multiple epigenetic maintenance factors implicated by the...

DEVELO

PMENT

1423RESEARCH ARTICLE

INTRODUCTIONUntil recently, epigenetic mechanisms have been equated with theinheritance of heterochromatin, exemplified by DNA methylation inmammals (Wolffe and Matzke, 1999; Egger et al., 2004). Evidencethat transcriptionally active states of chromatin can also beepigenetically maintained is now accumulating (Roguev et al., 2001;Noma and Grewal, 2002; Jaenisch and Bird, 2003; Wysocka et al.,2005). This paradigm shift began with the realization that DNAmethylation is secondary to a more universal mechanism forepigenetic silencing based on methylation of histone 3 lysine 9 (H3K9) for constitutive heterochromatin (Rea et al., 2000; Lachner etal., 2001; Bannister et al., 2001) and on H3 K27 for facultativeheterochromatin (Cao et al., 2002; Czermin et al., 2002; Kuzmichevet al., 2002; Muller et al., 2002).

Active chromatin states may also be epigenetically maintainedbecause alternative histone lysine methylations, mainly at H3 K4,characterize active chromatin and preclude the lysine methylationsthat characterize inactive chromatin (Noma et al., 2001; Litt et al.,2001). The functional opposition of these two classes of histonelysine methylation was further supported by linkage to theantagonism between Polycomb- and trithorax-Group (PcG andtrxG) action (Brock and Fisher, 2005; Ringrose and Paro, 2004). The

association of trxG action with H3 K4 methylation (Roguev et al.,2001; Krogan et al., 2002; Milne et al., 2002; Nagy et al., 2002;Nakamura et al., 2002; Beisel et al., 2002) and PcG action with H3K27 methylation (Cao et al., 2002; Czermin et al., 2002; Kuzmichevet al., 2002; Muller et al., 2002) provides a molecular explanationfor this antagonism.

The silencing methylations at both H3 K9 and H3 K27 areepigenetically maintained via positive-feedback loops. The relevantmethyltransferases [SUV39 and E(Z), respectively] associate witha protein (HP1 and Polycomb, respectively) that recognizes themethylated epitope. The enzyme is thereby associated with thechromatin that it has methylated, to methylate it further andpropagate the silent state.

Recent evidence indicates that maintenance of active chromatinoccurs in the same way, because a constituent protein of all H3 K4methyltransferase complexes, WDR5/SWD3 (Roguev et al., 2001;Krogan et al., 2002; Nagy et al., 2002; Wysocka et al., 2003; Hugheset al., 2004; Yokoyama et al., 2004; Dou et al., 2005; Lee andSkalnik, 2005), binds to methylated H3 K4 (Wysocka et al., 2005).

These observations support the polarization model, which isbased on opposing positive feedback loops (Jaenisch and Bird,2003). Both active and heterochromatic states involve severalpositive feedback loops that reinforce the local status quo. Hence,each state has an implicit epigenetic status that adds stability andreduces the chances of inadvertent transitions to the other state.

The polarization model poses questions that can now beaddressed. Do uncommitted neutral chromatin states exist? Howare active and silenced states specified? Are transitions betweenactive and heterochromatic states used to regulate gene expressionand if so, how? These questions are particularly relevant to thestudy of development because the transition from the totipotencyof the zygote to differentiated states in the adult is reflected bychanges in the epigenetic status of chromatin (Jaenisch and Bird,2003).

Multiple epigenetic maintenance factors implicated by theloss of Mll2 in mouse developmentStefan Glaser1, Julia Schaft1,*, Sandra Lubitz1, Kristina Vintersten†, Frank van der Hoeven‡,Katharina R. Tufteland2, Rein Aasland2, Konstantinos Anastassiadis1, Siew-Lan Ang3 and A. Francis Stewart1,§

Epigenesis is the process whereby the daughters of a dividing cell retain a chromatin state determined before cell division. The best-studied cases involve the inheritance of heterochromatic chromosomal domains, and little is known about specific gene regulationby epigenetic mechanisms. Recent evidence shows that epigenesis pivots on methylation of nucleosomes at histone 3 lysines 4, 9 or27. Bioinformatics indicates that mammals have several enzymes for each of these methylations, including at least six histone 3lysine 4 methyltransferases. To look for evidence of gene-specific epigenetic regulation in mammalian development, we examinedone of these six, Mll2, using a multipurpose allele in the mouse to ascertain the loss-of-function phenotype. Loss of Mll2 slowedgrowth, increased apoptosis and retarded development, leading to embryonic failure before E11.5. Using chimera experiments, wedemonstrated that Mll2 is cell-autonomously required. Evidence for gene-specific regulation was also observed. Although Mox1and Hoxb1 expression patterns were correctly established, they were not maintained in the absence of Mll2, whereas Wnt1 andOtx2 were. The Mll2 loss-of-function phenotype is different from that of its sister gene Mll, and they regulate different Hoxcomplex genes during ES cell differentiation. Therefore, these two closely related epigenetic factors play different roles indevelopment and maintain distinct gene expression patterns. This suggests that other epigenetic factors also regulate particularpatterns and that development entails networks of epigenetic specificities.

KEY WORDS: Epigenetics, Histone methylation, SET domain

Development 133, 1423-1432 (2006) doi:10.1242/dev.02302

1Genomics, BioInnovationsZentrum, Dresden University of Technology, Am Tatzberg47, Dresden 01307, Germany. 2Department of Molecular Biology andComputational Biology Unit at BCCS, University of Bergen, HiB, Bergen N5020,Norway. 3National Institute for Medical Research, The Ridgeway Mill Hill, LondonNW7 1AA, UK.

*Present address: Sydney IVF, 4 O’Connell Street, Sydney 2000, Australia†Present address: Samuel Lunenfeld Research Institute, 600 University Avenue,Toronto, Ontario M5G 1X5, Canada‡Present address: German Cancer Research Centre, Im Neuenheimer Feld 280,Heidelberg, Germany§Author for correspondence (e-mail: [email protected])

Accepted 7 February 2006

DEVELO

PMENT

1424

S. pombe has only one enzyme for each of the active andheterochromatic lysine methylation sites (Roguev et al., 2003;Sanders et al., 2004; Cam et al., 2005). To date, no evidence forspecific gene regulation by histone methylation in either S. pombeor S. cerevisiae has been observed. Higher eukaryotes have severalenzymes for each site of lysine methylation. SET domain sequencealignments suggest that the mouse genome encodes at least six H3K4 methyltransferases and at least seven H3 K9 methyltransferases(Fig. 1). Because gene-specific regulation by epigenesis duringdevelopment has been anticipated but not yet defined, we decided tolook among these SET domain factors in mouse development.

Few lysine methyltransferases have been analyzed for their roleduring metazoan development. Of the H3 K4 methyltransferases(Fig. 1), only Mll (mixed lineage leukaemia; Mll1 – MouseGenome Informatics), which is the mouse homolog of Drosophilatrithorax, has been mutated in the mouse. The gene has beenindependently mutated in the mouse three times, each differentmutation producing a different lethal phenotype whenhomozygous. Fusion of lacZ into exon 3 caused embryoniclethality after E10.5 when homozygous, with pleiotropic defectsin many tissues and disturbed Hox gene expression (Yu et al.,1995; Hess et al., 1997; Yu et al., 1998; Hanson et al., 1999). Thismutant allele expresses the first 458 amino acids of Mll, includingthe conserved AT hooks region, both protein phosphatase 2Ainteraction sites and SNL1 (speckled nuclear localization signal)fused to the tetramerizing protein, �-galactosidase (see Fig. S1 inthe supplementary material). Heterozygotes showed a hypofertileand mildly homeotic phenotype. By contrast, truncation at exon5, which permits expression of the above regions plus the MT(CxxC methyltransferase homology) domain, was lethal at thetwo-cell stage in homozygotes, with a mildly homeoticheterozygous phenotype without reported hypofertility (Ayton etal., 2001). Replacement of exons 12-14 truncated the transcript inthe middle of the conserved PHD finger region and causedembryonic lethality around E13.5, without a reportedheterozygous phenotype (Yagi et al., 1998). It is not clear whetherany of these mutations resulted in a complete loss of function.However, it is clear that Mll is required for definitivehematopoiesis (Ernst et al., 2004a) and sustains expression ofcertain Hox genes, particularly Hoxa7, Hoxa9 and Hoxc8 (Yu etal., 1998; Hanson et al., 1999; Ernst et al., 2004b).

