Virology 487 (2016) 207–214

Contents lists available at ScienceDirect

Virology

http://d0042-68

☆TheCpz1cl2Cpz2cl2sequenc

n CorrFacultyences, B

E-m

journal homepage: www.elsevier.com/locate/yviro

New species of Torque Teno miniviruses infecting gorillasand chimpanzees$

Kristýna Hrazdilová a,b,n, Eva Slaninková a,c, Kristýna Brožová a,c, David Modrý b,c,e,Roman Vodička d, Vladimír Celer a,b

a Department of Infectious Diseases and Microbiology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno,612 42Brno, Czech Republicb CEITEC – Central European Institute of Technology, University of Veterinary and Pharmaceutical Sciences Brno,612 42 Brno, Czech Republicc Department of Pathology and Parasitology, Faculty of Veterinary Medicine, University of Veterinary and Pharmaceutical Sciences Brno,612 42 Brno,Czech Republicd The Prague Zoological Garden, Prague 171 00, Czech Republice Biology Centre, Institute of Parasitology, Czech Academy of Sciences, Branišovská 31, 37005 České Budějovice, Czech Republic

a r t i c l e i n f o

Article history:Received 24 June 2015Returned to author for revisions12 October 2015Accepted 15 October 2015Available online 4 November 2015

Keywords:AnellovirusTorque Teno mini virusGreat apesNon-human primatesGenome sequence

x.doi.org/10.1016/j.virol.2015.10.01622/& 2015 Elsevier Inc. All rights reserved.

GenBank accession number for the Cpz1cl1 ssequence is KT027936, for the Cpz2cl1 seqsequence is KT027938, for the GorF sequencee is KT027940, and for the GorMcl4 sequenceesponding author at: Department of Infectiouof Veterinary Medicine, University of Veterinrno 612 42, Czech Republic. Tel.: þ420 604 2ail address: kristyna@hrazdilova.cz (K. Hrazdi

a b s t r a c t

Anelloviridae family is comprised of small, non-enveloped viruses of various genome lengths, highsequence diversity, sharing the same genome organization. Infections and co-infections by differentgenotypes in humans are ubiquitous. Related viruses were described in number of mammalian hosts, butvery limited data are available from the closest human relatives – great apes and non-human primates.

Here we report the 100% prevalence determined by semi-nested PCR from fecal samples of 16 captiveprimate species. Only the Mandrillus sphinx, showed the prevalence only 8%. We describe three newspecies of gorillas' and four new species of chimpanzees' Betatorqueviruses and their co-infections in oneindividual. This study is also first report and analysis of nearly full length TTMV genomes infectinggorillas. Our attempts to sequence the complete genomes of anelloviruses from host feces invariablyfailed. Broader usage of blood /tissue material is necessary to understand the diversity and interspeciestransmission of anelloviruses.

& 2015 Elsevier Inc. All rights reserved.

Introduction

Despite the 18 years from the first description of anellovirus inprimate species – humans, very little is known about their originand limited data are available from the closest human relatives –

great apes and non-human primates. First member of new, cur-rently unassigned family Anelloviridae was described in 1997 inJapanese patient with acute post transfusion hepatitis and wasnamed human TTV (following the TT initials of index case patient,lately termed Torque Teno virus) (Nishizawa et al., 1997). TTV is asmall, non-enveloped virus carrying negative, single-strandedDNA genome of approximate length of 3.8 kb (Mushahwar et al.,

equence is KT027935, for theuence is KT027937, for theis KT027939, for the GorMcl3is KT027941.s Diseases and Microbiology,ary and Pharmaceutical Sci-14 439.lová).

1999). Subsequently shorter analogs sharing the same genomeorganization were described in humans - TTV-like mini virus(TTMV) (Takahashi et al., 2000) with the genome length of about2.9 kB and lately torque teno midi virus (TTMDV) with genomelength of about 3.2 kb (Jones et al., 2005).

All anelloviruses share the genomic organization with three over-lapping open reading frames (ORF1 to 3) and short GC rich sequencein the most conserved untranslated region. The expression profile ofanelloviruses is not fully characterized, but the work of Qiu et al.shows that following transfection of human 293 cells at least 6 TTVproteins were produced by alternative splicing of three differentmRNAs (Qiu et al., 2005). Further molecular characterization of anel-loviruses as gene expression and protein functions remains poorlyunderstood.

In humans, prevalence up to 100% and dual or triple infectionby different species was published (Hussain et al., 2012; Ninomiyaet al., 2008; Pinho‐Nascimento and Leite, 2011), however so farwithout apparent association with any disease.

TTV analogues were first detected in farm animals, New Worldmonkeys, macaques and chimpanzees (Cong et al., 2000; Leary et al.,1999; Okamoto et al., 2000a; Verschoor et al., 1999). Later authors

K. Hrazdilová et al. / Virology 487 (2016) 207–214208

(Kapusinszky et al., 2015; Thom et al., 2003) confirmed the presenceof anelloviruses in great apes other than chimpanzees (gorillas andorangutans) and Old World monkeys (drills, mandrills, mangabeysand African green monkeys). Beside complex work on Chlorocebussabaeus (Kapusinszky et al., 2015), only short parts of genome(mostly from conserved untranslated region) from sera samples weredetected and analyzed. The reported genome sizes in non-primateanimals are in general smaller than for the human variants rangingfrom 2019 nt in cats to 2878 nt in pigs (Biagini et al., 2007; Inamiet al., 2000; Ng et al., 2009b; Okamoto et al., 2002, 2001, 2000a,2000b; Van den Brand et al., 2012). Besides humans, chimpanzeesare so far the only reported hosts infected by anelloviruses of variousgenome lengths (assigned to genera Alphatorquevirus, Betatorquevirusand Gammatorquevirus).

In this study, we examined presence and determined pre-valence of TTV-like viruses in fecal samples of 17different Africanprimate species in Czech and Slovak zoos. We also describedalmost full length genomes of two different species of TTMV co-infecting wild-born, captive living gorilla male and one captiveborn gorilla female and also coding sequences from two captiveborn chimpanzees. We reported TTV-like virus infection and pre-valence in all 17 studied African primate species and first char-acterized gorilla's analogue of TTMV. The elucidation of host rangeand characterization of genome sequences of TTV-like virusescontribute to understanding of origin, evolution, and interspeciestransmission potential of anelloviruses.

