nirali k patel, nutan prakash v* principle and tools for primer...

Atmiya Spandan Vol.1, Iss.1, 2013

[BIOLOGICAL SCIENCES ] Principles and tools for primer design

Nirali K Patel, Nutan Prakash V* Department of Biotechnology, Shree M & N Virani

Science College, Rajkot

[email protected]

Abstract

Bioinformatics has become an essential

tool not only for biological database but also for

applied research in biotechnology and biomedical

sciences. Optimal primer sequence and appropriate

primer concentration are essential for maximal

specificity and efficiency of PCR. Selection of

oligonucleotide primers is useful for polymerase

chain reaction (PCR), Oligo hybridization and

DNA sequencing. Proper primer design is actually

one of the most important steps in successful DNA

PRINCIPLE AND

TOOLS FOR PRIMER

DESIGN specific amplification. Primer-dimer formation can

become competitive enough to suppress PCR

reaction and product formation. There are several

online tools and server help to serving molecular

biologist design effective PCR primers. This

review intends to provide information to choosing

the most efficient way to design a new specific-

primer by applying current publicly available

bioinformatics tools, and server. Also, the aim here

is to provide essential information and principle for

the primer design and use of primers.

sequencing and PCR reaction. A poorly designed Key words: PCR primer, primer design,

primer can result in little or no product due to non-

INTRODUCTION

Primer design is the one of the best application

bioinformatics tool, server sequence. The programs for PCR primer

design play the central role in PCR reaction,

in bioinformatics. Bioinformatics is an and DNA sequencing. Primer is very essential

interdisciplinary research area, which may be

broadly defined as the combination of

for successful molecular experiment. There are

several parameters essential for successful

biological and computational sciences (Singh primer design. These parameters are

and Kumar, 2001). Primer is small mentioned under the title principle for primer

oligonucleotide sequence. Selection of design.

oligonucleotide primers is often critical for the

overall successes of polymerase chain reaction

(PCR), and DNA sequencing. PCR is a

technique that is used to amplify a sample of

DNA from miniscule amount of DNA (ex.,

DNA from a crime scene, archaeological

samples, organisms that can’t be cultured).The

manual selection of optimal PCR primer set is

Primer

A primer is a short oligonucleotide which is

the reverse complement of a region of a DNA

template. It would anneal to a DNA strand to

facilitate the amplification of the targeted

DNA sequence. There are a mainly two types

of primer use in PCR forward primer and

tedious process and not efficient. Thus, reveres primer. But in case of DNA

various bioinformatics programs are available sequencing only forward primer is use (1).

for selection of primer pairs from a template

79



Fig 1: primer and template.

TYPES OF PRIMER:

Universal Primer

Primers can be designed to amplify only one

product in general but Primers can also be

designed to amplify multiple products. We call

5.Matching forward and reverse primers to

find the best pair.

6.Ensure uniqueness in all template sequences. Guessmer

In some cases, DNA sequences are either

such primers “universal primers”. PCR unavailable or difficult to align. Then, a

primers are used to amplify the 16SrRNA gene

providing the phylogenetic information, the

most common universal primer pair was

devised by Weisburg et al.(3)

Semi-Universal Primers

Primers can be designed to amplify only a

subset of template sequences from a large

group of similar sequences. For example,

design primer to amplify HPV type 1 and type

single/group of related proteins can be back

translated into nucleotide sequences that will

be used as template to design primers/probes.

We call such primers “Guessmer”. Oligo dT Primers

Oligo d (T) 12-18 is the classic primer mix

used to prime synthesis of the first strand

cDNA by reverse transcriptase using poly A+

mRNA as a template

6 genes, but not other types.

Degenerate primers

Strategy:

1.Align all types of HPV genes.

2.Identify a subset of genes that are more

similar to each other than to other subsets. In

this case, type 1 and type 6.

3.Find the 5’ and 3’ regions that are conserved

between type 1 and type 6, but are variable in

other types.

Sometimes degenerate primers are used. These

are actually mixtures of similar, but not

identical primers. They may be convenient if

the same gene is to be amplified from different

organisms, as the genes themselves are

probably similar but not identical. The other

use for degenerate primers is when primer

design is based on protein sequence.

4.Design forward primers from the 5’ region

and reverse primers from the 3’ region.