Mammals have a second trithorax homologue, Mll2, as well astwo other similar genes Mll3 and Mll4, and two more genes, Set1aand Set1b, which contain very similar SET domains (Fig. 1). Mll andMll2 are closely related proteins (see Fig. S1 in the supplementarymaterial), having arisen from a duplication that includes theupstream [Plzf (Zbtb16 – Mouse Genome Informatics) and Plzf2]and downstream (U2af1 and U2af1l4) genes (FitzGerald and Diaz,1999). The functional relationship between Mll and Mll2 is notknown. Both proteins are very large, share the same architecture(Fig. 2A; see Fig. S1 in the supplementary material) and areexpressed from CpG islands in a nearly, but not completely,ubiquitous manner, including in ES cells and all major tissues, asdetermined by northern analysis (FitzGerald and Diaz, 1999) (datanot shown). Partial characterizations of associated proteins indicatethat they both reside in similar complexes (Hughes et al., 2004;Yokoyama et al., 2004; Dou et al., 2005), as do Set1a/b (Wysocka etal., 2003; Lee and Skalnik, 2005).

Because Mll and Mll2 are orthologous, a comparison of theirfunctional roles in mouse development represents a good way tolook for evidence of epigenetic regulation in specific geneexpression. Therefore we created a multipurpose allele for Mll2. Byconversion of the allele from one state to another, we established thenull phenotype in mouse development and in ES cells.

MATERIALS AND METHODSGene targeting in embryonic stem cells and genotyping.A 16.4 kb fragment of Mll2 genomic DNA including exon 1 to exon 10 wasisolated from a 129Sv ES cell-phage library. The targeting vector wasconstructed by inserting an FRT flanked cassette including the spliceacceptor sequence from the second exon of the engrailed 2 gene, EMCVIRES, a LacZ-neo fusion and SV40 early polyadenylation signal (Testa etal., 2004) into intron 1 by recombineering (Angrand et al., 1999). Thecassette is flanked on the 3� end by a loxP site and a second loxP site replaced

RESEARCH ARTICLE Development 133 (8)

Fig. 1. Classification of murine SET domain proteins. An exhaustivesearch for SET domains in the mouse genome revealed 50 proteins thatwere grouped into 11 subclasses using a tree based on a structure-based multiple sequence alignment (see Materials and methods). Thetree is shown on the left with protein Accession Number and names.The most likely target specificity for each group is indicated. The mostprominent SET domain co-domains are listed in the right-most column.Accession Numbers are for UniProt except those indicated in blue italic,which are from Ensembl (release 30.33f; the full Accession Number isof the form ENSMUSP000000xxxxx, and only the last five digits areshown), and for HYPB, which is a NCBI RefSeq entry. For the PRDMgroup, the protein names for the human orthologs are given. For theSMYD group, only 3 out of 5 members were included in the alignment,and for the PRDM group, only 7 of 15 members were included. Mll2,which resides on mouse chromosome 7, has also been called MLL4 andWbp7 (FitzGerald and Diaz, 1999; Huntsman et al., 1999; Bedford etal., 1997).

40003

Q60636

49262

Q96EQ9

44245

59485

Q9CXE0

Q8VHL1

P58467

Q9CWY3

76057

Q91WC0

P97443

Q8R5A0

Q9CWR2

Q6Q784

Q6Q783

Q8C0J9

Q5XJV7

Q5FWI1

Q99MY8

XP_135176

O88491

Q6ZPY1

47310

Q8BNK2

O54864

Q5DW34

Q9Z148

Q80UJ9

78444

O88974

P70351

Q61188

Q6PDK2

Q8BRH4

P55200

Q5NU09

Q8CFT2

Q80V17

TRX H3 K4

SET1a

MLL2MLL

MLL4

MLL3

EZ H3 K27H1 K26

Ezh2

Ezh1

SET8 H4 K20SET8

SET3/4MLL5

Suv3-9

Suv3-9h1

H3 K9G9a/BAT8

H3 K9

SETDB2

Suv3-9h2

GLP/EHMT1

SETDB1

SETMAR

Ash1H4 K20H3 K36

WHSC1/NSD2

ASH1L

NSD1

NSD3

HYPB

Suv4-20 H4 K20Suv4-20h2Suv4-20h1

SMYD H3 K4SMYD1SMYD2SMYD3

SET7/9 H3 K4 p53 K372SET7/9

PRDM H3 K9

PRDM1

PRDM7/9

PRDM12

PRDM10

PRDM11

PRDM5

PRDM14

RMT

SET1b

Rubiscocytochrome c

PHDePHDFYRN/C

PHD

Chromo

PHDBromoBAHPWWP

ZnF_C2H2

MBD

ANK

Tree acc.no name group specificity codomains

RRM

MYND

H3 K4 K9

DEVELO

PMENT

an ApaL1 site in intron 2. Two correctly targeted E14 ES cell clones wereused to generate chimeric mice that were subsequently bred to C57BL/6mice. Offspring from Mll2+/– crosses and individual embryos weregenotyped by PCR with the following primers that produced a 1.7 kbproduct from the targeted allele: primer 34, 5�-GGGCTGACCGCTTCCT-CGTGCTTTAC-3�; primer 36, 5�-GGAGAACAGTTGTGGGGAGATGG-GTC-3�. Homozygote Mll2 embryos were distinguished from heterozygoteswith the following primers that produced a 914 bp product from the wild-type allele and no product from the targeted allele: primer 31, 5�-CTCTCTGGTTCTAAGGTAGAGTG-3� and primer 36. To generate Mll2F/+ mice, we crossed Mll2+/– mice to the hATPC-Flpe line (Rodriguez etal., 2000). Subsequent crossing to the PGK-Crem line (Lallemand et al.,1998) produced Mll2 FC/+ mice. Mll2 F/+ and Mll2 FC/+ mice weregenotyped by PCR with the following primers: primer 145, 5�-CGG-AGGAAGAGAGCAGTGACG-3�; primer 147, 5�-GGACAGGAGTC-ACATCTGCTAGG-3�. The products were 1554 bp, 1448 bp and 737 bp forthe Mll2F, Mll2+ and Mll2FC alleles, respectively. For double-targeted EScells, the targeting construct was changed from a lacZ-neo fusion to a lacZ-hygro (hygromycin resistance) fusion by recombineering (Testa et al., 2004).Double-targeted cells were selected for G418 (350 �g/ml) and hygromycin(180 �g/ml) resistance.