Results

To establish the prevalence of anelloviruses of captive Africannon-human primate species in 12 Czech and one Slovak zoos, fecalsamples were collected. In total 153 samples from 17 differentspecies were screened using semi-nested PCR for anellovirusdetection from which 136 samples were positive. The prevalencerates range from 75 to 100% in all tested species (Table 1) with theonly exception of Mandrillus sphinx where only single sample from12 was positive (8.3%). Specificity of PCR reaction was confirmedby sequencing of 35 randomly chosen amplification products fromrepresentative primate species. Nucleotide sequence analysisshowed high variability out of the primer binding sites and

Table 1Anellovirus prevalence in NHP species based on semi-nested PCR targeting theconserved UTR; species in which anelloviruses were described for the first time arein bold.

+/all % Prevalence at thegenus level

Gorilla gorilla 10/10 100.0Pan troglodytes 25/25 100.0Thercopithecus gelada 5/5 100.0Mandrillus sphinx 1/12 8.3

Papio anubis 4/4 100.0 100.0Papio hamadryas 18/18 100.0

Chlorocebus sabaeus 13/13 100.0

Colobus guereza 10/12 83.3 88.9Colobus angolensis 6/6 100.0

Erythrocebus patas 9/10 90.0Lophocebus aterrimus 4/4 100.0

Cercopithecus campbelli 4/4 100.0 87.0Cercopithecus diana 8/9 88.9Cercopithecus neglectus 6/8 75.0Cercopithecus mitis 2/2 100.0

Miopithecus ogouensis 5/5 100.0Macaca sylvanus 6/6 100.0

confirmed common co-infection by several annellovirus species inone individual (Supplementary file 1).

The DNA extracted from the whole blood/serum samples offourteen NHPs was also used for the detection of anelloviruses bynested PCR. Except one guereza sample, all other tested DNAswere anellovirus positive. Using this DNA as template, the entiregenomic sequence of anelloviruses from only 4 samples could beamplified by PCR with the further described inverted primers. Thestrongest PCR signal of anellovirus genome was found to beapprox. 2.8–2.9 kb in size (in two gorillas’ and two chimpanzees’samples), weaker signal was also detected in approx. size of 4 kb insome samples. Remaining nine blood/serum samples did notprovide any PCR product in whole genome amplification. The 2.8–2.9 kb PCR product for each sample was molecularly cloned andseven TTV clones (GorF; GorM-cl3 and cl4; CPZ1-cl1 and cl2; andCPZ2-cl1 and cl2) were sequenced over the entire coding part ofthe genome. Missing UTR part between primers was amplified andsequenced for both clones of GorM and one clone of GorF samplesresulting in first almost complete gorilla infecting anellovirusgenomes. According to the genome length and phylogenetic ana-lysis ( Fig. 2, Supplementary file 2) all newly described anello-viruses infecting gorillas and chimpanzees were classified to thegenus Betatorquevirus.

Gorilla TTMV

Anelloviruses infecting gorillas share the common genome lengthand structure including UTR as most conserved region, GC rich regionand major ORF (so called ORF1 coding putative capsid protein)spanning 1992 nt, 1995 nt and 2025 nt respectively. The nearly fulllength gorillas' TTMV genomes were obtained due to difficulties tosequence the GC rich part of anellovirus' genomes. The length ofobtained sequences was 2851 nt for GorM cl3, 2856 nt for GorM cl4and 2568 nt for GorF, which corresponds to the length of anellovirusmini genomes wihout GC rich domain in humans and other pri-mates. The three genomes displayed overall organization of anello-viruses, with main ORFs in the same orientation; nevertheless theydiffered in the number of these major ORFs.

Transcribed region of the genomes encompassed TATA-box(TATAA) which was recognized 100–160 bp before the startcodon of the first ORF and ended by polyadenylation signal(ATAAA) detected 110–120 nt following stop codon of ORF3 pro-tein. The complete sequence of GC rich regionwas not obtained fortechnical reasons. Anyway 40 nt long fragment of GC rich stretchidentified in GorM cl3 genome had the GC content of 84%.

The largest ORF was 1992 nt, 2025 nt and 1995 nt long in GorMcl3, GorM cl4 and GorF respectively. Based on the similarity withother known anelloviruses, ORF1 is most likely coding putativenucleocapsid protein. The similarity of ORF1s is ranging from 53 to65% at nucleotide and from 38 to 54% at amino acid level (Table 2).All of them also contained nuclear localization signals detected byboth cNLS Mapper (Kosugi et al., 2009) and NLStradamus (Nguyenet al., 2009). Arginine rich region at the beginning of ORF1 genewas also found ranging from 22 to 25 arginine residues in first 50amino acids.

ORF2 partially overlapped the ORF1 and resulted in 348 nt (GorMcl3 and GorF), and 342 nt (GorM cl4) long reading frames. TTV/CAV-common motif WX7HX3CXCX5H described previously (Jazaeri Far-sani et al., 2013; Takahashi et al., 2000), was found in the ORF2 of thenew gorilla TTMV described here (CX7HX3CXCX5H) at the aminoacid positions 25–45 of GorM cl4, 19–39 of GorF and degenerated inone position to the sequence CX7HX3RXCX5H in positions 22–42 ofGorM cl3.

Finally, ORF3 overlapping with 3' terminus of ORF1 was foundin GorM cl3 (495 nt) and GorF (504 nt) genomes only. In agree-ment with previously described sequences, in both cases the ORF3

71 160| CVOS |

TTV TATA box 5’TRCACWKMCGAATGGCTGAGTTT 3’Human-1 GGGTCTACGTCCTC ATATAA GTAAG TACACTTCCGAATGGCTGAGTTT -TCCACGCCCGTCCGCAGCGGTGAAG-------CCACGGAGGGA--GATCACHuman-2 ........A....A ...... ....C .G..................... -...............G...AGA.CA-------..........G--AG..CGHuman-3 T.........G..G ...... AGCG. .G..................... -.T.................AGATC.-------.G...C...AG--CGATCGHuman-4 T.TC..C.CA.TGA ...... .C..C AG.GG.GA.......TA...... -.TTC...............AG..C.------CGAG..C..C..G-CGG.CGHuman-5 T...T...A..... ...... C...C .G..................... -...............G.A.AG..G--------......CA.CG--....CG

CPZ-1 ..A...T.CCGGC. ...... C..GC .G..................... -ATGC.............AC.GAG--------GAGG..CT.CCGC-CGA.CGCPZ-3 T...T..T.AAACT ...... C.G.C .G..................... -ATGC................GAGC.T----TGA.GG.A.CCC.A-CGG.CGMacaque ...AAA.G.G-.CA ...... .CCG. AG..................... -.T.C.C.GA.-A.....GC.A.G.CG--AACCG.G.A.CCT.GTGAG.G..