80



length of the primer, its melting temperature,

Specific primer

Specific primer is primer which design for

specific target gene. Like, primer 3 is software

which design primer for particular target gene

sequences. Primer3 is simplest and most

popular software for specific primer design.

PRENCIPLE FOR PRIMER DESIGN

The most critical parameter for successful

PCR is the design of Primers. A poorly

designed primer can result in a PCR reaction

that will not work. The primer sequence

determines several parameters such as the

its annealing temperature and ultimately the

yield. A poorly designed primer can result in

little or no product due to non-specific

amplification and/or primer-dimer formation,

which can become competitive enough to

suppress product formation. This review note

is provided to give rules that should be taken

into account when designing primers for PCR.

The sequences of the primers used for PCR

amplification can have a major effect on the

specificity and sensitivity of the reaction. See

the table which providing parameter for primer

designing.

Character

parameter

1

2

3

4

Specificity Stability Compatibility Other Recommendation

Uniqueness

Primer length

GC content

Internal stability

Melting temperature

Annealing temperature

GC clamp

Primer pair matching

3’-End Sequence

Secondary structure

Amplicon Length

concentration of primer

Avoid Cross homology:

1. SPECIFICITY

As mentioned above, primer specificity is at

least partly dependent on primer length. It is

found that there are many more unique 24

bases Oligo than 15 bases Oligo. However,

primers must be chosen so that they have a

unique sequence within the template DNA that

is to be amplified.

A. Uniqueness

There shall be one and only one target site in

the template DNA where the primer binds,

81



which means the primer sequence shall be

unique in the template DNA. A primer

result in a smear on amplification of genomic

DNA.

designed with a highly repetitive sequence will

TemplateDNA,

5’...TCAACTTAGCATGATCGGGTA...GTAGCAGTTGACTGTACAACTCAG CAA...3’

3’GTTGAATCGT 5’ 3’CATCGTCAACTGAC5’ ‘3’GTTGA TCGT5’

A

Primer candidate 1 5’-TGCTAAGTTG-3’ NOT UNIQUE

Primer candidate 2 5’-CAGTCAACTGCTAC-3 UNIQUE!

B. Primer Length

Primer length is one of the important

parameter for successes of PCR reaction. The

specificity is controlled by length of primer

and annealing temperature of PCR reaction.

Primer between 18-35 nucleotides is very

specific for PCR. Primers with long runs of a

calculation. In general shorter the primer more

quickly it will anneal to target DNA (2).Since

both specificity and the temperature and time

of annealing are at least partly dependent on

primer length, this parameter is critical for

successful PCR (Wu et al., 1991). Primers

longer than 30 bases do not demonstrate

single base should generally be avoided. higher specificity. Additionally, long

Primer with longer sequences posses extra Amplicon are more likely to

information and also disturb in Tm value

cross-hybridize with other primers and

sequences in the reaction mixture, and this can

terminate the DNA polymerization

Fig 2: primer length

GC% is an important characteristic of DNA.

C. GC Content Primers should have a GC contents between

82



50 and 60 percent. GC contents, melting

temperature and annealing temperature are

strictly dependent on one another. The

100%Poly G’s or C’s can result in non-

specific annealing. GC-content of primers is

used to predict their annealing temperature to

GC pair is bound by three hydrogen bonds.

The presence of G or C bases at the 3′ end of

primers (GC clamp) helps to promote correct

binding at the 3′ end due to the stronger

hydrogen bonding of G and C bases.

GC% = (G + C) / length of sequence *

the template DNA. A higher GC-content level

indicates a higher melting temperature as The

Fig 3: G-C bond

D. Internal stability

Internal stability is calculated with entropy

To minimize false priming, it’s critical that the

stability at 5’ end be high and the stability at

values of neighbor nucleotides. Usually, we

draw a graph of ∆G for all nucleotides of the

3’ end be relatively low. The

stability is ∆

internal

primers. This is known as the stability profile.