Expression analysis by RT-PCR and western blottingTotal RNA from individual embryos or cells was extracted using TriReagent(Sigma) according to the manufacturer’s instructions. First-strand cDNAwas synthesized from 1 �g of total RNA using M-MLV reverse transcriptase(Promega). The primer pairs that produced a 1228 bp product were: mll2se,5�-GCAGCAGAGGAGAACCAGACC-3�; mll2as, 5�-GGAGGAACCT-CCCCTGCCATC. LacZse (5�-AAGTTCAGATGTGCGGCGAGTT) andLacZas (5�-GGCTTCATCCACCACATACAGG) produced a 511 bpproduct. Actin primers were described previously (Testa et al., 2004). Q-PCR was performed using a Stratagene MX4000 according to themanufacturer’s instructions. Cells were homogenized in buffer E (20 mMHEPES, 350 mM NaCl, 10% Glycerol, 0.1% Tween, 1 �g/ml pepstatin A,0.5 �g/ml leupeptin, 2 �g/ml aprotinin, 1 mM PMSF) and snap-frozen threetimes for protein extraction. Protein extracts were fractionated by 5% SDS-PAGE, transferred to nitrocellulose membranes and revealed with a rabbitIgG polyclonal antibody raised against the Mll2 amino acids between SNL1and SNL2 (see Fig. S1 in the supplementary material), and a polyclonal CBPantibody (Santa Cruz). The primer pairs for Q-PCR amplification of Hoxcluster genes were: Hoxa2, TTCCCAGTTTCGCCTTTAACC andCAGTTCTGGCCCATTGTTGAC; Hoxa3, CCTTTCCCTTTTCTCCT-CTGC and ACTGACAGCCTTTCCAGCAAC; Hoxa5, TATAGACG-CACAAACGACCGC and CATTTGGATAGCGACCGCA; Hoxb2,CCCGCTGTCTTGGAGACATTT and TTTTGGCTCCCTGGTCTCTGA;Hoxb4, CGGAAACAGGAAAACGAGTCA and TGTGAATACTCCTCG-CACGGA; Hoxb5, CCCCAAGTTGCCAGTGTTTCT and AACCTCA-ACTGCTGCCCCTTA; Pbx1, GCGCCGGGAGCCCATTTCTGC andGGTCCCTCCGGCCCCATCCTG.

Whole mount X-gal staining, immunohistochemistry and TUNELassayEmbryos were dissected in PBS containing 0.4% BSA. Fixation was carriedout at 4°C in 4% PFA for 20 minutes for E7.5 embryos and 1 hour for laterstages. Embryos were washed three times for 5 minutes in PBS and stainedovernight at 37°C in PBS containing 0.8 mg/ml X-Gal, 0.2 mg/ml sodiumdeoxycholate, 5 mM K3FE(CN)6, 5 mM K4Fe(CN)6, 2 mM MgCl2 and0.02% NP-40. Stained embryos were washed twice in PBS and fixed for 1hour at room temperature in 4% PFA. Embryos were fixed in 4%paraformaldehyde, dehydrated, embedded in paraffin and sectioned at 6 �m.Sections were processed for immunohistochemistry using the monoclonalKi67 antigen antibody (Novo Castra) and a universal detection kit(Novostain) according to the manufacturer’s instructions. Apoptotic cells onparaffin-embedded sections of three mutant embryos and three heterozygouslittermates were detected by using an in situ Cell Death Detection Kit(Roche). Total cells numbers were determined on adjacent sections by DAPIstaining. Embryos were collected and fixed in 4% PFA in PBS for 1 hour onice. After three washes in PBS plus 0.1% Tween 20, embryos were stored at–20°C in methanol. Mutant embryos were identified by yolk-sac PCR.

Whole-mount in situ hybridization was performed as described (Wilkinsonand Nieto, 1993). An Mll2 probe was cloned with the following primers:5-TAGAAGCAGCAGAGGAGAACC-3� and 5�-GGAGGAACCTCCC-CTGCCATC-3�.

Chimera analysis and ES cell differentiationBlastocysts were isolated at embryonic day E4.5. After injection of 20-25targeted ES cells per blastocyst, 14 blastocysts were reintroduced into theuterus of pseudopregnant foster mothers. Injected Mll2+/– and Mll2–/– cellswere detected in embryos by �-galactosidase staining as whole mount (E8.5and E9.5) or in sections (E10.5, E18.5). ES cells were differentiated on massby plating onto bacterial plates in the absence of LIF or retinoic acid.

Database searches and classification of SET domainsThe murine SET domain proteins were identified by searching the murineproteome (ENSEMBL release 30.33f) using a set of 11 profile HMMs(Eddy, 1998) based on a classification of the human SET domain proteins.All proteins included had E-values lower than 10–9. Each murine SETprotein was classified by the highest scoring profile. The SET domain profileHMMs are available at http://www.uib.no/aasland/chrab/. In brief, they wereobtained as follows: initially, a non-redundant set of human SET proteinswas obtained with SMART (http://smart.embl-heidelberg.de/). Afteralignment and clustering the SET domains using Clustal X (Thomspon etal., 1997), nine groups were identified. Clusters of related sequences for eachgroup were obtained by Blastp searches in all of SwissProt/Trembl. For eachgroup, six to eight of the closest sequences were used to build profile HMMsthat were subsequently used in iterative searches in SwissProt/Trembl.During this process, the groups SET7/9 and SET8 were separated from thelarger Suv3-9 group, resulting in a total of 11 groups and correspondingprofile HMMs. An alignment of SET domain sequences from mouse,human, zebrafish and Drosophila corresponding to the 11 groups describedabove was obtained by progressive profile-profile alignments usingClustal_X guided by a structure mask based on information from thestructures of SET7/9, DIM-5, Clr4 and LSMT (pdb: 1O9S, 1PEG, 1MVH,1P0Y). The mouse subset of this alignment (available athttp://www.uib.no/aasland/chrab/) was used to generate a phylogenetic treeusing the MrBayes software (Huelsenbeck and Ronquist, 2001).

RESULTSA null allele for Mll2To explore the function of Mll2, we created a multi-purpose allele(Fig. 2A), which can be converted from one state to another usingFLPe and/or Cre recombination (Testa et al., 2004). An FRT flanked,genetrap-type, stop cassette (Friedrich and Soriano, 1991) wasinserted into the first intron. As determined by RT-PCR (Fig. 2B),western blotting using an Mll2 specific antibody (Fig. 2C), in situhybridization (Fig. 2D) and �-galactosidase expression (Fig. 3), thiscassette captures and truncates the transcript before the second exon.Because the Mll2 initiating methionine is in the first exon, atranscript encoding the first 121 amino acids of Mll2 fused to 40frameshifted amino acids encoded by the second exon of theengrailed 2 gene could be expressed. The retained first 121 aminoacids of Mll2 do not appear to contain any conserved residues ormotifs (see Fig. S1 in the supplementary material).

Removal of one or both FRT cassettes either in homozygouslymutated ES cells or in the germline fully restored wild-typefunction (data not shown). The targeted allele also included loxPsites flanking the small 73 bp second exon (Fig. 2A). Removal ofexon 2 by Cre recombination invokes a frameshift in the mRNA.Embryos homozygous for deletions of both the FRT cassette andexon 2 displayed a phenotype indistinguishable from embryoshomozygous for the targeted allele (Fig. 2E, Table 1). Thisphenotype was also observed in embryos homozygous for theremoval of the second exon while leaving the FRT cassette in thegene (data not shown). Therefore we conclude that the mutantalleles are most probably nulls. For clarity we term the targeted

1425RESEARCH ARTICLEEpigenetic specificity in mouse development

DEVELO

PMENT

1426 RESEARCH ARTICLE Development 133 (8)

Fig. 2. Targeted disruption of the mouse Mll2 gene. (A) The mouse Mll2 cDNA sequence is illustrated at the top to indicate the positions ofdomains and motifs (see Fig. S1 in the supplementary material for more details). Below is a diagram of the gene with exons shown as numberedboxes connected by known splicing events. The exact start site of transcription is not known but arises in the indicated CpG island. Polyadenylationsignals are indicated by red circles. The RT-PCR primers and in situ probe are indicated below, as are the alleles after targeting, FLPe and Crerecombination. (B) RT-PCR analysis of E8.5 embryos. An Mll2-specific primer pair amplified a reaction product from Mll2+/– and Mll2+/+ embryos, butnot from a Mll2–/– embryo. (C) Western blot analysis of wild-type and Mll2–/– ES cells probed with an antibody raised against Mll2 amino acids 864-980. The strong band detected in wild-type extract probably corresponds to the predicted proteolytic 225 kDa Mll2 fragment processed by Taspase.The weaker band in wild-type extract could correspond to the 284 kDa full-length protein. No bands were detected in extracts from Mll2–/– cellsand the blot was controlled using antibodies against CBP, which is also very large. (D) Expression of Mll2 at E8.5. The expression is ubiquitous in thewild-type embryo and absent in the homozygous embryo. (E,F) Mll2–/– embryos and Mll2FC/FC embryos have an identical embryonic lethalphenotype, as illustrated here for E9.5.

