novel aav-mediated therapeutic strategies for epilepsy

Novel AAV-mediated Therapeutic Strategies for Epilepsy

Stacey Beth Foti

A dissertation submitted to the faculty of the University of North Carolina at Chapel Hill in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the

curriculum of Neurobiology

Chapel Hill 2008

Approved by:

Advisor: Thomas McCown

Advisor: Richard Jude Samulski

Committee Chair: Mohanish Deshmukh

Reader: Tal Kafri

Reader: Kay Lund

ii

©2008 Stacey Beth Foti

ALL RIGHTS RESERVED

iii

ABSTRACT

Stacey Beth Foti: Novel AAV-mediated Therapeutic Strategies for Epilepsy (Under the direction of Thomas McCown and Richard Jude Samulski)

Epilepsy afflicts 2.1 million people in the United States, and many patients

develop drug resistant seizures. For these patients, gene therapy may be an attractive

treatment option. Recent studies have shown that viral vector-mediated expression of

neuropeptides such as galanin and neuropeptide Y (NPY) can attenuate seizure sensitivity

and prevent seizure-induced cell death in the brain. NPY13-36 is a C-terminal peptide

fragment of NPY that activates the NPY-Y2 receptor, thought to mediate the anti-seizure

activity. Therefore we investigated if recombinant adeno-associated virus (AAV)-

mediated expression and constitutive secretion of NPY or NPY13-36 could alter limbic

seizure sensitivity. We found that AAV-mediated delivery of both NPY and NPY13-36

attenuates limbic seizures, and provides a vector technology platform for delivering

therapeutic peptide fragments with increased receptor selectivity.

To further explore the potential of this platform, we utilized a strategic approach

to deliver multiple neuropeptides simultaneously. To achieve this, we used a proteolytic

strategy such that our vectors contained a single promoter driving expression of a

cleavable chimeric fusion protein of galanin and NPY13-36. The chimeric fusion protein

contained a linker sequence capable of being cleaved by the intracellular protease furin,

and also contained a fibronectin constitutive secretion signal (FIB) sequence. We first

characterized several constructs in vitro, and determined that 1) a single FIB

iv

sequence was sufficient to cause secretion of both proteins, 2) the proteins were cleaved

from one another regardless of position relative to the cleavage sequence, 3) cleavage

efficiency of secreted proteins was 100%, 4) if the cleavage sequence was absent,

uncleaved fusion protein was secreted into the medium.

We then tested these constructs in a limbic seizure model, and showed that all of

our vectors were capable of attenuating limbic seizure sensitivity. However, no

additional efficacy was observed with the vector delivering both galanin and NPY13-36.

Surprisingly, the level of attenuation was less than with previously published single

peptide vectors, suggesting reduced translation efficiency. This body of work describes a

gene therapy vector technology platform to express and constitutively secrete single and

multiple proteins from transduced cells, and to deliver peptide fragments that are capable

of selective receptor targeting.

v

ACKNOWLEDGEMENTS

I would like to thank the current and past members of the Samulski lab for all their

encouragement and scientific discussions that were invaluable to me in this endeavor. I

would especially like to thank Vivian Choi and Doug McCarty for their mentorship and

patience when I was new to the lab. They set me down the right path! I would also like

to thank my advisors Thomas McCown and Jude Samulski for their constructive criticism

and guidance. They really helped put things in perspective, particularly when I was

getting lost in the details. Finally, I would like to thank my friends (especially Angelique

Camp and Matt Hirsch) and my family; they truly supported me through this process.

My parents George and Susan Foti are great motivators; my brother Andrew Foti always

knows what to say to make me feel better when I have my doubts; and my fiancé Bruce

Herzer who is my sounding board, and reminds me that I really am cut out to be a

scientist.

vi

TABLE OF CONTENTS

List of Tables ......................................................................................................................x

List of Figures .................................................................................................................... xi

Chapter 1 Introduction......................................................................................................1

I.A. Epilepsy ............................................................................................................1

I.B. Gene Therapy....................................................................................................4

I.C. AAV Biology....................................................................................................6

I.D. AAV Vectors ..................................................................................................10

I.E. Potential Gene Therapy Targets for Epilepsy .................................................13

I.F. Ex Vivo Gene Therapy.....................................................................................17

I.G. In Vivo Viral Vector-mediated Alterations in Receptor Function ..................19

I.H. In Vivo Viral Vector-mediated Expression and Secretion of Neuropeptides and Peptide Fragments.......................................................22

I.I. Combination Therapy.......................................................................................25

Chapter 2 Methods ..........................................................................................................31

II.A. rAAV Vectors: Cloning and Construction ....................................................31

II.A.1. Cloning Plasmids for rAAV-CB-FIB-NPY and rAAV-CB-FIB-NPY13-36.............................................................31

II.A.2. Cloning Plasmids for Multiple Gene Product Delivery Vectors ...........................................................................................32

II.A.3. DNA Sequencing...........................................................................33

vii

II.B. In Vitro Methods............................................................................................35

II.B.1. Cell Culture and Transfection........................................................35

II.B.2. Immunoprecipitation and Western Blotting ..................................35

II.C. rAAV Production, Purification, and Characterization...................................36

II.D. In Vivo Methods ............................................................................................44

II.D.1. Experimental Animals...................................................................44

II.D.2. rAAV Vector Microinjection ........................................................44

II.D.3. In Vivo Detection of AAV-Derived NPY or NPY13-36...............46

II.D.4. In Vivo Detection of AAV-Derived GFP ......................................47

II.D.5. Kainic Acid Treatment ..................................................................47

Chapter 3 Results .............................................................................................................48

III.A. rAAV-Mediated Expression and Constitutive Secretion of NPY or NPY13-36 Suppresses Seizure Activity In Vivo ...................................48

III.B. A Strategic Approach for Delivering Multiple Gene Products Using a Single AAV Vector ......................................................................51

III.B.1. In Vitro Characterization of Dual Reporter Gene Product Delivery Vectors...............................................................53

III.B.2. In Vitro Characterization of Double FIB Multiple Gene Product Delivery Vectors .....................................................59

III.B.3. In Vivo Characterization of Double FIB Multiple

Gene Delivery Vectors...................................................................62

III.B.4. In Vitro Characterization of Single FIB Multiple Gene Product Delivery Vectors .....................................................65

III.B.5. In Vivo Functional Test of Single FIB Multiple Gene Product Delivery Vectors .....................................................68

Chapter 4 Discussion .......................................................................................................73

viii

IV.A. rAAV-Mediated Expression and Constitutive Secretion of NPY or NPY13-36 Suppresses Seizure Activity In Vivo ......................73

IV.B. A Strategic Approach for Delivering Multiple Gene Products Using a Single AAV Vector ......................................................................78

Chapter 5 The Future of AAV-mediated Gene Therapy in Brain: Obstacles and Opportunities...................................................................83

V.A. Vector Delivery.............................................................................................83

V.B. Vector Safety, Tolerability, and Efficacy......................................................85

V.B.1. Vector Targeting............................................................................85

V.B.1.a. Capsid-mediated Vector Targeting.................................86

V.B.1.b. Cell Type-specific Promoter-mediated Vector Targeting ....................................................90

V.B.1.c. Inducible and Conditional Promoter-mediated Vector Targeting ....................................................92

V.B.2. Cis-acting Regulatory Elements....................................................93

V.B.3. Immune Response .........................................................................95

V.C. Conclusions and Progress of Current Clinical Trials in Brain ....................100

Appendices......................................................................................................................104

Appendix A. Plasmids Generated and Characterized ..........................................104

Appendix B. Multiple Gene Product Delivery Vectors .......................................107

Appendix C. Nerve Growth Factor (NGF) and Glial Cell Derived Neurotrophic Factor (GDNF).........................................107

Appendix D. Publications ....................................................................................112

Appendix D.1. Adeno-associated Virus-Mediated Expression and Constitutive Secretion of NPY or NPY13-36 Suppresses Seizure Activity In Vivo ................................113

Appendix D.2. Viral Vector Gene Therapy ............................................122

ix

References .......................................................................................................................145

x

LIST OF TABLES

Table 1-1 Current AAV-mediated Gene Therapy Clinical Trials for Neurological Diseases..................................................................................7

Table 1-2. Potential Therapeutic Targets that Influence Seizure Behavior .......................16

Table 2-1. PCR Primers for Multiple Gene Product Delivery Vectors .............................34

Table 5-1. Current Open Gene Therapy Trials for Neurological Diseases......................101

Table 6-1. Plasmids Generated and Characterized ..........................................................104

xi

LIST OF FIGURES

Figure 1-1. Different Types of Epilepsy Surgery ................................................................3

Figure 1-2 AAV Latent and Lytic Life Cycles ....................................................................9

Figure 1-3. Comparing wtAAV to rAAV..........................................................................11

Figure 1-4. Ex Vivo versus In Vivo Viral Gene Delivery...................................................18

Figure 1-5. Strategies to Co-express Gene Products .........................................................26

Figure 2-1. Dot Blot, Standard Curve, and Titer Calculations for AAV2-CB-FIB-NPY and AAV2-CB-FIB-NPY13-36 ..............................37

Figure 2-2. Dot Blot, Standard Curve, and Titer Calculations for AAV2-CB-FIB-GAL-RKRRKR-FIB-EGFP, AAV2-CB-FIB-EGFP, and AAV2-CB-EGFP ..........................................38

Figure 2-3. Dot Blot, Standard Curve, and Titer Calculations for Multiple Gene Product Delivery Vectors ..................................................39

Figure 2-4. Infectious Center Assay of AAV2-CB-FIB-GAL- RKRRKR-EGFP........................................................................................40

Figure 2-5. Infectious Center Assay of AAV2-CB-FIB-EGFP- RKRRKR-GAL..........................................................................................41

Figure 2-6. Infectious Center Assay of AAV2-CB-FIB-GAL-EGFP ...............................42

Figure2-7. Infectious Center Assay of AAV2-CB-FIB-GAL- RKRRKR-NPY13-36 ................................................................................43

Figure 2-8. Coronal Section of the Rat Brain Depicting the Location of Vector Microinjection............................................................................45

Figure 3-1. AAV Vectors that Express and Constitutively Secrete NPY or NPY13-36..............................................................................................49

Figure 3-2. The Effects of AAV-FIB-NPY and AAV-FIB-NPY13-36 Vectors on the Expression of Limbic Seizure Behaviors ..........................50

Figure 3-3. The In Vivo Presence of FIB-NPY and FIB-NPY13-36 mRNA 1 Week after Vector Infusion into the Piriform Cortex .............................52

xii

Figure 3-4. AAV Vectors Characterized in Initial Multiple Gene Product Delivery Studies ...........................................................................54

Figure 3-5. Luciferase Assay on Concentrated Medium ...................................................56 Figure 3-6. Luciferase Antibody Protein Analysis of Luciferase-GFP

Multiple Gene Product Delivery Constructs..............................................57 Figure 3-7. GFP Antibody Protein Analysis of Luciferase-GFP Multiple

Gene Product Delivery Constructs.............................................................58 Figure 3-8. Double FIB Multiple Gene Product Delivery Vectors....................................60

Figure 3-9. In Vitro Protein Analysis of Double FIB Multiple Gene Product Delivery Constructs ...................................................................................61

Figure 3-10. In Vivo Fluorescence Pattern in Rat Cortex after Infusion of AAV2-CB-FIB-GAL-RKRRKR-FIB-EGFP, AAV2-CB-FIB-EGFP, or AAV2-CB-EGFP.............................................63

Figure 3-11. The Effects of AAV2-CB-FIB-GAL-RKRRKR-FIB-EGFP on the Expression of Limbic Seizure behaviors .............................................64

Figure 3-12. AAV Vectors Characterized in Final Multiple Gene Product Delivery Studies.........................................................................................66

Figure 3-13. In Vitro Characterization of Fluorescence Patterns, Cleavage, and Secretion of Proteins Derived from Multiple Gene Product Delivery Vectors...........................................................................67

Figure 3-14. Immunofluorescence of Neurons in the Piriform Cortex That Have Been Transduced with GFP-containing Vectors ..............................69

Figure 3-15. The In Vivo Presence of FIB-GAL-RKRRKR-NPY13-36 mRNA 1 Week After Vector Infusion into the Piriform Cortex ...............70

Figure 3-16. The Effects of Multiple Gene Product Delivery Vectors on Limbic Seizure Behavior ...........................................................................71

Figure 4-1. Regulated versus Constitutive Secretion in Neurons ......................................76

Figure 6-1. Immunoprecipitation Followed by SDS-PAGE and Coomassie Staining of Multiple Gene Product Delivery Vectors for Mass Spectrometry...................................................................................108

xiii

Figure 6-2. NGF and GDNF ELISA................................................................................111

Chapter 1

Introduction

I.A. Epilepsy

About 2.1 million people in the United States are living with epilepsy (Hirtz,

Thurman et al. 2007), with a world wide prevalence of 1 percent (Hauser, Hesdorffer et

al. 1990), making epilepsy one of the most common neurological diseases. Epilepsy

syndromes can be classified into two major categories based on the origin of seizure

activity. In generalized epilepsy the seizure originates bilaterally from the cerebral

hemispheres and typically involves the whole brain. For partial or focal epilepsy, the

area of seizure genesis is localized to one or more defined areas termed foci, although it

may spread to involve the entire brain.

Temporal lobe epilepsy (TLE), is a partial epilepsy where seizure genesis occurs

in temporal lobe structures such as the hippocampus and amygdala, and is the most

frequent and severe form of adult focal epilepsy (Cohen, Navarro et al. 2002). Patients

with TLE can have seizures that cause them to lose consciousness. If the seizures go

untreated, they can lead to severe brain damage. Having epilepsy is not only debilitating,

it can also be a significant economic burden. The estimated annual economic cost of

epilepsy in the United States including the direct cost of treatment and the indirect costs

such as lost productivity and wages is 12.5 billion dollars (Shafer and Begley 2000).

There is a critical need for effective epilepsy treatment. Currently, the preferred

treatment method for epilepsy is to administer anti-epileptic drugs (AEDs) to arrest the

seizures or at least reduce their frequency and intensity. If seizures are left untreated,

they can increase in duration and subsequently cause more activity-induced pathology in

the brain. The AEDs attempt to prevent seizure activity by four major mechanisms: (1)

increasing gamma-aminobutyric acid (GABA)-ergic actions which are predominantly

inhibitory; (2) decreasing excitatory glutamatergic transmission; (3) decreasing voltage-

dependant calcium release; and (4) decreasing voltage-dependant sodium conductance

(Ure and Perassolo 2000).

Since seizures seem to result from hyperexcitable networks of neurons, the AEDs

are designed to enhance inhibitory neurotransmission and hyperpolarize neurons.

Unfortunately, even with new AEDs available, the number of drug resistant epilepsies

has not decreased (Loscher and Leppik 2002). Patients who continue to exhibit

intractable seizures or those who develop intolerable side effects while on AEDs are

considered to have medically refractory epilepsy. Unfortunately, 30–40% of all patients

with epilepsy have medically intractable seizures, and only half of these patients are

candidates for surgery (Shafer, Hauser et al. 1988; Engel, Levesque et al. 1992; Sander

1993; Siegel 2004), which is currently one of the few treatment options for medically

refractory patients. Additionally, 20% of the patients who do undergo temporal lobe

surgery will still have seizures post-operatively (Spencer, Spencer et al. 1984).

Even though surgical techniques have become more refined, several factors still

limit success. The highest surgical success rate is achieved if the epileptogenic tissue can

be directly removed using procedures like focus surgery, anterior temporal lobectomy,

and total lobe resection (See Figure 1-1). Lower success is achieved when the area of

2

3

Figure 1-1. Different Types of Epilepsy Surgery (modified from Siegel 2003). A. Temporal lobectomy, B. Selective amygdalo-hippocampectomy, C. Frontal lobectomy, and D. Anatomical hemispherectomy. Arrows show where brain has been resected. Surgery is currently the only alternative for the 30% of patients who develop intractable epilepsy. Gene therapy represents a potential treatment that is less invasive.

4

seizure genesis overlaps with tissues that serve important sensory or motor functions. For

these patients, preventing seizure spread by surgically interrupting the hyperexcitable

circuits is accomplished through procedures like amygdalo-hippocampectomy and

corpuscollosectomy. Surgical complications such as visual field deficits, transient or

persistent hemiparesis, infections, epidural hematoma, dysphasia, global memory deficits,

and transient psychosis or depression may also limit success (Siegel 2004). Although

current surgical procedures can be beneficial to patients, more effective and potentially

less invasive treatment strategies need to be designed.

Theoretically, a gene therapy approach to seizure suppression is an attractive

alternative treatment option for focal epilepsy. Focal epilepsy arises from a

circumscribed and hyperexcitable network of neurons whose synchronous electrical

discharge creates seizure activity. Since the area of seizure genesis is confined, the

localized nature of in vivo gene therapy should prove capable of influencing a site that

initiates seizure activity, therefore preventing the cascade leading to seizure spread. One

significant advantage of localized gene delivery is the limited exposure of the rest of the

brain and body to the therapeutic compounds, thereby minimizing the potential for

unwanted side effects. Furthermore, gene therapy allows for localized de novo synthesis

of the therapeutic compounds in the brain, surmounting the difficulty of delivering

therapeutic compounds with short half-lives across the otherwise impermeable blood

brain barrier.

I.B. Gene Therapy

The primary goal of gene therapy is to provide long term and effective treatment

of a disease by delivering therapeutic genes into the patient’s target cells. Gene therapy

5

offers the possibility that chronic disease progression (which occurs with medically

intractable seizures) can be halted and the symptoms can be controlled, substantially

increasing the quality of life for the patient. Using a virus as a means to deliver

therapeutic genes circumvents many of the problems that non-viral vector-based gene

therapy is subject to, such as inefficient gene transfer and transient gene expression

(Huang, Hung et al. 1999). In order to complete their lifecycle, viruses must efficiently

deliver their genes into the nucleus of a host cell. Thus, viruses can be exploited as

excellent gene delivery tools by substituting therapeutic genes in place of viral genes.

Focal epilepsy would be very amenable to viral gene therapy particularly because

viruses like adenovirus (Ad), lentivirus, and adeno-associated virus (AAV) are capable of

infecting post-mitotic neurons. This provides direct access to the cells responsible for

generating and propagating the seizure activity; and which are otherwise difficult to

genetically manipulate. Ad is a non-enveloped, double stranded DNA virus that causes

mild upper respiratory tract infections in humans. Ad vectors have a large packaging

capacity (up to 37kb), can infect both dividing and quiescent cells, and remains episomal

after infection, with a very low probability of randomly integrating into the host cell’s

chromosomes (Schiedner, Morral et al. 1998; Harui, Suzuki et al. 1999). The use of Ad

vectors in the brain is controversial because it has been reported to cause vector-

associated toxicity and inflammation (Wood, Charlton et al. 1996; Thomas, Birkett et al.

2001; McMenamin, Lantos et al. 2004). In addition, Ad-mediated gene expression is

unstable in the brain over time (Thomas, Birkett et al. 2001; McMenamin, Lantos et al.

2004).

6

Lentiviral vectors (HIV based) are effective in transducing neurons, do not seem

to cause cytotoxicity upon central nervous system (CNS) infection, and are capable of

long term transgene expression (Blomer, Naldini et al. 1997; Bosch, Perret et al. 2000).

However, since lentiviral vectors randomly integrate into the host cell’s genome, they can

cause insertional mutagenesis. These random insertions may disrupt or activate cellular

genes including oncogenes. Recently, class 1 non-integrative lentiviral vectors derived

from HIV type 1 were developed and characterized in brain tissue (Philippe, Sarkis et al.

2006; Yanez-Munoz, Balaggan et al. 2006). These vectors can be further modified to be

self-inactivating (Miyoshi, Blomer et al. 1998), a combination that substantially reduces

the risks of insertional mutagenesis and replication-competence, thereby generating safer

lentiviral vectors for gene therapy in the brain.

AAV vectors which are based on a non-pathogenic and replication deficient virus

offer the safest method of viral gene delivery in the brain. In addition, AAV vectors are

capable of long term stable gene expression and do not elicit an immune response upon

infection, making it the viral vector of choice in clinical trials for neurological diseases

(see Table 1-1 and http://www.wiley.co.uk/wileychi/genmed/clinical/).

I.C. AAV Biology

Wild type AAV (wtAAV) is a non-enveloped single stranded DNA virus

belonging to the Parvovirus family. Although the virus is prevalent in the human

population (about 80% of humans are seropositive to AAV2 (Tobiasch, Rabreau et al.

1994), infection is not associated with any known disease (Blacklow, Hoggan et al.

1968). Because of this, the virus is said to be nonpathogenic. AAV is classified as a

dependovirus because it is replication deficient, and cannot cause a productive infection

http://www.wiley.co.uk/wileychi/genmed/clinical/

7

Table 1-1. Current AAV-mediated Gene Therapy Clinical Trials for Neurological Diseases. This data is current to July 2007. For more details on these clinical trials please see: http://www.wiley.co.uk/wileychi/genmed/clinical/ Trial ID: Title: Gene Disease

US-469 Subthalamic GAD Gene Transfer in Parkinson’s Disease Patients Who Are Candidates for Deep Brain Stimulation.

Glutamic acid decarboxylase 65-67 (GAD 65-67)

Parkinson's Disease

US-593 A Phase I Open-Label Safety Study of Intrastriatal Infusion of Adeno-Associated Virus Encoding Human Aromatic L-amino Acid Decarboxylase (AAV-hAADC-2) in Subjects with Advanced Parkinson's Disease

Aromatic L-amino Acid Decarboxylase (AADC)

Parkinson's Disease

US-623 A Phase I/II, Dose-Escalating, Randomized and Controlled Study to Assess the Safety, Tolerability, and Efficacy of CERE-110 [Adeno-Associated Virus (AAV)-based, Vector-Mediated Delivery of beta-Nerve Growth Factor (NGF)] in Subjects with Mild to Moderate Alzheimer's Disease

Nerve growth factor (NGF)

Alzheimer's Disease

US-669 Hippocampal NPY Gene Transfer in Subjects with Intractable Temporal Lobe Epilepsy

Neuropeptide Y (NPY)

Epilepsy

US-689 A Phase I, Open-Label Study of CERE-120 (Adeno-Associated Virus Serotype 2 [AAV2]-Neurturin [NTN]) to Assess the Safety and Tolerability of Intrastriatal Delivery to Subjects with Idiopathic Parkinson's Disease

Neurturin (NTN)

Parkinson's Disease

US-788 Multicenter, Randomized, Double-Blind, Sham Surgery-Controlled Study of CERE-120 (Adeno-Associated Virus Serotype 2 [AAV2]-Neurturin [NTN]) to Assess the Efficacy and Safety of Bilateral Intraputamenal (IPu) Delivery in Subjects With Idiopathic Parkinson's Disease

Neurturin (NTN)

Parkinson's Disease


http://www.abedia.com/wiley/record_detail.php?ID=902






8

unless facilitated by a helper virus such as Ad or Herpes Simplex virus (HSV) (Buller,

Janik et al. 1981; Bauer and Monreal 1986). When helper viruses are absent and the host

cell is not subjected to DNA damaging agents or metabolic inhibitors, AAV will establish

a latent infection within the cell (Yalkinoglu, Heilbronn et al. 1988). This latent infection

will occur by site-specific integration of AAV into the host genome at human

chromosome 19q13.3qter AAVS1 site (Samulski, Zhu et al. 1991; Muzyczka 1992), by

AAV persistence as an episome within the nucleus (Yue and Duan 2003; McCarty,

Young et al. 2004), or by random integration at chromosomal double-strand breaks

(Miller, Petek et al. 2004). AAV is stable in this latent state and can persist for years

until rescued by helper virus co-infection, which reinitiates the lytic cycle (Cheung,

Hoggan et al. 1980) (see Figure 1-2).

AAV virions are comprised of a linear single-stranded DNA genome of 4.7 kb,

which is encapsidated by a non-enveloped icosahedral shell, measuring approximately 22

nm in diameter. The elegant simplicity of the genome is astounding, with only two genes

rep (replication) and cap (capsid) encoding nonstructural and structural proteins

respectively. From a single open reading frame (ORF) the rep gene encodes four

replication proteins (Rep78, Rep 68, Rep 52, and Rep 40), which collectively are

responsible for site-specific integration, DNA nicking, and helicase activity. Rep

proteins also respond to intracellular cues (like the presence of helper virus) to regulate

the AAV promoters that drive expression of its genome (Pereira, McCarty et al. 1997).

The cap gene encodes three overlapping proteins (VP1, VP2, and VP3) which differ from

each other only by their N terminus (Rose, Maizel et al. 1971; Berns and Linden 1995).

Together they assemble into the capsid which is made up of 60 subunits with

9

Figure 1-2 AAV Latent and Lytic Life Cycles. In the absence of helper virus, AAV latently integrates into host chromosomes, with 70% of the genomes being targeted to the human chromosome 19q13.3qter AAVS1 site. If the cells are then superinfected with a helper virus, AAV enters its lytic phase and initiates virus replication. AAV can also immediately enter its lytic phase upon helper virus co-infection, resulting in the replication of both AAV and the helper virus.

wtAAV

19q13.3qter

Ad

Helper Virus Co-infection

Cell Lysis

Helper Virus Infection

Cell Lysis

Latent Infection

wtAAV

19q13.3qter 19q13.3qter 19q13.3qter

Ad

Helper Virus Co-infection

Cell Lysis

Helper Virus Infection

Cell Lysis

Latent Infection

10

approximately a 1:1:20 ratio and T=1 icosahedral symmetry (Rose, Maizel et al. 1971;

Muzyczka 1992). The rep and cap genes are flanked by the AAV inverted terminal

repeats (TR), which are the only cis-acting elements required for genome replication and

packaging (Samulski, Chang et al. 1987; Samulski, Chang et al. 1989).

I.D. AAV Vectors

Since the AAV TR is the only required cis-element for replication and

encapsidation, the two viral genes (rep and cap) can be removed and replaced by a

transgene expression cassette (see Figure 1-3). As long as rep and cap are provided in

trans, AAV vectors can be produced and subsequently purified. Building on experiments

by Ferrari et al., (1996) which demonstrated that Ad helper function could be conferred

using noninfectious Ad DNA, pioneering work was done by Xiao, Li, and Samulski,

allowing production of high titer AAV vectors in the absence of contaminating helper

viruses (Ferrari, Samulski et al. 1996; Ferrari, Xiao et al. 1997; Xiao, Li et al. 1998).