Fig 4: internal stability

2. STABILITY

The primer should have stable 5’ end and an

unstable 3’ end. Stretches of A and T are also

to be avoided as these will open up stretches of

the primer- template complex. “G” or “C” is

desirable at the 3’ end. This GC clamp reduces

83



spurious secondary bands. Stability of primer

T m. The melting temperature of nucleic acid

depended on Melting temperature and duplex is increases as the length and GC

annealing temperature also. Determine the �G

of the last 5 bases at 3' end and 5’ end. An

unstable 3' end (less negative �G) will result

in less false priming, stable 5' end (more

negative �G) will result in more efficient and

specific bonding to the template.

content increases. A simple formula for

calculation of the (T m) is: Tm = 2(A+T) + 4(G+C).

B. Annealing temperature:

The annealing temperature (T a) chosen for a

A. Melting Temperature (Tm) PCR depends directly on length and

The melting temperature (T m) is the composition of the primer(s). Generally, an

temperature at which one-half of a particular

DNA duplex will dissociate and become single

strand DNA. The optimal melting temperature

for primers generally lies in the range of 52-

annealing temperature about 5°C below the

lowest T m of the pair of primers is used. Too

high T a will produce insufficient primer-

template hybridization resulting in low PCR

580C. Both the forward and reverse product yield. Too low T a may possibly lead

oligonucleotide primers should be designed to non-specific products caused by a high

such that they have similar melting number of base pair mismatches. The optimal

temperatures. A good approximant working

value can be calculated using the formula of

Wallace et al (1979).The stability of a primer-

annealing temperature for any given primer

pair on a particular target can be calculated as

follows:

template DNA duplex can be measured by its

Ta Opt = 0.3 x(Tm of primer) + 0.7 x(Tm of product) – 25

Fig 5: primer anneal with target sequences

= 0.3 x(T m of primer) + 0.7 x(T m of product) - 25

84


C. GC Clamp:


B. 3’-End Sequence:

The presence of G or C bases within the last

five bases from the 3' end of primers (GC

clamp) helps promote specific binding at the 3'

end due to the stronger bonding of G and C

bases. More than 3 G's or C's should be

avoided in the last 5 bases at the 3' end of the

primer. Several studies have indicated that a

GC-clamp as short as 25bp would be sufficient

It is well established that the 3’ terminal

position in PCR primers is essential for the

control of miss-priming (Kwok et al., 1990).

Primers should be “stickier” on their 5’ end

than on their 3’ ends. A “sticky” 3’ end as

indicated by a high G C content could

potentially anneal at multiple sites on the

template DNA. A “G” or “C” is desirable at

in DGGE. [Denaturing gradient gel the 3’ end but the first part of this rule should

electrophoresis] is one of the most powerful

methods for mutation detection currently

available] this may be true for AT-rich

fragments, but for a GC-rich sequence the

difference in T m with a GC-clamp might

become too small.

3. COMPATIBILITY

A. Primer Pair Matching

Primers work in pairs – forward primer and

reverse primer. Since they are used in the same

PCR reaction, it shall be ensured that the PCR

condition is suitable for both of them. One

critical feature is their annealing temperatures,

which shall be compatible with each other.

apply. This GC clamp reduces spurious

secondary bands (Sheffield et al., 1989).

C. Secondary structure

Presence of the primer secondary structures

produced by intermolecular or intramolecular

interactions can lead to poor or no yield of the

product. They adversely affect primer template

annealing and thus the amplification. They

greatly reduce the availability of primers to the

reaction.

Hairpins: It is formed by intramolecular

interaction within the primer and should be

avoided. Optimally a 3' end hairpin with a ∆G

of -2 kcal/mol and an internal hairpin with a

∆G of -3 kcal/mol is tolerated generally.

The maximum difference allowed is 3 °C. The

closer their T anneal are the better.

Fig 5: hair pin

∆G definition: the Gibbs Free Energy G is the

measure of the amount of work that can be

extracted from a process operating at a

constant pressure. It is the measure of the

spontaneity of the reaction. The stability of

hairpin is commonly represented by its ∆G

value, the energy required to break the

secondary structure. Larger negative value for

∆G indicates stable, undesirable hairpins.

Presence of hairpins at the 3' end most

adversely affects the reaction.

