mystery of the crooked cell

Mystery of the Crooked Cell By Donald A. DeRosa and B. Leslie Wolfe

Adapted by The Institute for Genomic Research

This document contains information and handouts needed to prepare the MdBioLab activity, Mystery of the Crooked Cell, an investigation into

the molecular basis of sickle cell anemia.

Table of Contents

T E A C H E R M A T E R I A L S

Background Information 1

Pre-Lab Activity Information 2

Characterization of Sickle Cell Anemia Event Flow Chart 4

Laboratory Explanation 5

Laboratory Preparation 9

Extension Activities 12

S T U D E N T A C T I V I T Y H A N D O U T S A N D L A B O R A T O R Y P R O T O C O L

Patient Description

Station A, B, C & D Guide Sheets

Laboratory Protocol

Observation & Data Sheet

A Closer Look at the Cause of Sickle Cell Anemia

Documents 1, 2 & 3

TEACHER MATERIALS

Background Sickle cell anemia is a genetic disease that affects the hemoglobin molecule in red blood cells. Normal red blood cells are round like doughnuts, and they move through small blood vessels in the body to deliver oxygen. Diseased red blood cells become hard, sticky and shaped like sickles used to cut wheat. Then these hard and pointed red cells go through the small blood vessels, they clog the blood flow and break apart. This can cause pain, damage and a low red blood cell count or anemia. Each person has two copies of the gene for hemoglobin. Normal hemoglobin is referred to as Hemoglobin A. The letters AA are used to indicate that both hemoglobin genes are normal. The gene that causes sickle cell anemia is referred to as Hemoglobin S. There are three possible combinations of the genes for hemoglobin:

AA Individual is homozygous for the hemoglobin A gene. So both copies of hemoglobin code for normal hemoglobin and the person does not have the disease.

AS Individual is heterozygous. One copy of hemoglobin codes for normal hemoglobin and the other copy of the gene codes for sickled hemoglobin. This person does not have the disease and will not develop it later in life.

SS Individual is homozygous for the sickled hemoglobin S gene. So both copies of hemoglobin code for diseased hemoglobin. This person suffers from sickled cell anemia.

The irregularly shaped blood cells lead to a cascade of symptoms. The sickle-shaped blood cells die prematurely resulting in anemia and the production of excess bilirubin (a yellow pigment resulting from the breakdown of hemoglobin). Jaundice often results when the liver cannot metabolize bilirubin fast enough. Infection, dehydration, overexertion, high altitude, chills, or cold weather can bring on a sickling episode, or crisis. Sometimes there is no apparent precipitating factor. People with sickle cell disease are susceptible to fevers and infection. There is no cure for sickle cell anemia. Hydration, bed rest, painkillers, and antibiotics are often prescribed. Recent research has focused on re-expressing the fetal hemoglobin gene. After birth, the gene for fetal hemoglobin turns off while the gene for adult hemoglobin becomes activated. If the gene for fetal hemoglobin could be turned on again, it may compensate for the diseased hemoglobin and provide relief for people with sickle cell anemia. Sickle trait may serve as a protective mechanism against malaria. Malaria is a deadly disease found in countries along the equator. People with sickle cell trait are protected from malaria while those with normal hemoglobin are susceptible to it. Over the years, people with sickle trait migrated to other continents. Sickle cell disease is seen predominantly in the African descendant populations but is also seen in people of other ethnic groups. These ethnic groups include individuals from parts of the Middle East, Central India, and countries bordering the Mediterranean Sea, especially Italy and Greece. This lesson is organized into two parts: A pre-lab and a laboratory investigation. During the pre-lab, students visit learning stations and acquire clues about a mystery disease (sickle cell anemia). Each station challenges the students to explore different aspects of sickle cell anemia. Working in groups, students manipulate models and gather data to construct an explanation of how sickle cell anemia affects the patient at the molecular level. Following the pre-lab, students enter the

Mystery of the Crooked Cell: Background 1

laboratory where they apply the concepts acquired in the pre-lab to test a fictional patient for the presence of sickle cell hemoglobin using gel electrophoresis.