Consequently these vectors are safer for clinical trial applications. In addition, there are

approximately 300 nucleotides of viral DNA present in the AAV vector expression

cassette (the TR), and this sequence is not translated into viral proteins. Perhaps this lack

of translated viral proteins reduces the risk of AAV vector genomes eliciting a host cell

immune response, and may contribute to the longevity of transgene expression (longer

than 3 years in humans) (Duan, Sharma et al. 1998; Jiang, Pierce et al. 2006).

Along with its lack of immunogenicity and pathogenicity, AAV vectors have a

broad tissue tropism (e.g. brain, liver, muscle) and can transduce both mitotic and

quiescent cells (During, Samulski et al. 1998; Song, Morgan et al. 1998; Ye, Rivera et al.

1999; Acland, Aguirre et al. 2001; Flotte 2001), reinforcing the suitability of rAAV for

11

Figure 1-3. Comparing wtAAV to rAAV. A. The wtAAV genome encodes two viral genes, the rep and cap, and is flanked by terminal repeats (TR). The four Rep proteins: Rep78, Rep68, Rep52 and Rep40 are responsible for site-specific integration, DNA nicking, and helicase activity. All four proteins are transcribed from the p5 and p19 promoters and by alternative splicing. The three viral structural proteins VP1, VP2, and VP3 share the same C-terminus and form trimers and pentamers that ultimately come together and encapsidate the single stranded genome. They are transcribed from the p40 promoter and by alternative splicing. B. Since the AAV terminal repeats are the only cis-elements required for viral vector (a.k.a. recombinant AAV or rAAV) production, rep and cap can be removed and replaced by a transgene expression cassette. As long as rep and cap are provided in trans, AAV vectors can be produced and subsequently purified.

wtAAV

A.

p19 p40 polyA

Rep Cap

Vp2

Vp1

Vp3

Rep 78

Rep 52

Rep 40

Rep 68

p5

Promoter Transgene

rAAV

B.

polyA

12

clinical trials in brain. Several AAV serotypes have been tested in the brain, although not

every serotype was tested at the same time in the same model. While there is some

variability, some generalizations can be made: capsids from AAV9, AAV8, AAV7, and

AAV5 cause transduction in neurons (and a few glia) farthest from the site of injection

(Klein, Dayton et al. 2006; Taymans, Vandenberghe et al. 2007; Klein, Dayton et al.

2008), followed by AAV1 (Burger, Gorbatyuk et al. 2004) which still transduces neurons

farther away than AAV2, which seems to have the most localized effects. AAV4 appears

to transduce ependymal cells exclusively, severely limiting its use as a vector for

neurological diseases (Davidson, Stein et al. 2000). Furthermore, with the discovery of

novel serotypes and the ability to engineer new capsid mutations by rational design and

directed evolution approaches, it is now possible to enhance viral transduction and

targeting (see Chapter 5 for detailed discussion).

Despite its many advantages, there are a few drawbacks to using AAV vectors.

Perhaps the primary concern is the vector’s limited packaging capacity (approximately

5kb). AAV vectors can package genomes up to 6kb, but infectivity drops dramatically

when the genome is larger than that of wtAAV (Grieger and Samulski 2005). However,

there are elegant ways of surmounting this obstacle, such as shortening and optimizing

the components of the expression cassette (promoter, therapeutic gene sequence, and

polyA), or employing a split vector system. A split vector system divides the coding

sequence of the transgene in two, such that each one is packaged in a separate vector

which relies upon co-infection, and the ability of AAV vectors to concatamerize with one

another to allow gene expression (Duan, Yue et al. 2003).

13

Another concern that potentially limits AAV vector efficiency is the ability and

speed with which the infected cells orchestrate viral genome second strand synthesis.

Since traditional AAV vectors are single stranded, the DNA must be converted to a

double stranded form before gene expression can be initiated, and the process is

dependent upon the host cell-mediated DNA synthesis (Ferrari, Samulski et al. 1996;

Fisher, Gao et al. 1996). One way to overcome this obstacle was pioneered by McCarty

et al, and involves generating a self-complimentary AAV vector (scAAV) that upon

uncoating could fold back on itself through intramolecular base pairing, creating a

duplexed form (McCarty, Monahan et al. 2001; McCarty, Fu et al. 2003; Wang, Ma et al.

2003). Once duplexed, the efficiency with which transcriptionally active double stranded

molecules are formed is greatly enhanced. Not only does this scAAV vector allow gene

expression to occur much faster, it also has been reported to increase the level of

transgene expression (McCarty, Monahan et al. 2001; Yang, Schmidt et al. 2002). While

these vectors have shown great promise, they are even further limited in their packaging

capacity to around 2.3kb (Wu, Zhao et al. 2007), which may restrict the range of

therapeutic applications.

I.E. Potential Gene Therapy Targets for Epilepsy

Due to the diverse etiology of epilepsy, there are sure to be multiple genes and

mechanisms involved in seizure genesis and epilepsy-induced pathology. While this may

mean that there will not be “one cure to fit them all,” many potential therapeutic targets

can be investigated. Seizure activity is most likely the result of inadequate neuronal

inhibition, excessive neuronal excitation, or a combination of the two states (Engel 1996;

Holmes 1997; Bernard, Hirsch et al. 1999; Ying and Najm 2002). Neuronal inhibition is

14

primarily achieved through GABAergic neurotransmission, and loss of this inhibition has

been implicated in epilepsy, making GABA a good therapeutic target. This is evident by

the fact that many of clinically effective AEDs enhance GABA action either by

increasing the time GABA remains in the synapse (by blocking its intracellular

catabolism or by blocking its reuptake transporter, GAT1), or by acting at GABA

receptors (to increase chloride ion flux into the neuron which hyperpolarizes it and

prevents the firing of new action potentials).

As mentioned before, many patients with epilepsy do not respond to these drugs,

and some patients respond initially, but relapse over time. Perhaps the same problems

will occur with gene therapies directed at GABA. One possible mechanism for decreased

drug efficacy is GABA receptor desensitization, a process whereby overstimulation leads

to the removal of the receptors at and around the synapse by endocytosis (Galpern, Miller

et al. 1990; Qi, Yao et al. 2006), eventually causing a loss of GABA binding, and shifts

the neuronal inhibitory tone toward excitation. Once neurons become hyperexcitable,

they fire action potentials and release glutamate until synchronized excitation can cause

hyperexcitable circuits that kindle seizure genesis. If left untreated, excitotoxicity ensues,

leading to epilepsy-induced pathologies like hippocampal sclerosis, mossy fiber

sprouting, and neuronal death. In fact, administration of a glutamate agonist, kainic acid

is the model we and others use to induce limbic seizures in naïve animals, emphasizing

that a reduction in glutamate action can be a good therapeutic target. There is evidence

from many investigators that epilepsy enhances several other excitatory neurotransmitters

like glycine, aspartate, acetylcholine, N-methyl-D-aspartate (NMDA), α-amino-3-

hydroxy-5-methylisoxazole-4- propionic acid (AMPA), and second messengers like

15

calcium and cyclic GMP (Ure and Perassolo 2000). Even channels for ions such as

sodium, potassium, and calcium regulate neuronal excitability, and their manipulation

could provide in vivo seizure control. However, a liability with many of these targets in a

gene therapy context is that success will depend on the pattern of neuronal transduction,

i.e. the type of neuron and its position within a functional circuit will influence seizure

outcome. For example, reducing excitatory tone of a primary output neuron will reduce

overall excitability, but reducing excitatory tone of an inhibitory interneuron may actually

increase seizure severity.

Perhaps the therapeutic target that holds the greatest potential for treating focal

epilepsy is neuropeptides. Neuropeptides are larger than classical neurotransmitters but

smaller than most proteins, and have less complex tertiary structure. Their main function

is to modulate the release of neurotransmitters, which can influence neuronal excitability.

Neuropeptides diffuse more slowly (100-500ms) but bind tighter to their receptors than

classical neuropeptides (2-5ms), enabling slow long-lasting changes (Hokfelt, Bartfai et

al. 2003). They can also travel to receptors somewhat distant from their release site, a

phenomenon called volume transmission that was first described by Agnati and Fuxe in

1986 (Agnati, Bjelke et al. 1995). Since neuropeptides can influence autoreceptors as

well as the receptors on surrounding neurons, transduction of a few cells within the

seizure focus may result in more wide-spread seizure suppression that is independent of

transduction pattern. To date, the neuropeptides best studied as therapeutics for epilepsy

are neuropeptide Y (NPY) and galanin (see Table 1-2), but others such as dynorphin,

somatostatin, and cholecystokinin have shown some promise.

16

Table 1-2. Potential Therapeutic Targets that Influence Seizure Behavior. Abbreviations are: AAV: adeno-associated virus; ASPA: aspartoacylase; Ad: adenovirus; CB: cytomegalovirus enhancer, chicken beta-actin promoter; CMV: cytomegalovirus promoter; GAD: glutamic acid decarboxylase; GDNF: glial-derived neurotrophic factor; ICP10PK: ICP 10 protein kinase; ih: intrahippocampal; ip: intraperitoneal; NMDA: N-methyl-D-aspartate; NPY: Neuropeptide Y; NSE: neuron- specific enolase; SER: spontaneously epileptic rats; SN: substantia nigra; TET off: tetracycline-off regulatable promoter; WPRE: woodchuck hepatitis virus post-transcriptional element. Target Placement Delivery vector Experimental model Functional effect References Adenosine

Intracerebroventricular

Grafting of fibroblasts or myoblasts

Hippocampal kindling Suppression of generalized

seizures

(Huber, Padrun et al. 2001; Guttinger, Padrun et al. 2005)

Anti NMDA Collicular cortex AAV-CMV vector Focal electrical stimulation Increased seizure threshold (Haberman, Criswell et al. 2002)

AAV-TEToff vector

Decreased seizure threshold

(Haberman, Criswell et al. 2002)

Orogastric tube delivers vector to stomach (oral vaccine)

AAV-CMV

Kainic acid ip

Seizure inhibition, neuroprotection

(During, Symes et al. 2000)

ASPA


Ad-CB vector

Spontaneous seizures in SER

Transiently reduced incidence of tonic seizures (2 weeks)

(Seki, Matsubayashi et al. 2004)

Cholecystokinin Intracerebroventricular Lipofectin and plasmid Audiogenic seizure-prone rats

Transient seizure inhibition (1 week) (Zhang, Li et al. 1997)

GABAAR Hippocampus AAV-GABAR4 Pilocarpine-induced Status Epilepticus

Transiently reduced spontaneous seizures (4 weeks)

(Raol, Lund et al. 2006)

GAD65 Anterior SN Grafting of neuronal or glial cell lines Entorhinal kindling Delayed rate of kindling

(Thompson, Anantharam et al. 2000)

Posterior SN

Faster rate of kindling (Thompson, Anantharam et al. 2000)

Anterior SN

Grafting neuronal cell line

Pilocarpine-induced Status Epilepticus

Reduced spontaneous seizures

(Thompson and Suchomelova 2004)

Piriform cortex


Amygdala kindling

Increased threshold to seizures

(Gernert, Thompson et al. 2002)

GAD67 SN pars reticulata Grafting of mixed neuronal and glial cell line

Kainic acid ip Delayed seizure behavior (Castillo, Mendoza et al. 2006)

Galanin Collicular cortex AAV-TEToff vector+FIB secretory sequence

Increased seizure threshold (Haberman, Samulski et al. 2003)

Hippocampus

AAV-TEToff vector+FIB secretory sequence

Kainic acid ip

Neuroprotection

(Haberman, Samulski et al. 2003)

AAV-NSE vector+WPRE

Kainic acid ih

Reduced number of seizures

(Lin, Richichi et al. 2003)

Piriform cortex

AAV-CB vector+FIB secretory sequence

Kainic acid ip

Seizure inhibition

(McCown 2006)

Focal electrical stimulation Increased seizure threshold (McCown 2006)

GDNF

Hippocampus

AAV-CB vector+WPRE

Hippocampal kindling

Decreased number of generalized seizures, increased seizure threshold

(Kanter-Schlifke, Georgievska et al. 2007)

Hippocampus

Ad-CMV vector

Kainic acid ip

Delayed seizure behaviors, neuroprotective

(Yoo, Lee et al. 2006)

ICP10PK

Intranasal vaccine

HSV-2∆RR –ICP10 vector

Kainic acid ip

Reduced seizure behaviors, neuroprotection

(Laing, Gober et al. 2006; Laing and Aurelian 2008)

NPY

Hippocampus

AAV-NSE vector+WPRE

Kainic acid ih Delayed seizure behavior

(Richichi, Lin et al. 2004)


Increased seizure threshold and delayed rate of kindling

(Richichi, Lin et al. 2004)

Piriform cortex


Kainic acid ip Reduced and delayed seizure behaviors

(Foti, Haberman et al. 2007)

NPY 13-36

Piriform cortex


Kainic acid ip Reduced and delayed seizure behaviors

(Foti, Haberman et al. 2007)

17

I.F. Ex Vivo Gene Therapy

There are two basic modalities for gene therapy: ex vivo gene therapy which relies

on genetically modifying cells in vitro then implanting them into the target tissue, or in

vivo gene therapy where the transfer of genetic material occurs directly within the host

via viral or non-viral mediated gene delivery (see Figure 1-4). To date, ex vivo gene

therapy experiments in brain have been carried out using fibroblasts (Huber, Padrun et al.

2001), myoblasts (Lisovoski, Wahrmann et al. 1997; Guttinger, Padrun et al. 2005), CNS

progenitor cells (Martinez-Serrano and Bjorklund 1997), immortalized neurons (Gernert,

Thompson et al. 2002; Longhi, Watson et al. 2004), and astrocytes (Lundberg, Horellou

et al. 1996; Ericson, Wictorin et al. 2002). In order for this ex vivo approach to be

successful in treating epilepsy, the implanted cells must be engineered to secrete a

product that will enhance neuronal inhibition. In the Boison lab, genetically engineered

fibroblasts (Huber, Padrun et al. 2001) and myoblasts (Guttinger, Padrun et al. 2005)

were made to secrete the inhibitory neuromodulator adenosine, and then grafted into the

lateral ventricles or hippocampus of rats. While the rate of limbic kindling was

significantly attenuated during the first week post-implantation, by the fourth week there

was a drastic reduction of seizure suppression. The authors determined that the loss of

therapeutic efficacy was due to low viability of the grafted cells. These results point to a

universal problem with ex vivo gene therapy: the loss of graft viability over time. With

regard to epilepsy gene therapy, the gene product must remain functional for a long

period of time, hence the clinical potential of grafting modified cells in the brain is very

low (McCown 2004).

18

Figure 1-4. Ex Vivo versus In Vivo Viral Gene Delivery.

2. Culture Cells

4. Inject Genetically Modified Cells into Rodent

3. Infect Cells with Virus Encoding Therapeutic Gene

1. Harvest Cells from Rodent

A. Ex Vivo Viral Gene Therapy

2. Culture Cells
















B. In Vivo Viral Gene Therapy

1. Inject Virus Encoding Therapeutic Gene Directly into Rodent

B. In Vivo Viral Gene Therapy

1. Inject Virus Encoding Therapeutic Gene Directly into Rodent

19

More recently the Boison lab has used genetically engineered human

mesenchymal stem cells (hMSC) where lentiviral RNAi mediates knockdown of

adenosine kinase (ADK), the gene responsible for adenosine metabolism and influx from

the extracellular space back into cells (Ren, Li et al. 2007). The authors demonstrate

reduced seizure duration and neuronal loss after graft implantation in the hippocampus

followed by intra-amygdaloid injection of kainic acid (Ren, Li et al. 2007). This type of

approach would be compatible with autologous cell grafting in patients, and thus

represents a potential clinical therapy if the grafts of mesenchymal stem cells can remain

viable in the brain over time.

The Boison lab is also currently exploring implantation of genetically modified

embryonic stem cell-derived neural precursors with biallelic genetic disruption of ADK

(Li, Steinbeck et al. 2007). Implanting these grafts into the hippocampus caused

increased levels of extracellular adenosine and suppressed kindling epileptogenesis (Li,

Steinbeck et al. 2007). While the authors only conducted these experiments for 26 days,

they see integration of the grafted cells and neuronal maturation markers expressed in

about half of their grafted cells; leading the authors to speculate that graft viability may

extend beyond the limited time course analyzed.

I.G. In Vivo Viral Vector-Mediated Alterations in Receptor Function

As mentioned before, enhancing inhibitory receptor function may be an effective

target for antiepileptic gene therapy. Thus, an obvious approach would be to increase

GABA-mediated fast neuronal inhibition, which is achieved through GABAA receptors

(GABRs). GABRs are made up of several subunits whose combinations confer a range

of pharmacological function. For example, it has been reported that GABRs rich in

20

GABRα4 and poor in GABRα1 have been found in both humans with temporal lobe

epilepsy and in rodent models of epilepsy, and show reduced GABA-mediated inhibition

in the presence of zinc (Buhl, Otis et al. 1996; Gibbs, Shumate et al. 1997; Brooks-Kayal,

Shumate et al. 1998; Brooks-Kayal, Shumate et al. 1999). In addition, after pilocarpine-

induced status epilepticus, GABRα4 expression increases while GABRα1 expression

decreases in the dentate gyrus of adult rats (Brooks-Kayal, Shumate et al. 1998). While

these adult rats go on to develop spontaneous seizures, postnatal day 10 rats that are

subjected to the same paradigm fail to develop spontaneous seizures (Zhang, Raol et al.

2004). Furthermore, the postnatal day 10 rats exhibit an increase in GABRα1 expression

in dentate gyrus neurons (Zhang, Raol et al. 2004), suggesting that overexpression of

GABRα1 may confer seizure protection if overexpressed in the adults. To investigate

this hypothesis, Raol et al. used an AAV5 vector to express GABRα1 from the GABRα4

promoter in adult rats subsequently injected with pilocarpine (Raol, Lund et al. 2006).

While it was a good idea to use a conditional promoter whose expression is known to be

upregulated by pilocarpine treatment, only transient expression of the transgene GABRα1

was observed (about 4 weeks). A more robust promoter like the constitutively active

cytomegalovirus enhancer, chicken beta-actin promoter (CB) could be used to prevent

this. Even though the effects were transient and not uniform, some seizure protection

was observed; however, about 30% of the rats receiving GABRα1 developed behavioral

phenotypes that were not desirable, including excessive sedation, and anorexia (Raol,

Lund et al. 2006). These results point to a therapeutic liability that must be considered,

and may be a universal risk of directly manipulating fast neuronal inhibition.

21

Another strategy to limit seizure activity would be to reduce or block excitatory

amino-acid receptors, which may help restore inhibitory tone and prevent excitotoxicity.

Since activation of NMDA receptors has been shown to increase seizure sensitivity

(McCown, Givens et al. 1987), it is logical to try to limit their activation. In fact, NMDA

channels are a good target for a gene therapy approach because although they are

comprised of multiple subunits that are coded for by several genes, each channel must

have the required NR1 subunit to be fully functional (Monyer, Sprengel et al. 1992;

Hollmann and Heinemann 1994; Yamakura and Shimoji 1999). Therefore, knockdown

of NMDAR1 protein should result in fewer functional NMDA channels. Haberman et al.

tested this hypothesis using an NMDAR1 antisense construct delivered by an AAV2

vector (Haberman, Criswell et al. 2002). While in vitro NMDAR1 receptor function and

in vivo NMDAR1 protein levels were significantly reduced, the seizure behavior outcome

was complicated by the promoter choice. When the antisense construct was driven by the

CMV promoter, a significant increase in the amount of current was necessary to elicit a

focal seizure (Haberman, Criswell et al. 2002). However, when expression of the same

antisense construct was driven by the tet-off promoter, there was a significant decrease in

the amount of current necessary to elicit a focal seizure. The authors go on to show that

the plausible explanation for the opposing results is that when the CMV promoter was

driving expression of the antisense NMDAR1, a majority of the transduced neurons were

primary output neurons that benefit from a reduction in excitatory input. When the tet-

off promoter was used, the majority of transduced neurons were inhibitory interneurons,

and the resulting reduction in NMDA activation increased the overall excitatory tone and

seizure sensitivity (Haberman, Criswell et al. 2002). This highlights another very

22

important liability when modulating receptors, ion channels, or even neurotransmitters

and transporters: results may be dependant upon the pattern of transduction.

I.H. In Vivo Viral Vector-Mediated Expression of Neuropeptides and Peptide Fragments

Neuropeptides and their receptors are found in areas often associated with seizure

generation, and their physiological effects are predominantly inhibitory suggesting anti-

convulsant action. In particular, both galanin and NPY (and their analogs) have anti-

convulsant effects in several models of experimentally induced seizures (Mazarati, Liu et

al. 1998; Mazarati, Hohmann et al. 2000; Mazarati and Wasterlain 2002; Haberman,

Samulski et al. 2003; Mazarati 2004; McCown 2006; Foti, Haberman et al. 2007).

Experimental evidence suggests that prolonged overstimulation, such as recurring

seizures, depletes galanergic innervation (Mazarati, Liu et al. 1998) and destroys a subset

of GABA-ergic NPY containing interneurons in the hippocampus (Sloviter 1991; Sperk,

Marksteiner et al. 1992; Schwarzer, Williamson et al. 1995). This finding was also

validated in patients with mesial temporal lobe sclerosis (de Lanerolle, Kim et al. 1989).

Taken together, these data suggest that overexpressing galanin and NPY in the ictogenic

brain regions may not only suppress seizures and prevent them from spreading, but might

also compensate for depleted neuropeptides, conferring some neuroprotection.

The use of AAV vectors to express galanin and NPY in the hippocampus and

piriform cortex has been explored with very good results. Haberman et al. first

demonstrated the anti-seizure efficacy of vector-mediated neuropeptide gene expression,

using a novel platform designed to circumvent the potential liabilities of viral vector

tropism (Haberman, Criswell et al. 2002; Haberman, Samulski et al. 2003). An AAV2

vector was constructed in which the coding sequence for the active galanin peptide was

23

preceded by the secretory signal sequence of the laminar protein, fibronectin. Thus, the

active peptide would be constitutively secreted from the transduced cell. The elegance of

this approach hinges on the fact that the newly synthesized neuropeptide will be

packaged in vesicles and continuously released, independent of neuronal activity,

essentially bypassing the traditional neuropeptide regulatory pathways. These studies

showed that the fibronectin secretion signal sequence (FIB) did cause constitutive

secretion of the gene product from transfected cells in vitro and, upon transduction in

vivo, significantly attenuated focal seizure sensitivity and prevented seizure-induced

hippocampal cell damage (Haberman, Samulski et al. 2003).

In a subsequent publication, Lin et al. found that AAV mediated expression of a

human galanin cDNA significantly decreased the number of kainic acid-induced seizure

episodes, but this approach did not alter seizure latency or kainic acid-induced neuronal

damage (Lin, Richichi et al. 2003). McCown then used an AAV2 vector where

expression was driven by the constitutively active CB promoter to deliver galanin to the

piriform cortex in rats (McCown 2006). The vector also contained the FIB sequence to

mediate constitutive secretion of the expressed galanin. This approach not only

prevented electrographic seizures, as measured by electroencephalography (EEG), but

also completely blocked seizure behavior, while delivery of green fluorescent protein

(GFP) had no effect (McCown 2006). Furthermore, in a kindling paradigm, vector-

derived galanin caused a significant increase in the amount of current necessary to elicit

limbic seizures compared to GFP control (McCown 2006). Taken together, these

experiments suggest that the piriform cortex is directly involved in mediating the onset

24

and severity of kainic acid-induced seizure behaviors. Thus, the piriform cortex is a good

place to deliver and test potential therapeutic targets for anti-seizure efficacy.

As previously discussed, there is evidence to suggest that NPY can exhibit anti-

seizure activity in vivo (Woldbye, Larsen et al. 1997; Mazarati and Wasterlain 2002;

Vezzani, Michalkiewicz et al. 2002), by acting primarily through NPY Y1, Y2, and Y5

G protein-coupled receptors in brain (Parker and Herzog 1999; Redrobe, Dumont et al.

1999). Each of these receptors has been reported to affect seizure genesis, but not via the

same mechanism. For example, in the dentate gyrus, activation of Y1 receptors results in

increased neuronal excitation (seizure permissive) (Brooks, Kelly et al. 1987), while

activation of Y2 (Colmers, Klapstein et al. 1991; El Bahh, Cao et al. 2002; Vezzani and

Sperk 2004) and Y5 receptors (Woldbye, Larsen et al. 1997; Marsh, Baraban et al. 1999;

Baraban 2002) mediate inhibitory and anti-convulsant actions. In addition, it has been

demonstrated that in epileptic tissue from patients (Furtinger, Pirker et al. 2001) and

rodents (Kofler, Kirchmair et al. 1997; Schwarzer, Kofler et al. 1998) Y1 receptors are

downregulated, whereas Y2 receptors are upregulated. Even Y5 receptors are transiently

upregulated following kindling and kainic acid-induced seizures (Kopp, Nanobashvili et

al. 1999; Vezzani, Moneta et al. 2000). Taken together, these results suggest that when

designing anti-epileptic therapeutics, it may be advantageous to deliver Y2/Y5-preferring

agonists. In fact, acute intracerebral delivery of the Y2 receptor preferring agonist

NPY13-36 reduces seizure susceptibility following systemic kainic acid administration

(Vezzani, Moneta et al. 2000; Vezzani, Rizzi et al. 2000). These data suggest NPY13-36

would be a good candidate to use in a rAAV vector to treat epilepsy. By using the FIB

secretion strategy, we have the capability of expressing and constitutively secreting

25

peptide fragments, which have demonstrated receptor selectivity. Thus, we infused

AAV2 vectors that mediate expression and constitutive secretion of NPY or the peptide

fragment NPY13-36 into the piriform cortex, and evaluated their ability to suppress

kainic acid-induced limbic seizure behaviors (see Chapter 3).