∆G = ∆H – T∆S 85



dimer with a ∆G of -6 kcal/mol is tolerated

Self Dimer: A primer self-dimer is formed by

intermolecular interactions between the two

(same sense) primers, where the primer is

homologous to itself. Generally a large amount

generally. Cross Dimer: Primer cross dimers are formed

by intermolecular interaction between sense

of primers are used in PCR compared to the and antisense primers, where they are

amount of target gene. When primers form

intermolecular dimers much more readily than

hybridizing to target DNA, they reduce the

product yield. Optimally a 3' end self dimer

homologous. Optimally a 3' end cross dimer

with a ∆G of -5 kcal/mol and an internal cross

dimer with a ∆G of -6 kcal/mol is tolerated

generally.

with a ∆G of -5 kcal/mol and an internal self

Fig 6: cross dimer.

To improve specificity of the primers it is

4. OTHER RECOMMENDATION

A. Concentration

necessary to avoid regions of homology.

Primers designed for a sequence must not

The concentration of primer in amplification amplify other genes in the mixture.

reaction should be between 0.1 and 0.5 mM.

B. Amplicon Length:

The forward primer and the reverse primer

should be between 300 and 2,000 base pairs

apart. In general, primers distanced < 2000

bases apart are used. This allows for sufficient

Commonly, primers are designed and then

Blasted to test the specificity. Our products

offer a better alternative. You can avoid

regions of cross homology while designing

primers. You can BLAST the templates

against the appropriate non-redundant database

and the software will interpret the results. It

amplification of the target region. This will identify regions significant cross

distance determines how big the band will be

in your gel. Larger bands are easier to see. If

they are too close, the amplified region the

product will be too small and run off the gel

and if they are too big. The product will not

make it out of the well

Product length = (Position of antisense

homologies in each template and avoid them

during primer search. TOOLS FOR PRIMER DESIGN

The use of software in biological applications

has given a new dimension the field of

bioinformatics. There are a numerous web-

primer - Position of sense primer) + 1. based resources and different programs

available for primer design. These are (I)

C. Avoid Cross homology Primer design web servers for PCR (II) Tool

86

NO TOOL NAME FUNCTION

1. AntiSense

Design

Design antisense primers at IDT.

2. AutoPrime Designs primers that are specific for expressed sequences (mRNA).

3. BatchPrimer3 High throughput web application for PCR and sequencing primer design.

4. CODEHOP Consensus Degenerate Hybrid Oligonucleotide Primers.

5. Exonprimer Design primers for the amplification of exons with intronic primers.

6. Genefisher Interactive PCR primer design.

7. MEDUSA A tool for automatic selection and visual assessment of PCR primer pairs

(Karolinska).

8. Methprimer Design primers for methylation PCR.

9. mPrimer3 modified Primer3.

10. MutScreener Design primers for mutation screening (by PCR direct sequencing).

11. NetPrimer Free primer design service of Premier Biosoft.

12. Oligodb A web based system for interactive design of oligo DNA for transcription

profiling (hybridization) of human genes.

13. Osprey Oligonucleotide Design Software for Sequencing and Gene Expression.

14. PCR suite A collection of programs to search overlapping primers, genomic primers for

exon amplification, SNP and cDNA flanking primers.

15. PRIDE The less automated web version of PRIDE (a.o. 50-70 mer oligo design).

16. Primaclade A web based application that accepts a multiple species nucleotide alignment

file as input and identifies a set of PCR primers that will bind across the

alignment.

17. Primer3 A common used software for designing primers.



for primer properties calculation (III) Useful

Biosystems,

Molecular

Biology

Insights,

site for PCR reaction setup. These are listed PREMIER Biosoft International,

below in (Tables 1, 2, and 3). These all web- IntelliGenetics Inc., Hitachi Inc., DNA Star,

based resources are very essential for Advanced American Biotechnology and

molecular biologist. There is different Imaging. Some scientists have also developed

software freely and commercially available for

local installation. These are listed below in

(Table 4 and 5). Companies engaged in

biosoftware development include: Alkami

algorithms and computer programs for various

purposes of primer design (Rychlik and

Rhoades, 1989; Lowe et al., 1990; Lucas et al.,

1991; O'Hara and Venezia, 1991; Tamura et)

Table 1 Primer design web servers for PCR.

87

NO TOOL NAME FUNCTION

18. Primer3Plus Use primer3 to pick primers for specific tasks.

19. PrimerQuest Primer design at IDT.

20. Primer

Generator

Automated generator of primers for site directed mutagenesis.

