B. SUBTILIS 3193

-35 -10 r-P11 AAATGC gATGGCTTTTTATATGTGTTACTACATACAGAAATTCTTCACTTTGTT

61 GGACAAACATTCCTCAGAGTGCAGTTTTTCTTAAAAAGCCGTTTAATTGCCTTTCTCTTA

121 CTTGCTCTCATTTTTTTCTGAGACAGGTTTAGAATCAGACTGAACTGTGAAGAAATGATA

181r-P2 m-hbs

ATAAACGAACTGAATGTATCCTTTTGGGAGGTGAAAGGCATGAACAAAACAGAACTTSD M N K T E L

241 ATCAATGCGGTTGCAGAAGCAAGCGAATTGTCTAAAAAAGACGCTACAAAAGCAGTTGACI N A V A E A S E L S K K D A T K A V D

301 TCTGTTTTTGATACGATCTTAGATGCACTTAAAAACGGTGATAAAATCCAACTGATCGGTS V F D T I L D A L K N G D K I Q L I G

361 TTTGGTAACTTCGAGGTGCGTGAACGTTCTGCACGTAAAGGACGCAATCCTCAAACAGGTF G N F E V R E R S A R K G R' N P Q T G

421 GAAGAAATCGAAATTCCAGCAAGCAAAGTACCTGCTTTCAAACCAGGTAAAGCGCTTAAAE E I E I P A S K V P A F K P G K A L K

481 GACGCAGTTGCCGGAAAATAATTGTGAATATAGATCGTGTATGCATCTAGCTTACATACAD A V A G K * * *

541 CTTTATTTCTTCACAGAAAAGCCCTxCT6AGGGGTTTATATTTCAAGAGCATGGG

601 CTTCCTGACAGGGCATTCACTTTGCTTTTAGCGGGGCATATGTGCTAGAATCGAAATTAA

661- mtrA

ATGTATTCATTGGTGGAGGACATAGAACATGAAAGAAGTTAATAAAGAGCAAATCGAACAM K E V N K E Q I E Q

60

120

180

240

300

360

420

480

540

600

660

720

721 AGCTGTTCGTCAAATTTTAGAAGCGA 746A V R Q I L E A

FIG. 3. DNA sequence of the hbs gene and the deduced amino acid sequence. The hbs gene is 279 bp in length and encodes a protein of92 amino acid residues. The -10 and -35 regions, the putative ribosome binding site (SD), and the sequence of a potential transcriptionterminator are underlined. Arrows indicate the 5' ends (P1 and P2) mapped by primer extension. The 5' sequence of the mtrA gene and thefirst 19 amino acid residues are shown.

above. Promising plaques were isolated from the agar plateand transferred to 500 RI of SM buffer containing 20 ,ul ofchloroform (43).

In vivo excision of pBluescript plasmid from Lambda Zap II

vector. The Bacillus library has been constructed in LambdaZap II to use the facility of in vivo excision of the clonedinsert within this vector. The phagemid, pBluescript[SK(-)], can be excised by fl helper phage because LambdaZap II incorporates the signals for both initiation and termi-nation of DNA synthesis from the fl origin of replication(43). After in vivo excision of the lambda vector, coloniesthat appeared on plates were transferred to nylon filters anddenatured by standard procedures (2). Methods of hybrid-ization and wash conditions were as described previously(40).DNA sequencing. DNA sequencing of cloned plasmid

DNA denatured in alkali was carried out by the chaintermination reaction (United States Biochemical). Thechain-terminated products were separated on 6% sequencinggels and visualized by overnight autoradiography withKodak X-Omat film.RNA preparation and Northern (RNA) blot. Fifty-milliliter

cell cultures of B. subtilis were collected at two differenttimes during vegetative growth. Total cellular RNA was

prepared by the procedure of Penn et al. (36) as modified byIgo and Losick (20). RNA pellets were suspended in 50 ,ul ofdiethylpyrocarbonate-treated water. The transfer of RNAfrom the gel to the blot was performed by the method of Igoand Losick (20).Primer extension. Primer extension was used to map the 5'

termini of mRNA as described in reference 40. The RNAwas hybridized with an excess of single-stranded DNAprimer. The primer, a 50-mer oligonucleotide, is complemen-

tary to the sequence located between nucleotides 111 and158. Reverse transcriptase and nucleotides dATP, dGTP,dTTP, and radiolabeled [a-32P]dCTP were used to extendthis primer to produce the cDNA, which was used inmapping the 5' termini of mRNA of hbs.