I.I. Combination Therapy

Delivering individual inhibitory neuropeptides to the brain to prevent seizures has

been well studied (see above), but to date no one has tried to deliver multiple

neuropeptides simultaneously from an AAV vector. In the last 20 years, many different

virus-based strategies were explored to co-express two genes from vectors: 1. internal

promoters, 2. internal initiation (IRES), 3. self-processing peptides (CHYSEL), 4. fusion

proteins, 5. proteolytic processing, and finally 6. a combination of separate vectors where

each carries one transgene (see Figure 1-5). Internal promoter vectors (sometimes

referred to as bicistronic vectors) have two transcriptional units, each with its own open

reading frame that results in the production of two proteins. While these vectors are quite

popular, problems arise because of the uncoupled transcription of both genes. For

example, it has been reported that transcriptional interference and promoter silencing can

result in the transcription of only one gene (Hippenmeyer and Krivi 1991; Nakajima,

Ikenaka et al. 1993; Zaboikin and Schuening 1998).

Internal initiation vectors have two sites of translation initiation and two open

reading frames on a single transcript. The first open reading frame is cap-dependent,

while translation of the second open reading frame depends upon an internal sequence

called an internal ribosomal entry site (IRES). The main concern with IRES vectors is

the reduced expression of the gene downstream of the IRES (typically 20-50% less than

26

Figure 1-5. Strategies to Co-express Gene Products. A) Internal promoter vectors have two transcriptional units, each with its own open reading frame that results in the production of two proteins. B) Internal initiation vectors have a single transcript with two open reading frames and two sites of translation. The first open reading frame is cap-dependent, while translation of the second open reading frame depends upon an internal sequence called an internal ribosomal entry site (IRES). C) Self-processing peptide or cis-acting hydrolase element (CHYSEL) vectors have a single transcriptional unit with a single open reading frame and one site of translation. The CHYSEL sequence is inserted in frame between the two protein sequences, and upon translation, the CHYSEL produces a disruption in translation. D) Proteolytic processing vectors also have a single transcriptional unit with a single open reading frame and one site of translation. The proteolytic cleavage sequence is cloned in frame as a linker, and a chimeric fusion protein is generated that is capable of undergoing post-translational cleavage in the presence of trans proteases. E) Fusion protein vectors have a single transcriptional unit with a single open reading frame and one site of translation. A single chimeric fused protein is generated. (Arrows depict promoters, star depicts cleavage site)

IP Gene 2 polyApolyAGene 1

AAA AAAProtein 1 Protein 2

A

Gene 1 Gene 2 polyAIRES

AAAProtein 1 Protein 2

B

polyA

AAAProtein 1 Protein 2 Post-translational Cleavage

and Removal of SequenceProtein 1 Protein 2

*

Gene 1 Gene 2Cleavage Sequence

D

Gene 2 polyAGene 1


E

Gene 2 polyACHYSEL

AAAProtein 1 CHYSE

Gene 1C

Protein 2L

IP Gene 2 polyApolyAGene 1

AAA AAAProtein 1 Protein 2

AIPIP Gene 2Gene 2 polyApolyApolyApolyAGene 1Gene 1

AAAAAA AAAAAAProtein 1Protein 1 Protein 2Protein 2

A



BGene 1 Gene 2 polyAIRES



AAA

Gene 1 Gene 2 polyAIRESGene 1Gene 1 Gene 2Gene 2 polyApolyAIRESIRES

AAAAAAProtein 1Protein 1 Protein 2Protein 2

B

polyA



*

Gene 1 Gene 2Cleavage Sequence

DpolyApolyA



*AAAAAA

Protein 1Protein 1 Protein 2Protein 2 Post-translational Cleavage

and Removal of SequenceProtein 1Protein 1 Protein 2Protein 2

*

Gene 1Gene 1 Gene 2Gene 2Cleavage SequenceCleavage Sequence

D

Gene 2 polyAGene 1


EGene 2 polyAGene 1


Gene 2Gene 2 polyApolyAGene 1Gene 1

AAAAAAProtein 1 Protein 2Protein 1Protein 1 Protein 2Protein 2

E

Gene 2 polyACHYSEL

AAAProtein 1 CHYSE

Gene 1C

Protein 2L

Gene 2Gene 2 polyApolyACHYSELCHYSEL

AAAAAAProtein 1 CHYSEProtein 1Protein 1 CHYSECHYSE

Gene 1Gene 1C

Protein 2L Protein 2Protein 2LL

27

the expression of the upstream gene) (Mizuguchi, Xu et al. 2000). Perhaps the biggest

drawback of both vector strategies discussed so far (internal promoters and IRES) is that

they contain large DNA sequences (often >0.5kb), which compete with the transgene for

a limited amount of space in an AAV vector (around 4.7kb).

Self-processing peptide or cis-acting hydrolase element (CHYSEL) vectors have a

single transcriptional unit and one site of translation with a single open reading frame.

The CHYSEL sequence is inserted in frame between the two protein sequences, and upon

translation, the CHYSEL produces a disruption in translation. The ribosome then

releases the first protein and continues to translate the second protein, resulting in the

production of two proteins (Donnelly, Luke et al. 2001). While it has been demonstrated

that higher levels of the second protein are achieved when using CHYSEL in contrast to

IRES (Furler, Paterna et al. 2001), a potential problem is that after processing, the

CHYSEL sequence remains fused to the C-terminus of the upstream protein, and an extra

proline residue will be added to the N-terminus of the second protein (de Felipe 2002).

This extra sequence may interfere with protein bioactivity, especially with relatively

small proteins such as neuropeptides that need to bind to receptors to initiate signaling.

Fusion protein vectors are the simplest way to co-express two proteins using a

single transcriptional unit and open reading frame. However, because both proteins

remain attached to each other, there may be a potential loss of function of one or both

proteins, especially if trying to deliver neuropeptides where high affinity receptor binding

is required to initiate signaling cascades. In addition, since fusion proteins are not

cleaved from one another, transport to different subcellular compartments is not feasible.

Therefore, fusion protein strategies could not be used to deliver both secreted proteins

28

and intracellular or membrane bound proteins, further limiting the applicability of this

approach.

There are also major drawbacks with using a co-infection of two separate vectors

where each carries one transgene. Three populations of transduced neurons will result

based on a Poisson distribution: some neurons will be transduced only by the first vector,

some neurons will be transduced only by the second vector, and some neurons will be

transduced by both. This kind of transduction pattern can complicate the analysis of

transgene interactions, because the observed therapeutic effects will not be attributable

solely to the co-transduced neurons. For these reasons we chose to pursue a proteolytic

processing vector strategy where a fusion protein gene product is processed into separate

bioactive proteins. This method will ensure that each transduced neuron expresses both

gene products, and utilizes only a small amount of the AAV vector genome, since

proteolytic cleavage consensus sequences can be as small as two amino acids (Seidah and

Chretien 1999). In addition, we can use this same strategy in the future to express more

than two therapeutic peptides simultaneously, and to manipulate the ratios of expressed

peptides by inserting multiple copies of the same peptide. Furthermore, by using a single

vector we can reduce viral particle number (and viral capsid proteins), which would

likely increase clinical safety.

As mentioned above, neuropeptides are typically synthesized as large pro-proteins

that upon being packaged into vesicles get cleaved into their mature form before

secretion. Furin is one such pro-protein convertase that is active in the constitutive

secretory pathway, and cleaves pro-proteins like neurotrophins, hormones, receptors,

plasma proteins, matrix metalloproteinases, viral envelope glycoproteins, and bacterial

29

endotoxins (Nakayama 1997). Furin cleaves precursors into bioactive proteins by

recognizing and cleaving strings of basic amino acids such as arginines and lysines. In

addition, furin is ubiquitously expressed in neurons and glia throughout the brain (Day,

Schafer et al. 1993), making it an ideal pro-protein convertase to target with our

constitutively secreted neuropeptides platform. The furin pathway has already been used

in a gene therapy context where a furin cleavage site was engineered into the rat

preproinsulin-I gene, which was then packaged into a recombinant retroviral vector and

delivered to the liver (Muzzin, Eisensmith et al. 1997). It was shown that correctly

processed and functional insulin could be secreted from the ectopic organ (Muzzin,

Eisensmith et al. 1997). In a subsequent study, Margaritis et al. used a furin cleavage

consensus sequence in an AAV vector cassette between Factor VIIa subunits, then

delivered the vector into the spleens of hemophiliac mice (Margaritis, Arruda et al. 2004).

Phenotypic correction was achieved using this strategy (Margaritis, Arruda et al. 2004).

While both of these studies demonstrate that engineering a furin cleavage

consensus sequence into a transgene can be successful in a gene therapy context, only

one functional protein was delivered. In a study by Gaken et al., a furin cleavage

consensus sequence was cloned in frame as a linker between two different proteins,

yielding a chimeric protein that can be post-translationally cleaved (Gaken, Jiang et al.

2000). These constructs contained combinations of cytokines or a cytokine and a trans-

membrane protein. They were packaged into retroviral constructs and used to infect

several cell lines where furin cleavage efficiency was evaluated. The authors reported

around 50% cleavage efficiency (Gaken, Jiang et al. 2000).

30

Previous experiments suggest that it is possible to use a proteolytic strategy to

deliver multiple peptides from AAV vectors, but to date no one has tried. We are in a

unique position to conduct these experiments and combine them with our constitutively

secreted neuropeptides platform. We expect improved cleavage efficiencies over

previous attempts because we are using a FIB sequence that will direct our chimeric

protein to the constitutive secretory pathway where furin is most active (Van de Ven,

Creemers et al. 1991). We first proved the concept that the therapeutic gene galanin and

the reporter gene GFP could be correctly cleaved from one another and secreted into the

medium of transfected cells in vitro. Then, we evaluated the in vivo function of each

protein by packaging the cleavable galanin-GFP gene into AAV2 vectors, and infusing

them into the piriform cortex of rats that subsequently received injections of kainic acid

(see Chapter 3). We visualized the GFP protein expression in the piriform cortex

confirming its function, and we evaluated the ability of vector-derived galanin to block

the limbic seizure behaviors elicited by the kainic acid administration. Finally, we

replaced the reporter gene with NPY13-36 and evaluated the combined effects of vector-

derived galanin plus NPY13-36 on kainic acid-induced limbic seizures (see Chapter 3).

Chapter 2

Methods

II.A. rAAV Vectors: Cloning and Construction

II.A.1. Cloning Plasmids for rAAV-CB-FIB-NPY and rAAV-CB-FIB-NPY13-36

The expression cassette backbone is the same for both NPY and NPY13-36

plasmids, where gene expression is driven by the hybrid chicken beta-actin promoter, the

mature coding sequence of the transgene is followed by the SV-40 polyadenylation

sequence (polyA), and the cassette is flanked by AAV2 TRs. The full length NPY active

peptide sequence was amplified by RT-PCR from rat brain RNA using primers directed

to the mature peptide sequence, such that melting and reannealing of two separate PCR

products resulted in 5’ AgeI and 3’ NotI overhangs (Zeng 1998). The 3’ primer included

a stop codon to properly terminate translation. The sequence of the primers used is as

follows: (NPY 5’ long) CCG GTA ATG TAC CCC TCC AAG CCG; (NPY 5’ short) TA

ATG TAC CCC TCC AAG CCG; (NPY 3’short) GC TCA ATA TCT CTG TCT GGT

G; (NPY 3’ long) GGC CGC TCA ATA TCT CTG TCT GGT G. The PCR product was

ligated into the AgeI-NotI sites of the AAV2 backbone plasmid, resulting in the plasmid

pTR-CB-NPY. Next, the fibronectin signal sequence (nucleotides 208–303) was derived

from the rat fibronectin mRNA sequence (GenBank Accession No. X15906) and

oligonucleotides corresponding to both strands were generated (Midland Certified

Reagent Co.). AgeI overhangs were included such that the annealed oligonucleotides

32

could be ligated in front of NPY, resulting in the plasmid pTR-CB-FIB-NPY. For NPY

13-36, the same cloning strategy was used, except the plasmid pTR-CB-FIB-NPY served

as the PCR template and cloning backbone. The primers used to generate NPY13-36

were as follows: (NPY13-36 5’ long) 5’-CCG GTA ATG CCA GCA GAG GAC ATG-

3’, (NPY13-36 5’ short) 5’-TA ATG CCA GCA GAG GAC ATG GC-3’, (NPY13-36 3’

short) 5’-GC TCA ATA TCT CTG TCT GGT G-3’, (NPY13-36 3’ long) 5’-GGC CGC

TCA ATA TCT CTG TCT GGT G-3’. Again, the PCR product was ligated into the

AgeI-NotI site of pTR-CB-FIB-NPY, replacing the “FIB-NPY”. Then the annealed FIB

oligonucleotides were ligated into the AgeI site resulting in the plasmid pTR-CB-FIB-

NPY13-36. All plasmids were sequenced to verify accuracy.

II.A.2. Cloning Plasmids for Multiple Gene Product Delivery Vectors

The plasmids pTR-CB-EGFP, pTR-CB-FIB-EGFP, and pTR-CB-FIB-GAL were

generated as previously described (McCown 2006). Briefly, gene expression is driven by

the hybrid chicken beta-actin promoter, the mature coding sequence of the transgene is

followed by the SV-40 polyA, and the cassette is flanked by AAV2 TRs. The plasmid

EGFP-N1 was purchased from BD-biosciences-clontech, and the GFP was digested out

using AgeI-NotI restriction sites. The fragment was gel purified and ligated into the

AgeI-NotI sites of the AAV2 plasmid backbone, resulting in the plasmid pTR-CB-EGFP.

Then the annealed FIB oligonucleotides were ligated into the AgeI site resulting in the

plasmid pTR-CB-FIB-EGFP. The galanin sequence was amplified by RT-PCR from rat

brain RNA using primers directed to the mature peptide sequence, such that melting and

reannealing of two separate PCR products resulted in 5’ AgeI and 3’ NotI overhangs

(Zeng 1998). The 3’ primer included a stop codon to properly terminate translation. The

33

sequence of the primers used is as follows: (Gal 5’ long) 5’-CCG GTA ATG GGC TGG

ACC CTG AAC-3’, (Gal 5’ short) 5’-TA ATG GGC TGG ACC CTG AAC-3’, (Gal 3’

short) 5’-GC TCA TGT GAG GCC ATG CTT G-3’, (Gal 3’ long) 5’-GGC CGC TCA

TGT GAG GCC ATG CTT G-3’. The PCR product was ligated into the AgeI-NotI sites

of the AAV2 plasmid backbone, resulting in the plasmid pTR-CB-GAL. Then the

annealed FIB oligonucleotides were ligated into the AgeI site resulting in the plasmid

pTR-CB-FIB-GAL. Using pTR-CB-FIB-GAL as a backbone, the other plasmids were

generated by PCR so the furin cleavage consensus sequence arginine-lysine-arginine-

arginine-lysine-arginine (RKRRKR) was cloned in frame between two genes. Briefly,

two pairs of oligonucleotides were designed for each construct, such that a forward and

reverse primer corresponded to each gene plus 3 of the six amino acids that make up the

furin consensus sequence (see Table 2-1). The oligonucleotides included the restriction

sites NheI and NotI that would be used for cloning. Two fragments each containing the

gene of interest plus half of the furin consensus sequence were generated by PCR, then

the products were digested with NheI and NotI, and ligated into the plasmid backbone

using a sticky-blunt-sticky ligation. All plasmids were sequenced to verify accuracy.

II.A.3. DNA Sequencing

All DNA sequencing was performed by the UNC Lineberger Cancer Center DNA

Sequencing Facility. Briefly, 10pmol of primer and 0.7μg of plasmid DNA were diluted

in water to a final volume of 20μL. Samples were further processed by the sequencing

facility.

34

Table 2-1 PCR Primers for Multiple Gene Product Delivery Vectors

Construct Name Primers Used Melting Temperature

TR-CB-FIB-GAL-RKRRKR-EGFP

F1= GTACGGAAGTGTTACTTCTGCTC R1= 5’PTCTCTTTCTTGTGAGGCCATGCTT F2= 5’PAGAAAGAGAATGGTGAGCAAGGGCGAGGAGC R2= CTTATCATGTCTGGATCCCCGCGGCC

55.0°C 56.0°C 66.0°C 64.0°C

TR-CB-FIB-EGFP-RKRRKR-GAL

F1= GTACGGAAGTGTTACTTCTGCTC R1= 5’PTCTCTTTCTCTTGTACAGCTCGTC F2= 5’PAGAAAGAGAGGCTGGACCTGAACAGCG R2= CTTATCATGTCTGGATCCCCGCGGCC

55.0°C 56.0°C 64.0°C 64.0°C

TR-CB-FIB-GAL-EGFP

F1= GTACGGAAGTGTTACTTCTGCTC R1= 5’PTGTGAGGCCATGCTTGTCGCT F2= 5’PATGGTGAGCAAGGGCGAGGAGCTG R2= CTTATCATGTCTGGATCCCCGCGGCC

55.0°C 56.0°C 63.0°C 64.0°C

TR-CB-FIB-GAL-RKRRKR-NPY13-36

F1= GTACGGAAGTGTTACTTCTGCTC R1= 5’PTCTCTTTCTTGTGAGGCCATGCTT F2= 5’P AGAAAGAGACCAGCAGAGGACATGGCC R2= CTTATCATGTCTGGATCCCCGCGGCC

55.0°C 56.0°C 63.0°C 64.0°C

35

II.B. In Vitro Methods

II.B.1. Cell Culture and Transfection

293 cells were cells were maintained at 37°C in a 5% CO2 atmosphere in

Dulbecco’s modified Eagle’s medium (DMEM), supplemented with 10% fetal bovine

serum (FBS) and penicillin-streptomycin (PS). Cells were plated at a density of 5.5x105

cells per mL medium in 60mm dishes the day prior to transfection. Cells were

transfected using the polyethyleneimine (PEI) technique (Grieger, Choi et al. 2006).

Forty-eight hours after transfection, cells were imaged then medium and lysates were

harvested. Briefly, medium was cleared by centrifugation at 2500 RPM at 4°C for 5

minutes to remove any cellular debris. Cells were scraped and rinsed with 2mL

Dulbecco phosphate buffered saline (DPBS) then lysed using 1mL lysis buffer (50mM

Tris pH8.0, 150mM NaCl, 50mM NaF, 1% NP-40) per 60mm plate. Lysates were

cleared by spinning in centrifuge at maximum speed at 4°C for 5 minutes, supernatant

was transferred to a clean tube.

II.B.2 Immunoprecipitation and Western Blotting

Immunoprecipitation of GFP was performed on cleared medium and lysates.

Briefly, medium and lysates were pre-incubated with 20μL Protein A Sepharose beads

(Amersham Biosciences) and rocked for 1 hour at 4°C to remove non-specific binding.

Supernatant was transferred to a clean tube. For medium 50μL Protein A beads and

10μL Living Colors Full-Length A.V. Polyclonal Antibody (BD) was added. For lysates

25μL Protein A beads and 5μL Living Colors Full-Length A.V. Polyclonal Antibody

(BD) was added. Samples were incubated overnight on a rocker at. Supernatant was

removed by vacuum and beads were washed 3 times using 1mL DPBS. Load dye was

added to beads along with water and betamercaptoethanol, then samples were boiled 5

minutes and cooled to room temperature before loading on 10% Bis-Tris gel (NuPage)

Samples were transferred by western blot to a nitrocellulose membrane and blocked using

10% nonfat milk in tris buffered saline + 0.1% Tween (TBST). Blot was incubated at

4°C overnight in 1:1000 dilution of primary antibody Living Colors A.V. Monoclonal

antibody JL-8 (BD). Blot was rinsed 3 times 5 minutes in TBST then incubated in a

1:3000 dilution of goat-anti-mouse HRP (Pierce) Signal was detected using the West

femto-chemiluminescence kit (Pierce) according to the manufacturer’s instructions.

II.C. rAAV Production, Purification, and Characterization

Recombinant AAV2 was produced and purified as previously described

(Rabinowitz, Rolling et al. 2002) with the following modifications: 293 cells (10 15cm

plates/prep)were transfected with 60μg transgene plasmid, 120μg XX-680, and 100μg

PXR2 via the polyethyleneimine (PEI) technique. Nuclei were isolated and lysed using

sonication. AAV particles were purified by cesium chloride density gradient. Peak

fractions were determined via dot blot hybridization, and extensively dialyzed against

DPBS + 10% (wt/vol) D-sorbitol. Final titer was determined by dot blot hybridization

(modified southern blot) using a probe against the CB promoter sequence so all viruses

could be titered on the same blot (see Figures 2-1 through 2-3) Infectious center assays

(ICA) were performed using C12 cells (293 cells with Rep stably integrated) as

previously described (Grieger, Choi et al. 2006) (see Figures 2-4 through 2-7). AAV

particles were analyzed to determine purity and ratio of empty to full particles by staining

36

37

Figure 2-1. Dot Blot, Standard Curve, and Titer Calculations for AAV2-CB-FIB-NPY and AAV2-CB-FIB-NPY13-36. The top panel shows three dilutions (across) of the viruses performed in duplicate (down). Dilutions of known amounts (nanograms) of one of the plasmids used to make the rAAV vectors were included (pTR-CB-FIB-NPY). Upon hybridization with a radiolabeled probe that was complementary to a fragment of the CB promoter, a standard curve was generated (middle panel). Then a linear regression analysis was done, and the derived equation (displayed in the upper left corner of the standard curve graph) was used to calculate the number of rAAV particles present in each dilution (bottom panel), then the average particles present per mL.

AAV2-CB-FIB-NPY AAV2-CB-FIB-NPY13-36

pTR-CB-FIB-NPY

AAV2-CB-FIB-NPY AAV2-CB-FIB-NPY13-36

pTR-CB-FIB-NPY

1.73E+121.08E+09748630.3

1.89E+122.37E+091595254

1.77E+121.69E+124.23E+092820913

Avg Particles/mLParticles/mLy=Avg*X-BAverage

1.73E+121.08E+09748630.3

1.89E+122.37E+091595254

1.77E+121.69E+124.23E+092820913

Avg Particles/mLParticles/mLy=Avg*X-BAverage

1.54E+129.65E+08674020

1.68E+122.10E+091420987

1.64E+121.71E+124.27E+092845020

1.54E+129.65E+08674020

1.68E+122.10E+091420987

1.64E+121.71E+124.27E+092845020

Standard Curve y = 1520.8x - 6E+07R2 = 0.9974

0.00E+00

5.00E+09

1.00E+10

1.50E+10

0 2000000 4000000 6000000 8000000

Number of Probes

Volu

me

of S

tand

ard

38

Figure 2-2. Dot Blot, Standard Curve, and Titer Calculations for AAV2-CB-FIB-GAL-RKRRKR-FIB-EGFP, AAV2-CB-FIB-EGFP, and AAV2-CB-EGFP. The left panel shows three dilutions (across) of the viruses performed in duplicate (down). Dilutions of known amounts (nanograms) of one of the plasmids used to make the rAAV vectors were included (pTR-CB-FIB-GAL-RKRRKR-FIB-EGFP). Upon hybridization with a radiolabeled probe that was complementary to a fragment of the CB promoter, a standard curve was generated (bottom panel). Then a linear regression analysis was done, and the derived equation (displayed in the upper left corner of the standard curve graph) was used to calculate the number of rAAV particles present in each dilution (right panel), then the average particles present per mL.

AAV2-CB-FIB-GAL-RKRRKR-FIB-EGFP side and peak fractions

AAV2-CB-FIB-EGFP AAV2-CB-EGFP

50 25 12.5 6.25 3.125

AAV2-CB-FIB-GAL-RKRRKR-FIB-EGFP side and peak fractions

AAV2-CB-FIB-EGFP AAV2-CB-EGFP

50 25 12.5 6.25 3.125

5.76271E+117.20E+0838473.47

5.80512E+117.26E+0838756.62

5.47932E+114.87012E+111.22E+0965028.63

Avg particles/mLParticles/mL# * X+BAverage

5.76271E+117.20E+0838473.47

5.80512E+117.26E+0838756.62

5.47932E+114.87012E+111.22E+0965028.63

Avg particles/mLParticles/mL# * X+BAverage

2.16418E+122.71E+09144486.61

2.27565E+122.84E+09151928.995

2.1967E+122.15028E+125.38E+09287117.055

2.16418E+122.71E+09144486.61

2.27565E+122.84E+09151928.995

2.1967E+122.15028E+125.38E+09287117.055

2.51044E+123.14E+09167603.77

2.42044E+123.03E+09161595.12

2.41071E+122.30127E+125.75E+09307278.77

2.51044E+123.14E+09167603.77

2.42044E+123.03E+09161595.12

2.41071E+122.30127E+125.75E+09307278.77

1.88995E+122.36E+09126178.295

1.93021E+122.41E+09128866.455

1.87706E+121.81101E+124.53E+09241815.59

1.88995E+122.36E+09126178.295

1.93021E+122.41E+09128866.455

1.87706E+121.81101E+124.53E+09241815.59

Standard Curve y = 18225x + 1E+09R2 = 0.9899

0

5000000000

10000000000

15000000000

20000000000

25000000000

0 200000 400000 600000 800000 1000000 1200000

Number of Probes

Volu

me

of S

tand

ards

39

Figure 2-3. Dot Blot, Standard Curve, and Titer Calculations for Multiple Gene Product Delivery Vectors. The left panel shows three dilutions (across) of the viruses performed in duplicate (down). The virus order is as follows 1) upper left, AAV2-CB-FIB-GAL-RKRRKR-EGFP, 2) upper right, AAV2-CB-FIB-EGFP-RKRRKR-GAL, 3) lower left, AAV2-CB-FIB-GAL-EGFP, and 4) lower right, AAV2-CB-FIB-GAL-RKRRKR-NPY13-36. Dilutions of known amounts (nanograms) of one of the plasmids used to make the rAAV vectors were included (pTR-CB-FIB-GAL-EGFP). Upon hybridization with a radiolabeled probe that was complementary to a fragment of the CB promoter, a standard curve was generated (bottom panel). Then a linear regression analysis was done, and the derived equation (displayed in the upper left corner of the standard curve graph) was used to calculate the number of rAAV particles present in each dilution (right panel), then the average particles present per mL.