Mystery of the Crooked Cell: Background 2

Pre-Lab Activities The purpose of the pre-lab is to explore the connection of hemoglobin to symptoms exhibited in sickle cell anemia. It provides students with the opportunity to construct ideas and concepts about the mechanism of the disease based on their prior experience. The objectives of the pre-lab are as follows:

�� Observe prepared normal and sickle cell slides. �� Manipulate models of blood cells to gather data and make inferences about sickle cell anemia. �� Analyze an inheritance pattern using a pedigree. �� Work cooperatively to explain the symptoms exhibited in sickle cell anemia. �� Construct an explanation of the disease mechanism.

Pre-lab Materials

Four microscopes with 1000x capability ��

��

��

��

��

��

Prepared slides of sickle cell blood and normal blood. Prepared slides are available from several biological supply companies. One model of a red blood cell with normal hemoglobin and one model of a red blood cell with diseased hemoglobin. We make models of red blood cells from snap lock beads and balloons. One capillary model (Y connector) with several models of round and sickled red blood cells. We use Model Magictm to make the cells. Newsprint Markers

Pre-lab Engagement (10-15 minutes)

Organize the students in groups of four. Have each team read a description of the patient who came to Dr. Herrick, a Chicago physician, in 1904 (Patient Description File). The essential question is. “What is the mechanism of the disease?” Instruct the students to make observations and gather clues about the condition described in the patient scenario. Ask students to identify and underline any clues in the description that may help them determine the effect of the disease on the patient. When they are finished, invite a student from each team to write two clues on the board. Discuss the clues as a class. Ask for clarification or expansion of ideas where appropriate. Encourage the students to think freely and make connections based on the evidence given in the patient description as well as on their own experience. The discussion usually leads to many good ideas about the mechanism of the disease. However the students soon determine that they need to explore the disease in greater depth in order to substantiate their ideas and gain a deeper understanding of the disease. Pre-lab Exploration (40-50 minutes)

To assist the students in their investigation, set up the four stations described below. Each station is comprised of manipulatives that in some way model or illustrate concepts relating to the mechanism of the disease. Give each team descriptions of the stations (Station Sheets) that include directions that encourage exploration. Urge the students to gather observations that may yield insights to the mechanism of the disease. It is helpful to assign the roles of “reader” and “recorder” at each station to facilitate cooperation among team members. Rotate each team through stations A, B, C and D, allowing about ten to fifteen minuets per station.

Mystery of the Crooked Cell: Pre-lab Activities 3

Set up each station as follows:

Station A: Four microscopes with prepared slides of sickle cell blood and normal blood Station B: Y connectors, clay models of normal and sickled red blood cells Station C: One balloon model of a cell with normal hemoglobin and one of a cell with sickle cell

hemoglobin in red blood cells. Station D: Pedigree and pedigree symbol key (Station D sheet).

Pre-Lab Explanation (20-30 minutes)

Collect and display the data and ideas collected by the class by putting four pieces of newsprint around the room and labeling them A, B, C, and D respectively. Have each team write their observations for each station on the newsprint, using a different colored marker for each team. If another group already writes an idea or observation, students need not repeat it. In this manner, all the observations are recorded and each group is required to read the observations of the other groups. At this junction we find it helpful to ask the students to consider the information the class has collected at the stations and to reflect individually in writing on the essential question, “What is the mechanism of the disease?” Individual reflection gives each student time to collect and organize their thoughts in preparation for group discussion. After individual reflection, ask the members of each team to regroup and synthesize an explanation for the mechanism of the disease. Next ask teams to present their explanations to the entire class. Encourage students to be creative in their presentations by giving them the option to present verbally, in writing, with diagrams or concept maps, or by using role-play. Students often generate many ideas and interesting topics for discussion. Encourage the students to debate their ideas and consider them in light of the observations they made. The discussion frequently becomes lively with considerable student-student dialogue. Challenge and elaborate on students’ ideas to lead them to discover the following points:

1. The blood cells are irregularly shaped. 2. The irregular shape of the red blood cells interferes with ability to flow through the blood

pathways. 3. The hemoglobin units connect to each other when oxygen concentrations in the blood are

low resulting in abnormally shaped blood cells. 4. The condition is inherited.