Strain constructions to interrupt the chromosomal copy of

12kb

-23S

-16S

0.540-0.38 w '

-5S

FIG. 4. Northern blot analysis of total cellular RNA (5 ,ug) of B.subtilis prepared during two different periods of vegetative growth(optical densities at 600 nm of 0.5 and 1.0) (lanes 1 and 2, respec-tively). With a PCR probe, two transcripts of about 0.54 and 0.38 kbwere identified. To the right are indicated the locations of therRNAs.

VOL. 173, 1991

on Septem

ber 6, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

3194 MICKA ET AL.

pDH 88

pspacHind IN Sph I

a +HindNi

hbs'

Sph I

I

PhbsHindNi EcoRI HindM EcoRI

Iphbs

HindlilEcoRI

B1 2

kb

hbS'

Sphl

Kt

2.3 4W

the hbs gene and to place it under control of the spac-)promoter. Plasmid pHBS2 was linearized within the hbsgene by using the restriction enzyme HincII. The cat genelocalized on a 1.3-kb EcoRI fragment of pZA327 (50) wasisolated. To ligate blunt-ended fragments, dATP and dTTPwere filled into the EcoRI sites. After ligation, the hbs::catplasmid (pHBS2cat) was transformed into competent cells ofE. coli JM105 (40). About 2 tg of linearized pHBS2cat wasused to transform competent cells of B. subtilis JH642 (15).Transformants were selected on 2xYT plates containing 5 ,gof chloramphenicol per ml.To place the hbs gene under the control of the spac-J

p hbSspacIb 1

HindM HindM EcoRIFIG. 5. (A) Construction and integration of pDH88hbs' by homol-

ogous recombination. The plasmid is indicated by solid lines, and thechromosomal DNA is indicated by dotted lines. The box indicates thehbs coding region, and the jagged ends of hbs' indicate a truncatedcopy of the gene. The positions of the promoters are shown by Pspacand Phbs. The locations of the restriction sites HindIII, EcoRl, andSphI are shown. The figure is not to scale. (B) Characterization of B.subtilis BM19 by Southern hybridization. Chromosomal DNAs of B.subtilis wild type (lane 1) and BM19 (lane 2) were digested withHindIII-EcoRI. The cleaved products were separated on a 0.8%agarose gel, transferred to a nitrocellulose filter, and hybridized to aPCR probe. Arrowheads indicate the locations of the hbs gene in thewild type (2.3 kb) and in the BM19 strain containing the truncatedcopy (6.5 kb) and the Pspac-hbs fusion (1.8 kb).

promoter within the integrative plasmid pDH88, a 191-bpfragment flanked by the restriction sites Hindlll and SphIwas synthesized by PCR. The HindIII-SphI PCR fragmentcontained the natural ribosomal-binding site (SD) and thefirst 59 of 92 codons of hbs. This truncated copy and pDH88were digested with HindlIl and SphI, ligated, and trans-formed into competent cells of E. coli JM105. The newconstruct, pDH88hbs', was transformed into competentcells of B. subtilis JH642. Transformants were selected on2xYT plates containing 5 ,ug of chloramphenicol per ml and1 mM IPTG.

Antisera. Antisera against the HB protein of B. globigii,HBgl, were raised in rabbits and used in a dilution of 1:500without further purification. Polyclonal anti-HBgl antibodiescross-reacted with the B. subtilis HBsu protein. Total pro-tein extracts of B. subtilis and of E. coli cells containing the

J. BACTERIOL.

A

on Septem

ber 6, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

DNA-BINDING PROTEIN OF B. SUBTILIS 3195

2o

1.0

0.5

A B5 4 3 2 1 1 2 3 4 5

5kl _

P~~~~ffM --- HtIB P--

z0 0.1

C.3

0.05X

0.01- I I

0 1 2 3 4 5 6TIME (hours)

FIG. 6. Effect of IPTG on growth of B. subtilis BM19 bearing thePspac-hbs fusion. Cultures were grown in 2xYT with 5 F±g ofchloramphenicol per ml in the presence (U) and in the absence (a) of1 mM IPTG.

recombinant plasmid pHBS1 or pHBS2 were analyzed bySDS-polyacrylamide gel electrophoresis (PAGE) (15% poly-acrylamide) as described by Laemmli (29). Gels were stainedwith Coomassie brilliant blue R 250 or transferred to nitro-cellulose for immunodetection analysis (Western blot) asdescribed by Towbin et al. (45).