Fig. 3. Phenotype of Mll2–/– embryos up tothe last observable stage. Litters were takenfrom E6.5 to E11.5, as indicated, and stained(A-D) or not (E,F) for �-galactosidase (E6.5-E9.5). Intensely staining embryos werehomozygous and lighter staining embryoswere heterozygous for the null allele. Stainingseems absent from the extra-embryonic tissues(A,B).

DEVELO

PMENT

allele ‘-’, the FLP recombined allele ‘F’, and the FLP and Crerecombined allele ‘FC’ (Fig. 2A). As determined by �-galactosidase expression, Mll2 is expressed widely from bothalleles, except in the extra-embryonic tissues (Fig. 3).

Loss of Mll2 causes severe growth retardation andis cell autonomousMll2–/– and FC/FC embryos die before E11.5 (Table 1). The Mll2–/–

mutation was originally created on a mixed 129Sv/C57BL/6background. Careful inspections, particularly of skeletalpreparations, failed to identify any heterozygous phenotype on thisbackground. Increasing the C57BL/6 content resulted in a slight

reduction in the severity of the homozygous phenotype (data notshown). We were unable to identify any cell-type specific defect inmutant embryos before E9.5. Mutant embryos developed allstructures and cell types that we looked for. On the mixed129Sv/C57BL/6 background, most embryos, but not all, showedincomplete closure of the neural tube. This phenotype diminishedwith increasing C57BL/6 content. Regardless of background,growth was increasingly slowed in all embryos from E6.5 (Fig. 3)and development was retarded from E7.5, as assessed later bycounting somite numbers (Table 2) and observing othermorphological markers, such as embryo turning.

The lack of specificity in the phenotype suggested that a generalexplanation, like a nutritional problem caused by a placental defect,could be involved (Guillemot et al., 1994; Nagy and Rossant, 2001).Therefore we used Mll2–/– ES cells in chimera experiments. TheMll2–/– cells were made by exchanging the selectable gene in thetargeting construct from neomycin resistance to hygromycinresistance by recombineering (Testa et al., 2004), followed by


Table 1. Embryonic lethality of Mll2–/– and Mll2 FC/FC embryosEmbryonic day +/+ +/– –/– Resorbtion

E6.5 8 13 6 (21%) 1 (4%)E7.5 8 18 9 (25%) 1 (3%)E8.5 27 44 30 (27%) 9 (8%)E9.5 32 71 36 (23%) 14 (9%)E10.5 24 51 19 (18%) 10 (10%)E11.5 5 10 3* (13%) 4 (18%)E12.5 3 7 0 4 (29%)

+/+ FC/+ FC/FC Resorbtion

E9.5 4 18 9 (26%) 3 (9%)E10.5 6 15 5 (19%) 1 (4%)E11.5 5 12 3* (14%) 1 (5%)E12.5 4 14 0 5 (22%)

*Number includes dead embryos.

Table 2. Retardation of Mll2–/– embryosMll2+/+; +/– Somites Mll2–/– Somites �day

E7.5 – E7.0-E7.5 – 0.0-0.5 E8.0 4 E7.5-E7.8 1 0.2-0.5 E8.5 10 E7.6-E8.0 1-4 0.5-0.9 E9.0 16-17 E8.0-E8.3 4-7 0.7-1.0 E9.5 21-29 E8.3-E8.5 7-10 1.0-1.2 E10.5 35-39 E8.5-E9.0 10-13* 1.5-2.0

*Somite development was disturbed at this stage.

Fig. 4. Mll2 is cell autonomouslyrequired. Chimeras made with wildtype +/+ (A,E,I), Mll2+/– (B,F,J) orMll2–/– (C,D,G,H,K,L) ES cells wereharvested at the times indicated andstained for �-galactosidaseexpression after sectioning (E18.5)or not (E8.5, E9.5). Embryos withMll2–/– cells were divided into low(<50%) or high (>50%) percentageaccording to the intensity ofstaining. Blue stained cells werebroadly distributed in all Mll2+/– andlow percentage Mll2–/– embryos,except for E18.5–/– (K), where only afew blue staining cells could beobserved in the condensing oralcartilage (L, a magnification of theboxed region in K), as well as theendogenous �-galactosidase activityin the gut (I,J,K).

DEVELO

PMENT

1428

targeting in the Mll2+/– ES cells and double selection for G418 andhygromycin resistance. Targeting of the second allele occurred at afrequency compatible with the first targeting frequency (3% versus8%, respectively), hence Mll2 is not required for ES cell survival.

Chimeric embryos were analyzed at E8.5, E9.5, E10.5 and E18.5(Fig. 4, Table 3). As determined by staining for �-galactosidase,highly (>50%) chimeric Mll2–/– embryos recapitulated the Mll2–/–

phenotype up to E10.5. No heavily blue stained embryos were foundat E18.5. Therefore, in concordance with the observed lack of Mll2expression in extra-embryonic cells (Fig. 3), placental defects do notexplain the Mll2–/– phenotype. Embryos that had a low percentage(<50%) null cells developed normally. However Mll2-null cells weresteadily eliminated from these chimeras with increasing

developmental age. By E18.5, only a very few Mll2–/– cells, whichappeared to be macrophages or chondrocytes, were found in anyembryo (Fig. 4K,L; Table 3). Therefore, Mll2 is cell-autonomouslyrequired.

Widespread apoptosis in Mll2–/– embryosWe looked for other causes of the general catastrophe inembryogenesis that were consistent with a cell-autonomousrequirement. Embryos were examined for the proliferation markerKi-67 but showed no significant difference between mutant andwild type (data not shown), as well as for apoptosis by TUNELstaining. Widespread apoptosis was obvious (Fig. 5). Consequently,the simplest explanation for the phenotype is an increased rate ofapoptosis, which slows growth and in turn retards development.

Specificity in gene expressionA sign of cell type specificity was observed in the Mll2–/– embryosafter E9.5 because the neural tube became kinky. In situhybridization to Mox1, a marker for the somites (Candia et al.,1992), was used to examine this issue more closely (Fig. 6). Up to


Table 3. Blastocyst-derived chimeras from ES cell injectionEmbryo chimerism

ES cell High Low None

Mll2+/– E9.5 6 (50%) 4 (33%) 2 (16%)E10.5 17 (65%) 3 (12%) 6 (23%)

Mll2–/– E8.5 2 (11%) 10 (56%) 6 (33%)E9.5 4 (12%) 15 (44%) 15 (44%)E10.5 2 (7%) 11 (39%) 15 (54%)E18.5 0 0 14*/3 (100%)

*Individual blue cells were seen in cartilage of these embryos.

Fig. 5. Widespread apoptosis in E9.5 Mll2–/– embryos. Paraffinsections were taken from an Mll2–/– embryo (A) and a Mll2+/+ littermate(B), stained with TUNEL and then with Hematoxylin and Eosin. Forgreater contrast, A shows a section after TUNEL but beforeHematoxylin and Eosin staining. (C) The average ratio of apoptotic cellsto total cells from three embryos each yields the apoptotic index.

