nikonorova supporting information - journal of biological … supporting information ... strain pbs...

9
1 Supporting Information Time-resolved analysis of amino acid stress identifies eIF2 phosphorylation as necessary to inhibit mTORC1 activity in liver Inna A. Nikonorova 1 , Emily T. Mirek 1 , Christina C. Signore 1 , Michael P. Goudie 1 , Ronald C. Wek 2 , and Tracy G. Anthony 1 * From the 1 Department of Nutritional Sciences, Rutgers University, New Brunswick, NJ 08901; 2 Department of Biochemistry & Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 Running title: eIF2 phosphorylation is necessary to inhibit mTORC1 in liver * To whom correspondence should be addressed: Tracy G. Anthony: 59 Dudley Rd., New Brunswick, NJ 08901; [email protected]; Tel. (848) 932-6331; Fax. (732) 932-6837. Contents Extended Material and Methods ............................................................................................................................. 2 Table S1. Numbers of animals utilized in each strain and treatment group. ........................................................... 3 Table S2. Amino acid content of the sera of WT and Gcn2 -/- mice after a single injection of asparaginase .......... 4 Figure S1. Serum glutamine and glutamate ............................................................................................................ 5 Figure S2. Graphical display of levels of serum amino acids that were significantly increased over 24 h time period following a single injection of asparaginase ................................................................................................ 6 Figure S3. S6K1 phosphorylation in the liver of wild type and Gcn2 -/- mice before and after asparaginase exposure. ................................................................................................................................................................. 7 Figure S4. Translational efficiency of Atf4 mRNA (10-fraction resolution). ......................................................... 8 Figure S5. Translational efficiency of mRNAs unchanged following asparaginase exposure in wild type and Gcn2 -/- strains .......................................................................................................................................................... 9

Upload: lamminh

Post on 08-Jun-2018

213 views

Category:

Documents


0 download

TRANSCRIPT

1  

Supporting Information

Time-resolved analysis of amino acid stress identifies eIF2 phosphorylation as necessary to inhibit mTORC1 activity in liver

Inna A. Nikonorova1, Emily T. Mirek1, Christina C. Signore1, Michael P. Goudie1,

Ronald C. Wek2, and Tracy G. Anthony1*

From the 1Department of Nutritional Sciences, Rutgers University, New Brunswick, NJ 08901; 2Department of Biochemistry & Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202

Running title: eIF2 phosphorylation is necessary to inhibit mTORC1 in liver

* To whom correspondence should be addressed: Tracy G. Anthony: 59 Dudley Rd., New Brunswick, NJ 08901; [email protected]; Tel. (848) 932-6331; Fax. (732) 932-6837.

Contents

Extended Material and Methods ............................................................................................................................. 2

Table S1. Numbers of animals utilized in each strain and treatment group. ........................................................... 3

Table S2. Amino acid content of the sera of WT and Gcn2-/- mice after a single injection of asparaginase .......... 4

Figure S1. Serum glutamine and glutamate ............................................................................................................ 5

Figure S2. Graphical display of levels of serum amino acids that were significantly increased over 24 h time period following a single injection of asparaginase ................................................................................................ 6

Figure S3. S6K1 phosphorylation in the liver of wild type and Gcn2-/- mice before and after asparaginase exposure. ................................................................................................................................................................. 7

Figure S4. Translational efficiency of Atf4 mRNA (10-fraction resolution). ......................................................... 8

Figure S5. Translational efficiency of mRNAs unchanged following asparaginase exposure in wild type and Gcn2-/- strains .......................................................................................................................................................... 9

2  

Extended Material and Methods

Animals

Timeline of tissue collection for asparaginase injections:

Treatment duration Injection time Tissue collection

15-30 min 4:30-4:45 PM 5:00 PM

1 h 3:00 PM 4:00 PM

3 h 2:30 PM 5:30 PM

6 h 12:00 PM 6:00 PM

12 h 11:00 PM 11:00 AM

18 h 6:00 PM -1 day 12:00 PM

24 h 1:00 PM -1 day 1:00 PM

Quantitative RT-PCR analysis

All primer sequences were validated and optimized using standard methods as described

(https://www.sigmaaldrich.com/technical-documents/articles/biology/assay-optimization-and-validation.html).