Nucleotide sequence accession number. Sequence data inthis work have been assigned EMBL GenBank data baseaccession number X52418.

RESULTS

Construction of the PCR probe and its hybridization tochromosomal DNA. To verify the quality of the successfullyamplified PCR probe (a 241-bp fragment of the chromosomalhbs gene), the labeled probe was hybridized to a chromo-somal DNA blot and washed under stringent conditions asindicated in Materials and Methods. Chromosomal DNAthat has been cleaved with the restriction enzymes HindIII,EcoRI, and PstI revealed in the corresponding Southern blotthe presence of one major band in each digest (Fig. 1). Theprobe recognized one band of about 5.4 kb in the EcoRI andPstI chromosomal digests and a smaller fragment of about

FIG. 7. Western blot analysis of HBsu protein of B. subtilis. (A)Coomassie brilliant blue R 250 stain of total cellular protein analyzedon 15% SDS-PAGE of B. subtilis JH642 cells (lane 5), E. coli cellsbearing the recombinant plasmid pHBS1 (lane 4), vector DNA (lane3), and no plasmid (lane 2). (B) Proteins were transferred tonitrocellulose filter and incubated with anti-HBgl antibodies and thechromogenic substrate 5-bromo-4-chloro-3-indolyl-phosphate. Puri-fied HBgl protein (lane 1) was used as an internal control.

4.3 kb in the HindIII digest. This suggested the presence ofat least one hbs gene within these fragments.

Cloning, sequencing, and transcriptional mapping of thehbs gene. The efficiency of the constructed genomic librarywas very high, since less than 1% of the PFU were withoutinserted DNA. About 1 RI (0.002%) of the packaged materialwas amplified and gave rise to about 8_ 103 PFU/,ul. Theplaques were transferred to nylon membranes and screenedwith the PCR probe. Five plaques (L-1 to L-5) were identi-fied. After purification by reinfection, one of them (L-1) wassubjected to the excision process. By using 105 phageparticles of L-1, a few ampicillin-resistant colonies ap-peared. After colony filter hybridization and screening withthe PCR probe, one promising clone was identified. Aplasmid, designated pHBS1, containing a 3.8-kb DNA insertwas identified. By Southern blot analysis, the hbs gene wasassigned to a 900-bp EcoRI-NdeI fragment of the 3.8-kbinsert of pHBS1 (Fig. 2A). Plasmid pHBS2, bearing the hbsgene within its 1-kb insert, was constructed by elimination ofthe 2.8-kb EcoRI insert of pHBS1 (Fig. 2B).By using the T7 primer and synthetic oligonucleotides, the

sequence of a major part of the inserted DNA in pHBS2 wasdetermined. The hbs gene is 279 bp in length and encodes aprotein of 92 amino acid residues with a molecular mass of9,884 Da (Fig. 3). A strong potential ribosome-binding site(AGGAGGT) with a AG of -18.8 kcal (1 cal = 4.184J) islocated 7 bp upstream of the initiation codon AUG (33). Thehbs open reading frame ends with three stop codons fol-lowed by a hairpin loop structure similar to rho-independentterminators. The deduced amino acid sequence of the hbsgene was found to be identical to that of the purified HBsuprotein (49). Also, a part of the sequence of an open readingframe located downstream of the hbs gene was determined.This sequence was found to be identical to that of the 5' endof the mtrA gene which was determined by Gollnick et al.(12). As shown in Fig. 3, the determined sequence of mtrA,which is located to the 3' end of hbs, comprises 58 nucleo-tides which encode the first 19 amino acid residues of theMtrA protein (12). The sequence determined by Gollnick etal. at the 5' end of the mtrA gene overlaps with our sequenceover a region of 453 bp. This region comprises the 3' end ofhbs, the 5' end of mtrA, and a region of 175 bp located inbetween. These data revealed the exact location of the hbsgene to the 5' end of the mtr operon located at about 2040 onthe Bacillus chromosome.