6.44569E+114.03E+08503472.1

1.03451E+121.29E+09909902

1.09097E+121.14743E+122.87E+091629115

Avg Particles/mLParticles/mLAvg * x - BAverage

6.44569E+114.03E+08503472.1

1.03451E+121.29E+09909902

1.09097E+121.14743E+122.87E+091629115

Avg Particles/mLParticles/mLAvg * x - BAverage

5.3877E+113.37E+08473285.3

1.10069E+121.38E+09947668.1

1.16655E+121.2324E+123.08E+091726094

5.3877E+113.37E+08473285.3

1.10069E+121.38E+09947668.1

1.16655E+121.2324E+123.08E+091726094

2.4716E+121.54E+091024766

2.88779E+123.61E+091967467

2.84914E+122.81049E+127.03E+093527150

2.4716E+121.54E+091024766

2.88779E+123.61E+091967467

2.84914E+122.81049E+127.03E+093527150

6.71364E+124.20E+092235117

6.56656E+128.21E+094066745

6.00733E+125.4481E+121.36E+106537437

6.71364E+124.20E+092235117

6.56656E+128.21E+094066745

6.00733E+125.4481E+121.36E+106537437

AAV2-CB-FG-RKRRKR-E AAV2-CB-FE-RKRRKR-G

AAV2-CB-F-G-E AAV2-CB-FG-RKRRKR-NPY13-36

pTR-CB-FIB-GAL-EGFP

AAV2-CB-FG-RKRRKR-E AAV2-CB-FE-RKRRKR-G

AAV2-CB-F-G-E AAV2-CB-FG-RKRRKR-NPY13-36

pTR-CB-FIB-GAL-EGFP

Standard Curve y = 2190.5x - 7E+08R2 = 0.991

-20000000000

2000000000400000000060000000008000000000

100000000001200000000014000000000

0 1000000 2000000 3000000 4000000 5000000 6000000

Number of probes

Volu

me

of S

tand

ards

40

Figure 2-4. Infectious Center Assay of AAV2-CB-FIB-GAL-RKRRKR-EGFP. A) 500 particles, B) 1000 particles, and C) 5000 particles of AAV2-CB-FIB-GAL-RKRRKR-EGFP were co-infected with Ad in C12 cells, blotted on a membrane, and hybridized with radiolabeled probe that was complementary to a fragment of the CB promoter to determine the number of infectious units per mL (IU/mL). This virus is 3.6x109 IU/mL.

AAV2-CB-FIB-GAL-RKRRKR-EGFP

A

B

C

AAV2-CB-FIB-GAL-RKRRKR-EGFP

A

B

C

41

Figure 2-5. Infectious Center Assay of AAV2-CB-FIB-EGFP-RKRRKR-GAL. A) 500 particles, B) 1000 particles, and C) 5000 particles of AAV2-CB-FIB-EGFP-RKRRKR-GAL were co-infected with Ad in C12 cells, blotted on a membrane, and hybridized with radiolabeled probe that was complementary to a fragment of the CB promoter to determine the IU/mL. This virus is 1.0x109 IU/mL.

AAV2-CB-FIB-EGFP-RKRRKR-GAL

A

C

B

AAV2-CB-FIB-EGFP-RKRRKR-GAL

A

C

B

42

Figure 2-6. Infectious Center Assay of AAV2-CB-FIB-GAL-EGFP. A) 500 particles, B) 1000 particles, and C) 5000 particles of AAV2-CB-FIB-GAL-EGFP were co-infected with Ad in C12 cells, blotted on a membrane, and hybridized with radiolabeled probe that was complementary to a fragment of the CB promoter to determine the IU/mL. This virus is 2.0x109 IU/mL.

AAV2-CB-FIB-GAL-EGFP

A

B

C

AAV2-CB-FIB-GAL-EGFP

A

B

C

43

Figure 2-7. Infectious Center Assay of AAV2-CB-FIB-GAL-RKRRKR-NPY13-36. A) 500 particles, B) 1000 particles, and C) 5000 particles of AAV2-CB-FIB-GAL-RKRRKR-NPY13-36 were co-infected with Ad in C12 cells, blotted on a membrane, and hybridized with radiolabeled probe that was complementary to a fragment of the CB promoter to determine the IU/mL. This virus is 9.0x109 IU/mL.

AAV2-CB-FIB-GAL-RKRRKR-NPY13-36

A B C

AAV2-CB-FIB-GAL-RKRRKR-NPY13-36

A B C

44

with 1% aqueous uranyl acetate and visualizing with transmission electron microscopy

(LEO-EM910, accelerating voltage = 80 KV).

II.D. In Vivo Methods

II.D.1. Experimental Animals

All of the animals were pathogen-free male Sprague–Dawley rats obtained from

Charles Rivers. The animals were maintained in a 12 hour light–dark cycle and had free

access to food and water. All care and procedures were in accordance with the Guide for

the Care and Use of Laboratory Animals (DHHS Publication No. [NIH]85-23), and all

procedures received prior approval by the University of North Carolina Institutional

Animal Care and Usage Committee.

II.D.2. rAAV Vector Microinjection

For AAV infusions, rats were first were anesthetized with 50 milligrams per

kilogram, intraperitoneal (mg/kg, ip) pentobarbital and placed into a stereotaxic frame.

Using a 32 gauge stainless steel injector and a Sage infusion pump, the rats received 2 or

3µL of virus (depending on virus titer) over 20 minutes into the piriform cortex (inter-

aural line (IAL) 6.7 millimeters (mm), lateral 6.0mm, vertical 8.4mm, according to the

atlas of Paxinos and Watson, 1998) (see Figure 2-8). The injector was left in place for 3

minutes post-infusion to allow diffusion from the injectors. In all cases, the incisions

were sutured, and the animals were allowed to recover for a minimum of 7 days.

45

Figure 2-8. Coronal Section of the Rat Brain Depicting the Location of Vector Microinjection. rAAV2 vector is stereotaxically injected bilaterally into the piriform cortex, denoted by arrows. The coordinates are inter-aural line (IAL) 6.7 millimeters (mm), lateral 6.0mm, vertical 8.4mm, according to the atlas of Paxinos and Watson (1998).

Interaural 6.70 mm Bregma -2.30 mm

46

II.D.3. In Vivo Detection of AAV-Derived NPY or NPY 13-36

As previously described (Haberman, Samulski et al. 2003; Foti, Haberman et al.

2007) the vector-derived NPY could not be visualized in vivo by immunohistochemistry,

likely due to the fact that the secreted NPY or NPY 13-36 would be rapidly degraded,

especially during the perfusion procedure. Thus, in vivo activity of the vectors AAV-FIB-

NPY or NPY 13-36 was validated by demonstrating the presence of vector-derived

mRNA. Two rats received AAV-FIB-NPY and two received AAV-FIB-NPY 13-36

vector infusions into the piriform cortex as described above. Then, 1 week later, the

animals received an overdose of pentobarbital (100mg/kg, ip) and were subsequently

decapitated. The brain was removed, and the piriform cortex was dissected out. The

tissue was stored in RNAlater (Ambion, Austin, TX, USA) at -80°C. Subsequently, the

RNA was extracted from the tissue (Promega SV-40 total RNA isolation kit; Madison,

WI, USA) and reverse transcribed using AMV reverse transcriptase and oligo(dT)

primers. The subsequent PCR used primers that were designed to span the FIB-NPY (and

thus the FIB-NPY 13-36) sequence, which can only be derived from the rAAV vector:

(FIB, 5’) 5’-CTA GCA GTC CTG TGC CTG-3’, (NPY and NPY13-36, 3’) 5’ –GCT

CAA TAT CTC TGT CTG GTG-3’.

For the multiple gene product delivery vector AAV-CB-FIB-GAL-RKRRKR-

NPY13-36, the same procedure and primers were used with the following modifications:

all seven animals receiving vector infusions in the piriform cortex were sacrificed

immediately after the behavior data was collected from the kainic acid treatment

(described in II.D.5.), and all animals were processed for vector-derived mRNA.

47

II.D.4. In Vivo Detection of AAV-Derived GFP

Although the GFP is likely being secreted in these animals, it is very stable with a

fairly long half-life (around 80 hours (Kamau, Grimm et al. 2001). This allows us to

visualize the pattern of AAV transduction via GFP immunohistochemistry. Ten days

after piriform cortical infusion of AAV vectors containing GFP, the animals received an

overdose of pentobarbital (100mg/kg, ip) and subsequently were perfused transcardially

with ice-cold 100mM sodium phosphate-buffered saline (PBS) (pH 7.4), followed by 4%

paraformaldehyde in 100mM phosphate buffer (pH 7.4). After overnight fixation in the

paraformaldehyde–phosphate buffer, Vibratome sections (40μm thick) were taken and

rinsed in PBS. The sections were mounted and GFP fluorescence was visualized on a

Zeiss 510 confocal microscope.

II.D.5. Kainic Acid Treatment

Seven days after piriform cortical infusion of the AAV vectors, the animals

received a 10mg/kg ip dose of kainic acid (Cayman Chemical Co., Ann Arbor, MI,

USA). Using the limbic seizure scale of Racine (Racine 1972), the latency was recorded

to class I, II, III, IV, and V limbic seizure behaviors. Four hours after kainic acid

treatment, the animals received an overdose of pentobarbital (100mg/kg, ip) and

subsequently were perfused transcardially with ice-cold 100mM sodium phosphate-

buffered saline (PBS) (pH 7.4), followed by 4% paraformaldehyde in 100mM phosphate

buffer (pH 7.4). After overnight fixation in the paraformaldehyde–phosphate buffer,

Vibratome sections (40μm thick) were taken and rinsed in PBS. The sections were

mounted and the infusion placement was determined.

Chapter 3

Results

III.A. rAAV-mediated Expression and Constitutive Secretion of NPY or NPY13-36

Suppresses Seizure Activity In Vivo

A gene therapy approach to suppress seizures is an attractive treatment for focal

epilepsy. Although previous studies validated the effectiveness of gene expression and

constitutive secretion using galanin (McCown 2006), the same approach might not

necessarily prove successful with NPY or the peptide fragment NPY13-36. Therefore,

we used a similar approach with the following modifications: AAV2 vectors were

constructed where the hybrid chicken beta actin promoter drives expression of the FIB-

NPY or FIB-NPY13-36 coding sequences (see Figure 3-1). Then, 2µL of recombinant

AAV-FIB-NPY (3.3 X 1012 viral particles/mL) or AAV-FIB-NPY13-36 (3.0 X 1012 viral

particles/mL) was infused bilaterally into the piriform cortex of rats, as previously

described (McCown 2006). Control rats received no infusion, as we have previously

shown that vectors expressing and secreting reporter genes like GFP (AAV-FIB-EGFP),

as well as vectors expressing peptides that lack secretion sequences (AAV-GAL) have no

effect on seizure sensitivity, seizure behaviors, or seizure-induced cell death (Haberman,

Samulski et al. 2003; McCown 2006). One week later, the rats received a dose of

10mg/kg, i.p. kainic acid to induce seizures. We then recorded the time required to

initiate limbic seizure behaviors.

49

Figure 3-1. AAV Vectors that Express and Constitutively Secrete NPY or NPY13-36 AAV2 vectors were constructed where the hybrid chicken beta actin promoter (CB) drives expression of the FIB-NPY or FIB-NPY13-36 coding sequences.

TR (2)

CB FIB TR (2)

SV-40 Poly-A

NPY13-36

TR (2)

CB FIB NPY SV-40 Poly-A

TR (2)

TR (2)

CB FIB TR (2)

SV-40 Poly-A

NPY13-36

TR (2)

CB FIB TR (2)

SV-40 Poly-A

NPY13-36

TR (2)


TR (2)

TR (2)


TR (2)

TR (2)


TR (2)

50

Figure 3-2. The Effects of AAV-FIB-NPY and AAV-FIB-NPY13-36 Vectors on the Expression of Limbic Seizure Behaviors. The latencies to wet dog shakes and limbic seizure behaviors were determined for 240 min post-kainic acid. The numbers in the columns indicate the number of rats in each group that exhibited any seizure activity, compared to the total number of rats in that treatment group.

51

As seen in Figure 3-2, both AAV treatment groups and the untreated control

group developed wet dog shake behaviors with the same latency.Because the origin of

wet dog shakes appears to be the hippocampus (Frush and McNamara 1986), a local

action of the AAV-FIB-NPY or AAV-FIB-NPY13-36 in the piriform cortex would not be

expected to influence these kainic acid-induced behaviors. However, the findings do

validate the uniformity of kainic acid administration across the different groups. In

marked contrast, however, onset of class III and class IV seizures was significantly

delayed or completely blocked in rats receiving either AAV-FIB-NPY or AAV-FIB-

NPY13-36 compared to control (*t-test; P<0.01). In fact, the majority of rats in both

vector treated groups did not exhibit any seizure behavior at all, whereas all rats in the

untreated group develop class III and class IV seizures within 90 minutes (see Figure 3-

2). Thus, like findings with expression and secretion of galanin, NPY actions in the

piriform cortex significantly attenuated seizure activity induced by the peripheral

administration of the chemical convulsant kainic acid. As previously discussed, the

constitutive secretion of these peptides renders immunohistochemical identification

untenable (Haberman, Samulski et al. 2003), but as previously shown for galanin

(Haberman, Samulski et al. 2003; McCown 2006), the appropriate vector-derived NPY or

NPY13-36 mRNA was present in the area of AAV infusion (see Figure 3-3). Presence of

vector derived mRNA supports the finding that over-expression of NPY or NPY13-36 in

the piriform cortex is responsible for the preventing of seizure behavior.

III.B. A Strategic Approach for Delivering Multiple Gene Products in the Brain

Using a Single AAV Vector

52

Figure 3-3. The In Vivo Presence of FIB-NPY and FIB-NPY13-36 mRNA 1 Week after Vector Infusion into the Piriform Cortex. The appropriate 208bp FIB-NPY (lane A) or 172bp FIB-NPY13-36 (lane C) product is present in the injected piriform cortex, while no product was found in an area slightly distal to the piriform cortex (lane B). Omission of the reverse transcriptase step (lanes D and E) indicated the absence of contaminating viral DNA. The left outside lane contains a 100bp DNA ladder with relevant sizes indicated on the left.

53

III.B.1. In Vitro Characterization of Dual Reporter Gene Product Delivery Vectors

Vectors delivering individual inhibitory neuropeptides to the brain to prevent

seizures has been well studied (Mazarati and Wasterlain 2002; Haberman, Samulski et al.

2003; Richichi, Lin et al. 2004; McCown 2006; Foti, Haberman et al. 2007), but to date

no one has reported the simultaneous delivery of multiple neuropeptides. To achieve

this, we used a proteolytic strategy such that our plasmids contained a single

promoterdriving expression of a single chimeric fusion protein containing the FIB

secretion sequence. Upon being sorted into the constitutive secretion pathway, the fusion

protein should come in contact with the protease furin, and it then should be cleaved into

two separate functional proteins which are then constitutively secreted from the cells.

Using a strategy similar to Margaritis et al., (2004) we engineered our plasmids to

contain a cleavage site for the intracellular protease, furin. The cleavage consensus

sequence arginine-lysine-arginine-arginine-lysine-arginine (RKRRKR) was cloned in

frame as a linker between the coding sequences for the two gene products being

delivered.

As a first proof of concept for the multiple gene product delivery vectors, we used

the two reporter genes luciferase and GFP. Since both gene products are reporter genes

which typically do not undergo secretion from cells, we hypothesized that each gene

would need a secretion sequence in order for the protein to be correctly trafficked within

the cell. Thus, we made constructs that contained either one FIB sequence (in front of the

first gene luciferase) or two FIB sequences. The constructs generated and characterized

by in vitro protein assays were: CB-LUC, CB-FIB-LUC, CB-FIB-LUC-RKRRKR-

EGFP, and CB-FIB-LUC-RKRRKR-FIB-EGFP (see Figure 3-4). In order to determine

54

Figure 3-4. AAV Vectors Characterized in Initial Multiple Gene Product Delivery Studies. (A) CB-LUC is a negative control used in luciferase assays and immunoprecipitation then western blot (IP/WB) experiments to show that luciferase is expressed but not secreted in the absence of a FIB sequence. (B) CB-FIB-LUC is a positive control used in luciferase assays and IP/WB experiments for secretion of luciferase into the medium. (C,D) CB-FIB-LUC-RKRRKR-EGFP and CB-FIB-LUC-RKRRKR-FIB-EGFP are analyzed by IP/WB to determine if the two gene products are made as a fusion protein in the cell then cleaved from one another, and to examine if a single FIB sequence is sufficient for secretion of both gene products into the medium, or would two be necessary.

FIBTR (2)

CB SV-40 Poly-A

TR (2)

B

TR (2)

CB SV-40 Poly-A

TR (2)

ALUC

LUC

TR (2)

CB FIB SV-40 Poly-A

TR (2)

EGFPRKRRKR

CLUC

TR (2)

CB FIB SV-40 Poly-A

TR (2)

EGFPRKRRKR

DLUC FIB

FIBTR (2)

CB SV-40 Poly-A

TR (2)

B

TR (2)

CB SV-40 Poly-A

TR (2)

ALUCTR

(2)CB SV-40

Poly-ATR (2)

ALUC

LUC

TR (2)

CB FIB SV-40 Poly-A

TR (2)

EGFPRKRRKR

CLUCTR

(2)CB FIB SV-40

Poly-ATR (2)

EGFPRKRRKRRKRRKR

CLUC

TR (2)

CB FIB SV-40 Poly-A

TR (2)

EGFPRKRRKR

DLUC FIBTR

(2)CB FIB SV-40

Poly-ATR (2)

EGFPRKRRKRRKRRKR

DLUC FIB

55

if the luciferase was secreted into the medium, we harvested medium and lysates and

performed luciferase assays in the presence of luciferin substrate (see Figure 3-5). To our

surprise, luciferase activity was present in the medium of the non-secreted luciferase

construct (CB-LUC), but is probably due to residual cell lysis and spilling out of the

expressed transgene. In addition, the absence of luciferase activity in the medium of the

secreted constructs (CB-FIB-LUC, and CB-FIB-LUC-RKRRKR-EGFP) suggests either

that the FIB sequence is interfering with the luminescence catalytic domain, or the

luciferase protein is not being expressed. Immunoprecipitation followed by Western

blotting (IP/WB) was performed using antibodies to luciferase and GFP to distinguish

between these possibilities (see Figures 3-6 and 3-7). The luciferase IP/WB revealed that

although there was a complete absence of secretion of luciferase protein into the medium

(Figure 3-6, lanes 2-5), luciferase protein was detected in the all of the cell lysates

(Figure 3-6, lanes 7-10). Thus, luciferase expression is occurring, but that enzymatic

function is abolished when the FIB sequence is included (see Figure 3-5, CB-FIB-LUC).

In addition, the luciferase IP/WB reveals that the fusion protein of luciferase and GFP is

being made in the cells (Figure 3-6, lanes 9-10) even though correctly processed

luciferase is not seen in the lysates or the medium. These results suggest that neither

furin-mediated cleavage nor FIB-mediated secretion are occurring, and are in contrast to

the data obtained with the GFP IP/WB (Figure 3-7).

The GFP IP/WB revealed that some processing of the proteins was occurring, and

that cleaved GFP was secreted into the medium in of CB-FIB-LUC-RKRRKR-FIB-

EGFP transfected cells. CB-FIB-LUC-RKRRKR-EGFP and CB-FIB-LUC-RKRRKR-

FIB-EGFP suggest that two FIB sequences are necessary in order for cleaved GFP to be

56

Luciferase Assay (Avg of Duplicates)

287.5

23730.5

749 980

0

5000

10000

15000

20000

25000

Rel

ativ

e Li

ght U

nits

Mock Transfected

CB-LUC

CB-FIB-LUC

CB-FIB-LUC-RKRRKR-EGFP

Figure 3-5. Luciferase Assay on Concentrated Medium. 293 cells were transfected with the constructs listed above. The medium was harvested 48 hours later, and centrifuged in a concentrating column with a molecular weight cut off membrane of 10kDa. Since firefly luciferase is around 61kDa it will be retained in the supernatant, while salts and smaller proteins flow through. 5mL samples were concentrated into 1mL, then 20μL of each sample was mixed with 100μL of luciferin solution in a 96 well plate and read in the luminometer. Presence of luciferase activity in the medium of the non-secreted luciferase construct (CB-LUC) is probably due to residual cell lysis and spilling out of the expressed transgene. Absence of luciferase activity with the secreted constructs (CB-FIB-LUC, and CB-FIB-LUC-RKRRKR-EGFP) suggests either that the FIB sequence is interfering with the luminescence catalytic domain, or that luciferase protein is not being expressed. IP/WB was performed to distinguish between these possibilities, and to examine protein processing and trafficking.

57

Figure 3-6. Luciferase Antibody Protein Analysis of Luciferase-GFP Multiple Gene Product Delivery Constructs. IP/WB using the same anti-luciferase polyclonal antibody to pull down and blot samples, hence the heavy and light chain antibody bands are visible at around 50kDa and 25kDa respectively. Luciferase is around 61kDa and GFP is around 30kDa. 1 is rainbow marker, 2 is CB-LUC, 3 is CB-FIB-LUC, 4 is CB-FIB-LUC-RKRRKR-EGFP, 5 is CB-FIB-LUC-RKRRKR-FIB-EGFP, 6 is untransfected control, 7 is CB-LUC, 8 is CB-FIB-LUC, 9 is CB-FIB-LUC-RKRRKR-EGFP, 10 is CB-FIB-LUC-RKRRKR-FIB-EGFP. No luciferase is present in the medium following transfection (lanes 2-6), however, luciferase is detected in all of the cell lysates (lanes 7-10). In addition, lanes 9 and 10 show that luciferase-GFP fusion protein is being made in the cells (98kDa), even though processed luciferase (61kDa) is not seen in the lysates or the medium.

Medium 2-6 Lysates 7-10Medium 2-6 Lysates 7-10Luciferase Antibody

58

Figure 3-7. GFP Antibody Protein Analysis of Luciferase-GFP Multiple Gene Product Delivery Constructs. IP/WB using an anti-GFP polyclonal antibody to pull down and an anti-GFP monoclonal antibody to blot. 1 is CB-FIB-LUC-RKRRKR-EGFP, 2 is CB-FIB-LUC-RKRRKR-FIB-EGFP, 3 is CB-FIB-EGFP, 4 is CB-FIB-LUC, 5 is CB-FIB- LUC-RKRRKR-EGFP, 6 is CB-FIB-LUC-RKRRKR-FIB-EGFP, 7 is CB-FIB-EGFP, 8 is CB-FIB-LUC, 9 is untransfected control. CB-FIB-LUC-RKRRKR-EGFP and CB-FIB-LUC-RKRRKR-FIB-EGFP (lanes 1-2) suggest that two FIB sequences are necessary in order for cleaved GFP to be secreted into the medium because it is absent in lane 1 but present in lane 2. CB-FIB-EGFP (lane 3, 7) is a positive control showing GFP is secreted into the medium when FIB is present and is found within the cells. CB-FIB-LUC (lanes 4, 8) is a negative control demonstrating that the GFP antibody does not cross-react with luciferase. Lanes 5 and 6 show that luciferase-GFP fusion protein is made (98kDa), but the multiple bands suggest that it is also being degraded within the cells. Fragments of luciferase-GFP fusion protein may not show up when probing with a luciferase antibody because the luciferase antibody may loose its binding capacity, however, this would not affect GFP antibody binding.

Medium 1-4 Lysates 5-9Medium 1-4 Lysates 5-9GFP Antibody

59

secreted into the medium because GFP was absent in medium of CB-FIB-LUC-

RKRRKR-EGFP transfected cells, but present in the medium of CB-FIB-LUC-

RKRRKR-FIB-EGFP transfected cells (Figure 3-7, lanes 1-2). However, multiple bands

in the lysates for these constructs show that luciferase-GFP fusion protein is made and

then degraded within the cells (Figure 3-7, lanes 5-6). Fragments of luciferase-GFP

fusion protein may not show up when probing with a luciferase antibody because the

luciferase antibody may loose its binding capacity, however, this would not affect GFP

antibody binding. Taken together, we determined that luciferase would not be functional

in these vectors because the protein was expressed but then degraded in the cells, thus it

was not secreted. Therefore we decided to retain the proteolytic vector strategy, but

instead of luciferase, we would use the neuropeptide galanin along with GFP.

III.B.2. In Vitro Characterization of Double FIB Multiple Gene Product Delivery Vectors

Because the initial luciferase data suggested that each gene would need its own

FIB sequence, we made the following additional constructs: CB-FIB-GAL-RKRRKR-

FIB-EGFP and CB-FIB-EGFP-RKRRKR-FIB-GAL (see Figure 3-8). These constructs

were first characterized at the protein level in vitro (see Figures 3-9). Due to the

extremely rapid degradation of galanin in serum (Holst, Bersani et al. 1993), GFP

secretion was assayed. Constructs were made containing GFP and galanin in both

possible orientations, assuring that GFP was correctly processed and cleaved from

galanin whether it was 5’ or 3’ of the cleavage site. The IP/WB revealed that while the

construct CB-FIB-GAL-RKRRKR-FIB-EGFP resulted in secretion of cleaved GFP into

the medium, the construct CB-FIB-EGFP-RKRRKR-FIB-GAL was not processed

60

Figure 3-8. Double FIB Multiple Gene Product Delivery Vectors. (A) CB-EGFP is a negative control used in IP/WB experiments to show that GFP is expressed but not secreted in the absence of a FIB sequence. (B) CB-FIB-EGFP is a positive control used in IP/WB experiments for secretion of GFP into the medium. (C) CB-FIB-GAL-RKRRKR-FIB-EGFP and (D) CB-FIB-EGFP-RKRRKR-FIB-GAL are constructs designed to test cleavage and secretion of both gene products in IP/WB experiments in vitro, and to test the function of both gene products in vivo.