Refer to the stations to assist the students’ discovery of the above points. Demonstrate the cause of sickling using the models form station C. The blockage created by the sickled cells is illustrated in station B while the prepared blood slides at station A indicate anemia and irregularly shaped red blood cells. The family history suggests the possibility that the condition is inherited. At this point, the students are usually curious about the name of the disease. Let them generate their own name for the condition based on their understanding of it and emphasize that their name is just as valid as the name given by Dr. Herrick. He based the name on his observations of sickle shaped cells and the decrease in the number of red blood cells or anemia.

Mystery of the Crooked Cell: Pre-lab Activities 4

Characterization of Sickle Cell Anemia Event Flow Chart Ask the students to make a concept map depicting what they learned today about sickle cell anemia such as the one shown below.

SICKLE CELL

M

Transmitted through

INHERITANCE

ANEMIA

BROCH

o

ystery of the Crooked Cell: Pre-lab Activitie

Is characterized

ABNORMAL HEMOGLOBIN

o

LOW O

g

KEN AINS

CHA

s

Which Reacts t

Causing the Hemoglobin to form

XYGEN

SICKLED CELLS

INS

o

Causin

Which contributes t
Which contributes t
BLOCKED CAPILLARIES

5

Laboratory Explanation The purpose of the laboratory component is to apply the concepts developed in the pre-lab to a clinical test for sickle cell anemia using gel electrophoresis. The objectives of the laboratory component area as follows:

To perform gel electrophoresis to distinguish normal hemoglobin from sickle cell hemoglobin. ��

��

��

To interpret the results of gel electrophoresis. To demonstrate the concept and process of gel electrophoresis

Before proceeding with the laboratory investigation, it is necessary to make a logical connection to the concepts developed in the pre-lab. In doing so, the laboratory component becomes a tool in the continuum of an ongoing problem rather than an isolated end in itself. The transitional activity that follows links the pre-lab concepts to the ensuing laboratory investigation. With the understanding of sickle cell anemia generated by the pre-lab, ask the students to consider ways to test for the disease. A common response is to examine the blood and look for signs of anemia or sickled cells. Anemia however, is not unique to sickle cell anemia nor are the blood cells necessarily sickled unless the patient is in crisis. Furthermore, thalassemic blood samples frequently look very similar to sickle cell blood samples (thalassemia is a hemoglobin disorder associated with the defective synthesis of hemoglobin). Since hemoglobin is the molecule affected by the disease; the conclusion is to observe the diseased or affected hemoglobin for characteristics that would distinguish it from normal hemoglobin. Developing the concept for the test The next goal is to help the students realize the conceptual basis of the test that distinguishes normal hemoglobin from affected hemoglobin. Raise the question by holding up a tube containing a sample of hemoglobin and ask whether they can identify it as normal or abnormal (Use red food coloring and water to create a light rust color which simulates the color of both normal and affected hemoglobin for this demonstration). The students realize that they first need to see what a normal hemoglobin sample looks like in order to identify whether the unknown is normal. Place control samples of normal hemoglobin and abnormal hemoglobin next to the unknown sample. Again ask whether they can identify which sample is normal and which is affected by visually comparing the three samples of hemoglobin. The samples look exactly alike. Therefore a tool is to distinguish hemoglobin samples that look identical but have different properties. The tool, electrophoresis, becomes the laboratory component of the investigation. Electrophoresis role-play A role-play is used to demonstrate the theory behind electrophoresis. Have two groups of three students come to the front of the room. Each group represents a hemoglobin protein and each person represents an amino acid. Note that both molecules have the same number of amino acids and are, therefore, the same size. Give each student a card with a number representing a charge of -1 or 0. To one group assign two -1 charges and one 0 charge. To the other group give two people 0 charges and one person a -1 charge. Consequently one group has a net charge of -2 and the other group has a net charge of -1. Point out that the difference in overall charge between the two molecules cannot actually be seen with the naked eye. However the charge difference does make the hemoglobin react differently in an electric field. Illustrate this concept by telling the class to imagine the classroom as an electrical field with the positive pole at the back of the room and the negative pole at the front of the room. In an electrical field, the negatively charged hemoglobin molecules migrate toward the positive pole. The group with a net