VOL. 173, 1991

on Septem

ber 6, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

31% MICKA ET AL.

1 10 20 30 40 50 60 70 80 90

HBsuHBglHBstHBcaTF-1

------------QT-G-----------A---NS-T--RK---V----------A------------A-----------------K---LKY--------T---I-G-----------A--"-TZ---K---V-------------A------------N--------------------K-------K-I-QDT--TQVSVS-JLA-FEKITTLWTAK---V--T--L-3[KPVA-Q----F----Q-AL--AP-VGVSV---ES--K-AE-LKYED

di e2 arm region 63FIG. 8. Comparison of the amino acid sequences of HB proteins of the genus Bacillus. Proteins were obtained from B. subtilis (HBsu),

B. globigii (HBgl), B. stearothermophilus (HBst), B. caldolyticus (HBca), and B. subtilis bacteriophage SPOl (TF-1). At the lower part, thelocations of the conserved a-helices and the potential DNA-binding arm region are shown. Only amino acid residues different from those inB. subtilis are shown for the other proteins.

In order to determine the level and size of the hbstranscript, Northern blot and primer extension analyseswere carried out. Northern blot analysis of total cellularRNA prepared at different stages of vegetative growth(optical densities at 600 nm of 0.5 and 1.0) indicated thepresence of two distinct hbs transcripts of almost constantlevel (Fig. 4). The approximate lengths of both transcriptswere estimated to be about 0.54 and 0.38 kb. In addition,primer extension studies (not shown) confirmed that both 5'ends of the transcripts are located about 160 bases apart.Inspection of the DNA sequence (Fig. 3) upstream of theputative initiation site P1 at about -10 and -35 revealedconsensus sequences which may be recognized by thevegetative form of RNA polymerase (EorA) in B. subtilis. Incontrast, the -10 and -35 regions upstream of P2 (notunderlined in Fig. 3) show a good homology to the conservedconsensus sequence recognized by a minor form of RNApolymerase containing sigma-32 (ETC) (24). However, addi-tional studies are needed for a direct evaluation of thoseputative promoters.

Interruption and placing the hbs gene under control of thespac-l promoter. Many attempts to interrupt the hbs genedirectly by a double-crossover recombination event usingthe linearized pHBS2cat plasmid (see Materials and Meth-ods) resulted only in the production of chloramphenicol-resistant hbs-partial diploids. Southern hybridization exper-iments (not shown) using digested chromosomal DNA ofsuch transformants indicated that the hbs: :cat construct wasintegrated by a Campbell-like single-crossover recombina-tion event.Our failure to interrupt hbs in the chromosome of B.

subtilis suggests an essential role for the gene product. Totest this possibility we have placed the hbs gene under thecontrol of the spac-J promoter (Fig. SA) and tested the cellviability in relation to IPTG induction. As shown in Fig. 6,normal cell growth in strain BM19 depends highly on thepresence of IPTG. In the absence of IPTG, cell growth isstrongly affected. This limited growth switched to the normallevel upon addition of 1 mM IPTG, which derepresses theexpression of hbs. It should also be noted that cells contain-ing the Pspac-hbs fusion were able to grow in the absence ofIPTG as a consequence of leakiness of the control system.The integration of pDH88hbs' by a homologous recombi-

nation event was confirmed by Southern hybridization ex-

periments. As shown in Fig. SB, in an HindIII-EcoRI digestof wild-type DNA, hbs is located on a single 2.3-kb frag-ment. In strain BM19, the fragment was split into a 6.5-kbfragment carrying the truncated gene of hbs and a 1.8kb-fragment containing the Pspac-hbs fusion.HBsu expression in E. coli. Anti-HBgl antibodies cross-

reacted specifically with a single band of about 10 kDa fromtotal B. subtilis protein extract (Fig. 7, lane 5). This band

corresponds to the HBsu protein which has the same molec-ular mass as the purified HBgl protein (Fig. 7, lane 1). Incontrast, anti-HBgl antibodies did not cross-react with pro-tein extract of the E. coli control strain (Fig. 7, lane 2) and E.coli containing pBluescript (Fig. 7, lane 3). However, oneimmunoreactive polypeptide was detected in protein ex-tracts of E. coli JM105 cells bearing the recombinant plas-mids pHBS1 (Fig. 7, lane 4) or pHBS2 (data not shown). Thepolypeptide synthesized by the E. coli strains carrying therecombinant plasmids has a molecular mass of 10 kDa,which is identical to that of the B. subtilis HBsu protein. Thisexpression was independent of the external vector promoter;as in both plasmids, pHBS1 and pHBS2, the lacZ promoteris located at the 3' end of the hbs gene.