21. PrimerStation Multiplex human PCR primer design site.

22. PrimerX Automated design of primers for site directed mutagenesis.

23. Primique Automatic design of specific PCR primers for each sequence in a family.

24. Primo Unique Primo Unique finds multiple primer pairs, each uniquely amplify one gene in a

family.

25. ProbeWiz

Server

The CBS Probe Wiz WWW server predicts optimal PCR primer pairs for

generation of probes for cDNA arrays.

26. PUNS Primer Uni Gene Selectivity Testing compares primer sequences against the

both the genome and transcriptome to assess the potential for multiple

amplicons .

27. RNAi Design Design primers for RNAi at IDT.

28. ROSO Software to design optimized oligonucleotide probes (size over 25 nucleotides)

for microarrays.

29. SNPbox A modular software package that automates the design of PCR primers for

large scale amplification and sequencing projects.

30. SOP3 Selection of Oligonucleotide Primers for PCR and Pyrosequencing .

31. SPADS Specific Primers & Amplicon Design Software for amplification of individual

members of gene families.

NO NAME FUNCTION

1 AutoDimer Rapid screen of previously selected multiplex PCR primers for primer.

dimer and hairpin interactions in short DNA oligomers (< 30 nucleotides) .

2 MultiPLX 2.0 Tool to analyze PCR primer compatibility and automatically finding

optimal multiplexing (grouping) solution.

3 OligoAnalyzer

3.0

Generates Tm, free energy, molecular weight and hairpin and dimer

formation structures.

5 OligoTM 1.0 Program for calculation oligo melting temperature and GC content.



Table 2 Primer property calculators

86

NO SOFTWARE

NAME

FUNCTION

1 Amplify A freeware Macintosh program for simulating and testing

polymerase chain reactions (PCRs).

2 AmplifX Software to test, manage and design your primers for Macintosh and

Windows.

3 Fast PCR PCR primer design, DNA and protein tools, repeats and own

database searches

4 MEDUSA A tool for automatic selection and visual assessment of PCR primer

pairs (Karolinska)

5 MethylPrimer

Express

Free Applied Biosystems software to design high quality PCR

primers for methylation mapping experiments.

6 MutaPrimer Designs primers for Stratagene's QuikChange site directed

mutagenesis kits.

7 OligoPicker OligoPicker picks specific oligos by skipping regions with

contiguous bases common in other sequences. In addition, oligo

specificity is double checked by NCBI BLAST.

8 PRIMEGENS PRIMEGENS (PRIMEr Design Using GEN Specific Fragments) is a

computer program to select gene specific fragments and then design

primer pairs using Primer3 for PCR amplifications.

9 PrimerD The primerD program implements a novel algorithm for the design

of unique degenerate primer pairs.

10 Primer3 A common used software for designing primers for microarray

construction.

11 mPrimer3 Modified Primer3

NO NAME FUNCTION

1 Optimase Protocolwriter Design PCR protocol

2 Optimase MasterMixCalculator Design PCR protocol



Table 3 Online site available for PCR setup

Table 4 PCR Primer design software for local installation free available.

87

NO SOFTWARE

NAME

FUNCTION

1 AlleleID For real time PCR based pathogen detection and bacterial identification.

TaqMan probe design supported.

2 Beacon Designer Real time PCR primer and probe design for single tube and multiplex

PCR assays.

3 OligoChecker An oligo database program which quickly checks which oligos available

in a lab can be used on a given template.

4 PRIDEand

GenomePRIDE

(a.o. 50- 70 me oligo design)


Table 5 Commercial packages

Computer-Aided Primer Design


Primer design is an art, in silico primer

designing done by using various computer

tools.

Primer3 software

It is software developed by Rozen and

Skaletsky (2000). It is freely available on

Internet

(http://frodo.wi.mit.edu/cgibin/primer3/primer

3.cgi). This software is provided by the

Whitehead Institute “as is” and any express or

Design a pair of primers for sequence

“NM_203378” in NCBI GenBank, so that the

coding sequence of human myoglobin will be

amplified using PCR reaction. We design

specific primer for “NM_203378” gene by

using primer3 software. It design only one

specific primer pair from the sequences.See

example, Step 1: download target sequence form

NCBI in fast format. See here the sequence

of “NM_203378” gene is given.

implied warranties, including, but not limited >gi|44955887|ref|NM_203378.1| Homo

to, the implied warranties of merchantability

and fitness for a particular purpose are

disclaimed. Primer3 is widely used program

sapiens myoglobin (MB), transcript variant 3,

mRNA

AATGGCACCTGCCCTAAAATAGCTTCC

for designing PCR (Polymerase Chain CATGTGAGGGCTAGAGAAAGGAAAAG

Reaction) primers. Primer3 can also design

hybridization probes and sequencing primers.