Fig. 6. In situ hybridization analysis of the paraxialmesoderm marker Mox1 indicates a defect inexpression maintenance in Mll2–/– mutant embryos.Whole-mount embryos (A-D) and transverse sections (E-G)are depicted. (A) Expression of Mox1 in the presomiticmesoderm and somites of an E8.4 wild-type embryo(eight somites). (B) Expression of Mox1 in an E9.0 Mll2–/–

embryo with eight somites. (C) In an E9.5 Mll2–/– embryowith 10 somites, Mox1 expression was lost in the anteriorsomites. (D) In an E9.75 Mll2–/– embryo, almost no Mox1expression was detected. Defective longitudinal extensionof paraxial mesoderm is the most likely cause of theuneven and compressed shape of the neural tube inmutant embryos at this stage. (E) Transverse section of theE8.4 wild-type embryo displayed in A shows mox1expression in paraxial mesoderm. (F) TUNEL stainedtransverse section of the E9.5 Trx2–/– embryo displayed inC. Only a few apoptotic nuclei appear throughout thesection; therefore, the Mox1 signal (arrow) is notdecreasing because of apoptosis of the entire paraxialmesoderm at this stage. (G) TUNEL-stained transversesection of an E10.5 Mll–/– embryo. At this stage, the entireembryo section is positively stained, with the highestamount of apoptotic cells in the paraxial mesoderm(arrow).

DEVELO

PMENT

about the eight-somite stage, which is E9.5 for the mutant embryos(Table 2), Mox1 expression was initiated normally. Thereafter it waslost from the anteriormost somites (Fig. 6B,C) before decayingentirely (Fig. 6D). Loss of Mox1 expression appears to precede thedisappearance of the somites for two reasons. First, the observedgeneralized apoptosis does not explain why Mox1 expression is lostfirst from the anteriormost somites. Second, inspection of sectionsshowed that Mox1 expression is lost even though some somitic cellsremain (Fig. 6F). Later, cells in this region show intense apoptosis(Fig. 6G).

By E9.5, Mll2–/– embryos are moribund, so the loss of Mox1expression could be due to a generalized catastrophe rather than toa cell type-specific effect. Evidence in favor of cell type specificitywas found because of the persistence of Wnt1 expression along theneural tube (Fig. 7B). As can be seen from this staining, the neuraltube becomes highly buckled after the disappearance of the somites.

Trithorax in flies is a known regulator of HOM-C expression, andMll regulates at least several Hox genes in mouse. Therefore, welooked at Hox complex gene expression. The developmentalretardation and embryonic lethality prevented any meaningfulanalysis of middle to late Hox complex genes. However, a collapseof expression of Hoxb1 occurred sufficiently early in the mutantembryos to permit some confidence (Fig. 8). The correct expressiondomains of Hoxb1 were established in mutant embryos; however,expression decayed after establishment. Notably, expressiondecayed at the same time in all three main expression areas. Bycontrast, expression of Otx2, brachyury (Fig. 7C-E) and Hoxa1 (notshown) appeared normal.

Using Mll–/– ES cells in embryoid body differentiationexperiments, Ernst et al. (Ernst et al., 2004b) showed that theinduction of several Hoxa genes was severely impaired; however,

Hoxb gene induction was not. Therefore, we performed similarexperiments with Mll2–/– ES cells, using parental E14 cells and thedoubly targeted Mll2–/– cells rescued by FLPe transfection to restoreMll2 expression, as controls (Fig. 8). Loss of Mll2 had no significanteffect on expression of several Hoxa genes; however it did have astrong effect on expression of Hoxb2 and Hoxb5. These datastrengthen the conclusion that Mll and Mll2 regulate different targetgenes.

DISCUSSIONThe trxG was originally identified in flies as supressors of PcGmutations. Recent evidence demonstrates that the PcG hasbiochemical coherence and is linked to histone lysine methylationat H3 K27 and possibly H3 K9 (Cao et al., 2002; Czermin et al.,2002; Kuzmichev et al., 2002; Muller et al., 2002; Levine et al.,2004). Whether the trxG has biochemical coherence is not clear.Based on finding a linkage between the yeast homolog of trxGmember Ash2 and the first identified H3 K4 methyltransferase Set1,we proposed that a part of trxG action is linked to histone lysinemethylation at H3 K4 (Roguev et al., 2001). Because activechromatin is characterized by methylation at H3 K4, and inactivechromatin by methylations at H3 K9 and/or H3 K27, the oppositionbetween PcG and trxG lies, in part, at the level of histonemethylation.

Mammals appear to have at least two, and up to seven or more,enzymes for each of the histone lysine methylation sites (Fig. 1). Theyeast S. pombe has only one enzyme per site and these enzymesappear to play general roles in chromatin status, rather than specificroles in gene regulation. The added histone methyltransferasecapacity in mammals suggests that gene-specific regulation indevelopment, based upon epigenetic mechanisms of histone lysine


Fig. 7. In situ hybridization analysis of Wnt1, Otx2 and T. Theexpression of these markers was relatively unaffected in Mll–/– embryos(B,D-F). Expression of Wnt1 in wild-type E9.5 embryo (A) comparedwith Mll–/– E10.5 (B). Buckling of the neural tube is caused by the lossof somites. Expression of Otx2 in wild-type E9.5 embryo (C) comparedwith Mll–/– E10.5 embryo (D). Expression of brachyury (T) in Mll–/–

embryos at E8.5 (E) and E9.5 (F) shows that it was correctly establishedand maintained.

Fig. 8 In situ hybridization analysis of Hoxb1 indicates a defect inexpression maintenance in Mll2–/– mutant embryos. Wild-typeembryos from E8.75 (A) and E9.5 (B), and Mll2–/– embryos representingapproximately E7.75 (C), E8.25 (D), E8.5 (E) and E8.75 (F) werehybridized with a Hoxb1 probe.

DEVELO

PMENT

1430

methylation, is possible. To explore this possibility, the function ofcandidate histone lysine methyltransferases in development must beestablished. To date, Mll is the only H3 K4 methyltransferase to beanalyzed in mouse development. Here, we have analyzed the rolesof its sister gene, Mll2.

According to several criteria, the Mll2 alleles studied here showcomplete loss of function and we report the following observations.Mll2 is expressed in ES cells but is not required for ES cell viability.Mll2–/– ES cells or embryos show no detectable decrease in globalH3 K4 dimethylation level, indicating that Mll2 is not a major sourceof this modification (data not shown). The first manifestation of lossof Mll2 in development is widespread growth retardation apparentby E7.5. The growth retarded embryos display widespread apoptosisand an increasing delay of developmental progress. By E9.5 thedevelopmental delay is ~1 day. At this time, the first evidence for celltype specificity, involving specific loss of expression of Mox1 andHoxb1, was observed.

Previous studies with H3 K4 methyltransferases in developmenthave focused upon gene-specific regulation, including regulation ofHOM-C and Hox complex genes, as well as other transcriptionfactors such as the ecdysone receptor (Breen, 1999; Yu et al., 1998;Sedkov et al., 2003). Although we uncovered evidence for genespecificity, the loss of expression of Hoxb1 and Mox1 occurred wellafter other, widespread, cell-autonomous aspects of the phenotype.Growth retardation, apoptosis and developmental retardation allpreceded noticeable cell type-specific effects. These defects werenot due to inadequate function of extra-embryonic cells. Becauseboth Hoxb1 and Mox1 expression patterns are established properlyin the absence of Mll2, and then decay shortly before death, it ispossible that the collapse of expression is due to secondary effectsin the dying embryo. However, we found that expression of Wnt1 incells neighboring those affected by the loss of Mll2 is maintainedwell after the loss of Mox1 expression. This observation lends somereason to conclude that Mll2 is a specific maintenance factor forMox1 expression. It is also concordant with the existing propositionsregarding its homolog in flies, Trithorax, and sister, Mll, which areboth believed to act as maintenance factors for specific geneexpression (Sedkov et al., 1994; Yu et al., 1998; Klymenko andMuller, 2004).