DISCUSSION

We have cloned, sequenced, and characterized the hbsgene encoding the B. subtilis histonelike protein HBsu.According to our knowledge, hbs represents the first identi-fied gene for a histonelike protein within this Bacillus spe-cies. The gene encodes a protein of 92 amino acid residueswith a molecular mass of 9,884 Da. The deduced amino acidsequence of the hbs gene is identical to that determined fromthe purified B. subtilis protein and differs from B. globigiiprotein (HBgl) only at amino acid position 40. An asparticacid residue in HBsu is replaced by lysine in HBgl (49). Thisrelationship reflects the immunological cross-reactivity be-tween anti-HBgl antibodies and the HBsu protein. In con-trast, E. coli HU proteins (HU2 and HU1) which show alower degree of homology (52 to 57% identity) to the HBsuprotein do not cross-react with the anti-HBgl antibodies (21).Among the HB proteins of different Bacillus species so farsequenced, conservation is more than 80% (Fig. 8). How-ever, the homology of B. subtilis bacteriophage SPO1-encoded TF-1 protein to HB proteins of different Bacillusspecies is less than 50% (13). TF-1 isolated from infected B.subtilis cells shares only 41% identical residues with HBsu(13). Most of those amino acid substitutions are within theconserved a-helix region (Fig. 8). TF-1 binds preferentiallyto 5-hydroxymethyl-uracil-containing DNA as present inSPOl DNA (23), and the divergence in its amino acidsequence from those of Bacillus HB proteins may havearisen from selective pressure to adapt to this novel func-tion. However, when the nucleotide sequence of the TF-1gene (13) was compared with that of hbs, 57% identity wasobserved. This indicates a higher level of conservation at theDNA level than that observed on the amino acid sequencelevel. This may suggest a common ancestor for both genes.On the other hand, all histonelike proteins are lysine andarginine rich and are devoid of cysteine, tryptophan, andtyrosine, generally.

J. BACTERIOL.

on Septem

ber 6, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

DNA-BINDING PROTEIN OF B. SUBTILIS 3197

The data obtained from Southern hybridization and thesequence analysis suggest the presence of a single copy ofthe hbs gene in the B. subtilis chromosome. This copy islocated to the 5' end of the mtrA gene which maps at 2040 onthe standard genetic map of B. subtilis. As determined fromthe DNA sequence (Fig. 3), the mtrA initiation codon isplaced 175 bp downstream of the third hbs stop codon. Thehbs gene is located on a 900-bp EcoRI-NdeI chromosomalfragment. In E. coli and Salmonella typhimurium, two geneswere found to encode closely related proteins (HU2 andHU1) that form the heterodimeric protein HU (17, 25, 26,30-32). The availability of the genes encoding HU in E. coliand S. typhimurium facilitated studies of its biological role invivo. Recently, HU null mutants were constructed andshown to be defective in growth, cell division, lysogeny, andtransposition of bacteriophage Mu (18, 19, 35, 47). Thispleiotropy suggests an important role for the HU protein inthe physiology of E. coli and S. typhimurium.

In order to understand the in vivo physiological role of theHBsu protein during growth and development of B. subtilis,we have constructed in vitro the hbs::cat mutation. How-ever, we were unable to replace the hbs chromosomal copyby the hbs::cat construct by a double-crossover recombina-tion event. Although the transformation efficiency was verylow, several chloramphenicol-resistant transformants wereanalyzed by Southern hybridization to screen for the geneinterruption. All transformants tested were found to bepartial diploids; they contain one intact and one interruptedcopy of hbs, which may have arisen by a Campbell-likeintegration mechanism.Our failure to interrupt hbs within the B. subtilis chromo-

some by homologous recombination using the hbs::cat con-struct prompted us to use another strategy to control hbsexpression in vivo. We have constructed a strain bearing atruncated hbs copy under the control of its own promoterand a second complete copy under the spac promotercontrol (Fig. 5A). In this strain, BM19, normal growth wasfound to depend upon IPTG induction, indicating an essen-tial role for the intact HBsu protein in cell growth. Cellscontaining Pspac-hbs fusion grew at least threefold moreslowly than the same cells in the presence of 1 mM IPTG.The reduced growth in the absence of IPTG may be due tothe leakiness of the inducible spac promoter. Similar resultswere also obtained when the spoOA gene was fused to thespac promoter with the same vector (8).