It is a tool for automated primer generation

according to thermodynamic, primer size, and

product size restrictions

ATTAGACCCTCCCTGGATGAGAGAGAG

AAAGTGAAGGAGGGCAGGGGAGGGGG

ACAGCGAGCCATTGAGCGATCTTTGTC

AAGCATCCCAGAAGACTGCGCCATGGG

GCTCAGCGACGGGGAATGGCAGTTGGT

88



GCTGAACGTCTGGGGGAAGGTGGAGGC

TGACATCCCAGGCCATGGGCAGGAAGT

CCTCATCAGGCTCTTTAAGGGTCACCC

AGAGACTCTGGAGAAGTTTGACAAGTT

CAAGCACCTGAAGTCAGAGGACGAGAT

GAAGGCGTCTGAGGACTTAAAGAAGCA

TGGTGCCACCGTGCTCACCGCCCTGGG

TGGCATCCTTAAGAAGAAGGGGCATCA

TGAGGCAGAGATTAAGCCCCTGGCACA

GTCGCATGCCACCAAGCACAAGATCCC

CGTGAAGTACCTGGAGTTCATCTCGGA

ATGCATCATCCAGGTTCTGCAGAGCAA

GCATCCCGGGGACTTTGGTGCTGATGC

CCAGGGGGCCATGAACAAGGCCCTGGA

GCTGTTCCGGAAGGACATGGCCTCCAA

CTACAAGGAGCTGGGCTTCCAGGGCTA

GGCCCCTGCCGCTCCCACCCCCACCCA

TCTGGGCCCCGGGTTCAAGAGAGAGCG

GGGTCTGATCTCGTGTAGCCATATAGA

GTTTGCTTCTGAGTGTCTGCTTTGTTTA

GTAGAGGTGGGCAGGAGGAGCTGAGG

GGCTGGGGCTGGGGTGTTGAAGTTGGC

TTTGCATGCCCAGCGATGCGCCTCCCTG

TGGGATGTCATCACCCTGGGAACCGGG

AGTGGCCCTTGGCTCACTGTGTTCTGCA

TGGTTTGGATCTGAATTAATTGTCCTTT

CTTCTAAATAACCGAACTTCTTCCAACC

TCCAAACTGGCTGTAACCCCAAATCCA

AGCCATTACACACCTGACAGTAGCAAT

TGTCTGATTAATCACTGGCCCCTTGAAG

ACAGCAGAATGTCCCTTTGCAATGAGG

AGGAGATCTGGGCTGGGCGGGCCAGCT

GGGGAAGCATTTGACTATCTGGAACTT

GTGTGTGCCTCCTCAGGTATGGCAGTG

ACTCACCTGGTTTTAATAAAACAACCT

GCAACATCTCA

Step2: now online available primer3 server is used for design a primer

Step 3: paste the sequences and click on pick primers see arrow in give image, after few minutes

it give result in another window.

89



Step 4: see the result it give left primer and right primer respectively known as a forward

primer and reverse primer.

GENEFISHER2 SOFTWARE

Gene fisher 2 software design universal

best software because it done multiple

primer. Gene fisher2 software is one of the sequences analysis steps along with it

90



facilitates manual parameter setting for primer

design. It helps in rapid universal primer

design. Here, we take same gene, Design a

pair of primers for sequence “NM_203378” in

NCBI GenBank.

After the end of process it gives list of primer

pair. It helps to design universal primer from

the many sequences. It also helps in multiple

sequences analysis.

Step 1: download target sequence form

NCBI in fast format. See here the sequence

of “NM_203378” gene is given.