TTMDVHuman .A.A..TTTA.ACT ...... C.... .GT...GA............... -A..C...TA.-A..GT..A.A..CCGGATCGAG.G.A.C.--.GGAGGTCTHuman .A..TAC.AAA.CT ...... ....C ......GA............... -A..C...TA.-A..GT..A.G..CCGGATCGAG.G.A.C.--.GGAGGTC.CPZ .A..T.CAC.TTCT ...... C...C AG..................... T..GC...TT.-A..GT....A.C.C--AACGAG...A.C.--.GGAGAG..

TTMVHuman .A.A.ACAC.A-CT ...A.. C.... ......GA............... -AT......A.-A..G..AC------------GG..ACACCAC.G-TGG..GHuman .TTCTACACAA-GT .....G C.... ....................... -ATGC....A.-A..A..GA------------AG..TCACTTT.G-TGA.TGCPZ .A.C.A.TCAT-CT .....T TC..C .G..................... -ATGC...TA.-A..G..A.------------AAG.TA.TC.C.G-AC.A..

GorillaM3 T..CT.TTACTTCT ...... C...C ......GA............... -ATGC....A.-A..G...T.AA..C--AACTAG.G.A.C.T-.GGCGGACTGorillaM4 CAAC.A.ACC--CT ...... C...C .......A............... -ATGC...TA.-A..G..A.------------AA...A.CA.C.G--C.GCG

161 254| CVIA CVOA |

TTV 3’CCCGCCCWCGGCYTCCAC-TC 5’ 3’TCAGWTCCCCGTTAAGCCCGA 5’Human-1 CGCG---TCCCGA GGGCGGGTGCCGAAGGTG-AG TTTACACACCGA- AGTCAAGGGGCAATTCGGGCT CGGGACTGGCCGG-GCTATGGGCAAGGCTCTGHuman-2 ....---.....T ..................-.. ............- ....................A ..........T..-.................THuman-3 A...---...... ............G.....-.. ...........C- ..................... .............-.................THuman-4 A...---A....T .......A..........-.. ...........C- ..................... .............-............A....THuman-5 AA..---...T.. ............G.....-.. ............- ..................... .A...........-...T.............T

CPZ-1 ....TCG...... ........A..CG.....-.. ............- G..T................. .............-.................TCPZ-3 AC..-CG...... ........A..CG.....-.. ............- G..T................. .............-.................TMacaque .T..GCCG....T ...............CG.G.. G..TAC.C...CG ....................A A.-.G.G.T.TC.G.GACC.............

TTMDVHuman .CG.-CTG...AT .......A...CG.....-.. .GA.AC......- G...T................ A.-.G.A.T.TA.C.GA.C.......AAA..THuman .CG.-CTG...A. .......A...CG.....-.. .GA.AC......- G...T................ A.-.G.A.T.TA.C.GA.C.......AAA..TCPZ TC..-CAG.AGCT .......A....G.....-.. .GA.AC.....T- ....T...............G GC-TG.A.T.TA.C.GA.C.......AAA..T

TTMVHuman .CG.-CTGAT.TT .......A..........-.. .GA.AC......- ....T................ A.-AT.A.T.T..C.GACC.......AAA..THuman .AGA-CTGAT.TT .......A..........-.. .GA.AC.....T- ....T................ A.-AT.A.T.T..C.GA.C.......AAA..TCPZ TT..-CTGT..CT ..................-.. .GA.AC......- ..................... G.-...A.T.TA.C.GA.C.......AAA..T

GorillaM3 TCA.-CTGAG.CT ..........T.T.....-.. .GA.AC......- ....T................ G.-CGAA.T.T..A.GA.C.......AAA..TGorillaM4 TT..-CTG..AC. ........A...-.....-.. .GA.AC.....-- ..................... GA-.G.A.T.TA.C.GA.C.......AAA..T

Fig. 1. Sequence alignment showing highly conserved UTR region of anelloviruses of humans (TTVs: AF351132, AF261761, AY823988, AB064599, AJ620228, TTMDVs:AB303561, AB303555; TTMVs: AB038628, AB038629) and nonhuman primates (TTV chimpanzee: AB041957, AB049607, macaque: AB041959; TTMDV chimpanzee:AB449064; TTMV chimpanzee AB041963). Conserved regions and primers locations are indicated in boxes. Dot: sequence identity with prototype TTV sequence; dash: gapintroduced.

K. Hrazdilová et al. / Virology 487 (2016) 207–214 209

starts by alternative start codon GTG coding valine instead ofstandard ATG coding methionine. The carboxy-terminus of thisputative protein contains a serine-rich tract (15, respective 14 Serfrom last 18 amino acids) preceded by a cluster of basic aminoacids (R and K) capable of generating different phosphorylationsites (Asabe et al., 2001; Takahashi et al., 2000). Correspondingcoding region in GorM cl4 sequence spans only 180 nucleotidescoding for 60 aminoacids.

Chimpanzee TTMV

Coding part of the chimpanzee anellovirus genomes wassequenced in total of four strains originating from two animals.The length of sequenced regions was 2487–2577 nt and threemajor open reading frames were identified in all of them.

The longest ORF, designated as ORF1, corresponds by the length(1773–2007 nt) and relative position to putative nucleocapsidprotein gene identified in anelloviruses with the only exception ofCPZ2 cl2 sample where the premature stop codon forms the1350 nt long ORF thus lacking the C-terminus of coded protein.The similarity of chimpanzees' ORF1s is ranging from 53 to 68% atnucleotide level and from 39 to 60% at amino acid level (Table 2).