Mystery of the Crooked Cell: Laboratory Explanation 6

charge of -2 will move more quickly because it has a greater negative charge drawing it toward the positive pole. Pretend to turn on the electricity and have the two groups of students migrate as the molecules would. The groups can be distinguished by their different rates of migration with respect to their net negative charge. To check student understanding, have them predict and demonstrate the migration if the molecules both had a charge of -2. The laboratory investigation: Protein electrophoresis (Solution and sample preparations are given “Laboratory Preparation”) The laboratory component incorporates the same concept as described above. Each student receives three samples of hemoglobin:

1. The patient 2. Normal hemoglobin 3. Sickle cell hemoglobin.

The patient sample may represent sickle cell hemoglobin, normal hemoglobin, or both in the case of a carrier. The samples of hemoglobin are put into an electrical field and the rates of migration compared. Procedures vary depending on the electrophoresis system used. General instructions are as follows: ��Prepare a 1.3% agarose gel

Dissolve by heating the appropriate amount of agarose in the electrophoresis buffer and cast the gel. Introduce the function of the gel by comparing it to a track that provides a matrix for the migration of the hemoglobin. The wells act as a starting gate while the gel itself holds the hemoglobin and helps us visualizes it.

��Prepare the gel electrophoresis box

Orient the gels in the electrophoresis box with the wells at the negative pole. Slowly pour the hemoglobin electrophoresis buffer into the electrophoresis box. Fill the electrophoresis box until the gels are covered with a 2 to 3 mm layer of buffer.

��Load the samples

Put 15µl of the patient sample, 15µl of a normal hemoglobin, and 15µl of sickle cell hemoglobin into separate wells. You can make the patient sample normal, sickled or carrier for each gel. Create a mixture of patient samples for each class so students can compare the results.

��Electrophoresis

Connect the cables and run the gels at 100 volts until the bromphenol blue dye has migrated about 30 mm from the wells.

Mystery of the Crooked Cell: Laboratory Explanation 7

Interpretation: Results will vary. Some patient samples will display two bands representative of sickle cell trait, others will be positive for sickle cell anemia, while some will be negative for sickle cell anemia. The bands on the gel representing sickle cell trait usually present as one large band with the leading edge in line with normal hemoglobin and the trailing edge in line with affected hemoglobin. Students write their analysis in a notebook with evidence to support their results. Schematic representation of hemoglobin gel electrophoresis results Negative Patient 1 positive

N

P

N = Normal P = Patient Negative Patient 2 Positive

N

P

N = Normal P = Patient

Mystery of the Crooked Cell: Interpretation 8

Negative Patient 3 Positive

N

P

N = Normal P = Patient To facilitate discussion, choose a representative gel of each outcome and put the gels on the overhead projector. Highlight the bands projected on the board with a marker. Some sample questions for discussion include: What can be inferred from the results of the test? How can the presence of two bands in some patient samples be explained?

Mystery of the Crooked Cell: Interpretation 9

Laboratory Preparation

Ordering Information Item Company Phone No. Catalog

No. Quantity Price

(As of 8/26/02) Hemoglobin A* Sigma (800) 325-3010 H0267 100 mg $104.05

Hemoglobin S* Sigma (800) 325-3010 H0392 100 mg $119.70

Glycine Sigma (800) 325-3010 G7126 5 kg $141.80

Tris American Bioanalytical (800) 443-0600 AB02000-01000 1 kg $56.71

Glycerol Sigma (800) 325-3010 G7893 500 ml Contact sales representative

Bromphenol blue Sigma (800) 325-3010 B3269 5 mL $9.25

Agarose VWR (800) 932-5000 IB70042 100 g $110.00 *Occasionally, Sigma is out of stock of hemoglobin and it takes several months to manufacture, so please predict your needs and order early. Sample Preparation Hemoglobin Samples