>gi|44955887|ref|NM_203378.1| Homo

sapiens myoglobin (MB), transcript variant 3,

mRNA

AATGGCACCTGCCCTAAAATAGCTTCC

CATGTGAGGGCTAGAGAAAGGAAAAG

ATTAGACCCTCCCTGGATGAGAGAGAG

AAAGTGAAGGAGGGCAGGGGAGGGGG

ACAGCGAGCCATTGAGCGATCTTTGTC

AAGCATCCCAGAAGACTGCGCCATGGG

GCTCAGCGACGGGGAATGGCAGTTGGT

GCTGAACGTCTGGGGGAAGGTGGAGGC

TGACATCCCAGGCCATGGGCAGGAAGT

CCTCATCAGGCTCTTTAAGGGTCACCC

AGAGACTCTGGAGAAGTTTGACAAGTT

CAAGCACCTGAAGTCAGAGGACGAGAT

GAAGGCGTCTGAGGACTTAAAGAAGCA

TGGTGCCACCGTGCTCACCGCCCTGGG

TGGCATCCTTAAGAAGAAGGGGCATCA

TGAGGCAGAGATTAAGCCCCTGGCACA

GTCGCATGCCACCAAGCACAAGATCCC

CGTGAAGTACCTGGAGTTCATCTCGGA

ATGCATCATCCAGGTTCTGCAGAGCAA

GCATCCCGGGGACTTTGGTGCTGATGC

CCAGGGGGCCATGAACAAGGCCCTGGA

GCTGTTCCGGAAGGACATGGCCTCCAA

CTACAAGGAGCTGGGCTTCCAGGGCTA

GGCCCCTGCCGCTCCCACCCCCACCCA

TCTGGGCCCCGGGTTCAAGAGAGAGCG

GGGTCTGATCTCGTGTAGCCATATAGA

GTTTGCTTCTGAGTGTCTGCTTTGTTTA

GTAGAGGTGGGCAGGAGGAGCTGAGG

GGCTGGGGCTGGGGTGTTGAAGTTGGC

TTTGCATGCCCAGCGATGCGCCTCCCTG

TGGGATGTCATCACCCTGGGAACCGGG

AGTGGCCCTTGGCTCACTGTGTTCTGCA

TGGTTTGGATCTGAATTAATTGTCCTTT

CTTCTAAATAACCGAACTTCTTCCAACC

TCCAAACTGGCTGTAACCCCAAATCCA

AGCCATTACACACCTGACAGTAGCAAT

TGTCTGATTAATCACTGGCCCCTTGAAG

ACAGCAGAATGTCCCTTTGCAATGAGG

AGGAGATCTGGGCTGGGCGGGCCAGCT

GGGGAAGCATTTGACTATCTGGAACTT

GTGTGTGCCTCCTCAGGTATGGCAGTG

ACTCACCTGGTTTTAATAAAACAACCT

GCAACATCTCA

91



Step2: now online available primer3 server is used for design a primer

Step3: upload sequences in the box and click on submit button.

92



Step4: after submission of sequences, one window is open in which click on “calculate primer”

button.

Step5: it gives list of possible primer.

93


CONCLUSION


sequences held in gene databases are practical

The heart of PCR lies in the design of the two

oligonucleotide primers. It is very essential

that accuracy is taken in the design of primers

for PCR. Several basic parameters including

the length of the primer, %GC content and the

3' sequence, Tm value need to be optimized

for successful PCR. Now all of these

parameters can be easily optimized with the

help of computer programs. The increasing use

of information from the internet and the

REFERENCES

1. Garg N, Punthir S, Prakash A and Kumar A.

April 2008. Primer Designing for Dreb1A, A

Cold Induced Gene. Journal of Proteomics &

starting points when designing primers and

reaction conditions for the PCR. A number of

software packages such as Oligo, Primer etc.

have allowed the process of primer design to

be less troublesome. It is also possible to

include more than one set of primers in a PCR.

All these information related to the software,

online tool, sites for primer properties

calculation, are useful for successful primer

design and PCR reaction. 5. Kamel A. Abd- lsalam.2003.Bioinformatic tools

and guideline for PCR primer design. African J

Biotechnol.2 (5): 91-95.find article online.