The roles for H3 K4 methyltransferases in gene expression remainenigmatic. In yeast, there is no evidence so far that the H3 K4methyltransferase Set1 regulates specific gene expression (Santos-Rosa et al., 2002). Rather, Set1 and H3 K4 methylation play generalroles in the maintenance of chromatin status, which includes anassociation with transcriptional activity (Ng et al., 2003; Krogan etal., 2003) and an opposition to H3 K9 methylation (Noma andGrewal, 2002). In development, the action of H3 K4methyltransferases as maintenance factors is related to theopposition of PcG repression. That is, specific genes require trxGfactors to maintain expression because otherwise PcG action willextinguish expression (Klymenko and Muller, 2004). Thisopposition may be due to the control of opposing nucleosomalmethylations at H3 K4 and H3 K27. However, Trithorax andhomologs appear to be transcriptional co-factors, bothbiochemically, because of associations with CBP (Ernst et al., 2001;Petruk et al., 2001) and the elongating RNAP II (Ng et al., 2003;Krogan et al., 2003; Smith et al., 2004; Guenther et al., 2005), andfunctionally (Milne et al., 2002; Sedkov et al., 2003; Smith et al.,2004; Milne et al., 2005). Because Trithorax and homologs areinvariably large multi-domain proteins, it is likely that they act inboth roles: as epigenetic factors to maintain active chromatin and astranscriptional co-factors that interact with the transcriptional

machinery.The Mll2–/– phenotype displays characteristics consistent with a

general role implicit to all cells of the embryo, as well as gene-specific regulation in some cell types. The general role becomesevident after gastrulation and relates to widespread growthretardation, which is probably due to elevated apoptosis. If so, Mll2may regulate an apoptotic component. Alternatively, increasedapoptosis may be a consequence of complications caused bydisorganized gene expression resulting from the loss of Mll2. If so,this may reflect a general role for Mll2 in gene expression, such asan association with RNA polymerase, as has been suggested for Mll(Guenther et al., 2005).

Some doubt exists as to the exact nature of the Mll loss-of-function phenotype in development because the three publishedalleles differ and each could express a part of the protein containinghighly conserved regions. Nevertheless, both the Yu (Yu et al., 1995)and Yagi (Yagi et al., 1998) alleles share specific homozygousphenotypic features that are distinct from those reported here forMll2. When homozygous, neither of those alleles provokes obviousgrowth and developmental retardation, and somitic development


Fig. 9. Quantitative PCR analysis of Hox complex genes duringembryoid body differentiation. The E14 cells used for targeting(wild type), the double-targeted Mll–/– cells and their FLPe rescuedderivatives were differentiated in suspension in the absence of LIF orretinoic acid and harvested for RT-PCR analysis every second day. Eachdata point is the average from three parallel experiments. That is, threeculture plates were differentiated, mRNA was harvested, cDNA wasproduced and Q-PCR analysis took place for each data point in parallel.Results are plotted as Ct values (one Ct value corresponds to a doublingof signal and all values less than 31 were assumed to be zero, i.e. 31).Pbx1 served as a control for RNA input. In our experience, the earlieractivation of Hoxb2 and Hoxb5 seen in the rescued cells compared withwild type represents an implicit degree of variability involved in ES celldifferentiation experiments, owing to either clone-to-clone or slightonset of differentiation differences.

28

29

30

31

0 2 4 6 8 10

Hoxa2

20

24

26

Hoxa3

Hoxa4

Pbx1

Hoxb2

Hoxb4

Hoxb5

wtrescuedmll2-/-

0 2 4 6 8 10

0 2 4 6 8 10 0 2 4 6 8 10

0 2 4 6 8 10 0 2 4 6 8 10

0 2 4 6 8 10

28

29

30

31

28

29

30

31

28

29

30

31

28

29

30

31

28

29

30

31

DEVELO

PMENT

appears to proceed normally at least until E10.5. Thereafter,apoptosis in the somites, but not the neural tube, was observed (Yuet al., 1998). Similarly we observed apoptosis confined to thesomites (Fig. 6), but at an earlier developmental stage (Table 2). Thisrepresents another difference between the developmental roles ofthese sister genes. Furthermore, we suggest that the Yagi allele is thenull phenotype because of the lack of polyadenylation, nuclearexport of truncated Mll transcripts and protein expression. Bycontrast, it is known that a conserved part of Mll is expressed as afusion protein with �-galactosidase in the more aggressive Yu allele,which also shows a heterozygous phenotype as expected for adominant-negative effect. If this suggestion is correct, then thedifferences between the Mll and Mll2 loss-of-function phenotypesin mouse development are considerable. The conclusion that Mll andMll2 regulate different processes in development, includingdifferences in Hox gene regulation, is strengthened by theobservation that Mll2–/– ES cells show severely impaired Hoxb geneinductions (Fig. 9), whereas Mll–/– ES cells do not (Ernst et al.,2004b). Whether similar conclusions regarding specificities will alsoapply to the other four members of the H3 K4 methyltransferasegroup, or indeed to the other classes of epigenetic maintenance orsilencing factors (Fig. 1), remains to be determined. Our findingsindicate that mammalian development not only relies on networksof transcriptional regulation mediated by sequence specifictranscription factors, but also on networks of epigenetic specificities.

We thank Giuseppe Testa and Michelle Meredyth for discussions, MatthewBetts (CBU, Bergen) for advice on using the MrBayes software, and Jussi Helppifor services at the animal facility of the Max-Planck-Institute for Cell Biologyand Genetics, Dresden. K.R.T. held a fellowship from Research Council ofNorway (146652/431). This work was supported by funding from the VWFoundation, Program on Conditional Mutagenesis and the Sixth ResearchFramework Programme of the European Union, Project FunGenES (LSHG-CT-2003-503494).

Supplementary materialSupplementary material for this article is available athttp://dev.biologists.org/cgi/content/full/133/8/1423/DC1

ReferencesAngrand, P. O., Daigle, N., van der Hoeven, F., Scholer, H. R. and Stewart, A.

F. (1999). Simplified generation of targeting constructs using ET recombination.Nucleic Acids Res. 27, e16.

Ayton, P., Sneddon, S. F., Palmer, D. B., Rosewell, I. R., Owen, M. J., Young,B., Presley, R. and Subramanian, V. (2001). Truncation of the Mll gene in exon5 by gene targeting leads to early preimplantation lethality of homozygousembryos. Genesis 30, 201-212.

Bannister, A. J., Zegerman, P., Partridge, J. F., Miska, E. A., Thomas, J. O.,Allshire, R. C. and Kouzarides, T. (2001). Selective recognition of methylatedlysine 9 on histone H3 by the HP1 chromo domain. Nature 410, 120-124.

Bedford, M. T., Chan, D. C. and Leder, P. (1997). FBP WW domains and the AblSH3 domain bind to a specific class of proline-rich ligands. EMBO J. 16, 2376-2383.

Beisel, C., Imhof, A., Greene, J., Kremmer, E. and Sauer, F. (2002). Histonemethylation by the Drosophila epigenetic transcriptional regulator Ash1. Nature419, 857-862.

Breen, T. R. (1999). Mutant alleles of the Drosophila trithorax gene producecommon and unusual homeotic and other developmental phenotypes. Genetics152, 319-344.

Brock, H. W. and Fisher, C. L. (2005). Maintenance of gene expression patterns.Dev. Dyn. 232, 633-655.