The arginine rich region was also recognized in three of four iso-lates in expected extent (22–25R/50 amino acids), CPZ1 cl2 lacksthe first 79 codons (237 nt) compared to cl1 isolated from thesame animal.

ORF2, partially overlapping 5'end of the ORF1, was detected in allfour isolates in length ranging from 309 to 345 nt. The conservedmotif WX7HX3CXCX5H was found in three isolates (missing in CPZ1cl2) also in conserved position from 19 to 39 amino acid.

ORF3 in chimpanzee isolates is in general shorter (ranging from321 to 393 nt) than in above described gorillas' anelloviruses.Alternative start codon GTG is found in the only isolate CPZ1 cl1,other uses the standard ATG. Serine-rich region preceded by basicamino acids is coded in three chimpanzee isolates, its absence inthe CPZ2 cl1 might be caused by shortening of ORF1 of this clone.

Discussion

The anelloviruses in Old World primates (incl. man) are furtherdivided into 3 well defined monophyletic genera (Alphatorquevirus,Betatorquevirus and Gammatorquevirus, Fig. 2) clearly separated fromthe anelloviruses from other host species; our newly described

Fig. 2. Phylogenetic tree constructed by maximum likelihood method, based on nucleotide sequence of ORF1 coding region. Left part displays overall topology of Anello-viridae family, human gyrovirus sequences were used as an outgroup; full tree view is included in Supplementary file 2. Right part shows detail of Betatorquevirus genusclade; sequences are labeled by their ncbi accession numbers; those of non-human origin are marked by prefix (CPZ–Pan troglodytes). Newly described TTMVs of gorilla andchimpanzee origin are highlighted in red. Proportion of bootstrap values from 1000 replicates is shown.

Table 2ORF1 sequence similarities (reverse p-distance) on nucleotide (bold) and amino acid level of newly described gorilla and chimpanzee species and their closest relatives(human TTMVs: AB038629, AB038630; chimpanzee TTMV: AB041963).

GorM cl3 GorM cl4 GorF CPZ1 cl1 CPZ1 cl2 CPZ2 cl1 CPZ2 cl2 AB038629 AB038630 AB041963

GorM cl3 38.1 54.1 32.4 32.8 36.0 37.4 34.5 38.2 35.6GorM cl4 52.9 38.8 43.5 39.6 48.9 47.0 43.4 42.8 42.4GorF 64.7 55.6 34.7 35.4 36.8 35.9 35.6 36.8 35.6CPZ1 cl1 51.1 60.2 53.5 59.6 41.2 42.7 37.6 38.0 42.5CPZ1 cl2 53.8 60.3 52.2 60.0 38.7 39.0 38.6 35.0 39.3CPZ2 cl1 51.4 55.8 53.4 55.8 55.3 48.5 42.5 42.1 41.3CPZ2 cl2 49.6 56.1 53.0 53.7 52.9 67.6 39.2 40.2 47.2AB038629 52.3 57.9 53.2 54.7 54.1 55.0 53.7 42.9 38.6AB038630 52.0 58.8 55.0 59.5 56.8 53.5 54.9 59.9 37.7AB041963 51.4 56.9 50.2 58.3 59.7 58.0 53.7 54.7 56.1

K. Hrazdilová et al. / Virology 487 (2016) 207–214210

anelloviruses infecting gorillas and chimpanzees were classified tothe genus Betatorquevirus. TTVs have been detected from a broadrange of biological materials (serum or blood, feces, urine, saliva,semen, tears, and milk (Catroxo et al., 2008; Goto et al., 2000; Chanet al., 2001; Inami et al., 2000; Osiowy and Sauder, 2000; Sabacket al., 1999), but invasive sampling of primates represents a challengefor safety and ethical reasons. In most cases, the feces are the onlysamples available. We collected 153 fecal samples from differentsimian species kept in Czech and Slovak zoos. Further 14 blood/serum samples were obtained in the course of anesthesia for differ-ent reasons (transportation, routine health check, wound treatmentetc.) of several animals nonrelated with sampling for virus detection.

Our data represent the first report about prevalence of anello-viruses in 13 primate species (Table 1) and short sequences of UTRfrom 11 of these species (Supplementary file 1). The prevalence ofanelloviruses in feces in most examined primate species reached

almost 100%, reflecting close contacts between captive animalscombined with supposed oro-fecal route of virus transmission(Okamoto et al., 1998). The vertical transmission of anellovirusesamong primates is improbable, given the negative results ofNinomiya et al. (2008). Interestingly, low (8%) prevalence wasrecorded in M. sphinx. Almost ubiquitous occurrence of studiedviruses in blood/sera of captive primates examined in our study iscomparable to published data reaching 80% in chimpanzees, 100%in orangutans, 63% in gibbons, 100% in mandrills and 100% inmangabeys (Thom et al., 2003).

We identified TT viruses in fecal samples based on amplifica-tion of highly conserved UTR part of the virus genome and con-firmed the results by sequencing. Several negative samples werere-assigned as positive after repeated DNA isolation/virus detec-tion suggesting the 100% prevalence in all examined primatespecies with the exception of mandrills. Our attempts to classify

Fig. 3. Conserved motif WX7HX3CXCX5H in (A) anellovirus ORF2 sequences (for accession numbers see the Fig. 1 legend); (B) Chicken anemia virus and human gyroviruses;(C) herpesviruses of primate origin (ncbi accession numbers: human HV5 AY446894, panine HV2 AF480884, macacine HV3 NC_006150, macaque cytomegalovirus JN227533,cercopithecine HV5 NC_012783); residues of described conserved motif are shadowed and mark by star, additional conserved residues are in red.

K. Hrazdilová et al. / Virology 487 (2016) 207–214 211

K. Hrazdilová et al. / Virology 487 (2016) 207–214212

detected viruses based on obtained UTRs failed, as the Blast ana-lysis revealed range of hits with low scores, apparently caused bylimited length of sequences and their high variability.