Atf4 5’-GCCGGTTTAAGTTGTGTGCT-3' 5’-CTGGATTCGAGGAATGTGCT-3'

Fgf21 5’-AGCATACCCCATCCCTGACT-3’ 5’-AGGAGACTTTCTGGACTGCG-3’

Asns 5’-CTGTTACAATGGTGAAATCTACAACCACAAG-3’ 5’-GATGAATGCAAACACCCCGTCCAGCATACAGAT-3’

Trib3 5’ –CAGCAACTGTGAGAGGACGA–3’ 5’-TGGAATGGGTATCTGCCAGC-3’

Redd1 5’-GACCGCTGCGCGAGCCTGGAGAGCTCGGACTG-3’ 5’-GCTGCATCAGGTTGGCACACAGGTGCTCATCCTC-3’

Sesn2 5’-TAGCCTGCAGCCTCACCTAT-3’ 5’-TATCTGATGCCAAAGACGCA-3’

4ebp1 5’-CTTCAGCACCACCCCGGGAGGAACCAGGATTATC-3’ 5’-GAGGCTCATCGCTGGTAGGGCTAGTGACCCCAG-3’

Gapdh 5’-GACAACTCACTCAAGATTGTCAGCAATGC-3’ 5’-GTGGCAGTGATGGCATGGACTGTGGTC-3’

Trf2 5’-TGCAGAGCCAGATCACTATG-3’ 5’-AACCCATTGCTGACCATGGA-3’

Slc3a2 5’-AAGGAAGCTCTGAGTTCTTG-3’ 5’-CAAAAGCCTGTCCTCACTTA-3’

Hspa5 5’-TGAAGGTGAACGACCCCTAA-3’ 5’-TTCAGCTGTCACTCGGAGAA-3’

Pabpc1 5’-CGCTGGACTGCTCAGGGTGC-3’ 5’-GGGGGCGCAGATGCCAACAT-3’

Rps18 5’-GTTCCAGCACATTTTGCGAGT-3’ 5’- GGTGAGGTCGATGTCTGCTT-3’

Rps20 5’-TGACTCACCGCTGTTCGCTCC-3’ 5’-GAGTCGCTTGTGGATCCTCATCTGG-3’)

3  

Table S1. Numbers of animals utilized in each strain and treatment group.

Treatment Strains of mice

WT Gcn2-/- ls-Perk-/- ls-Perk-/- Gcn2-/-

Control 16 14 4

ASNase 15 min 7 7 3

ASNase 30 min 5 8 3

ASNase 1 h 6 6 3

ASNase 3 h 6 6

ASNase 6 h 5 5

ASNase 12 h 5 5

ASNase 18 h 5 5

ASNase 24 h 3 3

Tun 30 min 2 2 2

Tun 60 min 2 2 2

Tun 90 min 2 2 2

Tun+ASNase 30 min 4 4 3

Tun+ASNase 60 min 4 4 6 (3 @ 60 min + 3 @ 90 min)

ISRIB 90 min 8 8

ISRIB 120 min 4 4

ISRIB+ASNase 60 min 4 4

ISRIB+ASNase 90 min 5 5

4  

Table S2. Amino acid content of the sera of WT and Gcn2-/- mice after a single injection of asparaginase.

Amino acid

Strain PBS 15 min 30 min 1 h 3 h 6 h 12 h 18 h

Glu WT 87 ± 18 524 ± 173 * 760 ± 183 * 832 ± 72 * 952 ± 239 * 714 ± 505 * 245 ± 69 * 303 ± 190 *

Gcn2-/- 77 ± 22 412 ± 219 * 743 ± 224 * 754 ± 251 * 806 ± 356 * 866 ± 343 * 368 ± 191 * 294 ± 135 *

Gln WT 1031 ± 200 409 ± 336 * 175 ± 81 * 35 ± 12 * 44 ± 22 * 382 ± 346 * 893 ± 190 1147 ± 206

Gcn2-/- 904 ± 175 526 ± 331 * 170 ± 133 * 137 ± 169 * 241 ± 487 * 348 ± 270 * 842 ± 354 1223 ± 168