1 Prepare 500 mL of 1.5M Tris, pH=9.2

1.1 Weigh out 90.86 g of Tris and place in a 1 L beaker

1.2 Add approximately 400 ml of dH20 to the beaker

1.3 Add magnetic stir bar and mix on stir plate until dissolved

1.4 Measure pH and adjust until pH is 9.2 (using HCl)

1.5 Pour into a 500 ml graduate cylinder and add dH20 until final volume is 500 ml

1.6 Pour into a 500 ml bottle, label, and use as needed

Note: This solution will last several months. Therefore, it is recommended that the solution be autoclaved or filtered in order to keep it free of contaminants (and remain sterile). By doing this you will avoid remaking this solution every time you run out of hemoglobin.

2 Resuspend Hemoglobin

2.1 Dissolve 100 mg of HgA and/or 100 mg HgS in 5 ml of 1.5M Tris, pH = 9.2

Note: Hemoglobin is purchased in 100mg aliquots. Add 5 ml 1.5M Tris, pH = 9.2 directly to the bottle the hemoglobin was shipped in and gently swirl to mix. Make five-1 ml aliquots and freeze at -20oC. This will reduce the number of times the hemoglobin has to be handled.

Mystery of the Crooked Cell: Laboratory Preparation 10

3 Prepare 2X Sample Dye by mixing the following:

3.1 Glycerol 8ml 3.2 1.5M Tris, pH = 9.2 4ml 3.3 Deionized H2O 28ml 3.4 Bromphenol Blue 0.01g

Note: Store at 4oC

4 Prepare Hemoglobin Sample Mixes:

HgA HgA/S HgS 1.5 M Tris, pH 9.2 270µl 230µl 270µl 2X Sample dye 500µl 500µl 500µl HgA 230µl --- --- Hgs --- 230µl 230µl Note: This will make approximately 50 aliquots of each type.

4.1 Aliquot Hemoglobin Samples

4.1.1 Label microcentrifuge tubes “N” and “P” 4.1.2 Into tubes labeled “N” add 18µl of HgA mix 4.1.3 Into tubes labeled “P” add 18µl of either HgA, HgA/S, HgS mix

Note: Each student will load 15µl of Sample “N” and 15µl of Sample “P”. Sample “N” is the normal control and Sample “P” is the patient they are testing. Patient samples should be distributed amongst the students so that all results (normal-HgA, carrier-HgA/S, and sickle-HgS) will be represented.

Electrophoresis Buffer 1 Prepare 10X Buffer Stock

1 liter 2 liters Tris 160 g 320 g Glycine 72 g 144 g

1.1 Weigh out Tris and Glycine for either 1 liter or 2 liters according to chart below and place

into a flask 1.2 Add approximately 700 ml (or 1400 ml if preparing 2 liters) of dH2O 1.3 Add magnetic stir bar and mix on stir plate until dissolved 1.4 Pour into a 1 liter (or 2 liters) graduated cylinder and add dH20 until final volume is 1

liter (or 2 liters) 1.5 Pour into a storage jug labeled accordingly

Note: This buffer can be stored indefinitely at room temperature 2 Dilute 1X Working Stock

2.1 Add 2 liters of 10X stock to an empty 20 liter carboy 2.2 Add dH20 to 20 liter “fill line” for a final volume of 20 liters 2.3 Shake very well 2.4 Label student bottles “Hemoglobin Electrophoresis Buffer” 2.5 Fill Student bottles with 500 ml of 1X Working Solution


Note: Do not prepare 1X-working solution in 20-liter carboy until carboy is completely empty. Other volumes may be prepared as needed. This buffer can be stored indefinitely at room temperature.