Inconclusive results from UTRs sequence analysis and difficul-ties to amplify the whole virus genomes from fecal samplesapparently prohibit further investigation of anelloviruses in fecalmaterial. To amplify the whole virus genomes in blood/serumsamples from gorillas and chimpanzees we used primers com-plementary to those for diagnostic purposes and obtained nearlyfull virus genomes excluding GC rich region. Similar strategy wasused by Okamoto et al. also on non-human primate samples(Okamoto et al., 2000a). Blast analysis, ORF arrangement patternand phylogenetic analysis proved that the identified sequencesbelong to anelloviruses and in fact are the first identified in gor-illas. Estimated full size of these genomes (2700–3000 nt for gor-illas' and 2500–2600 nt for chimpanzees' isolates) and phyloge-netic analysis suggest their classification to Betatorquevirus genus,among so called TT mini viruses (Biagini et al., 2001; Takahashiet al., 2000). Following the International Committee on Taxonomyof Viruses (ICTV) guidelines (ICTV, 2013), setting up the para-meters of new species to be 20–55% divergence in nucleotidesequence of ORF1, we assign all seven described viruses fromgorillas and chimpanzees as new species (Table 2).

In humans, co-infection of one individual by several differentspecies of anelloviruses was described (Ninomiya et al., 2008;Pinho‐Nascimento and Leite, 2011) and seems to be common. Co-infection with at least two species was described also in pigs(Jarosova et al., 2011). Similarly, the co-infection seems to becommon in great apes as we describe co-infections with two dif-ferent species of anellovirus in gorillas and chimpanzees based onsequencing separate clones. For GorM individual four clones oflong range PCR products were sequenced and two different spe-cies were detected (each twice) suggesting their equal presence inthe sample. Analogous situation was with both chimpanzee sam-ples tested.

The longest ORF identified in gorillas and chimpanzees TTMVgenomes share general characteristics of nucleoproteins of manyssDNA viruses, like size, nuclear localization signal and basic –

arginine-rich region present at the N-terminal part of the protein.Our results support the data of Okamoto et al. (Okamoto et al.,2000a) describing the shorter arginine-rich region of ORF1 inshorter anelloviruses. In TTVs this region span is about 100 aminoacids from N-terminus while in TTMVs just about half of this size.

Two smaller ORFs (ORF2 and ORF3) are partially overlappingORF1. In six of seven genomes of great apes' anellovirus describedin this work, ORF2 coding sequence contains a previously descri-bed conserved motif WX7HX3CXCX5H (Andreoli et al., 2006;Takahashi et al., 2000). Using ScanProsite online search (De Castroet al., 2006) the same motif was recognized in all known types ofanelloviruses (TTVs, TTMDVs and TTMVs) from all known hostspecies (humans, pigs, cats, dogs, tamarins, douroucoulis, pinemarten, tupaias, seals etc.) and also in recently described, distantlyrelated sea turtle tornovirus ORF2 (Ng et al., 2009a) (Fig. 3A).Besides anelloviruses, this motif was already described in VP2proteins of chicken anemia virus and human gyrovirus (Gia Phanet al., 2013; Phan et al., 2012) (Fig. 3B). The same motif was alsorecognized in two copies in proteins coded by genes US1, US31 andUS32 of human herpesvirus 5, macacine herpesvirus 3cynomolgusmacaque cytomegalovirus, panine herpesvirus 2 and cercopithe-cine herpesvirus 5 (Fig. 3C). In non-viral sequences the motif wasrecognized in two PAS domain containing bacterial proteins and inDrosophila TIL domain containing protein (Marchler-Bauer et al.,2014). None of these findings give us a clue about possible func-tion of the motif because it does not overlap with functionalresidues/parts of above mentioned proteins or their function is notknown so far. Detailed analysis of the motif in different ORFs

shows a different degree of conservation especially of the firsttryptophan residue in humans' anelloviruses regardless theirgenome length. In chimpanzees and gorillas isolates we foundseveral other conserved positions in and around the describedmotif (Fig. 3A), but due to limited number of available sequenceswe can specify only one more residue in a motif to WX7H(A/D)X2CXCX5H for human and great apes anelloviruses. The short-ening of ORF3 in one of the gorillas TT virus genomes and theabsence of standard ATG start codon was already observed inseveral human TTMV isolates and indicate that this virus genemight be nonfunctional (Biagini et al., 2001).

Our attempts to sequence the complete genomes of anello-viruses from host feces invariably failed. On the contrary, theexamination of limited set of blood/sera from captive great apesrevealed the presence of 7 new TTMV species. Eighteen years afterthe description of first human anellovirus, our knowledge ondiversity of these viruses in primates is extremely limited, whichcontrasts with almost ubiquitous presence as revealed by detec-tion in feces. Blood samples are routinely collected (and stored)from captive primates as part of health monitoring and diseasediagnostics and also the free ranging primates are occassionallysampled. Broader usage of available blood or tissue material offersa unique opportunity to study the diversity and interspeciestransmission of anelloviruses, as well as their zoonotic potential.

Materials and methods

Samples

A total of 153 fecal samples from 17 different species (Table 1)of African primates from Czech and Slovak zoos were collectedduring 2012 and stored in RNAlaters at �20 °C. Two samples ofwhole, frozen blood of Cercopithecus campbelli and one sample ofwhole, frozen blood of G. gorilla from Czech zoos were available.Stated gorilla individual is a male, wild born in 1972 in Cameroonliving from approx. the age of one year in captivity in differentzoos in Europe, mainly in Czech Republic (Sample GorM). Elevensamples of frozen serum samples obtained during routine exam-ination of animals from different ZOOs were available from threedifferent gorillas (including sample GorF), two chimpanzees(samples labeled CPZ1 and CPZ2), three samples of Colobus guer-eza, one sample of Macaca sylvanus and two samples fromorangutans.

Nucleic acid extraction

DNA from feces samples was extracted from solid fraction of1.5 ml feces suspension in RNAlaters by PSPs Spin Stool DNA Kit(Stratec Molecular, Germany) according to manufacturer'sinstructions, eluted by total volume of 150 ml of elution buffer. DNAfrom blood/serum samples was extracted from 100 ml of blood/serum diluted by 100 ml of PBS buffer using NucleoSpins Blood kit(Macherey-Nagel, Germany) following manufacturer's instruc-tions, eluted by 2�50 ml of elution buffer.