EGFPFIBTR (2)

CB SV-40 Poly-A

TR (2)

TR (2)

CB SV-40 Poly-A

TR (2)

EGFPA

B

CTR (2)

CB FIB GAL SV-40 Poly-A

TR (2)

EGFPRKRRKR

FIB

TR (2)


TR (2)RKRRKR

EGFPD

FIB

EGFPFIBTR (2)

CB SV-40 Poly-A

TR (2)

EGFPFIBTR (2)

CB SV-40 Poly-A

TR (2)

TR (2)

CB SV-40 Poly-A

TR (2)

EGFPA

TR (2)

CB SV-40 Poly-A

TR (2)

EGFPA

B

CTR (2)


TR (2)

EGFPRKRRKR

FIBCTR (2)


TR (2)

EGFPRKRRKR

FIBTR (2)


TR (2)

EGFPRKRRKRRKRRKR

FIB

TR (2)


TR (2)RKRRKR

EGFPD

FIBTR (2)


TR (2)RKRRKRRKRRKR

EGFPD

FIB

61

Figure 3-9. In Vitro Protein Analysis of Double FIB Multiple Gene Product Delivery Constructs. The following constructs were transfected into 293 cells using PEI 1mg/mL: 1) CB-FIB-EGFP; 2) CB-FIB-GAL-RKRRKR-FIB-EGFP; 3) CB-FIB-EGFP-RKRRKR-FIB-GAL. After 48 hours the lysate and medium were harvested and IP/WB was performed using an anti-GFP polyclonal antibody to pull down and an anti-GFP monoclonal antibody to blot. Lane 1 shows GFP is present in the lysate and is also present in the medium. Lane 2 shows that GFP is present in the lysate and is also in the medium. Note that it appears to be the same size as lane 1 suggesting it has been cleaved from galanin. Lane 3 shows that the GFP is not being processed correctly intracellularly, and intermediate products are present in the lysate. While these intermediates do not seem to be secreted, the amount of correctly processed and secreted protein is reduced. Consequently, we did not use this construct for in vivo experiments.

1 2 3 1 2 3

Lysate Medium

14.3

20.1

30

45

66

97

220

14.3

20.1

30

45

66

97

220

1 2 3 1 2 3

Lysate Medium

14.3

20.1

30

45

66

97

220

14.3

20.1

30

45

66

97

220

correctly within the cells (see Figure 3-8). Thus, we only made virus with CB-FIB-GAL-

RKRRKR-FIB-EGFP, CB-FIB-EGFP and CB-EGFP.

III.B.3. In Vivo Characterization of Double FIB Multiple Gene Delivery Vectors

These viruses were titered by dot blot (see Figure 2-2) and injected into the rat

piriform cortex to analyze the in vivo fluorescence patterns (see Figure 3-10). The in vivo

fluorescence patterns were similar to that of Haberman et al. (2003), such that when the

FIB sequence was present, GFP was localized to the periphery of the neurons, which is

highly suggestive of GFP secretion. However, when the FIB sequence was absent, the

neurons were uniformly fluorescent, suggesting cytoplasmic localization of GFP. Upon

determining that the GFP was functional, we decided to evaluate the function of galanin

from the AAV2-CB-FIB-GAL-RKRRKR-FIB-EGFP construct in vivo. In order for

galanin to be functional it must not only be expressed, but also secreted, because the

receptors for galanin are located on the exterior cell membrane. Thus, if infusion of this

construct into the piriform cortex is able to attenuate limbic seizure behavior following

i.p. kainic acid administration, then functional galanin must have been secreted from the

transduced cells. As seen in Figure 3-11, infusion of AAV2-CB-FIB-GAL-RKRRKR-

FIB-EGFP significantly attenuated limbic seizures, and completely blocked seizure

behavior in 3 of 4 animals. While these experiments provided us with an initial proof of

concept, we did not conduct any further experiments with AAV2-CB-FIB-GAL-

RKRRKR-FIB-EGFP, because the reciprocal construct CB-FIB-EGFP-RKRRKR-FIB-

GAL was not processed correctly within the cells. This led us to hypothesize that having

multiple FIB sequences may create sequence-dependent protein sorting and trafficking

62

63

Figure 3-10. In Vivo Fluorescence Pattern in Rat Cortex after Infusion of AAV2-CB-FIB-GAL-RKRRKR-FIB-EGFP, AAV2-CB-FIB-EGFP, or AAV2-CB-EGFP. (A) AAV2-CB-FIB-GAL-RKRRKR-FIB-EGFP, (B) AAV2-CB-FIB-EGFP, (C) AAV2-CB-EGFP. (A, B) In vivo GFP patterns are highly suggestive of GFP secretion following infusion of AAV-CB-FIB-GAL-RKRRKR-FIB-EGFP and CB-FIB-GFP because there is a subcellular localization of GFP to the perimeter of neurons. (C) Uniform fluorescence suggests cytoplasmic accumulation of GFP but not secretion after infusion of AAV-CB-EGFP. Each image was obtained with a confocal microscope using a 1.4μm thick slice through the middle of the cell.

64

Figure 3-11. The Effects of AAV2-CB-FIB-GAL-RKRRKR-FIB-EGFP on the Expression of Limbic Seizure Behaviors. The latencies to wet dog shakes and limbic seizure behaviors were determined for 240 min post-kainic acid. The numbers in the columns indicate the number of rats in each group that exhibited any seizure activity, compared to the total number of rats in that treatment group. Infusion of AAV-CB-FIB-GAL-RKRRKR-FIB-EGFP in the piriform cortex completely blocks limbic seizure behavior in 3 of 4 animals following i.p. kainic acid administration. Control rats received no infusion, as we have previously shown that vectors expressing and secreting reporter genes like GFP (AAV-FIB-EGFP), as well as vectors expressing peptides that lack secretion sequences (AAV-GAL) have no effect on seizure sensitivity, seizure behaviors, or seizure-induced cell death.

4/4 4/4 1/44/44/4 4/4 1/44/4

problems, thus we decided to explore if a single FIB sequence would be sufficient to

cause secretion of both galanin and GFP in vitro and in vivo.

III.B.4. In Vitro Characterization of Single FIB Multiple Gene Product Delivery Vectors

In order to determine if a single FIB sequence would be sufficient to cause

secretion of both galanin and GFP, we generated and characterized the following

constructs: CB-EGFP, CB-FIB-EGFP, CB-FIB-GAL, CB-FIB-GAL-RKRRKR-EGFP,

CB-FIB-EGFP-RKRRKR-GAL, CB-FIB-GAL-EGFP, and CB-FIB-GAL-RKRRKR-

NPY 13-36 (a construct used only for in vivo experiments and should allow secretion of

two therapeutic neuropeptides) (see Figure 3-12). Again, due to the extremely rapid

degradation of galanin in serum (Holst, Bersani et al. 1993), GFP secretion was assayed.

Constructs were made containing GFP and galanin in both possible orientations, assuring

that GFP was correctly processed and cleaved from galanin whether it was 5’ or 3’ of the

cleavage site. In addition, we made a secreted non-cleavable control of galanin and GFP

to demonstrate the size of a fusion of these two proteins. Figure 3-13 shows that

transfection of our constructs into 293 cells results in similar fluorescence patterns to that

of Haberman et al. (2003) (Figure 3-13, A), and demonstrates that 1) indeed, a single FIB

sequence was sufficient to allow secretion of both gene products (Figure 3-13, B lane 4),

indicating that FIB designates the protein for secretion before furin cleaves it; 2) our

proteins were correctly processed intracellularly regardless of position relative to the

cleavage sequence and secreted into the medium (Figure 3-13, B-C, lanes 3-4); 3) in the

absence of a cleavage sequence the uncleaved fusion protein is secreted into the medium

(Figure 3-13, B lane 5); 4) the absence of fusion protein in the medium suggests that

cleavage between GFP and galanin is 100% efficient (Figure 3-13, B, lanes 3-4).

65

66

Figure 3-12. AAV Vectors Characterized in Final Multiple Gene Product Delivery Studies. (A) CB-EGFP is a negative control used in immunoprecipitation then western blot (IP/WB) experiments to show that GFP is expressed but not secreted in the absence of a FIB sequence. (B) CB-FIB-EGFP is a positive control used in IP/WB experiments for secretion of GFP into the medium. (C) CB-FIB-GAL is a negative control used in IP/WB experiments to show that the GFP antibody does not cross-react to galanin or other non-specific proteins. (D,E) CB-FIB-GAL-RKRRKR-EGFP and CB-FIB-EGFP-RKRRKR-GAL are used both for in vitro cleavage and secretion assay, and used for in vivo studies to test the function of both gene products. (F) CB-FIB-GAL-EGFP is a non-cleavable control for both in vitro and in vivo experiments. (G) CB-FIB-GAL-RKRRKR-NPY 13-36 is a construct used only for in vivo experiments and should allow secretion of two therapeutic neuropeptides.

TR (2)


TR (2)

EGFPFIBTR (2)

CB SV-40 Poly-A

TR (2)

TR (2)


TR (2)

EGFPRKRRKR

TR (2)


TR (2)RKRRKR

EGFP

TR (2)


TR (2)

EGFP

TR (2)


TR (2)RKRRKR

NPY 13-36

TR (2)

CB SV-40 Poly-A

TR (2)

EGFPA

B

C

D

E

F

G

TR (2)


TR (2)

TR (2)


TR (2)

EGFPFIBTR (2)

CB SV-40 Poly-A

TR (2)

EGFPFIBTR (2)

CB SV-40 Poly-A

TR (2)

TR (2)


TR (2)

EGFPRKRRKR

TR (2)


TR (2)

EGFPRKRRKRRKRRKR

TR (2)


TR (2)RKRRKR

EGFPTR (2)


TR (2)RKRRKRRKRRKR

EGFP

TR (2)


TR (2)

EGFPTR (2)


TR (2)

EGFP

TR (2)


TR (2)RKRRKR

NPY 13-36

TR (2)


TR (2)RKRRKRRKRRKR

NPY 13-36

TR (2)

CB SV-40 Poly-A

TR (2)

EGFPTR (2)

CB SV-40 Poly-A

TR (2)

EGFPA

B

C

D

E

F

G

67

Figure 3-13. In Vitro Characterization of Fluorescence Patterns, Cleavage, and Secretion of Proteins Derived from Multiple Gene Product Delivery Vectors. (A) GFP expression patterns in transfected 293 cells at low and high magnification. (B-C) Immunoprecipitation and Western blotting of GFP from transfected cells; either conditioned medium (B) or cell lysate (C) was analyzed. (1) CB-EGFP, GFP is expressed as seen in C lane 1, but is not secreted into the medium (B lane 1). Cells have a bright and uniform distribution of intracellular GFP (A, panel 1). (2) CB-FIB-EGFP, GFP is expressed and secreted into the medium (B-C, lane 2). Fluorescence is concentrated around the perimeter, indicating secretion (A, panel 2). (3) CB-FIB-EGFP-RKRRKR-GAL, GFP is cleaved from galanin and secreted into the medium (B, lane 3). As seen in C lane 3, unprocessed protein is detected in the cell lysate. (4) CB-FIB-GAL-RKRRKR-EGFP, GFP behaves the same as B and C lane 3, so correct processing and secretion occurs whether GFP is 5’ or 3’ of the cleavage sequence. (5) CB-FIB-GAL-EGFP, GFP cannot be cleaved from galanin because this construct lacks a cleavage sequence. The fusion protein is still secreted due to the inclusion of FIB (B lane 5). A small amount of degraded protein is present in the cell lysate, but does not get secreted (C lane 5). Fluorescence patterns are similar with all secreted GFP constructs (A, panels 2-5), although intensity seems to be lower in A, 3, however, the relative amount of GFP detected in the medium is similar (B lanes 2-5). (6) CB-FIB-GAL, GFP is not present in the cells (A, panel 6), and the GFP antibody does not cross-react to galanin (B-C, lane 6). (7) Rainbow marker of known proteins from Amersham, size indicated to the right (B-C, lane 7).

1

2

3

4

5

6

20X 40XA.

Cell LysateC.

Conditioned MediumB.1

2

3

4

5

6

20X 40XA.

Cell LysateC.

Conditioned MediumB.

Cell LysateC. Cell LysateC.

Conditioned MediumB. Conditioned MediumB.

68

III.B.5. In Vivo Functional Test of Single FIB Multiple Gene Product Delivery Vectors

In order to test the in vivo function of these proteins, we packaged our multiple

gene product delivery constructs into AAV2 vectors where the CB promoter drives

expression of the FIB-GAL-RKRRKR-EGFP, FIB-EGFP-RKRRKR-GAL, FIB-GAL-

EGFP, or FIB-GAL-RKRRKR-NPY13 36 coding sequence (see Figure 3-12). Then,

3µL of virus (1.0 X 1012 viral particles/mL) was infused bilaterally into the piriform

cortex of rats, as previously described (McCown 2006) (see Figure 3-14). Control rats

received no infusion, as we have previously shown that vectors expressing and secreting

reporter genes like GFP (AAV-FIB-EGFP), as well as vectors expressing peptides that

lack secretion sequences (AAV-GAL) have no effect on seizure sensitivity, seizure

behaviors, or seizure-induced cell death (Haberman, Samulski et al. 2003; McCown

2006). One week later, the rats received a dose of 10mg/kg, i.p. kainic acid, and

subsequently, the time to limbic seizure behaviors was recorded. As seen in Figure 3-14,

the immunohistochemistry data presented shows that the GFP is functional in both

orientations, but reveals that number of transduced cells is limited. Figure 3-15 confirms

the presence of vector-derived mRNA for the animals injected with AAV2-CB-FIB-

GAL-RKRRKR-NPY13-36. As seen in Figure 3-16, all groups exhibited wet dog shakes

(WDS) with similar latency, validating the efficacy and uniformity of the absorbed dose

of kainic acid. All vector treated animals showed a significant delay in the onset of class

IV seizures (*t-test; P≤0.01). A strong increase in the latency to seizure behavior

demonstrates that the galanin gene product is in fact expressed, secreted, and functional

regardless of whether it is 5’ or 3’ of the cleavage site in our multiple gene product

69

Figure 3-14. Immunofluorescence of Neurons in the Piriform Cortex That Have Been Transduced with GFP-containing Vectors. The shaded area in the coronal section shows the range of placement within the piriform cortex of the AAV vector microinjections. Sections were taken at the level of the needle track and processed for GFP fluorescence. Presence of GFP protein reveals the virus transduction pattern, and confirms that our constructs are functional in both orientations in vivo. The localization of GFP to the periphery of the cells is consistent with GFP secretion.

70

Figure 3-15. The In Vivo Presence of Vector-derived FIB-GAL-RKRRKR-NPY13-36 mRNA 1 Week after Vector Infusion into the Piriform Cortex. To validate viral transfer for the AAV2-CB-FIB-GAL-RKRRKR-NPY13-36 group, we performed RT-PCR on tissue from the piriform cortex. As seen in Figure 3-8, the appropriate vector derived mRNA (252bp) is present in all 7 animals injected with this vector (lanes A-G). The left outside lane contains a 50bp DNA ladder with the size indicated on the left. Omission of the reverse transcriptase step resulted in loss of the product (data not shown). Together, Figures 3-13 and 3-14 confirm successful gene transfer occurred in all of our vector-treated groups.

71

Figure 3-16. The Effects of Multiple Gene Product Delivery Vectors on Limbic Seizure Behavior. The latencies to wet dog shakes and limbic seizure behaviors were determined for 180 min post-kainic acid. All the animals regardless of treatment group developed wet dog shakes with similar latencies, suggesting an equivalent absorbed dose of kainic acid. All AAV vector groups exhibited a significant delay in the time to class IV limbic seizures. (FG-E is AAV2-CB-FIB-GAL-RKRRKR-EGFP, FE-G is AAV2-CB-FIB-EGFP-RKRRKR-GAL, FG-NPY13-36 is AAV2-CB-FIB-GAL-RKRRKR-NPY13-36, FGE is AAV2-CB-FIB-GAL-EGFP, and Control is kainic acid only with no vector; * signifies significance of p≤0.01 compared to Control using two-tailed t-test)

Effects of AAV Vectors on Limbic Seizure Behavior

020406080

100120140160180

FG-E FE-G FG-NPY13-36

FGE Control

Late

ncy

(Min

utes

)

Wet Dog ShakesClass IV

* *

**

72

delivery vectors (CB-FIB-GAL-RKRRKR-EGFP + CB-FIB-EGFP-RKRRKR-GAL,

Figure 3-16). Unexpectedly, galanin was able to decrease seizure activity even when

GFP was not cleaved (CB-FIB-GAL-EGFP, Figure 3-16). While animals receiving

AAV2-CB-FIB-GAL-RKRRKR-NPY13-36 did show a significant delay in the latency to

class IV seizures compared to controls, having two therapeutic neuropeptides did not

confer additional seizure protection over having a single therapeutic neuropeptide (Figure

3-16). Taken together, we can conclude that successful gene transfer occurred in all of

the vector-treated groups, and that the gene products are functional in vivo, providing

proof of concept.

Chapter 4

Discussion

IV.A. rAAV-Mediated Expression and Constitutive Secretion of NPY or NPY13-36 Suppresses Seizure Activity In Vivo

Epilepsy is an attractive target for recombinant Adeno-associated virus (rAAV)

gene therapy, because the temporal lobe structures involved in seizure genesis and

propagation have been shown to be permissive to AAV gene transfer (Freese, Kaplitt et

al. 1997; Vezzani, Michalkiewicz et al. 2002; Haberman, Samulski et al. 2003; Richichi,

Lin et al. 2004; Klugmann, Symes et al. 2005; McCown 2006). Recently, galanin and

NPY have been delivered as transgenes in rAAV vectors, and shown to be effective in

several epilepsy paradigms (Haberman, Samulski et al. 2003; Lin, Richichi et al. 2003;

Richichi, Lin et al. 2004; McCown 2006). While previous approaches utilize pre-pro

cDNA sequences which rely on the cell to modulate release of the gene product,

Haberman et al. (2003) were the first to use a novel secretion strategy whereby the

secretion signal sequence from the constitutively secreted laminar protein fibronectin

(FIB), is combined with the coding sequence for the active therapeutic peptide. Results

from Haberman et al. (2003) and McCown (2006) show that expression and constitutive

secretion of galanin is not only achieved, but also effective in attenuating focal and

limbic seizure activity. In contrast, expression of galanin without the secretory signal or

74

expression and secretion of the reporter gene, GFP had no effect on seizure sensitivity

(Haberman, Samulski et al. 2003; McCown 2006).

In addition to galanin, rAAV delivery of NPY has also been shown to attenuate

limbic seizures (Richichi, Lin et al. 2004). While there is still some question as to which

of the NPY receptors (Y1-Y5) mediates the anti-seizure activity, several studies have

suggested a critical role for the Y2 receptor in mediating anti-epileptic actions (Colmers,

Klapstein et al. 1991; Greber, Schwarzer et al. 1994; Dumont, Cadieux et al. 2000;

Dumont, Cadieux et al. 2000; El Bahh, Cao et al. 2002; El Bahh, Balosso et al. 2005; Lin,

Young et al. 2006). Furthermore, it has been demonstrated that in epileptic tissue from

patients (Furtinger, Pirker et al. 2001) and rodents (Kofler, Kirchmair et al. 1997;

Schwarzer, Kofler et al. 1998) that Y1 receptors are downregulated while Y2 receptors

are upregulated. Taken together, these results suggest that when designing anti-

epileptogenic therapeutics, it may be advantageous to deliver Y2 preferring agonists. In

fact, acute intracerebral delivery of the Y2 receptor preferring agonist NPY13-36 reduces

seizure susceptibility following systemic kainic acid administration (Vezzani, Moneta et

al. 2000; Vezzani, Rizzi et al. 2000). These data along with our current findings suggest

NPY13-36 is a good candidate to use in a rAAV vector to treat epilepsy. By using the

FIB secretion strategy, we have the capability of expressing and constitutively secreting

peptide fragments which have demonstrated receptor selectivity. Thus, we evaluated the

effects of AAV mediated expression and constitutive secretion of NPY and the peptide

fragment NPY13-36 on kainic acid induced limbic seizures. Our data demonstrates that

seizures can be effectively controlled in rats using rAAV to deliver inhibitory

neuropeptides to susceptible neurons.

75

Our approach differed with that of Richichi et al. who used a pre-pro form of

NPY cDNA in their AAV vector (Richichi, Lin et al. 2004). While their approach did

confer some seizure protection, their effects are dependent on three caveats that our

approach circumvents. First, since they use the pre-pro form of NPY, it is likely that only

a subset of transduced neurons will have the ability to correctly process the pre-pro

protein into the active protein, which requires a whole host of proteins including but not

limited to chaperones and pro-protein convertases. Second, even the transduced neurons

that are capable of processing pre-pro NPY (probably neurons that already contain and

release NPY), have a limit to the amount of pre-pro protein that can be correctly

processed and packaged into large core dense vesicles for release. As the authors point

out, pro-NPY could “spill over” into the constitutive pathway, resulting in the formation

of some inactive pro-NPY that cannot be released by exocytosis (Burgess and Kelly

1987), or worse, causes release of inactive protein that could act like a NPY receptor

antagonist. This is a concern especially because Richichi et al. are using a construct with

a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE), which

dramatically increases the total amount of vector-mediated transgene expression

(Donello, Loeb et al. 1998; Higashimoto, Urbinati et al. 2007). Finally, even the pro-

NPY that is correctly processed into mature NPY is stored in large dense core vesicles

and docked in pools which can only be released in the typical regulated fashion upon

robust neuronal excitation (see Figure 4-1). Usually, only high frequency action

potentials can trigger their release (Hokfelt, Bartfai et al. 2003). Since the NPY receptors

are located on the outside of the neuronal membrane, NPY can only exert function upon

76

Figure 4-1. Regulated versus Constitutive Secretion in Neurons. (1) In the regulated pathway neuropeptides and other proteins are first synthesized as pro-proteins in the endoplasmic reticulum, then they are sorted and processed in the golgi and trans golgi network, finally they are packaged in dense-core vesicles where they can be cleaved into their active forms and tethered in releasable pools until high frequency stimulation (depicted as a lightening bolt) causes exocytosis. (2) In the constitutive secretory pathway proteins are synthesized, sorted, and processed in a similar way, but once they are packaged into secretory vesicles and cleaved into active forms, they are continuously released via exocytosis independent of stimulation.

Continuous Constitutive Secretion Endoplasmic Recticulum

Plasma Membrane Stimulus-induced Regulated

Secretory Vesicles

1

1

2

Golgi Apparatus

2

77

release, so the manner in which the neuropeptide is released is critical to seizure

prevention.

Our approach circumvents all of these issues by using only the active peptide

sequence fused to a constitutive secretion signal. Hence, there is no pro-protein to

process, and release happens in the absence of regulation.While our approach has proven

effective for galanin and NPY, it would probably not work for dynorphin, an endogenous

opioid neuropeptide with anti-seizure activity (Bonhaus, Rigsbee et al. 1987; Mazarati

and Wasterlain 2002; Loacker, Sayyah et al. 2007). Mazarati and Wasterlain (2002)

showed that acute hippocampal delivery of dynorphin A(1-13) had a profound anti-

seizure effect in a rat model of self-sustaining status epilepticus, suggesting that

dynorphin A(1-13) would be a good therapeutic candidate for our constitutive secretion

vectors. However, like most neuropeptides dynorphin A(1-13) is first expressed as a pro-

protein that gets cleaved into active forms of various lengths by a protease that recognizes

basic amino acid residues (for review see (Simonato and Romualdi 1996). After close

examination of the amino acid sequence of dynorphin A(1-13) we discovered that it has a

potential furin cleavage site at residues 6-9 which are R-R-I-R. Hence, based on our

results with the multiple peptide delivery vectors, we predict that designing an AAV

vector where FIB mediates constitutive secretion of dynorphin A(1-13) would result in

undesirable cleavage then secretion of fragments of the expressed protein. This example

illustrates an important concern when delivering gene products as therapeutics: their

sequences must be carefully analyzed and perhaps even optimized for efficient transgene

expression. While our approach might not be effective for every transgene, we

demonstrated that it is effective with NPY and with NPY13-36, confirming that it is now

78

possible to express and secrete active peptide fragments which allow for more selective

receptor targeting. Furthermore, using small peptide fragments in an AAV context could

allow for multiple therapeutic peptides to be expressed from a single vector cassette. It is

likely that combination therapy will be the key to treating epilepsy and many other

complex neurological disorders.

IV.B. A Strategic Approach for Delivering Multiple Gene Products Using a Single AAV Vector

These experiments were conducted primarily to show that it is possible to use a

single AAV vector that upon transduction causes cells to express and secrete two gene

products simultaneously; and also to study the interaction of vector-mediated secretion of

galanin and NPY on limbic seizure behavior. We have shown in vitro and in vivo that

our constructs mediate the expression of a chimeric fusion protein that upon intracellular

processing gets cleaved and constitutively secreted as two functional proteins. These

results expand the utility of engineering a proteolytic cleavage site in an AAV vector

cassette.

While both galanin and NPY (and NPY13-36) have been extensively studied in

seizure models (see IV.A.), combinations of these peptides in such models remain

unexplored. In order for the two neuropeptides to have a synergistic effect, they must

have separate mechanisms of action, or at least divergent down stream pathways.

Mazarati and Wasterlain (2002) concluded that a different pattern of anticonvulsant

action was evident after the acute delivery of NPY versus galanin, suggesting that

delivering both neuropeptides simultaneously could be advantageous. However, it is

clear from our experiments that galanin and NPY13-36 do not potentiate one another in

the piriform cortex because simultaneous delivery did not result in a more complete

79

blockade of limbic seizure behavior. This suggests that galanin and NPY13-36 may have

the same mechanism of action and/or the same intracellular signaling pathways in the

piriform cortex. While unexpected, the data can be explained by carefully examining the

mechanisms of action, receptor subtype distribution, and signaling cascades of both

galanin and NPY in the piriform cortex. Galanin has been shown to reduce glutamate

release from presynaptic nerve terminals in the brain (Zini, Roisin et al. 1993). All three

galanin receptors (GALR1-3) are present in the piriform cortex (O'Donnell, Ahmad et al.