Laboratory Station Set – up

Set p20s at 15µl – please leave in racks ��

��

��

��

��

��

��

��

��

��

��

��

��

��

��

Pipette aid 10 ml pipette 2 test tubes in glass beaker spatula gel mold 2 combs 2 glass plates gel box buffer yellow tips practice gel practice loading dye manual 2 data/observation sheets

Preparation of the gel

If available, use E-gels to run the samples. E-gels are convenient pre-prepared agarose gels that come with blue stain or ethidium bromide. Follow the manufacturer’s recommendations for loading and running the gels. If Eels are not available, prepare a one percent agarose gel by combining 1 g of agarose for every 100 mL of 1X TAE. Heat in a microwave until the agarose has completely dissolved. Add ethidium bromide if that is the stain the class will use (10 mg/mL) to a final concentration of 0.2 �g/mL and mix. If methylene blue will be used to stain the gel (see step 5), do not add ethidium bromide to the agarose. Allow the agarose to cool to approximately 55 �C. Prepare and seal the ends of the gel mold according to the manufacturer’s instructions. Also position the desired comb to cast the wells. Pour the cooled, liquefied agarose into the gel mold and allow it to solidify. Gels should be 5 –0 8 mm thick. After the gel has solidified place it in the electrophoresis chamber and carefully remove the comb. Add a sufficient volume of the 1X TAE buffer used to make the gel to the electrophoresis chamber to cover the gel by 1 – 2 mm.


Extension Activities

Discussion Topics The investigation can serve as the centerpiece for a variety of topics to be explored further: Central dogma Using the amino acid sequence of the affected and normal hemoglobin, the students can identify the mutation from glutamate to valine that results in the change in net negative charge of the affected hemoglobin. Working back through the central dogma, they can identify the point mutation in the DNA resulting in the amino acid alteration. Inheritance Genotypes can be derived from the phenotypic results expressed on the gel and the probability of inheriting sickle cell anemia can be predicted given the genotypes of the parents. Natural Selection The sickle cell allele is more prevalent in races whose gene pools originate in tropical areas. People of African, Asian, and Hispanic-Caribbean descent have a higher incidence of sickle cell anemia. Selective pressure for the allele results from its ability to decrease the mortality rate of people infected with malaria. Malaria is caused by a protoctist in the genus Plasmodium, which is transmitted to human hosts by mosquitoes. Plasmodia infiltrate red blood cells where they multiply and eventually rupture the cell. Cells with sickle cell hemoglobin are less susceptible to infection by Plasmodia. Therefore carriers (heterozygotes) benefit from the presence of sickle cell hemoglobin while remaining largely asymptotic (some heterozygous individuals may show mild symptoms) with respect to sickle cell anemia. Random mutation/Selective Pressure Interestingly, plasmodium did not infect humans 10,000 years ago. It was an avian pathogen. However, a mutation in plasmodium enabled it to jump species and infect humans. Ask the students whether they think anyone could have had sickle cell anemia prior to 10,000 years ago. It often leads to a discussion concerning random mutations and the distinction between a Lamarkian and Darwinian perspective on evolution. Treatments Ask the students how they would treat sickle cell anemia based on their knowledge of the disease. Bone marrow transplants, blood transfusions, and gene therapy are often mentioned. Recently attention has been given to turning on the fetal hemoglobin gene, which is turned off shortly after birth. Hydroxyurea, which has been used to treat cancer and blood disorders, has been found to stimulate the production of fetal hemoglobin. Suggested Extension Activities

�� Have the students write a letter to the fictional patient explaining the results of the test and the precautions the patient may want to consider taking.

�� Use the documents at the end of the student section titled A Closer Look at the Cause of Sickle Cell Anemia. This activity shows students how the sickle cell trait is determined at the genetic level.