Anellovirus DNA detection

Primers (CVOS, CVOA, CVIA) as well as PCR conditions for semi-nested PCR co-amplifying 95 nt long fragments from UTR of TTVsand/or TTMVs (Fig. 1) were adopted from study of distribution ofthese viruses in humans and nonhuman primates (Thom et al.,2003). The universality of primers was tested based on currentlyavailable sequences of primate TTVs, TTMDVs and TTMVs indatabase as shown in Fig. 1. Amplification was done by Combi PPPMaster Mix (Top-Bio, Czech Republic). PCR products were

K. Hrazdilová et al. / Virology 487 (2016) 207–214 213

visualized on a 2% agarose gel stained with GelRedTM (Biotium,Hayward, CA). In order to confirm specificity of PCR reaction,randomly chosen amplification products from representative hostspecies were sequenced.

Whole genome amplification

To determine the full-length nucleotide sequence of anellovirusgenomes, inverted primers to those used for detection were designed.Amplification was done using LA DNA polymerases mix (Top-Bio,Czech Republic). In the first round of the PCR (in total volume of 25 ml),1 ml of blood extracted DNA was amplified using primers CVOSrc andCVIArc (CVOSrc 5ʹ-AAACTCAGCCATTCGKMWGTGYA-3ʹ, CVIArc 5ʹ-GGGCGGGWGCCGRAGGTGAG-3ʹ). One microliter of this reaction wascarried over to a second round and amplified using primers CVOSrcand CVOArc (CVOArc 5ʹ-AGTCWAGGGGCAATTCGGGCT-3ʹ). Amplifica-tion conditions were 94 °C/20 s, 52 °C/30 s, and 68 °C/5 min for 30cycles, with an additional 10 min extension at 68 °C. To amplifymissing sequence in between CVOSrc and CVOArc, specific primers foreach isolate were designed, and used for the first round of the PCR, thesecond round was performed using CVOS and CVOA primers. Ampli-fication was done by Combi PPP Master Mix (Top-Bio, Czech Republic)under conditions 95 °C/30 s, 50 °C/20, 72 °C/45 s for 30 cycles, withadditional 5 min extension at 72 °C. PCR products were visualized on a1% agarose gel stained by GelRedTM.

Molecular cloning and sequencing of TTV and TTMV DNA

PCR products chosen for sequencing were cut out of the gel,purified using QIAquick Gel Extraction Kit (Qiagen, Germany),ligated into pGEM-T Easy Vector (Promega Corp., Madison, WI)and cloned according to manufacturer´s instructions. Plasmid DNAwas purified by GenElute™ Plasmid Miniprep Kit (Sigma-Aldrich,St.Louis, MO). Cloned DNA was sequenced by Macrogen capillarysequencing services (Macrogen Europe, The Netherlands) usingprimers specific to T7promoter and/or SP6 promoter vectorsequences. For sequencing of the whole genome of gorilla TTMV,internal primers for sequencing were designed using primerwalking approach.

Analysis of nucleotide and amino acid sequences

Sequence analysis was performed by CLC Sequence viewer(Qiagen, Germany). Multiple sequence alignment of UTRs wasperformed by Clustal W (Larkin et al., 2007). Multiple sequencealignments of ORF1 were generated by Clustal Omega (McWilliamet al., 2013), p-distances were computed using PAUP softwareversion 4b.10 (Swofford, 2003). Best evolution model was chosenbased on Akaike information criterion computed by R software (RDevelopment Core Team, 2008) and phylogenetic trees wereconstructed by the maximum likelihood method (Felsenstein,1981) using GTR model considering a fraction of nucleotides to beinvariable (þ I), and assigning each site a probability to belong togiven rate categories (þG) by PhyML 3.0 software (Guindon et al.,2010). The reliability of the phylogenetic results was assessedusing 1000 bootstrap replicates (Felsenstein, 1985).

Funding

This work was supported by project of Internal Grant Agency ofUniversity of Veterinary and Pharmaceutical Sciences Brno [Grantnumber IGA VFU 42/2013/FVL]; by the project "CEITEC – CentralEuropean Institute of Technology" [Grant number CZ.1.05/1.100/02.0068] from European Regional Development Fund and furtherco-financed from European Social Fund and State Budget of the

Czech Republic [Grant numbers CZ.1.07/2.3.00/20.0300 andCZ.1.07/2.3.00/30.0014].

Acknowledgments

This work could not arise without kind cooperation of all 12Czech and one Slovak ZOOs, namely ZOO Brno, Děčín, Dvůr Krá-lové, Hodonín, Jihlava, Košice, Lešná, Liberec, Olomouc, Ostrava,Plzeň, Praha, and Ústí nad Labem graciously coordinated byDr. Klára J. Petrželková.

Appendix A. Supplementary material

Supplementary data associated with this article can be found inthe online version at http://dx.doi.org/10.1016/j.virol.2015.10.016.

References

Andreoli, E., Maggi, F., Pistello, M., Meschi, S., Vatteroni, M., Nelli, L.C., Bendinelli, M.,2006. Small Anellovirus in hepatitis C patients and healthy controls. Emerg.Infect. Dis. 12, 1175–1176. http://dx.doi.org/10.3201/eid1207.060234.

Asabe, S., Nishizawa, T., Iwanari, H., Okamoto, H., 2001. Phosphorylation of serine-rich protein encoded by open reading frame 3 of the TT virus genome. Biochem.Biophys. Res. Commun. 286, 298–304. http://dx.doi.org/10.1006/bbrc.2001.5385.

Biagini, P., Gallian, P., Attoui, H., Touinssi, M., Cantaloube, J., de Micco, P., de Lam-ballerie, X., 2001. Genetic analysis of full-length genomes and subgenomicsequences of TT virus-like mini virus human isolates. J. Gen. Virol. 82, 379–383.

Biagini, P., Uch, R., Belhouchet, M., Attoui, H., Cantaloube, J.-F., Brisbarre, N., deMicco, P., 2007. Circular genomes related to anelloviruses identified in humanand animal samples by using combined rolling-circle amplification/sequence-independent single primer approach. J. Gen. Virol. 88, 3–4. http://dx.doi.org/10.1099/vir.0.83071-0.

Catroxo, M.H.B., Nishiya, a, Sabino, E., Teixeira, P.S., Petrella, S., Milanelo, L., Vieira, J.C., Diaz, R.S., 2008. Research of Torque teno virus (TTV) in serum and totalblood of Brazilian non-human primates and in chicken plasma (Gallus gallusdomesticus) by the PCR N22 region. Int. J. Morphol. 26, 377–384. http://dx.doi.org/10.4067/S0717-95022008000200020.