6. Lowe T, Sharefkin J, Yang SQ, Dieffenbach

CW A computer program for selection of

Bioinformatics -Open Access. Vol.1find article oligonucleotide primers for

online . polymerasechain.1990. NucleicAcids.18.1757-

2. Ahsen N, Wittwer C T, and schu E.1956–1961

(2001) .Molecular Diagnostics Oligonucleotide

Melting Temperatures under PCRConditions:

1761. find Article online

7. ChavalI S, Mahajan A, Tabassuml R, Maiti S,

and Bharadwaj D. Oligonucleotide properties

Nearest-Neighbor Corrections forMg21, determination and primer

Deoxynucleotide Triphosphate, and Dimethyl

Sulfoxide Concentrations with Comparison to

designing.2005.Bioinformatics.21.3918–

3925.find article online.

Alternative Empirical Formulas. Clinical 8. .C W Dieffenbach, T M Lowe and G S Dveksler.

Chemistry.vol47:issue11.find article. online

3. W G Weisburg, S M Barns, D A Pelletier and D

J Lane 16S ribosomal DNA amplification for

phylogenetic study; Journal of Bacteriology.

General concepts for PCR primer design

Genome Research.1993 3: S30.find article

online. 9. Lowe T, Sharefkin J, Yang SQ, Dieffenbach CW

1991 January; 173(2): 697-703 find article A computer program for selection of

online. oligonucleotide primers for

4. Mehta N, Raikwar A, Chauhan P and Kushwaha

S. Primer design and analysis of Klebsiella

polymerasechain.1990.

1761. find Article online

NucleicAcids.18.1757-

granulomatis strain K22-14 16S rRNA gene. 10. ChavalI S, Mahajan A, Tabassuml R,

Research Journal of Pharmaceutical, Biological Maiti S, and Bharadwaj D. Oligonucleotide

and Chemical Sciences. properties determination and primer

designing.2005.Bioinformatics.21.3918–

3925.find article online.

94



11.

.C W Dieffenbach, T M Lowe and G S

vitro. Nucleic Acids Res 18 (21): 6409–12. find

Dveksler. General concepts for PCR primer article online. design Genome Research.1993 3: S30.find article 18. Vallone, P. M., and J. M. Butler. 2004.

online. AutoDimer: A screening tool for primer-dimer

12. Lowe T, Sharefkin J, Yang SQ, and hairpin structures. Biotechniques 37 (2):

Dieffenbach CW (1990). A computer program

for selection of oligonucleotide primers for

polymerase chain reaction. Nucleic Acids Res.

226–31. find article online.

BIBLIOGRAPHY

18: 1757-1761. 1. http://www.accessexcellence.org/AB/GG/poly 13. Rychlik, W., W. J. Spencer, and R. E. merase.html

Rhoads. 1990. Optimization of the annealing 2. http://www.accessexcellence.org/AB/BC/Kary temperature for DNA amplification in _B_Mullis.html vitro. Nucleic Acids Res 18 (21): 6409–12. find

article online. 3. http://bioweb.uwlax.edu/GenWeb/Molecular/S

eq_Anal/Primer_Design/primer_design.htm 14. O'Hara PJ, Venezia D (1991). 4. http://www.karymullis.com/

PRIMEGEN: a tool for designing primers from

multiple alignments. CABIOS 7: 533-534.

5. http://www.bioteach.ubc.ca/MolecularBiology/ PolymeraseChainReaction/

15. Lucas K, Busch M, Mossinger S, 6. http://www.emblheidelberg.de/ExternalInfo/ge Thompson JA (1991). An improved erlof/draft_frames/flowchart/clopcr_strategy/pr microcomputer program for finding gene or gene imer_design.html family-specific 7. http://www.ncbi.nlm.nih.gov/Class/NAWBIS/

16. Vallone, P. M., and J. M. Butler. 2004. Modules/DNA/dna9.html AutoDimer: A screening tool for primer-dimer

and hairpin structures. Biotechniques 37 (2):

226–31. find article online.

8. 9.

http://www.dnalc.org/shockwave/pcranwhole.h tml http://www.alumni.ca/~leema3m/bghtml

17. Rychlik, W., W. J. Spencer, and R. E. 10. http://marvin.ibest.uidaho.edu/~heckendo/CS5 Rhoads. 1990. Optimization of the annealing 04/Students/P/waltari.pdf temperature for DNA amplification in 11. http://www.nfstc.org/pdi/Subject04/pdi_s04_m

01_02_c.htm

95

nirali k patel, nutan prakash v* principle and tools for primer...

Documents