Asp WT 33 ± 16 38 ± 9 41 ± 17 32 ± 6 40 ± 11 32 ± 3 41 ± 13 52 ± 34

Gcn2-/- 33 ± 14 42 ± 15 42 ± 9 32 ± 6 39 ± 9 37 ± 6 50 ± 17 40 ± 11

Asn WT 141 ± 88 105 ± 35 114 ± 35 60 ± 19 * 136 ± 17 118 ± 59 129 ± 47 157 ± 41

Gcn2-/- 149 ± 68 117 ± 24 145 ± 46 132 ± 29 144 ± 38 118 ± 59 102 ± 51 159 ± 64

Ser WT 116 ± 39 125 ± 57 138 ± 43 126 ± 55 156 ± 29 * 215 ± 66 * 203 ± 44 * 346 ± 83 *

Gcn2-/- 122 ± 46 108 ± 42 112 ± 36 110 ± 47 162 ± 44 231 ± 35 * 193 ± 62 279 ± 89 *

His WT 88 ± 15 80 ± 23 81 ± 19 77 ± 27 68 ± 26 79 ± 27 84 ± 34 106 ± 54

Gcn2-/- 76 ± 18 74 ± 13 74 ± 16 65 ± 17 69 ± 30 84 ± 28 83 ± 50 75 ± 30

Gly WT 322 ± 68 401 ± 184 410 ± 127 400 ± 168 488 ± 212 618 ± 161 * 579 ± 270 756 ± 154 *

Gcn2-/- 299 ± 73 289 ± 49 300 ± 56 281 ± 70 331 ± 76 428 ± 49 * 620 ± 250 * 748 ± 225 *

Thr WT 174 ± 27 167 ± 49 170 ± 39 165 ± 45 187 ± 58 251 ± 103 332 ± 69 * 432 ± 90 *

Gcn2-/- 153 ± 40 128 ± 28 149 ± 30 136 ± 41 148 ± 52 220 ± 23 * 205 ± 37 * 297 ± 125

Arg WT 121 ± 25 117 ± 34 114 ± 36 120 ± 42 136 ± 20 123 ± 59 192 ± 49 * 235 ± 18 *

Gcn2-/- 111 ± 40 103 ± 38 104 ± 32 109 ± 41 129 ± 35 186 ± 22 * 153 ± 49 168 ± 29 *

Ala WT 286 ± 70 333 ± 108 * 371 ± 69 * 339 ± 139 437 ± 157 533 ± 179 * 513 ± 49 * 878 ± 313 *

Gcn2-/- 326 ± 104 300 ± 63 337 ± 82 306 ± 116 415 ± 108 573 ± 113 * 567 ± 131 * 653 ± 184 *

Val WT 239 ± 60 198 ± 47 198 ± 21 204 ± 53 260 ± 88 282 ± 49 336 ± 65 * 384 ± 66 *

Gcn2-/- 206 ± 58 183 ± 48 197 ± 48 178 ± 34 202 ± 60 254 ± 27 * 250 ± 47 296 ± 42 *

Met WT 69 ± 15 63 ± 15 63 ± 15 59 ± 16 65 ± 20 76 ± 7 98 ± 26 124 ± 18 *

Gcn2-/- 67 ± 20 55 ± 25 49 ± 23 56 ± 20 60 ± 33 77 ± 16 91 ± 26 89 ± 29

Trp WT 143 ± 15 139 ± 23 135 ± 19 126 ± 27 139 ± 26 154 ± 27 162 ± 34 185 ± 54

Gcn2-/- 110 ± 39 120 ± 46 130 ± 48 110 ± 52 128 ± 46 157 ± 54 166 ± 36 133 ± 39

Iso WT 81 ± 25 65 ± 23 66 ± 16 65 ± 15 78 ± 31 82 ± 14 111 ± 32 125 ± 35 *

Gcn2-/- 69 ± 24 63 ± 21 67 ± 19 52 ± 12 67 ± 23 91 ± 11 * 85 ± 22 102 ± 15 *

Leu WT 144 ± 43 119 ± 32 119 ± 21 120 ± 28 158 ± 53 157 ± 31 185 ± 43 223 ± 39 *

Gcn2-/- 114 ± 34 114 ± 36 117 ± 30 103 ± 21 132 ± 40 176 ± 16 * 160 ± 23 * 182 ± 28 *

Lys WT 223 ± 48 237 ± 77 243 ± 93 228 ± 60 243 ± 42 302 ± 49 * 343 ± 102 415 ± 62 *

Gcn2-/- 221 ± 80 217 ± 90 212 ± 72 219 ± 83 230 ± 87 320 ± 37 * 344 ± 73 * 350 ± 98 * Values are means ± SD expressed as mMol/L; n=3-11 mice/group, * indicates p-values < 0.05 by T-test comparing a given treatment group against the vehicle injected control assuming two-tailed distribution with unequal variance.