Cong, M.E., Nichols, B., Dou, X.G., Spelbring, J.E., Krawczynski, K., Fields, H. a,Khudyakov, Y.E., 2000. Related TT viruses in chimpanzees. Virology 274,343–355. http://dx.doi.org/10.1006/viro.2000.0471.

De Castro, E., Sigrist, C.J. a, Gattiker, A., Bulliard, V., Langendijk-Genevaux, P.S.,Gasteiger, E., Bairoch, A., Hulo, N., 2006. ScanProsite: detection of PROSITEsignature matches and ProRule-associated functional and structural residues inproteins. Nucl. Acids Res. 34, 362–365. http://dx.doi.org/10.1093/nar/gkl124.

Felsenstein, J., 1981. Evolutionary trees from DNA sequences: a maximum like-lihood approach. J. Mol. Evol. 17, 368–376.

Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using thebootstrap. Evolution (N.Y.) 39, 783–791.

Gia Phan, T., Phung Vo, N., Sdiri-Loulizi, K., Aouni, M., Pothier, P., Ambert-Balay, K.,Deng, X., Delwart, E., 2013. Divergent gyroviruses in the feces of Tunisianchildren. Virology 446, 346–348. http://dx.doi.org/10.1016/j.virol.2013.08.020.

Goto, K., Sugiyama, K., Ando, T., Mizutani, F., Terabe, K., Tanaka, K., Nishiyama, M.,Wada, Y., 2000. Detection rates of TT virus DNA in serum of umbilical cordblood, breast milk and saliva. Tohoku J. Exp. Med. 191, 203–207.

Guindon, S., Dufayard, J.-F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010.New algorithms and methods to estimate maximum-likelihood phylogenies:assessing the performance of PhyML 3.0. Syst. Biol. 59, 307–321. http://dx.doi.org/10.1093/sysbio/syq010.

Hussain, T., Manzoor, S., Waheed, Y., Tariq, H., Hanif, K., 2012. Phylogenetic analysisof Torque Teno virus genome from Pakistani isolate and incidence of co-infection among HBV/HCV infected patients. Virol. J. 9, 1. http://dx.doi.org/10.1186/1743-422X-9-320.

Chan, P.K., Tam, W.H., Yeo, W., Cheung, J.L., Zhong, S., Cheng, A.F., 2001. High car-riage rate of TT virus in the cervices of pregnant women. Clin. Infect. Dis. 32,1376–1377. http://dx.doi.org/10.1097/00006454-200109000-00023.

ICTV [WWW Document], 2013. URL ⟨http://ictvonline.org/virusTaxonomy.asp⟩.Inami, T., Obara, T., Moriyama, M., Arakawa, Y., Abe, K., 2000. Full-length nucleotide

sequence of a simian TT virus isolate obtained from a chimpanzee: evidence fora new TT virus-like species. Virology 277, 330–335. http://dx.doi.org/10.1006/viro.2000.0621.

Jarosova, V., Pogranichniy, R., Celer, V., 2011. Prevalence and age distribution ofporcine torque teno sus virus (TTSuV) in the Czech Republic. Folia Microbiol.(Praha) 56, 90–94. http://dx.doi.org/10.1007/s12223-011-0030-4.

Jazaeri Farsani, S.M., Jebbink, M.F., Deijs, M., Canuti, M., van Dort, K.A., Bakker, M.,Grady, B.P.X., Prins, M., van Hemert, F.J., Kootstra, N.A, van der Hoek, L., 2013.

K. Hrazdilová et al. / Virology 487 (2016) 207–214214

Identification of a new genotype of Torque Teno mini virus. Virol. J. 10, 323.http://dx.doi.org/10.1186/1743-422X-10-323.

Jones, M., Kapoor, A., Lukashov, V.V., Simmonds, P., Hecht, F., Delwart, E., 2005. NewDNA viruses identified in patients with acute viral infection syndrome. J. Virol.79, 8230–8236. http://dx.doi.org/10.1128/JVI.79.13.8230.

Kapusinszky, B., Mulvaney, U., Jasinska, A.J., Deng, X., Freimer, N., Delwart, E., 2015.Local virus extinctions following a host population bottleneck. J. Virol. 89,8152–8161. http://dx.doi.org/10.1128/JVI.00671-15.

Kosugi, S., Hasebe, M., Tomita, M., Yanagawa, H., 2009. Systematic identification ofcell cycle-dependent yeast nucleocytoplasmic shuttling proteins by predictionof composite motifs. Proc. Natl. Acad. Sci. USA 106, 10171–10176. http://dx.doi.org/10.1073/pnas.0900604106.

Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam,H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J.,Higgins, D.G., 2007. Clustal W and clustal X version 2.0. Bioinformatics, 23; , pp.2947–2948. http://dx.doi.org/10.1093/bioinformatics/btm404.

Leary, T.P., Erker, J.C., Chalmers, M.L., Desai, S.M., Mushahwar, I.K., 1999. Improveddetection systems for TT virus reveal high prevalence in humans, non-humanprimates and farm animals. J. Gen. Virol. 80 (Pt. 8), 2115–2120.

Marchler-Bauer, A., Derbyshire, M.K., Gonzales, N.R., Lu, S., Chitsaz, F., Geer, L.Y.,Geer, R.C., He, J., Gwadz, M., Hurwitz, D.I., Lanczycki, C.J., Lu, F., Marchler, G.H.,Song, J.S., Thanki, N., Wang, Z., Yamashita, R.A., Zhang, D., Zheng, C., Bryant, S.H.,2014. CDD: NCBI’s conserved domain database. Nucl. Acids Res. 43, D222–D226.http://dx.doi.org/10.1093/nar/gku1221.

McWilliam, H., Li, W., Uludag, M., Squizzato, S., Park, Y.M., Buso, N., Cowley, A.P.,Lopez, R., 2013. Analysis tool web services from the EMBL-EBI. Nucl. Acids Res.41, 597–600. http://dx.doi.org/10.1093/nar/gkt376.

Mushahwar, I.K., Erker, J.C., Muerhoff, A.S., Leary, T.P., Simons, J.N., Birkenmeyer, L.G., Chalmers, M.L., Pilot-Matias, T.J., Dexai, S.M., 1999. Molecular and biophy-sical characterization of TT virus: evidence for a new virus family infectinghumans. Proc. Natl. Acad. Sci. USA 96, 3177–3182.