Is hbs an essential gene for viability in B. subtilis? Theresults mentioned above, including (i) the failure to interrupthbs by homologous recombination, (ii) the IPTG-dependentgrowth in strain BM19 containing the hbs gene under spacpromoter control, and (iii) the fact that the gene is expressedfrom two distinct promoters throughout growth, may suggestan important or an essential physiological role for the HBsuprotein in B. subtilis. However, the final proof of whetherHBsu is essential for growth and development awaits addi-tional detailed studies, which are under way.

ACKNOWLEDGMENTSWe thank L. Diederich and S. Borchert for assistance in PCR and

library construction, respectively. We thank G. Willimsky fordiscussion and J. Bittner for excellent technical assistance. Also, wethank D. J. Henner for providing pDH88 and for sharing sequencedata for the mtr operon.

REFERENCES1. Beck, A., J. DiJk, and R. Reinhardt. 1987. Ribosomal proteins

and DNA-binding protein II from the extreme thermophileBacillus caldolyticus. Biol. Chem. Hoppe-Seyler 368:121-130.

2. Berger, S. L., and G. M. Wahl. 1987. Screening colonies orplaques with radioactive nucleic acid probes. Methods En-zymol. 152:415-423.

3. Broyles, S. S., and D. E. PettiJohn. 1986. Interaction of theEscherichia coli HU protein with DNA: evidence for formationof nucleosome-like structures with altered DNA helical pitch. J.Mol. Biol. 187:47-60.

4. DiJk, J., S. W. White, K. S. Wilson, and K. Appelt. 1983. On theDNA binding protein II from Bacillus stearothermophilus. I.Purification, studies in solution, and crystallization. J. Biol.Chem. 258:4003-4006.

5. Dixon, N. E., and A. Kornberg. 1984. Protein HU in theenzymatic replication of the chromosomal origin of Escherichiacoli. Proc. Natl. Acad. Sci. USA 81:424-428.

6. Drlica, K., and J. Rouvibre-Yaniv. 1987. Histonelike proteins ofbacteria. Microbiol. Rev. 51:301-319.

7. Durrenberger, M., M.-A. Bjornsti, T. Uetz, J. A. Hobot, and E.Kellenberger. 1988. Intracellular location of the histonelikeprotein HU in Escherichia coli. J. Bacteriol. 170:4757-4768.

8. Ferrari, F. A., K. Trach, D. LeCoq, J. Spence, E. Ferrari, andJ. A. Hoch. 1985. Characterization of the spoOA locus and itsdeduced product. Proc. Natl. Acad. Sci. USA 82:2647-2651.

9. Flashner, Y., and J. D. Gralla. 1988. DNA dynamic flexibilityand protein recognition: differential stimulation by bacterialhistone-like protein HU. Cell 54:713-721.

10. Funnell, B. E., T. A. Baker, and A. Kornberg. 1987. In vitroassembly of a prepriming complex at a region of the Escherichiacoli chromosome. J. Biol. Chem. 262:10327-10334.

11. Geider, K., and H. Hoffmann-Berling. 1981. Proteins controllingthe helical structure of DNA. Annu. Rev. Biochem. 50:233-260.

12. Gollnick, P., S. Ishino, M. I. Kuroda, D. J. Henner, and C.Yanofsky. 1990. The mtr locus is a two-gene operon required fortranscription attenuation in the trp operon of Bacillus subtilis.Proc. Natl. Acad. Sci. USA 87:8726-8730.