1999; He, Counts et al. 2005; Mazarati, Lundstrom et al. 2006), but GALR2 and GALR3

are the most abundant. GALR1 and GALR3 can signal both by inhibiting adenylyl

cyclase via a pertussis toxin-sensitive G-protein of the Gi/Go family (Parker, Izzarelli et

al. 1995; Smith, Forray et al. 1997), by reducing the concentrations of cAMP (Branchek,

Smith et al. 2000), or by activating G-protein-coupled inwardly rectifying potassium

channels (GIRKs) (Smith, Walker et al. 1998; He, Counts et al. 2005; Mazarati,

Lundstrom et al. 2006). GALR2 stimulates inositol phospholipid turnover and

intracellular calcium mobilization through a pertussis toxin-insensitive Gq/G11-type

mechanism (Fathi, Cunningham et al. 1997; Smith, Forray et al. 1997). This type of

channel activation could increase seizure sensitivity, but this was not observed after

AAV-mediated galanin secretion in the piriform cortex. NPY has several receptors (Y1-

6), but the peptide fragment NPY13-36 has the highest affinity for the Y2 receptor

(Y2R). Y2R are primarily presynaptic, and their activation suppresses glutamate release

(Colmers and Bleakman 1994; Greber, Schwarzer et al. 1994) via suppression of voltage-

dependent calcium influx through neuronal N-type calcium channels in presynaptic nerve

terminals (Toth, Bindokas et al. 1993; Qian, Colmers et al. 1997). Although galanin and

80

NPY receptors appear to have limited overlap in their downstream signaling pathways,

the end result is still the same: both neuropeptides reduce presynaptic glutamate release.

Therefore, a plausible explanation for the observed lack of potentiation in the piriform

cortex is that a maximal effect for inhibition of presynaptic glutamate release is already

achieved with the delivery of galanin.

Another possibility may be that the concentration of furin in the transduced

neurons could be in limited supply such that constitutive expression of our transcript with

the strong CB promoter is overwhelming the cleavage pathway. The consequence of this

might be that a percentage of secreted protein will still be a galanin-NPY13-36 fusion

protein. Furin and other pro-protein convertases are known to be upregulated in neurons

after seizures induced by kainic acid treatment (Meyer, Chretien et al. 1996), but this

upregulation seems to occur primarily in the hippocampus, and is perhaps not as robust in

the piriform cortex. While our in vitro data suggests that cleavage is completely efficient

(because we never detect fusion protein in the medium with galanin-GFP constructs),

perhaps efficiency is related to the size and structure of the cleavable protein. NPY13-36

is very different from GFP in that it is much smaller. In addition, it has been suggested

that Y2R analogs and NPY13-36 may form hairpin or helical structures (Yao, Smith-

White et al. 2002), and this may mask the cleavage site. The predicted results of a

masked cleavage site would be that the majority of the secreted protein would be a

galanin-NPY13-36 fusion protein. The affinity of the fusion protein for the galanin

receptors and/or the NPY receptors might be lower than that of either galanin or NPY

alone, and may explain our observed results. To rule out this possibility two more

control vectors can be made. The first vector can be a non-cleavable cassette with

81

galanin and NPY13-36. If results from this vector are similar to the results from the

cleavable vector, then it is likely that cleavage efficiency in vivo is poor. Another vector

that can be made is a cassette with an IRES sequence in between galanin and NPY13-36.

While levels of translation will be unequal, at least both gene products will be secreted

from the same transduced neuron, which would not happen 100% of the time with co-

infection of separate vectors. If indeed the proteins are not cleaved from one another in

vivo, it points to a potential liability when using a proteolytic strategy: each protein

combination must be tested on a case by case basis to ensure proper folding and

processing of the gene products are occurring. It is likely that this vector strategy might

not be universally suitable for all protein combinations.

Finally, compared to our previous experiments, transduction levels obtained with

the multiple gene product delivery vectors were modest. The limited spread of these

vectors within the piriform cortex probably decreased the sphere of influence of the

secreted neuropeptides. This could explain the lack of complete protection from seizure

behavior that delivering galanin alone in the piriform cortex has previously produced

(McCown 2006). Since the same AAV serotype and promoter was used, the change in

the transduction pattern can not be explained by virus tropism. Other possibilities include

differences in virus infectivity, sequence-dependent problems with second strand

synthesis, or sequence-dependent mRNA transcript instability. The first hypothesis was

investigated by performing an infectious center assay on the AAV vectors used in these

experiments, and confirmed that they were within the normal range (see Figures 2-3, 2-4,

2-5, 2-6). The second hypothesis can be tested by using a self-complementary vector to

bypass rate-limiting second strand synthesis. Since the size of the promoter, transgene,

82

and polyA is around 2.5kb for AAV2-CB-FIB-GAL-RKRRKR-NPY13-36 it should fit

into a double stranded cassette, although efficiency may be slightly lower than a 2kb

construct. Efforts are being made to shorten the CB promoter for more efficient use in

double stranded vectors, and that would restore full infectivity to our construct because

the largest element in our cassette is the CB promoter. The third hypothesis can be tested

by creating a construct that delivers both galanin and NPY13-36 from the same vector but

as separate transcripts by using two promoters and polyA sequences. While the results

are not exactly what we expected, we did demonstrate the concept that an engineered

proteolytic cleavage site can successfully be used in conjunction with a constitutive

secretion signal sequence to allow multiple gene products to be expressed and secreted

simultaneously, using a single cistron cassette in an AAV vector.

Taken together, this body of work describes a gene therapy vector technology

platform to express and constitutively secrete single and multiple proteins from

transduced cells, and to deliver peptide fragments that are capable of selective receptor

targeting. While epilepsy is one model where this technology was applied, it should be

easily transferable for the treatment of other neurological diseases such as Parkinson’s

disease, Alzheimer’s disease, and stroke.

Chapter 5

The Future of AAV-mediated Gene Therapy in the Brain: Obstacles and

Opportunities

V.A. Brain-wide Vector Delivery

One of the most challenging issues in gene therapy is delivering the vector to all

the disease-affected tissues in the patient. Although using gene therapy to treat a

neurological disease limits the area of vector delivery, the complex organization and

specialization of the substructures in the brain currently impedes global brain delivery.

Some attempts have been made to deliver AAV vectors via intracerebroventricular (ICV)

injection (Shenouda, Johns et al. 2006; Qing and Chen 2007) in the hopes that the

cerebrospinal fluid (CSF) would carry the vector throughout the brain, however, no

improvement in virus spread was achieved. It appears that when delivered ICV, AAV

vectors do not spread beyond the third ventricle or median eminence. Some strategies

exist to enhance the spread of AAV in the brain, such as co-administering mannitol

(Bartlett, Samulski et al. 1998), heparin (Nguyen, Sanchez-Pernaute et al. 2001), and

basic fibroblast growth factor (Hadaczek, Mirek et al. 2004). Alternatively, convection-

enhanced delivery (an approach that uses bulk flow--maintaining a pressure gradient over

time--to deliver and distribute molecules to large areas of brain tissue (Hadaczek,

Kohutnicka et al. 2006), or multiple vector injections (McPhee, Janson et al. 2006) can be

used to increase viral spread. A third strategy to increase AAV vector transduction can

84

be achieved by altering critical capsid components of the vector (see the next section for

a more detailed discussion of this point). Until the technical hurdle of global brain

delivery can be overcome, we must be realistic in our expectations of gene therapy to

treat certain neurological diseases. One factor that contributes to limited success is that

AAV2 continues to be the vector of choice for animal experiments and clinical trials,

(because it is the best characterized and most available serotype), however, it is the

poorest of the serotypes at transducing cells beyond the area of injection. While this

quality is beneficial for diseases with a localized nature (like focal epilepsy), it is

detrimental for most neurological diseases that involve multiple brain regions.

While the brain’s complex structure does present a challenge, knowledge of

neuroanatomy and neuronal projection pathways can be employed to design more

efficient delivery paradigms. For example, it has been reported that some but not all

AAV serotypes can be transported in an anterograde or retrograde manner along axonal

projections to a site distant from that of injection (Kaspar, Llado et al. 2003; Passini,

Macauley et al. 2005; Provost, Le Meur et al. 2005). In fact, Cearley and Wolfe (2006)

showed that when the identical vector genome was cross-packaged into AAV7, 8, 9, or

rh10 capsids, there was a difference not only in the transduction patterns of the different

serotypes, but also in the ability of the packaged vector genome to undergo axonal

transport to neuronal cell bodies distal to the injection site (Cearley and Wolfe 2006).

Furthermore, they then used rAAV9 and showed that a single injection into the ventral

tegmental area (VTA) resulted in delivery and transgene expression in several brain

structures known to have reciprocal projections with the VTA (Cearley and Wolfe 2007).

Injection in the VTA dramatically enhanced virus spread and therapeutic efficacy

compared to injection of the same amount of virus in the striatum (Cearley and Wolfe

2007). Another group compared AAV serotype 1, 2, 5, 7, and 8 in a mouse model of the

lysosomal storage disease Niemann-Pick type A (Dodge, Clarke et al. 2005). Niemann-

Pick type A disease is caused by a deficiency in acid sphingomyelinase (ASM) activity.

Thus, the serotypes were injected into the deep cerebellar nuclei (DCN), and evaluated

for the ability to facilitate global distribution of the viral vector and gene product (ASM).

The authors found that AAV1 was the superior serotype in all measures of disease

correction, and that transduction was observed in the DCN and throughout the

cerebellum, brainstem, midbrain, and spinal cord (Dodge, Clarke et al. 2005). By

understanding which brain regions are affected and how they project to one another,

scientists can design more efficient vector delivery strategies that are tailored to each

neurological disease. Successful vector delivery is paramount for gene therapy to

progress beyond clinical trials.

V.B. Vector Safety, Tolerability, and Efficacy

V.B.1. Vector Targeting

The goal of any Phase I clinical trial is to assess if an experimental treatment is

safe and well tolerated by the patients; AAV-mediated gene therapy is no exception. One

way to contribute to the safety and tolerability of a treatment is to minimize off-target

effects. For AAV gene therapy in the brain, targeting subpopulations of cells can be

achieved at two levels; one is by modifying the capsid so it is capable of binding and

mediating viral entry into specific cell types, and the other is by transcriptional control,

where the promoter and its associated cis and trans regulatory elements can be modified

to limit vector-mediated gene expression to specific cell types and conditions.

85

86

where the promoter and its associated cis and trans regulatory elements can be modified

to limit vector-mediated gene expression to specific cell types and conditions.

V.B.1.a. AAV Capsid-mediated Vector Targeting

Capsid modification is one of the most rapidly progressing areas of AAV vector

engineering. Several targeting approaches have been used by various labs including

genome transcapsidation, mixing of different serotypes to create mosaic capsids, domain

swapping from different serotypes, peptide insertion to create chimeric capsids, and

genetically shuffled AAV capsid gene libraries. Each of these approaches might be a

viable way to overcome some rate-limiting barriers in viral entry and post-entry in

neurons, thereby improving gene transfer.

Transcapsidation (sometimes referred to as pseudotyping) is the packaging of an

AAV genome containing the TR from one serotype (usually type 2 because it is the best

characterized and Food and Drug Administration (FDA) approved serotype) into the

capsid of another serotype in order to shift the viral vector tropism (for an in depth review

see (Choi, McCarty et al. 2005). This strategy is being used extensively in the brain to

increase the viral spread beyond the site of injection. For example, rAAV2 vector

genomes psuedotyped with capsids of AAV1 and AAV5 were compared to rAAV2 in

several brain regions. In this case, rAAV1 and rAAV5 had a more extensive area of

transduction than rAAV2 in most regions examined (Burger, Gorbatyuk et al. 2004;

Shevtsova, Malik et al. 2005). As new serotypes are being discovered and characterized

(Gao, Alvira et al. 2002; Gao, Alvira et al. 2003), it will not be long before we have an

arsenal of serotypes that work best for each brain region, and possibly each neurological

disease.

87

Mosaic capsid modification can also expand viral tropism because it involves

mixing capsid subunits from different serotypes to create a hybrid capsid with receptor

binding profiles conferred from each parent serotype (reviewed in (Wu, Asokan et al.

2006). It was shown that mosaic vectors can gain function compared to the parent

serotypes (Rabinowitz, Rolling et al. 2002; Rabinowitz, Bowles et al. 2004). An

AAV1/AAV2 mosaic vector where the capsid input ratio was 1 to 1 was compared to an

AAV2 vector after hippocampal delivery. The AAV2 vector transduced only the hilar

interneurons while the mosaic vector transduced the hilar interneurons and some

pyramidal and granule cells (Richichi, Lin et al. 2004). Although higher transduction

efficiency was achieved by using the mosaic vector, the authors did not include an AAV1

vector in this study. Therefore, it cannot be determined if the mosaic vector would

outperform each parent serotype. In addition, this method of viral production actually

yields non-uniform virions. For example, even though in this case an equal ratio of type

1 and type 2 helper plasmids were used, it is likely that not all particles will contain equal

amounts of type 1 and type 2 subunits. Since standardization of these preps is difficult,

this method of capsid engineering will probably not transition to clinical trials.

Chimeric vectors contain capsid proteins that have been modified by functional

domain or amino acid swapping between different serotypes, or by genetically inserting

peptide ligands into domains of the capsid to change its receptor binding profile

(reviewed in (Wu, Asokan et al. 2006). Bowles et al. applied the marker rescue approach

to AAV capsid engineering so mutations that may help to target vectors but renders them

non-infectious can be rescued by the addition of wild type capsid (Bowles, Rabinowitz et

al. 2003). By adding back wild type capsid with sequence homology and by selecting for

88

infectious particles using specific cell types, infectivity and vector targeting can be

achieved. This rescue may occur by host cell-mediated recombination at regions of

homology between the wild type and mutant capsid subunits (Bowles, Rabinowitz et al.

2003), or by limiting the number of mutation containing subunits that are incorporated

into the capsid (Gigout, Rebollo et al. 2005). Rational domain swapping is similar to

marker rescue, but instead of relying on recombination to make changes in the capsid

subunits, domains are chosen based on their three dimensional location in the assembled

capsid and their potential to impact function while preserving capsid structure (like

variable surface loops). These domains are then swapped into the capsid subunits by

cloning or other techniques. Marker rescue and rational domain swapping are powerful

techniques that when combined with specific cell-type selection can result in the

generation of AAV vectors with novel transduction capabilities (Bowles, Rabinowitz et

al. 2003; Hauck and Xiao 2003).

Chimeric vectors can also be made by inserting peptide ligands into the capsid to

target them to specific cell types expressing the complimentary receptors. Recently, this

approach was used with two peptide ligands that mimic binding domains for cytoplasmic

dynein and NMDA receptors. These peptides were genetically engineered into AAV2

capsid proteins by directed mutagenesis, and it was shown that these chimeric AAV

vectors exhibited significantly enhanced axonal uptake, allowing for more efficient

retrograde transport (Xu, Ma et al. 2005). The authors delivered AAV vectors to the

tongue and analyzed the brain stem for viral DNA as a proof of concept of retrograde

transport, but these vectors could be directly injected into the brain and analyzed for

transduction efficiencies.

89

Fortunately for patients with neurological diseases, most AAV serotypes tested so

far are neuro-tropic, making AAV a potentially ideal vector for treatment. However,

there are certain types of brain cancers like astrocytomas and gliomas, as well as diseases

like multiple sclerosis and other demyelinating diseases that affect oligodendrocytes.

These diseases could be treated with glia-tropic AAV vectors. Actually, one group tried

to use AAV2 vectors where transgene expression was mediated by the oligodendrocyte-

specific myelin basic protein (MBP) promoter, to transduce diseased oligodendrocytes in

a mouse model for the human demyelinating disease globoid cell leukodystrophy (Chen,

McCarty et al. 1999). In this mouse model called twitcher, demyelination occurs as a

result of degenerating oligodendrocytes, the onset of which is around 20 postnatal days

(Suzuki and Taniike 1995). It was reported that transduction of the oligodendrocytes in

the twitcher mice with AAV2 vectors was quite low (Chen, McCarty et al. 1999),

highlighting the need for more effective glia-tropic AAV vectors. While glial cells

cannot be efficiently targeted and transduced in vivo with the serotypes currently

available, engineering the AAV capsid could result in re-targeting the virus so it no

longer primarily infects neurons. DNA shuffling and error-prone PCR are powerful

library-based approaches that direct the evolution of the capsid, and could be used to re-

target AAV vectors to glial cells. DNA shuffling causes recombination to occur between

homologous fragments generated from a pool of related genes. Upon self-priming PCR,

these fragments can reassemble into diverse sequences that are generated in a non-biased

fashion. Error-prone PCR also introduces random mutations that alone or in combination

may confer unique or enhanced function (for review see (Yuan, Kurek et al. 2005). Both

of these techniques in combination with cell type-specific selection and repeated virus

90

cycling can result in lab engineered serotypes that may target and enhance transduction in

refractory cell types such as glia. In addition, these techniques were recently applied to

AAV2 vectors to select for variants that can escape neutralizing antibodies (Maheshri,

Koerber et al. 2006; Perabo, Endell et al. 2006), reinforcing the utility of these

engineering approaches (see section V.B.2. for more detailed discussion).

V.B.1.b. Cell Type-specific Promoter-mediated Vector Targeting

Along with capsid engineering, another way to limit off-target effects is by

restricting the expression of the transgene to the targeted cells by using cell type-specific

promoters. Cell type-specific promoters can only initiate transgene expression when

specific transcription factors or transactivators recognize and bind to regulatory

sequences within the promoter. Expression of these transcription factors and

transactivators is restricted to sub-populations of cells, and thus prevents ubiquitous

transgene expression (for review see (Walther and Stein 1996). Even though the

naturally occurring AAV serotypes primarily transduce neurons, there is evidence to

suggest that using tissue-specific transcription regulatory elements may increase the

strength and persistence of gene expression in vivo (Klein, Meyer et al. 1998; Paterna,

Moccetti et al. 2000; Xu, Janson et al. 2001; Klein, Hamby et al. 2002). Some promising

promoters that restrict transgene expression to neurons are the neuron-specific enolase

(NSE), platelet-derived growth factor b-chain (PDGF-b), and the human synapsin 1 gene

(hSYN) promoters. Transgene expression in neurons was confirmed for these promoters

by immunohistochemistry double labeling experiments, and persisted greater than 9

months in multiple brain regions (Peel, Zolotukhin et al. 1997; Klein, Meyer et al. 1998;

Paterna, Moccetti et al. 2000; Xu, Janson et al. 2001; Shevtsova, Malik et al. 2005).

91

In addition to neurons, the brain contains other cell types including astrocytes,

macrophages, oligodendrocytes, and epithelial cells. In combination with capsid

engineering, it may be possible to direct and restrict AAV-mediated gene expression to

these cell types. Caution must be taken when trying to target AAV transduction to non-

neuronal cells using cell type-specific promoters, because it has been reported that even

in the presence of glial cell-specific promoters, neuronal expression can still occur. For

example, in a study by Xu et al., high levels of neuronal expression and low levels of

glial expression were found when using AAV2 vectors where gene expression was driven

by the glial fibrillary acidic protein (GFAP) promoter (Xu, Janson et al. 2001). The

authors suggest that the observed “leakiness” of expression could be attributed to

promoter-specific effects on enhancer elements within the TRs (Xu, Janson et al. 2001).

This is likely the case because AAV TRs have been shown to posses transcriptional

activity (Flotte, Afione et al. 1993; Haberman, McCown et al. 2000), suggesting that each

cell type-specific promoter must be tested in vivo to confirm that transgene expression is

in fact limited to the targeted cell population. Furthermore, it is known that some

promoters are inactivated over time in various brain regions, causing shutdown of

transgene expression (McCown, Xiao et al. 1996; Klein, Meyer et al. 1998; Raol, Lund et

al. 2006). Thus, longevity of transgene expression should also be evaluated. The clinical

success of treating neurological diseases with AAV-mediated gene therapy will be

greatly improved with the development of cell type-specific promoters that confer

enhanced long-term gene expression.

92

V.B.1.c. Inducible and Conditional Promoters

In addition to cellular targeting, temporal regulation of transgene expression is a

desirable feature that enhances clinical safety of AAV-mediated gene therapy. Precise

control over the level of transgene expression is necessary, particularly when delivering

potent neurotrophic factors and neuropeptides in the brain, because robust over-

expression has been shown to cause deleterious side effects (Kirik, Rosenblad et al. 2000;

Georgievska, Kirik et al. 2002). Regulation of transgene expression can be achieved

through responsive/inducible elements within the promoter sequence of an AAV vector.

Many synthetic and endogenous promoters have been exploited for the purpose of

gene regulation including hypoxia-responsive promoters, metallothionein promoters, heat

shock, and hormone-responsive promoters (Searle, Stuart et al. 1985; Fuqua, Blum-

Salingaros et al. 1989; No, Yao et al. 1996; Semenza, Jiang et al. 1996). Hypoxia-

inducible and similar disease state-inducible systems have been incorporated into AAV

vectors and may be appropriate for use with specific diseases (Phillips, Tang et al. 2002;

Raol, Lund et al. 2006; Shen, Su et al. 2006; Shen, Fan et al. 2008). Perhaps the most

broadly applicable designs for use in an AAV vector are the FK506/rapamycin (Rivera,

Clackson et al. 1996), tetracycline (tet) (Baron and Bujard 2000), and RU486 (Wang,

Tsai et al. 2000) responsive systems (for an in depth review see (Haberman and McCown

2002). These responsive/inducible systems rely on chimeric transcription factors or

transactivators that in the presence of an administered drug (tet, rapamycin, or

mefipristone), bind/detach their promoter and allow/repress expression of the transgene.

Hence, vector-mediated gene expression can be turned on or off by administering drugs,

allowing baselines to be determined in the presence of vector but in the absence of gene

93

product. Additionally, the same animals may be tested before and after drug

administration, allowing for repeated-measures statistical analysis with improved

statistical power.

The rapamycin responsive system has been used successfully in AAV vectors

for gene expression in muscle (Rivera, Ye et al. 1999; Ye, Rivera et al. 1999; Johnston,

Tazelaar et al. 2003), liver (Auricchio, Gao et al. 2002), eye (Auricchio, Rivera et al.

2002), and more recently in the brain (Sanftner, Rivera et al. 2006). But to date, the tet

responsive system has been favored for gene delivery in the brain (Haberman, McCown

et al. 1998; Fitzsimons, McKenzie et al. 2001; Chtarto, Bender et al. 2003; Jiang,

Rampalli et al. 2004; Chtarto, Yang et al. 2007). There have been a few problems

reported with the use of tet responsive elements in AAV vectors, mainly that there is

“leakiness” or incomplete silencing of gene expression in the “off” state (Folliot, Briot et

al. 2003; Chenuaud, Larcher et al. 2004; Gafni, Pelled et al. 2004; Jiang, Rampalli et al.

2004). As mentioned above, AAV TRs have been shown to posses transcriptional

activity (Flotte, Afione et al. 1993; Haberman, McCown et al. 2000), and therefore

optimization and thorough in vivo testing will be needed to resolve this issue. While

some issues still need to be worked out, the combination of inducible/conditional

responsive elements along with cell type-specific promoters represent an attractive means

to target and regulate AAV-mediated gene expression.

V.B.2. Cis-acting Regulatory Elements

Although the serotype and the promoter can each play a role in determining the

transduction efficiency, there are other regulatory elements that when included in AAV

vector genomes can enhance transduction efficiency. The locus control region (LCR)

94

(reviewed in (Kioussis and Festenstein 1997) and the scaffold attachment region (SAR)

are gene regulatory elements that act in cis to ensure that active transcriptional units are

established in cells. LCRs work at the level of chromatin remodeling to keep an open

chromatin configuration, thus allowing transcription of the gene to occur (Festenstein,

Tolaini et al. 1996). These regulatory elements have shown promise in generating

transgenic animals where transgene integration and subsequent expression are required

(Dillon and Grosveld 1993), but limited success has been achieved in using these

elements in viral vectors (Novak, Harris et al. 1990; Plavec, Papayannopoulou et al.

1993). In contrast, inclusion of SAR elements in retroviral vectors have been found to

confer robust and position-independent enhancement of transgene expression (Agarwal,

Austin et al. 1998; Auten, Agarwal et al. 1999). How the SAR elements enhance

transgene expression is not well understood, but one hypothesis is that they act like

insulators to allow local access of transcription factors to the enhancer/promoter

sequences within the domain (Bode, Kohwi et al. 1992; Jenuwein, Forrester et al. 1997).

In fact, companies such as Gene Detect are incorporating SAR elements into their

commercially available AAV vector plasmids (see http://www.genedetect.com/rave.htm).

Perhaps the best known regulatory element used to enhance AAV-mediated

transgene expression is the Woodchuck hepatitis B virus post-transcriptional regulatory

element (WPRE). WPRE has been shown to increase the steady-state level of

mRNA and the efficiency of translation, resulting in higher levels of transgene synthesis

(Loeb, Cordier et al. 1999). Paterna et al. performed the first in vivo quantitative

comparison of AAV vectors containing the PDGF-β promoter in conjunction with a

WPRE in the substantia nigra (Paterna, Moccetti et al. 2000). It was found that a WPRE

http://www.genedetect.com/rave.htm

95

boosted gene expression 1.8 fold compared to vectors that contained the PDGF-β

promoter and lacked a WPRE (Paterna, Moccetti et al. 2000). Then Xu et al. tested a

variety of promoters with and without a WPRE in four different brain regions (Xu,

Janson et al. 2001). They also found a WPRE to enhance gene expression from every

AAV vector and in every brain region tested (Xu, Janson et al. 2001). Other groups have

also seen improved transduction using AAV constructs with a WPRE in the lung and eye,

(Lipshutz, Titre et al. 2003; Virella-Lowell, Zusman et al. 2005), demonstrating that the

WPRE is definitely effective in an AAV context.

It should be noted that maximum levels of transgene expression are not always

desirable, especially when intracellular processing of the transgene is needed. It is not

hard to envision certain cellular pathways as being rate limiting, and thus overwhelming

them with protein may have deleterious effects. In addition, as previously discussed,

some gene products cause unwanted side effects when robustly expressed (Kirik,

Rosenblad et al. 2000; Georgievska, Kirik et al. 2002). Furthermore, Chrarto et al. show

that incorporating a WPRE in a tet-responsive AAV vector caused increased leakiness

such that the transgene GDNF was expressed at a 2.5 fold greater level in the off state

than baseline levels or a tet construct lacking a WPRE (Chtarto, Yang et al. 2007). Thus,

careful consideration over the inclusion of regulatory elements should be taken when

designing AAV vectors for pre-clinical and clinical trials where tight gene regulation may

be paramount to safety and therapeutic efficacy.