�� Sickle cell anemia is an example of one genetic condition for which there is a test but no cure. Have groups of students research other inherited conditions for which there is a test but no cure, for example; cystic fibrosis, Huntington’s disease, muscular dystrophy, and fragile x syndrome. Each group can make an informative display about the disease. The display could be in the form of a poster, mobile, booklet, radio broadcast, interview, role-play etc. After each group has made

Mystery of Crooked Cell: Extension Activities 13

a presentation about the disease, create a role-play in which a genetic counselor presents a scenario, for example:

Both parents are carriers for sickle cell anemia, cystic fibrosis, or any recessive disorder. The couple decides whether or not to try to have children. One spouse’s parent has been diagnosed with Huntington’s disease. The couple has two young children. The counselor asks whether they want to be tested. The role-plays can lead to interesting discussions among the students. The teacher can facilitate by writing down ideas and issues on the board as they come up.

Suggested readings:

�� Pelehach, Laura. (1995).Understanding Sickle Cell Disease. Laboratory Medicine (26), 720-725

�� Ogamdi, S. and White, G. (1993).Sickle Cell Disease. Clinician Reviews (February), 65-82.

�� The Sickle Cell Information Center: www.emory.edu/PED/SICKLE/news.htm

Mystery of Crooked Cell: Extension Activities 14

http://www.emory.edu/PED/SICKLE/news.htm

STUDENT ACTIVITY HANDOUTS &

LABORATORY PROTOCOL

Patient Description

In 1904, a student from the West Indies came to a Chicago Physician, Dr. James Herrick, with a puzzling condition. Below is a summary of some of the observations Dr. Herrick made. Your job is to learn more about this condition and to find out how the disease affects the body. Read the description below and underline the information that you think may provide important clues that will help you understand the disease.

The patient reports feeling well most of the time. But he also reports odd reoccurring events. For instance, one day after a short swim he became so tired that he could hardly move. He became short of breath and complained of pain in his joints and muscles, especially the arms and legs. He felt unusually weak and required bed rest lasting a few weeks. These symptoms occurred repeatedly during his youth. He also had frequent fevers and infections. The patient complained of fatigue and soreness in the joints. Upon inspection, the whites of his eyes had a yellowish tint. He complained of pain in the left abdominal area, which was tender to the touch. A family history reveals that he has two brothers and three sisters. None of them have this condition. His uncle and his grandmother often had similar symptoms. His grandmother died a young woman. His parents do not have this condition.

James Herrick

Patient Description

Recorder_________________________

Reader___________________________

Station A At this station you will use a microscope to observe blood samples magnified 1000X. The slide marked P represents the patient’s blood sample. The slide marked N represents a normal blood sample. Describe (in writing or pictures) the differences you see between the two blood samples.

Station A Guide Sheet

Recorder__________________________

Reader____________________________ Station B The tubing at this station represents the pathways of blood in the body. Models representing the patient’s red blood cells are also given. Red blood cells must flow freely through the body in order for the blood to do its job of delivering oxygen and picking up wastes. Use these models to show the effect the patient’s red blood cells will have on the flow of blood.

Station B Guide Sheet

Recorder________________________________

Reader__________________________________

Station C At this station you will be given two sets of models. Each model represents a blood cell. One model represents a patient’s blood cell and is labeled “P”. The other model represents a normal blood cell and is labeled “N”. The pieces inside the blood cells represent blood proteins called hemoglobin. Hemoglobin is the oxygen-carrying component of blood. This model uses only a few pieces to represent the millions of hemoglobin units found in real blood cells. Scientists have discovered that abnormal hemoglobin units connect with one another when oxygen levels in the blood are low. Use these models to investigate what happens to the shape of red blood cells with abnormal hemoglobin when the oxygen levels in the blood are low. Record your results below.

Station C Guide Sheet

Recorder____________________

Reader______________________ Station D Based on the family history given below, how do you think the patient got the disease? Record your answer on the back or this page. I II III IV

Patient Key to symbols Male Female Deceased Male affected Female affected Parents Offspring

Station D Guide Sheet

Laboratory Protocol 1 Loading Samples

1.1 Use a micropipette (p20) to put 15µl of hemoglobin from sample N into a well. Keep a record of the well you put sample N into on your data sheet.