13. Greene, J. R., S. M. Brennan, D. J. Andrew, C. C. Thompson,S. H. Richards, R. L. Heinrikson, and E. P. Geiduschek. 1984.Sequence of the bacteriophage SPOl gene coding for transcrip-tion factor 1, a viral homologue of the bacterial type Il DNAbinding proteins. Proc. Natl. Acad. Sci. USA 81:7031-7035.

14. Groch, N., R. Quaas, U. Hahn, and U. Heinemann. 1988.Chemical synthesis and cloning of a gene coding for Bacillussubtilis HBsu protein. Nucleosides Nucleotides 7:817-820.

15. Gryczan, T. J., and D. Dubnau. 1978. Construction and prop-erties of chimeric plasmids in Bacillus subtilis. Proc. Natl.Acad. Sci. USA 75:1428-1432.

16. Henner, D. J. 1990. Inducible expression of regulatory genes inBacillus subtilis. Methods Enzymol. 185:223-228.

17. Higgins, N. P., and D. Hillyard. 1988. Primary structure andmapping of the hupA gene of Salmonella typhimurium. J.Bacteriol. 170:5751-5758.

18. Hillyard, D. R., M. Edlund, K. T. Hughes, M. Marsh, and N. P.Higgins. 1990. Subunit-specific phenotype of Salmonella typhi-murium HU mutant. J. Bacteriol. 172:5402-5407.

19. Huisman, O., M. Faelen, D. Girard, A. Jaffe, A. Toussaint, andJ. Rouvi*re-Yaniv. 1989. Multiple defects in Escherichia colimutants lacking HU protein. J. Bacteriol. 171:3704-3712.

20. Igo, M. M., and R. Losick. 1986. Regulation of a promotor thatis utilized by minor forms of RNA polymerase holoenzyme in B.subtilis. J. Mol. Biol. 191:615-624.

21. Imber, R., H. Bachinger, and T. A. Bickle. 1982. Purification andcharacterization of a small DNA-binding protein, HB, fromBacillus globigii. Eur. J. Biochem. 122:627-632.

22. Imber, R., M. Kimura, N. Groch, and U. Heinemann. 1987.DNA-binding properties and primary structure of HB proteinfrom Bacillus globigii. Eur. J. Biochem. 165:547-552.

23. Johnson, G. G., and E. P. Geiduschek. 1977. Specificity of theweak binding between the phage SPOl transcription-inhibitoryprotein, TF-1 and SPOl DNA. Biochemistry 16:1473-1495.

24. Johnson, W. C., C. P. Moran, and R. Losick. 1983. Two RNApolymerase sigma factors from Bacillus subtilis discriminatebetween overlapping promoters for a developmentally regulatedgene. Nature (London) 302:800-804.

25. Kano, Y., K. Osato, M. Wada, and F. Imamoto. 1987. Cloning

VOL. 173, 1991

on Septem

ber 6, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

3198 MICKA ET AL.

and sequencing of the HU-2 gene of Escherichia coli. Mol. Gen.Genet. 209:408-410.

26. Kano, Y., S. Yoshino, M. Wada, K. Yokoyama, M. Nobuhara,and F. Imamoto. 1985. Molecular cloning and nucleotide se-

quence of the HU-1 gene of Escherichia coli. Mol. Gen. Genet.201:360-362.

27. Kimura, M., and K. S. Wilson. 1983. On the DNA bindingprotein II from Bacillus stearothermophilus. lI. The amino acidsequence and its relation to those of homologous proteins fromother procaryotes. J. Biol. Chem. 258:4007-4011.

28. Krause, M., M. A. Marahiel, H. von Dohren, and H. Kleinkauf.1985. Molecular cloning of an ornithine-activating fragment ofthe gramicidin S synthetase 2 gene from Bacillus brevis and itsexpression in Escherichia coli. J. Bacteriol. 162:1120-1125.

29. Laemmli, U. K. 1970. Cleavage of structural proteins during theassembly of the head of bacteriophage T4. Nature (London)227:680-685.

30. Laine, B., D. Kmiecik, P. Sautiere, G. Biserte, and M. Cohen-Solal. 1980. Complete amino-acid sequences of DNA-bindingproteins HU-1 and HU-2 from Escherichia coli. Eur. J. Bio-chem. 103:447-461.

31. Marsh, M., and D. R. Hillyard. 1988. Nucleotide sequence ofthe HU-1 gene of Salmonella typhimurium. Nucleic Acids Res.16:7196.