V.B.3. Immune Response

One of the biggest challenges in optimizing viral vectors for gene therapy pertains

to the host-mediated immune response. This response can occur at the cellular level via

96

two pathways: a transient innate inflammatory immune response (i.e. the release of

cytokines, and the recruitment of monocytes and/or macrophages and neutrophils), and

an adaptive immune response where cytotoxic T lymphocytes (CTL) infiltrate the area of

vector injection. In addition, the host-mediated immune response can occur at the

humoral level, where antibodies are generated against the structural components of the

virus or the proteins encoded by the virus. Due to the unique cytoarchitecture of the

brain and the fact that is circumscribed by the blood-brain barrier (BBB), the brain

parenchyma is immune privileged under normal conditions, and has been shown to

exhibit no salient adaptive immune response, and only a minimal innate and humoral

response to viral antigens (Barker and Billingham 1977; Lowenstein 2002). Perhaps this

is because the brain is devoid of lymphoid tissue, and the parenchyma does not normally

contain antigen-presenting dendritic cells, thus an adaptive immune response is not

primed after viral vector delivery (Lowenstein 2002). Consequently, studies examining

the immune response to rAAV vectors in the brain have focused primarily on the humoral

response and its impact on transgene expression.

Earlier studies examined the effects of single and repeat administration of rAAV

into naïve animals with no pre-existing immunity to AAV. Lo et al. delivered AAV2-

LacZ vectors into the mouse brain and reported that serum antibodies to AAV capsid

proteins and β-gal transgene were elicited between 2–4 months post administration, but

did not correlate with transgene expression (Lo, Qu et al. 1999). Furthermore, the

presence of these antibodies did not consistently prevent transgene expression following

re-administration of the same vector 2 months later (Lo, Qu et al. 1999). In another re-

administration study by Mastakov et al., it was found that transgene expression was

97

diminished by approximately 5 to 10 fold in animals where the second injection was done

within a 2-4 week interval, but no reduction was observed if the second injection was

given 3 months the after first injection (Mastakov, Baer et al. 2002). These experiments

suggest that timing between multiple injections may have a critical effect on therapeutic

efficacy of AAV-mediated gene therapy in the brain. Moreover, if rAAV5 was first

injected, then 2 weeks later the same vector cassette was packaged into AAV2 and

injected, no decrease in transgene expression occurred, suggesting that the loss of

transgene expression observed earlier was in fact due to neutralizing antibodies to the

rAAV5 capsid (Mastakov, Baer et al. 2002). Thus, sequential delivery of different rAAV

serotypes into the brain avoids the host immune response. However, this strategy may

create new problems, because (as discussed in section V.A.) the different serotypes

exhibit different transduction patterns in the brain. Perhaps the identification and

mutation of antigenic capsid epitopes that are recognized by neutralizing antibodies can

be achieved without affecting receptor binding and thus the transduction profile. In fact,

Lochrie et al. tried to accomplish this using in silico modeling of antibody-capsid binding

interactions, then mutated residues suspected of being immune epitopes (Lochrie,

Tatsuno et al. 2006). Other approaches include insertion of peptides in or near

neutralizing epitopes (Huttner, Girod et al. 2003), or simultaneous recombination and

mutagenesis of the AAV2 capsid gene followed by selection in the presence of human

antisera (Maheshri, Koerber et al. 2006; Perabo, Endell et al. 2006). Regardless of the

method used to engineer the virus, unless the paradigm that the vector is tested in

accurately reflects a clinical trial scenario, the utility and predictive value of the outcome

will be diminished.

98

More recent experiments examining the humoral immune response have been

conducted in animals that have been pre-immunized via peripheral exposure to AAV.

This model more accurately represents the human population where an estimated 80%

have circulating antibodies to the capsid proteins of wtAAV2, and 30% to 70%

demonstrate the presence of neutralizing anti-capsid antibodies that can bind to the

surface of the virus, thereby preventing attachment to cellular receptors and subsequent

cellular uptake (Chirmule, Propert et al. 1999; Erles, Sebokova et al. 1999; Xiao,

Chirmule et al. 1999; Hildinger, Auricchio et al. 2001; Halbert, Miller et al. 2006). In a

study by Sanftner et al., a peripheral injection of a rAAV2 non-expressing vector (lacking

a promoter) was followed by bilateral intrastriatal injection of rAAV2 encoding a

therapeutic transgene (Sanftner, Suzuki et al. 2004). Neutralizing antibody titers after

rAAV administration in the striatum were highest in the animals pre-immunized with

higher doses of rAAV, and there was a weakly linear and negative relationship between

antibody titer and transgene expression distribution (R2 = 0.30 (Sanftner, Suzuki et al.

2004). No evidence of abnormal morphology, cellular infiltration or inflammatory

markers was found. The authors concluded that rAAV vectors can transduce brain tissue

in the context of pre-existing immunity, but that efficiency of transduction declines

significantly in the presence of very high titers of neutralizing antibodies (Sanftner,

Suzuki et al. 2004). In contrast to these results, another group used a strategy of multiple

pre-immunization injections with wtAAV2 and adjuvant, and found that the resulting

high levels of circulating neutralizing antibodies were sufficient to completely block

striatal transduction (Peden, Burger et al. 2004). It has been suggested that the

conflicting results between these two studies are likely due to differences in the

99

immunization strategies, surgical techniques, BBB integrity, rAAV formulations, and

serological methodologies (McPhee, Janson et al. 2006).

While the Peden study raises some concerns with using rAAV2 as a gene therapy

vector in the brain, a couple of phase I clinical trials have already been completed with

promising results (McPhee, Janson et al. 2006; Kaplitt, Feigin et al. 2007). In the

Canavan disease (CD) trial, an rAAV2 vector encoding a functional copy of the

aspartoacylase gene (ASPA) was injected at 6 sites: bilaterally in the frontal,

periventricular and occipital lobes (McPhee, Janson et al. 2006). It was found that only 1

of 10 subject had circulating neutralizing antibodies to AAV before rAAV

administration, and 3 of 10 had circulating neutralizing antibodies to AAV after rAAV

administration (McPhee, Janson et al. 2006). Fortunately, the subject with pre-existing

neutralizing antibodies had no adverse events, and a physiological response that was

similar to the other subjects (McPhee, Janson et al. 2006). In the Parkinson’s disease

(PD) trial, 2 of 12 subjects had pre-existing neutralizing antibodies, but the levels did not

change in any of the subjects following delivery of an AAV2 vector encoding glutamic

acid decarboxylase (GAD) into the subthalamic nucleus (Kaplitt, Feigin et al. 2007). The

lack of induction of neutralizing antibodies in the PD study compared to the CD study

may be attributed to fewer injection sites and therefore less BBB disruption. Moreover,

in the PD study there was no correlation between pre-existing immunity and clinical

outcome, as measured by improvement in motor function while off medication (Kaplitt,

Feigin et al. 2007). Finally, there was no evidence of pre-existing antibodies to the

transgene, and no induction of such antibodies at any time in any patient over the course

of the 1 year study (Kaplitt, Feigin et al. 2007). While the PD study was only an open

label Phase I study, the results suggest that pre-existing immunity to wtAAV may not

prevent effective AAV-mediated gene transfer in the human brain.

V.C. Conclusions and Progress of Current Gene Therapy Clinical Trials in Brain

Many chronic neurological diseases do not respond to small molecule

therapeutics, and have no effective long-term treatment. In fact, as many as 98% of the

candidate neuro-therapeutic drugs never get developed for clinical use because they have

poor BBB permeability (Pardridge 2001). Gene therapy is a promising alternative to

continuous administration of neuro-therapeutic drugs, because vectors can be locally

delivered to affected brain regions, where they mediate de novo synthesis of therapeutic

compounds. It has been shown that in vivo production of these therapeutic compounds

are more effective than their acute infusion (Frim, Simpson et al. 1993; Frim, Uhler et al.

1993; Venero, Beck et al. 1994; Martinez-Serrano and Bjorklund 1996). In addition,

long-term transgene expression can be achieved in the brain following a single vector

injection. For example, a single injection of an AAV vector into the striatum of primates

resulted in sustained gene expression for more than 6 years (Bankiewicz, Forsayeth et al.

2006). It is likely that the same persistence will be achieved in the human brain because

injections of rAAV in the muscle resulted in sustained gene expression upon biopsy 3.7

years post-delivery (Jiang, Pierce et al. 2006).

Currently, there are 12 open gene therapy clinical trials in the CNS, but most of

them are being conducted with naked DNA as the delivery vector (see table 5-1). Naked

plasmid gene transfer is safe, easy to handle, and cost effective, but has generally been

considered to be less efficient than viral gene transfer (Huang, Hung et al. 1999).

100

101

Table 5-1. Current Open Gene Therapy Trials for Neurological Diseases. This data is current to July 2007. For more details on these clinical trials please see: http://www.wiley.co.uk/wileychi/genmed/clinical/

Trial ID Title Gene Disease Vector Phase UK-129 A multicenter, randomized, double

blind, placebo-controlled study to evaluate the safety, tolerability, and efficacy of BHT-3009 when administered intramuscularly to patients with relapsing remitting multiple sclerosis (Protocol No. BHT-3009-03). EudraCT: 2005-001340-22

Myelin Basic Protein (MBP)

Multiple Sclerosis

Naked/Plasmid DNA

I

UK-132 A Phase II Double Blind, Cross-over Study to Compare the Safety and Efficacy of 125, 250 and 500µg/kg Monarsen (EN101) administered to Patients with Myasthenia Gravis. EudraCT: 2005-002740-26

Antisense Oligodeoxynucleotide against acetylcholinesterase

Myasthenia Gravis

Naked/Plasmid DNA

II

US-180 Phase I Single Dose-ranging Study Of Formulated hIGF-I Plasmid In Subjects With Cubital Tunnel Syndrome

Insulin-like growth factor-1 (IGF-1)

Cubital Tunnel Syndrome

Naked/Plasmid DNA

I

US-632 pVGI.1 (VEGF-2) Gene Transfer for Diabetic Neuropathy

Vascular endothelial growth factor (VEGF)

Diabetic Peripheral Neuropathy

Naked/Plasmid DNA

I/II

US-656 A Phase I/II, Dose-escalation Clinical Trial of SB509 in Subjects with Diabetic Neuropathy

VOP32E VEGF-A Transcription Factor


Naked/Plasmid DNA

I/II

US-669 Hippocampal NPY Gene Transfer in Subjects with Intractable Temporal Lobe Epilepsy

Neuropeptide Y (NPY) Epilepsy

Adeno-associated virus

I

US-689 A Phase I, Open-Label Study of CERE-120 (Adeno-Associated Virus Serotype 2 [AAV2]-Neurturin [NTN]) to Assess the Safety and Tolerability of Intrastriatal Delivery to Subjects with Idiopathic Parkinson's Disease

Neurturin (NTN) Parkinson's Disease


I

US-723 BHT-3009 Immunotherapy in Relapsing Remitting Multiple Sclerosis


Multiple Sclerosis

Naked/Plasmid DNA

II

US-788 Multicenter, Randomized, Double-blind, Sham Surgery-controlled Study of CERE-120 (Adeno-Associated Virus Serotype 2 [AAV2]-Neurturin [NTN]) to Assess the Efficacy and Safety of Bilateral Intraputamenal (IPu) Delivery in Subjects With Idiopathic Parkinson's Disease

Neurturin (NTN) Parkinson's Disease


II

US-822 A Phase 2 Repeat Dosing Clinical Trial of SB-509 in Subjects with Diabetic Neuropathy

Zinc finger DNA binding protein (ZPF-TF)


Naked/Plasmid DNA

II

US-837 A Phase 2 Repeat Dosing Clinical Trial of SB-509 in Subjects with Moderate to Severe Diabetic Neuropathy and Unmeasurable Nerve Conduction Velocity

Zinc finger DNA binding protein (ZPF-TF)


Naked/Plasmid DNA

II

US-851 Cell-Based Gene Therapy Using MRC-MBP for Treatment of Multiple Sclerosis-Phase I/II


Multiple Sclerosis

Retrovirus I/II














102

Perhaps when the initial AAV gene therapy clinical trials are completed and found to be

well tolerated, more will be approved.

A very exciting clinical trial is being initiated using AAV vectors to delivery NPY

to the hippocampus of patients with intractable TLE. It is the first gene therapy trial to be

conducted in epileptic patients. Pre-clinical studies including those that were presented

in this thesis show that AAV-mediated delivery of NPY to the brain results in seizure

suppression, and therefore has enormous therapeutic potential (Richichi, Lin et al. 2004;

Foti, Haberman et al. 2007). Although this trial will initially be a Phase I study and thus

is not designed to assess transgene efficacy, it is still possible that subjects will obtain

vector-mediated therapeutic benefits.

Currently, the most promising neurological gene therapy trial is the AAV-

mediated delivery of neurturin (NTN) to the striatum of patients with advanced PD.

NTN is a naturally occurring neurotrophic factor that has been shown to be

neuroprotective and regenerative in the damaged dopaminergic neurons that undergo

degeneration in PD (Oiwa, Yoshimura et al. 2002). Loss of dopaminergic innervation of

the striatum as a consequence of substantia nigral degeneration results in the cardinal

symptoms of PD, including tremor, rigidity, and the progressive inability to initiate and

control physical movements (Lang and Lozano 1998). In a recent press release the

company conducting the trial announced that the AAV vector was well tolerated in the

patients; and that the treatment appeared to reduce 8 of the 12 patients’ symptoms by

approximately 52% at 24 months post-treatment (see

http://www.medicalnewstoday.com/articles/91612.php). Furthermore, a multi-center

double-blind, controlled Phase II clinical trial completed enrollment in December of

http://www.medicalnewstoday.com/articles/91612.php

103

2007, of 58 patients with advanced PD. Two thirds of patients will be given the

treatment and one third will be in a control group. Clinical data from this trial are

expected to be available in late 2008, and if the data are positive, a Phase III trial is

expected to commence in 2009. Thus, this may be the first AAV vector-mediated gene

therapy to undergo Phase III testing.

In conclusion, AAV vectors have demonstrated clinical potential. The most

critical issues that will need to be addressed to ensure safe and effective gene therapy in

the brain are increased gene transfer efficiency, target specificity, and the ability to

regulate gene expression so maximal therapeutic efficacy can be reached with minimal

adverse effects. To this end, substantial progress is being made using recently developed

techniques to engineer the virus, both at the structural level through capsid modification,

and at the gene transcriptional level via promoter choice and regulatory element

inclusion. It is likely that the combination of these developments will facilitate clinical

gene therapy.

104

Appendices

Appendix A. Plasmids Generated and Characterized

Table 6-1. Plasmids Generated and Characterized. Abbreviations are: ELISA: Enzyme-Linked ImmunoSorbent Assay; GAL: galanin; GDNF: glial cell derived neurotrophic factor; IP/WB: Immunoprecipitation and Western blotting; LUC: Luciferase GL3; NA: no assay performed; PCR: polymerase chain reaction; RFP: DsRed2-C1; RKLRKR: arginine-lysine-leucine-arginine-lysine-arginine; RKRRKR: arginine-lysine-arginine-arginine-lysine-arginine; RT-PCR: Reverse transcriptase-polymerase chain reaction; WB: Western blotting. Constructs Generated

Assays Results

ptTak-Dynorphin A 1-13 FIB (has TR2)

WB Protein doesn't stick to membranes and may be cleaved in vivo

ptTAK-NPY13-36 FIB (has TR2)

ELISA NPY13-36 detected in lysates only, not sensitive enough for detection upon secretion into medium

CB-DsRed2-C1-FIB (CB-FIB-RFP) (has TR2)

WB DsRed antibody binds high molecular weight bands and is very poor at detecting proper size

pTR-CB-FIB-EGFP-RKLRKR-FIB-RFP

WB GFP antibody detects fusion protein in lysates

pTR-CB-FIB-EGFP-RKLRKR-RFP

WB GFP antibody detects fusion protein in lysates, and cleaved protein in medium

pTR-CB-FIB-EGFP-RKLGGG-RFP

WB GFP antibody detects fusion protein in lysates

pTR-CB-FIB-LUC (Luciferase GL3)

WB and IP/WB and light assay

Luciferase antibody detects protein in lysates but not medium so luciferase not secreted and not functional in light assay

pTR-CB-FIB-LUC-RKRRKR-EGFP

WB and IP/WB and light assay

Luciferase antibody detects protein in lysates but not medium so luciferase not secreted and not functional in light assay; GFP antibody detects fusion and cleaved protein in lysates

pTR-CB-FIB-LUC-RKRRKR-FIB-EGFP

WB and IP/WB GFP antibody detects cleaved protein in medium and both cleaved and fusion proteins in lysates

pTR-CB-FIB-GAL-RKRRKR-EGFP

IP/WB kainic acid test

GFP antibody detects cleaved protein in medium and both fusion and cleaved protein in lysates; some seizure protection is observed but not to the extent of galanin alone

pTR-CB-FIB-GAL-RKRRKR-FIB-EGFP


GFP antibody detects cleaved protein in medium and both fusion and cleaved protein in lysates; galanin blocks seizures in vivo

pTR-CB-FIB-EGFP-RKRRKR-FIB-GAL

IP/WB Misfolded so does not fluoresce in situ, but can be detected with GFP antibody in IP/WB

pTR-CB-EGFP-RKRRKR-FIB-GAL

Transfection Does fluoresce

pTR-UF-WGDNF (CB-human pre-pro GDNF plus WPRE and TR2)

NA

pTR-UF-GDNF (removed WPRE)

ELISA/ made virus for collaboration

GDNF is detected in medium and lysates; Publishing with this, article in press

105

pBS-SK-huNGF (human pre-pro Nerve Growth Factor )

PCR Worked for cloning

pTR-UF-NGF (cloned human pre-pro Nerve Growth Factor into UF-GDNF plasmid )

ELISA NGF detected in medium

pTR-CB-NGF-RKRRKR-GDNF

ELISA Only GDNF detected in medium and lysates

pTR-CB-FIB-NPY RT-PCR and kainic acid test

Published with this (Foti, Haberman et al. 2007)

pTR-CB-FIB-NPY13-36 RT-PCR and kainic acid test

Published with this (Foti, Haberman et al. 2007)

pCMV-Sport6-hGAL (human galanin)


pTR-CB-hGAL NA pTR-CB-FIB-GAL-RKRRKR-FIB-NPY

NA

pTR-CB-FIB-GAL-RKRRKR-FIB-NPY13-36

NA

pTR-CB-FIB-GAL-EGFP IP/WB GFP antibody detects gal-GFP fusion protein in medium, but some degradation product present along with fusion in lysates

pTR-CB-FIB-GAL-EGFP mut (ATG removed from GAL and EGFP)


GFP antibody detects gal-GFP fusion protein in medium, but some degradation product present along with fusion in lysates; some seizure protection is observed but not to the extent of galanin alone

pN1-CB-FIB-EGFP-RKRRKR-GAL (no TR for mutagenesis from EGFP N1 plasmid)


pN1-CB-FIB-GAL-RKRRKR-EGFP (no TR for mutagenesis)


pN1-CB-FIB-GAL-EGFP mut (no TR for mutagenesis)


pTR-CB-KOZ-FIB-GAL-EGFP mut (added Kozak sequence)

IP/WB GFP antibody detects gal-GFP fusion protein in medium, but some degradation product present along with fusion in lysates

pTR-CB-KOZ-FIB-GAL-RKRRKR-EGFP mut (added Kozak sequence)

IP/WB Construct does not behave properly in IP/WB

pTR-CB-KOZ-FIB-EGFP-RKRRKR-GAL mut (added Kozak sequence)

IP/WB GFP antibody detects cleaved protein in medium and fusion proteins in lysates

pTR-CB-KOZ-FIB-GAL-RKRRKR-NPY13-36 (added Kozak sequence)

NA

pTR-CB-FIB-EGFP-RKR Transfection Does fluoresce pTR-CB-FIB-ADNF made virus for

collaboration

pCMV-IL-10 NA pTR-CB-FIB-EGFP-RKRRKR-GAL mut


GFP antibody detects cleaved protein in medium and fusion proteins in lysates; galanin blocks seizures in vivo

106

pTR-CB-FIB-GAL-RKRRKR-NPY13-36 mut

RT-PCR and kainic acid test

Correct vector-derived mRNA product present after rAAV infection in vivo, and some seizure protection is observed but not to the extent of galanin or NPY13-36 alone

pTR-CB-FIB-GAL-RKRRKR-EGFP mut

IP/WB Construct does not behave properly in IP/WB

107

Appendix B. Multiple Gene Product Delivery Vectors

Along with the other in vitro experiments to characterize the secreted proteins

from our multiple gene product delivery vectors, an immunoprecipitation followed by

SDS-PAGE and Coomassie staining for mass spectrometry analysis was performed on

medium harvested from 293 cells transfected with the following constructs: CB-FIB-

EGFP, CB-FIB-GAL-RKRRKR-FIB-EGFP, CB-FIB-EGFP-RKRRKR-FIB-GAL, CB-

FIB-GAL-RKRRKR-EGFP, and CB-EGFP. Upon mass spectrometry analysis, we found

that all samples contained fragments of the FIB sequence and GFP, but not galanin;

except the sample from CB-EGFP, which contained only GFP fragments (see Figure 6-

1). While these results are promising, a positive control such as CB-FIB-GAL-EGFP

must be included next time to assure that galanin can be detected in this assay.

Appendix C. Nerve Growth Factor (NGF) and Glial Cell Derived Neurotrophic Factor (GDNF)

In addition to epilepsy, there are many neurological diseases that can benefit from

AAV-mediated gene therapy. Neurodegeneration is a common pathology of several

diseases (e.g. Huntington’s disease (HD), Parkinson’s disease (PD), Alzheimer’s disease

(AD), and temporal lobe epilepsy (TLE), and if left unchecked causes progressive

decline. Neurotrophic factors have long been recognized to be neuroprotective, and there

is a growing interest in using them as therapeutics. Several studies have shown that NGF,

brain-derived neurotrophic factor (BDNF), and GDNF are each capable of protecting

neurons from death in rat models of HD (Davies and Beardsall 1992; Frim, Short et al.

1993; Galpern, Matthews et al. 1996; Martinez-Serrano and Bjorklund 1996; Perez-

Navarro, Arenas et al. 1996; Araujo and Hilt 1997; Araujo and Hilt 1998; Perez-Navarro,

Arenas et al. 1999; Cruz-Aguado, Turner et al. 2000; Menei, Pean et al. 2000;

108

Figure 6-1. Immunoprecipitation Followed by SDS-PAGE and Coomassie Staining of Multiple Gene Product Delivery Vectors for Mass Spectrometry Analysis. 1, 7) Low molecular weight rainbow marker, 2) CB-FIB-EGFP, 3) CB-FIB-GAL-RKRRKR-FIB-EGFP, 4) CB-FIB-EGFP-RKRRKR-FIB-GAL, 5) CB-FIB-GAL-RKRRKR-EGFP, 6) CB-EGFP. Constructs were transfected into 293 cells using PEI (1mg/mL), and 48 hours later medium was harvested and immunoprecipitated using a GFP polyclonal antibody. After SDS-PAGE, the gel was fixed in 25% isopropanol, 10% acetic acid, and 65% sterile water, and stained overnight with Coomassie 0.01% in 10% acetic acid. Yellow boxes indicate the bands excised from the gel and digested in trypsin for protein laddering matrix assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF-MS). Samples 2-4 all contained fragments of the FIB signal sequence and GFP, but not galanin. Sample 5 contained only GFP but not FIB or galanin. Sample 6 contained only antibody fragments. While these results are promising, a positive control such as CB-FIB-GAL-EGFP must be included next time to assure that galanin can be detected in this assay.

1 2 3 4 5 6 71 2 3 4 5 6 7

109

Alberch, Perez-Navarro et al. 2002; Maksimovic, Jovanovic et al. 2002; McBride, During

et al. 2003; Kells, Fong et al. 2004). However, individual neurotrophic factors

preferentially spare subpopulations of neurons, and this sparing may be influenced by the

neurotrophic factor’s route of delivery. For example, acute infusions of NGF prior to or

concurrent with quinolinic acid (QA) spares the cholinergic interneurons of the striatum,

but not the striatal GABA-ergic medium spiny neurons (primary neurons vulnerable to

the degenerative cascade seen in HD) or the noncholinergic neurons (containing

somatostatin, or NADPH-diaphorase) (Venero, Beck et al. 1994). In contrast, when NGF

is chronically secreted by genetically modified cells, it potently protects the cholinergic,

GABA-ergic and noncholinergic neurons from QA induced degeneration (Frim, Uhler et

al. 1993; Martinez-Serrano and Bjorklund 1996), and 3-NP induced degeneration (Frim,

Simpson et al. 1993). So, therapeutic gene delivery of neurotrophic factors yields more

comprehensive protection for striatal neurons than acute infusions of the same factors.

Similarly, ex vivo methods of delivering GDNF to the striatum only results in partial

neuroprotection (Perez-Navarro, Arenas et al. 1996; Perez-Navarro, Arenas et al. 1999),

thus, using an in vivo method of neurotrophic factor delivery may overcome this

difficulty. In fact, McBride et al use adeno-associated virus (AAV) as their method of

therapeutic gene delivery to inject a GDNF expressing viral vector into the striatum of

rats before 3-NP challenge (McBride, During et al. 2003). They report significant

reduction in lesion size (assessed by NeuN immunohistochemistry) and increased

survival of striatal GABA-ergic neurons (assessed by a DARPP-32, a marker of GABA-

ergic terminals). In addition, rats receiving GDNF perform better on motor tasks than

controls, suggesting that viral-mediated gene transfer of GDNF into the striatum affords

110

neuroanatomical and behavioral protection from 3-NP. Although striatal neuronal

subtypes were not extensively evaluated in the McBride et al study, Kells et al used AAV

to deliver BDNF or GDNF prior to QA lesioning rats and evaluated subpopulations of

GABA-ergic striatal interneurons. BDNF expression protected NOS-immunopositive

neurons while GDNF protected parvalbumen immunopositive neurons (Kells, Fong et al.