Cam, H. P., Sugiyama, T., Chen, E. S., Chen, X., FitzGerald, P. C. and Grewal,S. I. (2005). Comprehensive analysis of heterochromatin- and RNAi-mediatedepigenetic control of the fission yeast genome. Nat. Genet. 37, 809-819.

Candia, A. F., Hu, J., Crosby, J., Lalley, P. A., Noden, D., Nadeau, J. H. andWright, C. V. (1992). Mox-1 and Mox-2 define a novel homeobox genesubfamily and are differentially expressed during early mesodermal patterning inmouse embryos. Development 116, 1123-1136.

Cao, R., Wang, L., Wang, H., Xia, L., Erdjument-Bromage, H., Tempst, P.,Jones, R. S. and Zhang, Y. (2002). Role of histone H3 lysine 27 methylation inPolycomb-group silencing. Science 298, 1039-1043.

Czermin, B., Melfi, R., McCabe, D., Seitz, V., Imhof, A. and Pirrotta, V. (2002).

Drosophila enhancer of Zeste/ESC complexes have a histone H3methyltransferase activity that marks chromosomal Polycomb sites. Cell 111,185-196.

Dou, Y., Milne, T. A., Tackett, A. J., Smith, E. R., Fukuda, A., Wysocka, J.,Allis, C. D., Chait, B. T., Hess, J. L. and Roeder, R. G. (2005). Physicalassociation and coordinate function of the H3 K4 methyltransferase MLL1 andthe H4 K16 acetyltransferase MOF. Cell 121, 873-885.

Eddy, S. R. (1998). Profile hidden Markov models. BioInformatics 14, 755-763.Egger, G., Liang, G., Aparicio, A. and Jones, P. A. (2004). Epigenetics in human

disease and prospects for epigenetic therapy. Nature 429, 457-463.Ernst, P., Wang, J., Huang, M., Goodman, R. H. and Korsmeyer, S. J. (2001).

MLL and CREB bind cooperatively to the nuclear coactivator CREB-bindingprotein. Mol. Cell. Biol. 21, 2249-2258.

Ernst, P., Fisher, J. K., Avery, W., Wade, S., Foy, D. and Korsmeyer, S. J.(2004a). Definitive hematopoiesis requires the mixed-lineage leukemia gene.Dev. Cell 6, 437-443.

Ernst, P., Mabon, M., Davidson, A. J., Zon, L. I. and Korsmeyer, S. J. (2004b).An Mll-dependent Hox program drives hematopoietic progenitor expansion.Curr. Biol. 14, 2063-2069.

FitzGerald, K. T. and Diaz, M. O. (1999). MLL2: A new mammalian member ofthe trx/MLL family of genes. Genomics 59, 187-192.

Friedrich, G. and Soriano, P. (1991). Promoter traps in embryonic stem cells: agenetic screen to identify and mutate developmental genes in mice. Genes Dev.5, 1513-1523.

Guenther, M. G., Jenner, R. G., Chevalier, B., Nakamura, T., Croce, C. M.,Canaani, E. and Young, R. A. (2005). Global and Hox-specific roles for theMLL1 methyltransferase. Proc. Natl. Acad. Sci. USA 102, 8603-8608.

Guillemot, F., Nagy, A., Auerbach, A., Rossant, J. and Joyner, A. L. (1994).Essential role of Mash-2 in extraembryonic development. Nature 371, 333-336.

Hanson, R. D., Hess, J. L., Yu, B. D., Ernst, P., van Lohuizen, M., Berns, A.,van der Lugt, N. M., Shashikant, C. S., Ruddle, F. H., Seto, M. et al. (1999).Mammalian Trithorax and polycomb-group homologues are antagonisticregulators of homeotic development. Proc. Natl. Acad. Sci. USA 96, 14372-14377.

Hess, J. L., Yu, B. D., Li, B., Hanson, R. and Korsmeyer, S. J. (1997). Defects inyolk sac hematopoiesis in Mll-null embryos. Blood 90, 1799-1806.

Huelsenbeck, J. P. and Ronquist, F. (2001). MRBAYES: Bayesian inference ofphylogenetic trees. BioInformatics 17, 754-755.

Hughes, C. M., Rozenblatt-Rosen, O., Milne, T. A., Copeland, T. D., Levine, S.S., Lee, J. C., Hayes, D. N., Shanmugam, K. S., Bhattacharjee, A., Biondi, C.A. et al. (2004). Menin associates with a trithorax family histonemethyltransferase complex and with the hoxc8 locus. Mol. Cell 13, 587-597.

Huntsman, D. G., Chin, S. F., Muleris, M., Batley, S. J., Collins, V. P.,Wiedemann, L. M., Aparicio, S. and Caldas, C. (1999). MLL2, the secondhuman homolog of the Drosophila trithorax gene, maps to 19q13.1 and isamplified in solid tumor cell lines. Oncogene 18, 7975-7984.

Jaenisch, R. and Bird, A. (2003). Epigenetic regulation of gene expression: howthe genome integrates intrinsic and environmental signals. Nat. Genet. Suppl.33, 245-254.

Klymenko, T. and Muller, J. (2004). The histone methyltransferases Trithorax andAsh1 prevent transcriptional silencing by Polycomb group proteins. EMBO Rep.5, 373-377.

Krogan, N. J., Dover, J., Khorrami, S., Greenblatt, J. F., Schneider, J.,Johnston, M. and Shilatifard, A. (2002). COMPASS, a histone H3 (Lysine 4)methyltransferase required for telomeric silencing of gene expression. J. Biol.Chem. 277, 10753-10755.

Krogan, N. J., Dover, J., Wood, A., Schneider, J., Heidt, J., Boateng, M. A.,Dean, K., Ryan, O. W., Golshani, A., Johnston, M. et al. (2003). The Paf1complex is required for histone H3 methylation by COMPASS and Dot1p: linkingtranscriptional elongation to histone methylation. Mol. Cell 11, 721-729.

Kuzmichev, A., Nishioka, K., Erdjument-Bromage, H., Tempst, P. andReinberg, D. (2002). Histone methyltransferase activity associated with ahuman multiprotein complex containing the Enhancer of Zeste protein. GenesDev. 16, 2893-2905.

Lachner, M., O’Carroll, D., Rea, S., Mechtler, K. and Jenuwein, T. (2001).Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins.Nature 410, 116-120.

Lallemand, Y., Luria, V., Haffner-Krausz, R. and Lonai, P. (1998). Maternallyexpressed PGK-Cre transgene as a tool for early and uniform activation of theCre site-specific recombinase. Transgenic Res. 7, 105-112.

Lee, J. H. and Skalnik, D. G. (2005). CpG-binding protein (CXXC finger protein 1)is a component of the mammalian Set1 histone H3-Lys4 methyltransferasecomplex, the analogue of the yeast Set1/COMPASS complex. J. Biol. Chem. 280,41725-41731.

Levine, S. S., King, I. F. and Kingston, R. E. (2004). Division of labor in polycombgroup repression. Trends Biochem. Sci. 29, 478-485.

Litt, M. D., Simpson, M., Gaszner, M., Allis, C. D. and Felsenfeld, G. (2001).Correlation between histone lysine methylation and developmental changes atthe chicken beta-globin locus. Science 293, 2453-2455.

Milne, T. A., Briggs, S. D., Brock, H. W., Martin, M. E., Gibbs, D., Allis, C. D.


DEVELO

PMENT

1432

and Hess, J. L. (2002). MLL targets SET domain methyltransferase activity toHox gene promoters. Mol. Cell 10, 1107-1117.