Ng, T.F.F., Manire, C., Borrowman, K., Langer, T., Ehrhart, L., Breitbart, M., 2009a.Discovery of a novel single-stranded DNA virus from a sea turtle fibropapillomaby using viral metagenomics. J. Virol. 83, 2500–2509. http://dx.doi.org/10.1128/JVI.01946-08.

Ng, T.F.F., Suedmeyer, W.K., Wheeler, E., Gulland, F., Breitbart, M., 2009b. Novelanellovirus discovered from a mortality event of captive California sea lions. J.Gen. Virol. 90, 1256–1261. http://dx.doi.org/10.1099/vir.0.008987-0.

Nguyen Ba, A.N., Pogoutse, A., Provart, N., Moses, A.M., 2009. NLStradamus: asimple hidden Markov model for nuclear localization signal prediction. BMCBioinf. 10, 202. http://dx.doi.org/10.1186/1471-2105-10-202.

Ninomiya, M., Takahashi, M., Nishizawa, T., Shimosegawa, T., Okamoto, H., 2008.Development of PCR assays with nested primers specific for differentialdetection of three human anelloviruses and early acquisition of dual or tripleinfection during infancy. J. Clin. Microbiol. 46, 507–514. http://dx.doi.org/10.1128/JCM.01703-07.

Nishizawa, T., Okamoto, H., Konishi, K., Yoshizawa, H., Miyakawa, Y., Mayumi, M.,1997. A novel DNA virus (TTV) associated with elevated transaminase levels inposttransfusion hepatitis of unknown etiology. Biochem. Biophys. Res. Com-mun. 241, 92–97. http://dx.doi.org/10.1006/bbrc.1997.7765.

Okamoto, H., Akahane, Y., Ukita, M., Fukuda, M., Tsuda, F., Miyakawa, Y., Mayumi,M., 1998. Fecal excretion of a nonenveloped DNA virus (TTV) associated withposttransfusion non-A-G hepatitis. J. Med. Virol. 56, 128–132.

Okamoto, H., Fukuda, M., Tawara, a, Nishizawa, T., Itoh, Y., Hayasaka, I., Tsuda, F.,Tanaka, T., Miyakawa, Y., Mayumi, M., 2000a. Species-specific TT viruses andcross-species infection in nonhuman primates. J. Virol. 74, 1132–1139.

Okamoto, H., Nishizawa, T., Takahashi, M., Tawara, A., Peng, Y., Kishimoto, J., Wang,Y., 2001. Genomic and evolutionary characterization of TT virus (TTV) in tupaiasand comparison with species-specific TTVs in humans and non-human pri-mates. J. Gen. Virol. 82, 2041–2050.

Okamoto, H., Nishizawa, T., Tawara, a, Peng, Y., Takahashi, M., Kishimoto, J., Tanaka,T., Miyakawa, Y., Mayumi, M., 2000b. Species-specific TT viruses in humans andnonhuman primates and their phylogenetic relatedness. Virology 277,368–378. http://dx.doi.org/10.1006/viro.2000.0588.

Okamoto, H., Takahashi, M., Nishizawa, T., Tawara, A., Fukai, K., Muramatsu, U.,Naito, Y., Yoshikawa, A., 2002. Genomic characterization of TT viruses (TTVs) inpigs, cats and dogs and their relatedness with species-specific TTVs in primatesand tupaias. J. Gen. Virol. 83, 1291–1297.

Osiowy, C., Sauder, C., 2000. Detection of TT virus in human hair and skin. Hepatol.Res. 16, 155–162.

Phan, T.G., Li, L., O’Ryan, M.G., Cortes, H., Mamani, N., Bonkoungou, I.J.O., Wang, C.,Leutenegger, C.M., Delwart, E., 2012. A third gyrovirus species in human faeces.J. Gen. Virol. 93, 1356–1361. http://dx.doi.org/10.1099/vir.0.041731-0.

Pinho‐Nascimento, C., Leite, J., 2011. Torque teno virus in fecal samples of patientswith gastroenteritis: prevalence, genogroups distribution, and viral load. J.Med. Virol. 1111, 1107–1111. http://dx.doi.org/10.1002/jmv.

Qiu, J., Kakkola, L., Cheng, F., 2005. Human circovirus TT virus genotype 6 expressessix proteins following transfection of a full-length clone. J. Virol. 79, 6505–6510.http://dx.doi.org/10.1128/JVI.79.10.6505.

Saback, F.L., Gomes, S. a, De Paula, V.S., Da Silva, R.R.S., Lewis-Ximenez, L.L., Niel, C.,1999. Age-specific prevalence and transmission of TT virus. J. Med. Virol. 59,318–322. http://dx.doi.org/10.1002/(SICI)1096-9071(199911)59:3o318::AID-JMV1043.0.CO;2-Q.

Swofford, D.L., 2003. PAUP*. Phylogenetic Analysis Using Parsimony (*and OtherMethods) Version 4.

Takahashi, K., Iwasa, Y., Hijikata, M., Mishiro, S., 2000. Identification of a newhuman DNA virus (TTV-like mini virus, TLMV) intermediately related to TTvirus and chicken anemia virus. Arch. Virol. 145, 979–993.

Thom, K., Morrison, C., Lewis, J.C., Simmonds, P., 2003. Distribution of TT virus(TTV), TTV-like minivirus, and related viruses in humans and nonhuman pri-mates. Virology 306, 324–333. http://dx.doi.org/10.1016/S0042-6822(02)00049-1.

Van den Brand, J.M.A., van Leeuwen, M., Schapendonk, C.M., Simon, J.H., Haagmans,B.L., Osterhaus, A.D.M.E., Smits, S.L., 2012. Metagenomic analysis of the viralflora of pine marten and European badger feces. J. Virol. 86, 2360–2365. http://dx.doi.org/10.1128/JVI.06373-11.

Verschoor, E.J., Langenhuijzen, S., Heeney, J.L., 1999. TT viruses (TTV) of non-humanprimates and their relationship to the human TTV genotypes. J. Gen. Virol. 80(Pt. 9), 2491–2499.