1.2 Use a micropipette (p20) to put 15µl of hemoglobin from sample P into a well. Keep a

record of the well you put sample P into on your data sheet. 1.3 Follow the instructor to begin electrophoresis of your samples.

2 Removal of the gel from the electrophoresis box

Wait for an instructor to demonstrate removal of the gel and clean up.

2.1 Turn the power off. 2.2 Disconnect the cables and return them to the bag. 2.3 Open the lid of the electrophoresis box. 2.4 Gently lift the casting tray and the gel out of the box. 2.5 Hold the clear plastic bag provided at your lab bench and label the top of the bag with

your initials (your partner should do the same with the other bag). 2.6 Slide the gel off the casting tray into the plastic bag.

3 Analysis of the gel

3.1 Observe the banding patterns on your gel and record the results on your data sheet. 3.2 What is your conclusion? Write your answer on your data sheet.

Laboratory Protocol

Name_________________________ Test Tube Number_______

Mystery of the Crooked Cell: Data/Observation sheet

Preparation of the Agarose Gel 1. What is the function of the agarose gel?

2. Predict what would happen if you used 0.02 g of agarose instead of 0.2 g. What effect would that have on your experiment?

3. What is the function of the comb?

Preparation of the Gel Electrophoresis Box 1. Predict what would happen if you put the agarose gel at the opposite pole?

2. Why is the gel in the electrophoresis buffer? 3. Describe what is occurring in the gel when the electric current is applied.

4. What must you be careful of when loading the samples into the wells?

5. Diagram the final results as they would appear on the gel if the patient (sample P) has sickle cell anemia.

Data/Observation Sheet

6. Diagram the expected results if the patient (sample P) does not have sickle cell anemia. Use the diagram below to:

�� Record where you loaded each sample. �� Record the results of the electrophoresis (sketch the results)

Conclusion

1. What is the purpose of sample N (normal hemoglobin)? 2. What do your results tell you about the hemoglobin in sample P?

3. If sample P came from a person who you were testing for sickle cell anemia, what would your diagnosis be?

4. How would you explain the test results to the patient? Assume the patient does not know how the test works.

Data/Observation Sheet

A Closer Look at the Cause of Sickle Cell Anemia Your research has determined that sickle cell hemoglobin differs from normal hemoglobin in the net negative charge on the proteins. This discovery is an important one; it identifies a characteristic that can be used to diagnose sickle cell anemia. However, it does not tell us what causes sickle cell anemia or why the proteins are different. Advances in molecular biology and our understanding of DNA in the past two decades have provided us with more insights into the cause of sickle cell anemia. See if you can use the following data obtained from research in molecular biology to uncover more information about sickle cell anemia. Document 1: The DNA base sequences of the first seven amino acids for both normal and sickle cell

hemoglobin. Document 2: A chart of mRNA codons and their corresponding amino acids. Document 3: The structural formulas for the amino acids and their corresponding charges.


Document 1 The DNA base sequences of the first seven amino acids for normal and sickle cell hemoglobin.

The DNA sequence of bases for the first 7 amino acids in normal hemoglobin is: CACGTGGACTGAGGACTCCTC The DNA sequence of bases for the first 7 amino acids in sickle cell hemoglobin is: CACGTGGACTGaGGACACCTC


Document 2 A chart of mRNA codons and their corresponding amino acids

5’ End T C A G 3’ End

Phe Ser Tyr Cys T

Phe Ser Tyr Cys C

Leu Ser Stop Stop A

T

Leu Ser Stop Trp G

Leu Pro His Arg T

Leu Pro His Arg C

Leu Pro Gln Arg A C

Leu Pro Gln Arg G

Ile Thr Asn Ser T

Ile Thr Asn Ser C

Ile Thr Lys Arg A A

Met(Start) Thr Lys Arg G

Val Ala Asp Gly T

Val Ala Asp Gly C

Val Ala Glu Gly A T

Val Ala Glu Gly G

SECOND BASE OF CODON

THIR

D BA

SE OF C

OD

ON

FIR

ST B

ASE

OF

CO

DO

N


Document 3 The structural formulas for the amino acids.