Milne, T. A., Hughes, C. M., Lloyd, R., Yang, Z., Rozenblatt-Rosen, O., Dou,Y., Schnepp, R. W., Krankel, C., Livolsi, V. A., Gibbs, D. et al. (2005). Meninand MLL cooperatively regulate expression of cyclin-dependent kinase inhibitors.Proc. Natl. Acad. Sci. USA 102, 749-754.

Muller, J., Hart, C. M., Francis, N. J., Vargas, M. L., Sengupta, A., Wild, B.,Miller, E. L., O’Connor, M. B., Kingston, R. E. and Simon, J. A. (2002).Histone methyltransferase activity of a Drosophila Polycomb group repressorcomplex. Cell 111, 197-208.

Nagy, A. and Rossant, J. (2001). Chimaeras and mosaics for dissecting complexmutant phenotypes. Int. J. Dev. Biol. 45, 577-582.

Nagy, P. L., Griesenbeck, J., Kornberg, R. D. and Cleary, M. L. (2002). Atrithorax-group complex purified from Saccharomyces cerevisiae is required formethylation of histone H3. Proc. Natl. Acad. Sci. USA 99, 90-94.

Nakamura, T., Mori, T., Tada, S., Krajewski, W., Rozovskaia, T., Wassell, R.,Dubois, G., Mazo, A., Croce, C. M. and Canaani, E. (2002). ALL-1 is a histonemethyltransferase that assembles a supercomplex of proteins involved intranscriptional regulation. Mol. Cell 10, 1119-1128.

Ng, H. H., Robert, F., Young, R. A. and Struhl, K. (2003). Targeted recruitmentof Set1 histone methylase by elongating Pol II provides a localized mark andmemory of recent transcriptional activity. Mol. Cell 11, 709-719.

Noma, K. and Grewal, S. I. (2002). Histone H3 lysine 4 methylation is mediatedby Set1 and promotes maintenance of active chromatin states in fission yeast.Proc. Natl. Acad. Sci. USA Suppl. 4 99, 16438-16445.

Noma, K., Allis, C. D. and Grewal, S. I. (2001). Transitions in distinct histone H3methylation patterns at the heterochromatin domain boundaries. Science 293,1150-1155.

Petruk, S., Sedkov, Y., Smith, S., Tillib, S., Kraevski, V., Nakamura, T.,Canaani, E., Croce, C. M. and Mazo, A. (2001). Trithorax and dCBP acting in acomplex to maintain expression of a homeotic gene. Science 294, 1331-1334.

Rea, S., Eisenhaber, F., O’Carroll, D., Strahl, B. D., Sun, Z. W., Schmid, M.,Opravil, S., Mechtler, K., Ponting, C. P., Allis, C. D. et al. (2000). Regulationof chromatin structure by site-specific histone H3 methyltransferases. Nature406, 593-599.

Ringrose, L. and Paro, R. (2004). Epigenetic regulation of cellular memory by thePolycomb and Trithorax group proteins. Annu. Rev. Genet. 38, 413-443.

Rodriguez, C. I., Buchholz, F., Galloway, J., Sequerra, R., Kasper, J., Ayala, R.,Stewart, A. F. and Dymecki, S. M. (2000). High-efficiency deleter mice showthat FLPe is an alternative to Cre-loxP. Nat. Genet. 25, 139-140.

Roguev, A., Schaft, D., Shevchenko, A., Pijnappel, W. W., Wilm, M., Aasland,R. and Stewart, A. F. (2001). The Saccharomyces cerevisiae Set1 complexincludes an Ash2 homologue and methylates histone 3 lysine 4. EMBO J. 20,7137-7148.

Roguev, A., Schaft, D., Shevchenko, A., Aasland, R. and Stewart, A. F.(2003). High conservation of the Set1/Rad6 axis of histone 3 lysine 4methylation in budding and fission yeasts. J. Biol. Chem. 278, 8487-8493.

Sanders, S. L., Portoso, M., Mata, J., Bahler, J., Allshire, R. C. andKouzarides, T. (2004). Methylation of histone H4 lysine 20 controls recruitmentof Crb2 to sites of DNA damage. Cell 119, 603-614.

Santos-Rosa, H., Schneider, R., Bannister, A. J., Sherriff, J., Bernstein, B. E.,Emre, N. C., Schreiber, S. L., Mellor, J. and Kouzarides, T. (2002). Activegenes are tri-methylated at K4 of histone H3. Nature 419, 407-411.

Sedkov, Y., Tillib, S., Mizrokhi, L. and Mazo, A. (1994). The bithoraxcomplex is regulated by trithorax earlier during Drosophila embryogenesisthan is the Antennapedia complex, correlating with a bithorax-likeexpression pattern of distinct early trithorax transcripts. Development 120,1907-1917.

Sedkov, Y., Cho, E., Petruk, S., Cherbas, L., Smith, S. T., Jones, R. S., Cherbas,P., Canaani, E., Jaynes, J. B. and Mazo, A. (2003). Methylation at lysine 4 ofhistone H3 in ecdysone-dependent development of Drosophila. Nature 426, 78-83.

Smith, S. T., Petruk, S., Sedkov, Y., Cho, E., Tillib, S., Canaani, E. and Mazo,A. (2004). Modulation of heat shock gene expression by the TAC1 chromatin-modifying complex. Nat. Cell Biol. 6, 162-167.

Testa, G., Schaft, J., van der Hoeven, F., Glaser, S., Anastassiadis, K., Zhang,Y., Hermann, T., Stremmel, W. and Stewart, A. F. (2004). A reliable lacZexpression reporter cassette for multipurpose, knockout-first alleles. Genesis 38,151-158.

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and Higgins,D. G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiplesequence alignment aided by quality analysis tools. Nucl. Acids Res. 25, 4876-4882.

Wilkinson, D. G. and Nieto, M. A. (1993). Detection of messenger RNA by in situhybridization to tissue sections and whole mounts. Methods Enzymol. 225, 361-373.

Wolffe, A. P. and Matzke, M. A. (1999). Epigenetics: regulation throughrepression. Science 286, 481-486.

Wysocka, J., Myers, M. P., Laherty, C. D., Eisenman, R. N. and Herr, W.(2003). Human Sin3 deacetylase and trithorax-related Set1/Ash2 histone H3-K4methyltransferase are tethered together selectively by the cell-proliferation factorHCF-1. Genes Dev. 17, 896-911.

Wysocka, J., Swigut, T., Milne, T. A., Dou, Y., Zhang, X., Burlingame, A. L.,Roeder, R. G., Brivanlou, A. H. and Allis, C. D. (2005). WDR5 associates withhistone H3 methylated at K4 and is essential for H3 K4 methylation andvertebrate development. Cell 121, 859-872.

Yagi, H., Deguchi, K., Aono, A., Tani, Y., Kishimoto, T. and Komori, T. (1998).Growth disturbance in fetal liver hematopoiesis of Mll-mutant mice. Blood 92,108-117.

Yokoyama, A., Wang, Z., Wysocka, J., Sanyal, M., Aufiero, D. J.,Kitabayashi, I., Herr, W. and Cleary, M. L. (2004). Leukemia proto-oncoprotein MLL forms a SET1-like histone methyltransferase complex withmenin to regulate Hox gene expression. Mol. Cell. Biol. 24, 5639-5649.

Yu, B. D., Hess, J. L., Horning, S. E., Brown, G. A. and Korsmeyer, S. J. (1995).Altered Hox expression and segmental identity in Mll-mutant mice. Nature 378,505-508.

Yu, B. D., Hanson, R. D., Hess, J. L., Horning, S. E. and Korsmeyer, S. J.(1998). MLL, a mammalian trithorax-group gene, functions as a transcriptionalmaintenance factor in morphogenesis. Proc. Natl. Acad. Sci. USA 95, 10632-10636.


multiple epigenetic maintenance factors implicated by the...

Documents