32. Mende, L., B. Timm, and A. R. Subramanian. 1978. Primarystructures of two homologous ribosome-associated DNA-bind-ing proteins of Escherichia coli. FEBS Lett. 96:395-398.

33. Moran, C. P., N. Lang, S. F. J. LeGrice, G. Lee, M. Stephens,A. L. Sonenshein, J. Peor, and R. Losick. 1982. Nucleotidesequences that signal the initiation of transcription and transla-tion in Bacillus subtilis. Mol. Gen. Genet. 186:339-346.

34. Nakayama, T. 1980. Purification of Bacillus subtilis DNA-binding protein related to Escherichia coli HU. Biochem.Biophys. Res. Commun. 97:318-324.

35. Ogawa, T., M. Wada, Y. Kano, F. Imamoto, and T. Okazaki.1989. DNA replication in Escherichia coli mutants that lackprotein HU. J. Bacteriol. 171:5672-5679.

36. Penn, M. D., G. Thireos, and H. Greer. 1984. Temporal analysisof general control of amino acid biosynthesis in Saccharomycescerevisiae: role of positive regulatory genes in initiation andmaintenance of mRNA derepression. Mol. Cell. Biol. 4:520-528.

37. Pettijohn, D. E. 1982. Structure and properties of the bacterialnucleoid. Cell 30:667-669.

38. Rouviere-Yaniv, J., J.-E. Germond, and M. Yaniv. 1979. Esch-erichia coli DNA binding protein HU forms nucleosome-like

structure with circular double-stranded DNA. Cell 17:265-274.39. Salti, V., F. Le Hegarat, and L. Hirschbein. 1985. Isolation and

characterization of small heat-stable acid-soluble DNA-bindingproteins from Bacillus subtilis nucleoids. J. Gen. Microbiol.131:581-590.

40. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

41. Schmidt, M. B. 1988. Structure and function of the bacterialchromosome. Trends Biochem. Sci. 13:131-135.

42. Sekimizu, K., D. Bramhill, and A. Kornberg. 1988. Sequentialearly stages in the in vitro initiation of replication at the origin ofthe Escherichia coli chromosome. J. Biol. Chem. 263:7124-7130.

43. Short, J. M., J. M. Fernandez, J. A. Sorge, and W. D. Huse.1988. Lambda Zap: a bacteriophage lambda expression vectorwith in vivo excision properties. Nucleic Acids Res. 16:7583-7600.

44. Tanaka, I., K. Appelt, J. Dijk, S. W. White, and K. S. Wilson.1984. 3-A resolution structure of a protein with histone-likeproperties in procaryotes. Nature (London) 310:376-381.

45. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretictransfer of proteins from polyacrylamide gels to nitrocellulosesheets: procedure and some applications. Proc. Natl. Acad. Sci.USA 76:4350-4354.

46. Varshavsky, A. J., S. A. Nedospasov, V. V. Bakayev, T. G.Bakayeva, and G. P. Georgiev. 1977. Histone-like proteins in thepurified Escherichia coli deoxyribonucleoprotein. Nucleic Ac-ids Res. 4:2725-2745.

47. Wada, M., Y. Kano, T. Okazaki, and F. Imamoto. 1988.Construction and characterization of the deletion mutant ofhuipA and hupB genes in Escherichia coli. J. Mol. Biol. 204:581-591.

48. Watanabe, F., S. Stankowski, and G. Schwarz. 1984. Interactionof the HB protein of Bacillus globigii with nucleic acids.Analysis of binding to DNA and polynucleotides. Eur. J.Biochem. 140:215-219.

49. Wilson, K. S., C. E. Vorgias, I. Tanaka, S. W. White, and M.Kimura. 1990. The thermostability of DNA-binding protein HUfrom bacilli. Protein Eng. 4:11-22.

50. Zuber, P. 1985. Localizing the site of spoO-dependent regulationin the spoVG promoter of Bacillus subtilis, p. 149-156. In J. A.Hoch and P. Setlow (ed.), Molecular biology of microbialdifferentiation. American Society for Microbiology, Washing-ton, D.C.

J. BACTERIOL.

on Septem

ber 6, 2020 by guesthttp://jb.asm

.org/D

ownloaded from