 

Figure S1. A

changes in g

mice.

Glutamine is

black. Time

the control

Upper panel

lower panel

following inj

individual wi

Gcn2-/- mice.

values for W

Each treatme

Asparaginase

glutamine and

s shown in bl

point 0 repre

group of an

shows values

is the close

ection. Close

ild type (WT

Solid and da

WT and Gc

ent group had

e injection ca

d glutamic a

ue, and gluta

esents circula

nimals treate

s over 24 h p

-up of the f

ed circles indi

) mice, and o

ashed lines ind

n2-/- groups,

at least 3 mic

uses acute

cid in sera of

amic acid is i

ating values o

ed with PBS

period, and th

first six hour

icate values o

open circles o

dicate averag

respectively

ce.

f

n

of

S.

he

rs

of

of

ge

y.

 

Figure S2. G

following a s

Each panel s

exposure. Clo/- samples. So

group had at

zero are less

Graphical dis

single injectio

shows linear t

osed circles in

olid and dash

least 3 anima

than 0.01.

splay of level

on of aspara

trend line of

ndicate value

hed lines show

als. For all th

s of serum am

ginase.

changes in s

es of individu

w average val

he amino acid

mino acids th

elect amino a

al wild type (

ues for WT a

ds shown p-va

hat were sign

acid concentr

(WT) sample

and Gcn2-/- gr

alues of the s

nificantly inc

ration over 24

s, and open c

roups, respect

slopes of the t

creased over

4 h after aspa

circles represe

tively. Each t

trend lines be

24 h

araginase

ent Gcn2-

treatment

eing non-

 

Figure S3. Sexposure. Panel A showbiological rep

6K1 phosph

ws multiple biplicates of tot

orylation in

iological repltal S6K1.

the liver of w

icates of phos

wild type and

spho-S6K1 at

d Gcn2-/- mice

t threonine 38

e before and

89 whereas pa

d after aspara

anel B shows

aginase

multiple

 

Figure S4. TTo confirm t

profiling usin

mice. Fractio

profile (this

polysomal fr

indicate the

mRNA amou

Translationalthe shift of A

ng more biolo

ons 19-24 fro

figure). Tra

ractions (10 f

position of e

unt.

l efficiency ofAtf4 mRNA in

ogical sample

om a 30-frac

anslational ef

fractions per

each fraction

f Atf4 mRNAnto polysome

es, and collec

ction profile (

fficiency was

profile were

along the pr

A (10-fractiones in response

cting 10 fract

(Figure 2C)

s assessed v

collected). B

rofile. Symbo

n resolution)e to asparagi

tions per prof

corresponded

ia RT-qPCR

Black dotted

ols represent

). inase, we rep

file in wild ty

d to fractions

R analysis of

outlines of th

individual re

eated liver p

ype (WT) an

s 7-8 in a 10

f RNA isolat

he polysomal

elative values

olysomal

nd Gcn2-/-

0-fraction

ted from

l profiles

s of Atf4

 

Figure S5. T

and Gcn2-/- s

Assessment o

in polysome

is shown to in

in the collect

Translational

strains.

of select hepa

fractions from

ndicate relativ

ted fractions,

l efficiency of

atic mRNAs r

m the livers o

ve position of

expressed as

f mRNAs un

reportedly sen

f wild type (W

f each fraction

percent of tot

changed foll

nsitive to meth

WT) and Gcn

n. Symbols r

tal mRNA va

lowing aspar

hionine-defic

2-/- mice. Poly

represent valu

alue in all the

raginase expo

cient media (H

ysomal profil

ues of relative

fractions.

osure in wild

Hspa5, Slc3a2

le at the lowe

e amounts of m

d type

2, Trf2)

r panel

mRNAs