2004). Since neither neurotrophic factor can afford complete protection when

administered singly, a combination of neurotrophic factors should be used. Therefore,

we were interested in using our multiple gene product delivery vectors to deliver both

NGF and GDNF in a rat model of Huntington’s disease. NGF and GDNF are both

synthesized as precursors that must be correctly assembled into homodimers, and cleaved

into their active forms. It has been reported that NGF needs its pro-sequence in order to

fold properly (Rattenholl, Ruoppolo et al. 2001), so we opted not to use the FIB sequence

to mediate secretion, but to use the pre-pro sequences of both NGF and GDNF (each

containing their own secretion sequence) to ensure correct folding and secretion. Using

the same cloning strategy as described in Chapter 2, we constructed the following AAV-

compatible plasmids: TR-CB-EGFP, TR-CB-β-NGF, TR-CB-GDNF, and TR-CB-β-

NGF-RKRRKR-GDNF. To characterize these constructs in vitro, we transfected them

into 293 cells and harvested medium 48 hours post transfection, added leupeptin and

aprotinin protease inhibitors, briefly centrifuged the medium to remove any cellular

debris, and stored the medium at -80oC until use in Enzyme-Linked ImmunoSorbent

Assay (ELISA). We found we could only detect NGF from our TR-CB-β-NGF

transfected samples and our NGF protein spiked samples, but not from our TR-CB-β-

NGF-RKRRKR-GDNF transfected samples (see Figure 6-2). We were however

111

Figure 6-2. NGF and GDNF ELISA. Assay reveals that NGF is not detected in the medium following transfection of CB-β-NGF-RKRRKR-GDNF, but GDNF is detected. Note that the antibodies are specific for each neurotrophin and do not cross-react.

NFG ELISA (Avg of Duplicates)

25

243

17 22

225

23

0

50

100

150

200

250

300

Con

cent

ratio

n (p

g/m

L)

CB-FIB-EGFP

CB-B-NGF

CB-GDNF

CB-B-NGF-RKRRKR-GDNFNGF Protein Spike

Untransfected Control

GDNF ELISA (Avg of Duplicates)

27 36

23562572

2758

260

500

1000

1500

2000

2500

3000

Con

cent

ratio

n (p

g/m

L)

CB-FIB-EGFP

CB-B-NGF

CB-GDNF

CB-B-NGF-RKRRKR-GDNFGDNF Protein Spike

Untransfected Control

112

detecting GDNF from our GDNF protein spiked samples, TR-CB-GDNF transfected

samples, and our TR-CB-β-NGF-RKRRKR-GDNF transfected samples (see Figure 6-2).

This is a puzzling result at first glance because GDNF is the second gene product in our

multi gene product delivery vector, so if we are detecting it, then it is likely that NGF is

also expressed even though we cannot detect it. These results can be explained if the

NGF protein was indeed expressed but misfolded. Misfolded NGF might not show up in

an ELISA if the antibody cannot detect denatured protein. This issue can be resolved by

performing a western blot assay with an antibody designed to detect denatured protein.

However, we felt it was not worth the expense to confirm that the NGF was being

misfolded, because misfolded NGF is not functional and obviously not therapeutic. We

decided to discontinue this project, but we gleaned very critical information from these

experiments about potential protein folding issues when using our multiple gene product

delivery vectors.

Appendix D. Publications

Appendix D.1. Adeno-associated Virus-Mediated Expression and Constitutive Secretion of NPY or NPY13-36 Suppresses Seizure Activity In Vivo.

113

Adeno-associated Virus-Mediated Expression and Constitutive Secretion of NPY or

NPY13-36 Suppresses Seizure Activity In Vivo.

Stacey Foti2, Rebecca P. Haberman5, R. Jude Samulski1,4 and Thomas J. McCown1,3

UNC Gene Therapy Center1, Curriculum in Neurobiology2, Departments of Psychiatry3 and Pharmacology4

University of North Carolina at Chapel Hill

7119 Thurston, CB 7352

University of North Carolina School of Medicine

Chapel Hill, NC, 27599

and

Department of Psychological and Brain Sciences5

Johns Hopkins University

Baltimore, MD

To whom correspondence should be addressed: Thomas J. McCown, Ph.D. UNC Gene Therapy Center 7119 Thurston, CB 7352 Chapel Hill, NC 27599 email:[email protected]

114

Neuropeptide Y (NPY) is a 36–amino acid peptide that attenuates seizure activity

following direct infusion or AAV-mediated expression in the CNS. However, NPY

activates all NPY receptor subtypes, potentially causing unwanted side effects. NPY13-

36 is a C-terminal peptide fragment of NPY that primarily activates the NPY Y2

receptor, thought to mediate the anti-seizure activity. Therefore, we investigated if rAAV

mediated expression and constitutive secretion of NPY or NPY13-36 could alter limbic

seizure sensitivity. Rats received bilateral piriform cortex infusions of AAV vectors that

express and constitutively secrete full length NPY (AAV-FIB-NPY), or NPY13-36

(AAV-FIB-NPY13-36). Control rats received no infusion, as we have previously shown

that vectors expressing and secreting reporter genes like GFP (AAV-FIB-EGFP), as well

as vectors expressing peptides that lack secretion sequences (AAV-GAL) have no effect

on seizures. One week later, all animals received kainic acid (10 mg/kg, i.p.), and the

latencies to wet dog shakes and limbic seizure behaviors were determined. Although

both control and vector treated rats developed wet dog shake behaviors with similar

latencies, the latencies to class III and class IV limbic seizures were significantly

prolonged in both NPY and NPY13-36 treated groups. Thus, AAV-mediated expression

and constitutive secretion of NPY and NPY13-36 is effective in attenuating limbic

seizures, and provides a platform for delivering therapeutic peptide fragments with

increased receptor selectivity.

Key Words: Adeno-associated virus, gene therapy, epilepsy, seizures, kainic acid,

neuropeptide Y, NPY13-36, piriform cortex

115

Epilepsy is an attractive target for recombinant Adeno-associated virus (rAAV)

gene therapy, because the temporal lobe structures involved in seizure genesis and

propagation have been shown to be permissive to AAV gene transfer.1-6 Recently,

galanin and neuropeptide Y (NPY) have been delivered as transgenes in rAAV vectors,

and shown to be effective in several epilepsy paradigms.1,3,6,7 While previous approaches

utilize pre-pro cDNA sequences which rely on the cell to modulate release of the gene

product, Haberman et al.3 were the first to use a novel secretion strategy whereby the

secretion signal sequence from the constitutively secreted laminar protein fibronectin

(FIB), is combined with the coding sequence for the active therapeutic peptide. Results

from Haberman et al.3 and McCown1 show that expression and constitutive secretion of

galanin is not only achieved, but also effective in attenuating focal and limbic seizure

activity. In contrast, expression of galanin without the secretory signal or expression and

secretion of the reporter gene, GFP had no effect on seizure sensitivity.1,3

In addition to galanin, rAAV delivery of NPY has also been shown to attenuate

limbic seizures,6 however, there is still some question as to which of the NPY receptors

(Y1-Y5) mediates the anti-seizure activity. Several studies have suggested a critical role

for the Y2 receptor in mediating anti-epileptic actions.8-14 In addition, it has been

demonstrated that in epileptic tissue from patients15 and rodents16,17 that Y1 receptors are

downregulated while Y2 receptors are upregulated. Taken together, these results suggest

that when designing anti-epileptogenic therapeutics, it may be advantageous to deliver

Y2 preferring agonists. In fact, acute intracerebral delivery of the Y2 receptor preferring

agonist NPY13-36 reduces seizure susceptibility following systemic kainic acid

administration.18,19 These data suggest NPY13-36 would be a good candidate to use in an

116

rAAV vector to treat epilepsy. By using the FIB secretion strategy, we have the

capability of expressing and constitutively secreting peptide fragments which have

demonstrated receptor selectivity. Thus, we evaluated the effects of AAV mediated

expression and constitutive secretion of NPY and the peptide fragment NPY13-36 on

kainic acid induced limbic seizures.

Although previous studies validated the effectiveness of gene expression and

constitutive secretion using galanin, the same approach might not necessarily prove

successful with NPY or the peptide fragment NPY13-36. Therefore, we used a similar

approach with the following modifications: AAV 2 vectors were constructed where the

hybrid chicken beta actin promoter drives expression of the FIB-NPY or FIB-NPY13-36

coding sequences. Then, 2 µl of recombinant AAV-FIB-NPY (3.3 X 1012 viral

particles/ml) or AAV-FIB-NPY13-36 (3.0 X 1012 viral particles/ml) was infused

bilaterally into the piriform cortex of rats, as previously described.1 Control rats received

no infusion, as we have previously shown that vectors expressing and secreting reporter

genes like GFP (AAV-FIB-EGFP), as well as vectors expressing peptides that lack

secretion sequences (AAV-GAL) have no effect on seizure sensitivity, seizure behaviors,

or seizure-induced cell death.1,3 One week later, the rats received a dose of 10 mg/kg, i.p.

kainic acid, and subsequently, the time to limbic seizure behaviors was recorded. As

seen in Figure 1, both AAV treatment groups and the untreated control group developed

wet dog shake behaviors with the same latency. Because the origin of wet dog shakes

appears to be the hippocampus,20 a local action of the AAV-FIB-NPY or AAV-FIB-

NPY13-36 in the piriform cortex would not be expected to influence these kainic acid-

induced behaviors. However, the findings do validate the uniformity of kainic acid

117

administration across the different groups. In marked contrast, the latency to class III or

class IV limbic seizure activity was significantly increased in the AAV-FIB-NPY or

AAV-FIB-NPY13-36 treated groups. In fact, the majority of rats in both vector treated

groups did not exhibit any seizure behavior at all, whereas all rats in the untreated group

develop class III and class IV seizures within 90 minutes (see Figure 1). Thus, like

findings with expression and secretion of galanin, NPY actions in the piriform cortex

significantly attenuated seizure activity induced by the peripheral administration of the

chemical convulsant kainic acid. As previously discussed, the constitutive secretion of

these peptides renders immunohistochemical identification untenable,3 but as previously

shown for galanin,1,3 the appropriate vector-derived NPY or NPY13-36 mRNA was

present in the area of AAV infusion (see Figure 2). Thus, not only does this gene therapy

approach prove effective with NPY, but it is now also possible to express and secrete

active fragments of peptides, allowing for more selective receptor targeting. In addition,

the use of smaller peptide fragments in an AAV context may allow for combinations of

therapeutic peptides to be expressed from a single vector cassette. It is likely that

combination therapy will be the key to treating many complex neurological disorders.

Acknowledgements: We thank Julie Hamra for expert technical assistance. These

studies were supported by NIH grant NINDS NS 35633 to TJM.

118

References:

1 McCown TJ. Adeno-associated virus-mediated expression and constitutive secretion of galanin suppresses limbic seizure activity in vivo. Mol Ther 2006; 14: 63-68.

2 Klugmann M et al. AAV-mediated hippocampal expression of short and long

Homer 1 proteins differentially affect cognition and seizure activity in adult rats. Mol Cell Neurosci 2005; 28: 347-360.

3 Haberman RP, Samulski RJ, McCown TJ. Attenuation of seizures and neuronal

death by adeno-associated virus vector galanin expression and secretion. Nat Med 2003; 9: 1076-1080.

4 Freese A et al. Direct gene transfer into human epileptogenic hippocampal tissue

with an adeno-associated virus vector: implications for a gene therapy approach to epilepsy. Epilepsia 1997; 38: 759-766.

5 Vezzani A et al. Seizure susceptibility and epileptogenesis are decreased in

transgenic rats overexpressing neuropeptide Y. Neuroscience 2002; 110: 237-243. 6 Richichi C et al. Anticonvulsant and antiepileptogenic effects mediated by adeno-

associated virus vector neuropeptide Y expression in the rat hippocampus. J Neurosci 2004; 24: 3051-3059.

7 Lin EJ et al. Recombinant AAV-mediated expression of galanin in rat

hippocampus suppresses seizure development. Eur J Neurosci 2003; 18: 2087-2092.

8 Colmers WF et al. Presynaptic inhibition by neuropeptide Y in rat hippocampal

slice in vitro is mediated by a Y2 receptor. Br J Pharmacol 1991; 102: 41-44. 9 Dumont Y et al. Potent and selective tools to investigate neuropeptide Y receptors

in the central and peripheral nervous systems: BIB03304 (Y1) and CGP71683A (Y5). Can J Physiol Pharmacol 2000; 78: 116-125.

10 Dumont Y et al. BIIE0246, a potent and highly selective non-peptide

neuropeptide Y Y(2) receptor antagonist. Br J Pharmacol 2000; 129: 1075-1088. 11 Greber S, Schwarzer C, Sperk G. Neuropeptide Y inhibits potassium-stimulated

glutamate release through Y2 receptors in rat hippocampal slices in vitro. Br J Pharmacol 1994; 113: 737-740.

12 Lin EJ et al. Differential actions of NPY on seizure modulation via Y1 and Y2

receptors: evidence from receptor knockout mice. Epilepsia 2006; 47: 773-780.

119

13 El Bahh B et al. The anti-epileptic actions of neuropeptide Y in the hippocampus are mediated by Y and not Y receptors. Eur J Neurosci 2005; 22: 1417-1430.

14 El Bahh B, Cao JQ, Beck-Sickinger AG, Colmers WF. Blockade of neuropeptide

Y(2) receptors and suppression of NPY's anti-epileptic actions in the rat hippocampal slice by BIIE0246. Br J Pharmacol 2002; 136: 502-509.

15 Furtinger S et al. Plasticity of Y1 and Y2 receptors and neuropeptide Y fibers in

patients with temporal lobe epilepsy. J Neurosci 2001; 21: 5804-5812. 16 Kofler N, Kirchmair E, Schwarzer C, Sperk G. Altered expression of NPY-Y1

receptors in kainic acid induced epilepsy in rats. Neurosci Lett 1997; 230: 129-132.

17 Schwarzer C, Kofler N, Sperk G. Up-regulation of neuropeptide Y-Y2 receptors

in an animal model of temporal lobe epilepsy. Mol Pharmacol 1998; 53: 6-13. 18 Vezzani A et al. Plastic changes in neuropeptide Y receptor subtypes in

experimental models of limbic seizures. Epilepsia 2000; 41 Suppl 6: S115-121. 19 Vezzani A, Rizzi M, Conti M, Samanin R. Modulatory role of neuropeptides in

seizures induced in rats by stimulation of glutamate receptors. J Nutr 2000; 130: 1046S-1048S.

20 Frush DP, McNamara JO. Evidence implicating dentate granule cells in wet dog

shakes produced by kindling stimulations of entorhinal cortex. Exp Neurol 1986; 92: 102-113.

21 Racine RJ. Modification of seizure activity by electrical stimulation. II. Motor

seizure. Electroencephalogr Clin Neurophysiol 1972; 32: 281-294.

120

FIGURES AND LEGENDS:

Figure 1 – The effects of AAV-FIB-NPY and AAV-FIB-NPY13-36 vectors on the expression of limbic seizure behaviors. Rats received bilateral infusions of AAV-FIB-NPY (2µl/20 minutes; 3.3 X 1012 viral particles/ml) (N=7) or AAV-FIB-NPY13-36 (2µl/20 minutes; 3.0 X 1012 viral particles/ml) (N=7) into the piriform cortex as previously described.1 Seven days later both vector treated groups and an untreated control group (N=8) received an i.p. injection of kainic acid (10 mg/kg). The latencies to limbic seizure behaviors were determined for 240 minutes post-kainic acid. Seizures were scored according to the Racine motor seizure grading scale.21 Briefly, class I seizures were scored when rats exhibited facial twitches and chewing, class II when head nodding, class III when contralateral forelimb clonus was observed, and class IV when bilateral forelimb clonus and rearing was observed. All groups developed wet dog shakes with the same latencies, indicating the uniformity of kainic acid administration across the different groups. In marked contrast, however, onset of class III and class IV seizures was significantly delayed or completely blocked in rats receiving either AAV-FIB-NPY or AAV-FIB-NPY13-36 compared to control. (* t-test, p<0.01). In fact, only 3/7 AAV-FIB-NPY treated rats and 1/7 AAV-FIB-NPY13-36 treated rats developed any class III or class IV seizure behaviors over the entire 240 minute observation period. All 8 rats in the untreated control group developed class III and class IV seizures within 90 minutes.

121

Figure 2 – The in vivo presence of FIB-NPY and FIB-NPY13-36 mRNA one week after vector infusion into the piriform cortex. The appropriate 208 bp FIB-NPY (lane A) or 172 bp FIB-NPY13-36 (lane C) product is present in the injected piriform cortex while no product was found in an area slightly distal to the piriform cortex (lane B). Omission of the RT step (lanes D and E) indicated the absence of contaminating viral DNA. The left outside lane contains a 100 base pair DNA step ladder (Invitrogen) with the size indicated on the left. Rats received bilateral infusions of AAV-FIB-NPY (2µl/20 minutes; 3.3 X 1012 viral particles/ml) (N=2) or AAV-FIB-NPY13-36 (2µl/20 minutes; 3.0 X 1012 viral particles/ml) (N=2) into the piriform cortex as previously described.1 Then, 1 week later, the animals received an overdose of pentobarbital (100 mg/kg, ip) and were subsequently decapitated. The brain was removed, and the piriform cortex was dissected out. The tissue was stored in RNAlater (Ambion, Austin, TX, USA) at -200C. Subsequently, the RNA was extracted from the tissue (Promega SV-40 total RNA isolation kit; Madison, WI, USA) and reverse transcribed using AMV reverse transcriptase and oligo (dT) primers. The subsequent PCR primers were designed to span the FIB-NPY (and thus the FIB-NPY13-36) sequence, which can only be derived from the rAAV vector (FIB, 5’- CTAGCAGTCCTGTGCCTG; NPY and NPY13-36, 3’-GCTCAATATCTCTGTCTGGTG).

122

Appendix D.2. Viral Vector Gene Therapy

Viral Vector Gene Therapy for Epilepsy

Stacey B. Foti1, Shelley J. Russek2, Amy R. Brooks-Kayal3, and

Thomas J. McCown4

Program in Neurobiology, University of North Carolina at Chapel Hill, Chapel Hill,

North Carolina1, Department of Pharmacology and Experimental Therapeutics, Boston

University School of Medicine, Boston, Massachusetts2, Division of Neurology, Pediatric

Regional Epilepsy Program, Children’s Hospital of Philadelphia, Philadelphia,

Pennsylvania3, University of North Carolina Gene Therapy Center, University of North

Carolina School of Medicine, Chapel Hill, North Carolina4.

Address Correspondence to :

Thomas J. McCown, Ph.D. UNC Gene Therapy Center 7119 Thurston, CB 7342 University of North Carolina School of Medicine Chapel Hill, NC 27599

123

About 2.1 million people in the United States have epilepsy (Hirtz, Thurman et al.

2007), and with a world wide prevalence of approximately 1 percent (Hauser et al.,

1990), epilepsy represents one of the most common neurological diseases. Not only can

epilepsy be debilitating for patients, it also exacts a significant economic toll. In the

United States the estimated annual economic cost of epilepsy is 12.5 billion dollars, a

figure that includes both the direct cost of treatment and the indirect costs such as lost

productivity and wages (Shafer and Begley 2000). Unfortunately, even with new AEDs

available, the number of drug resistant epilepsies has not decreased (Loscher and Leppik

2002). In fact, 30–40% of all patients with epilepsy have medically intractable seizures,

and only half of these patients are candidates for surgery (Shafer, et al. 1988; Engel et al.

1992; Sander 1993; Siegel 2004). Of those patients that undergo temporal lobe surgery,

20% still have seizures post-op (Spencer et al. 1984), and surgical complications along

with post-operative memory and language deficits can occur (Siegel 2004). For all these

reasons, improving epilepsy treatment remains a priority.

Theoretically, a gene therapy approach to seizure suppression is an attractive

alternative treatment option for focal epilepsy, the most common adult form (Semah et al.

1998). Focal epilepsy arises from a circumscribed, hyperexcitable network of neurons

whose synchronous electrical discharge creates seizure activity. To date, most gene

therapy studies have employed viral vectors based upon adenovirus (AD), adeno-

associated virus (AAV), human immunodeficiency virus (HIV) or herpes simplex virus

(HSV). In all cases, these viral vectors have proven capable of transducing post-mitotic

neurons which provides direct access to the cells responsible for generating and

propagating the seizure activity. Furthermore, these viral vectors have proven capable of

124

influencing brain function on a regional basis, so viral vector gene therapy should have

the ability to influence sites of seizure genesis. However, even with the promising results

obtained using viral vectors (see table 1), a number of factors must be considered when

modeling a gene therapy for the treatment of epilepsy.

Identifying Potential Therapeutic Targets

In general, epilepsy arises from a loss of inhibition, an enhanced state of

excitation or a combination of both processes, so given this wide range of influences, a

wealth of potential therapeutic targets exists. On the most basic level, altering receptor or

ion channel mediated function clearly has been shown to attenuate seizure activity. For

example, antiepileptic drugs (AEDs) exert their actions by (1) increasing GABAergic

inhibition, (2) decreasing excitatory glutamatergic excitation (3) decreasing voltage-

dependant calcium release or (4) decreasing voltage-dependant Na+ conductance (Ure and

Perassolo 2000). Because AD, AAV, HSV-1 and HSV vectors exhibit a clear

neurotropism, any of these targets are readily accessible by these viral vectors. In

addition, basic research has identified a number of other modulatory factors that likewise

can attenuate seizure activity in vivo. Prominent among this class are the neuropeptides,

such as galanin and neuropeptide Y. Although this extensive list of potential targets

would seem to offer many opportunities, the major difficulty is establishing a strategy

that is both effective and non-toxic.

Excitatory Amino Acid Receptors

125

Excitatory amino acid receptors comprise an obvious target for anti-epileptic gene

therapy, and certainly many studies have shown that N-methyl-D-aspartic acid (NMDA)

receptors influence seizure sensitivity. Because a fully functional receptor requires the

NMDA receptor 1 protein (NMDAR1), removal of this subunit protein should

significantly reduce NMDAR1 mediated excitation (Monyer et al., 1992; Hollmann and

Heinmann, 1994). Haberman et al. (2002) showed that AAV vector-mediated delivery of

an antisense RNA specific to the NMDAR1 could indeed reduce NMDA receptor

function in vitro and NMDAR1 protein in vivo. Using a focal seizure model, CMV

promoter driven expression of the NMDAR1 antisense significantly decreased the seizure

susceptibility, proving the principle that viral vector derived antisense could influence

native receptor function in vivo. However, when expression of the same antisense

construct was driven by a tetracycline regulated minimal CMV promoter (Haberman et

al., 1998), the seizure susceptibility actually increased. The fact that NMDA receptor

mediated excitation can drive endogenous GABA inhibition provided a tenable

explanation for these diametrically opposed results. In the case of the CMV promoter,

excitatory principal neurons likely comprised the preponderance of transduced cells, thus

removal of NMDA receptor excitation blunted the seizure susceptibility. In the case of

the regulated minimal CMV promoter, the preponderance of gene expression probably

occurred in inhibitory GABAergic interneurons, so removal of the endogenous excitatory

drive to these interneurons would cause a state of increased seizure sensitivity. The

likelihood of such an occurrence was validated, when equal amounts of each AAV vector

were administered together using different reporter genes. Some neurons supported

126

expression from both promoters, but significant portions exhibited transduction from only

one or the other of the promoters. Thus, a slight change in only the promoter resulted in a

dramatic shift in the final outcome of the gene expression. These surprising findings

greatly complicate the targeting of neurotransmitter receptor proteins or ion channels for

the treatment of epilepsy. Certainly, it is possible that the viral vector tropism and/or

promoter tropism could differ between experimental animals and humans. Thus, without

some detailed a priori knowledge of the transduction pattern in humans, any

manipulation of neurotransmitter receptor proteins or ion channels could lead either to the

desired reduction of seizure susceptibility or a paradoxical heightening of seizure

susceptibility.

Inhibitory GABA Receptors

GABA is the major inhibitory neurotransmitter in the adult brain. Most fast

synaptic inhibition in the mature brain is mediated by GABAA receptors (GABRs),

pentameric anion-selective channels composed of multiple subunit subtypes (α1-6, β1-3,

γ1-3, δ, ε, π, θ and ρ1-3). GABAergic signaling has long been hypothesized to play an

important role in the genesis of epilepsy, and many of the oldest and most commonly

used anticonvulsants such as benzodiazepines and barbiturates act, at least in part,

through augmentation of GABR activity. Mutations in several different GABR subunits

have been identified in families with generalized epilepsies (Macdonald et al., 2004). In

addition, several laboratories have identified changes in GABR function and subunit

composition in human temporal lobe epilepsy (TLE) and in animal models of TLE (Buhl

127

et al., 1996; Gibbs et al., 1997; Brooks-Kayal et al., 1998, 1999). Studies in humans with

temporal lobe epilepsy (TLE) and in adult rodent models of TLE have found reduced

expression of GABR α1 subunit gene and increased expression of GABR α4 subunit

gene in the dentate gyrus (DG)(Brooks-Kayal et al., 1998,1999; Peng et al., 2004; Zhang

et al., 2007). These findings suggest that diminished α1 levels in dentate granule neurons

(DGN) may contribute to epileptogenesis and/or that elevated α1 levels may be

protective. Certainly, reduction of GABR α1 subunit protein using an AAV that

expressed a GABR α1 antisense RNA significantly increased focal seizure susceptibility

(Xiao et al., 1997).

To directly test the hypothesis that the expression of higher α1 subunit levels

inhibits development of epilepsy after SE, an adeno-associated virus gene transfer vector

(AAV) serotype 5 was designed to express a bicistronic RNA that codes for both the

GABR α1 subunit as well as the reporter, enhanced yellow fluorescence protein (eYFP)

(Raol et al., 2006). Expression of this RNA was placed under control of the GABR α4

core promoter region, because it was previously shown to be markedly activated in DG

following SE (Roberts et al., 2005). AAV-vectors containing either the α1/eYFP fused

cDNA (AAV-α1) or the eYFP-reporter only (AAV-eYFP) were injected into DG of adult

rats, and SE was induced two weeks later by intraperitoneal injection of pilocarpine (385

mg/kg). Rats injected with AAV-α1 showed 3-fold higher levels of α1 subunits in DG

by 2 weeks after SE compared to the control groups. AAV-α1 injection resulted in a 3-

fold increase in the mean time to the first spontaneous seizure following SE, and only

39% of AAV-α1 injected rats were observed to develop spontaneous seizures in the first

4 weeks after SE, as compared to 100% of rats receiving sham-injections. Because all

128

groups of rats experienced similar SE after pilocarpine injection, these findings provide

the first direct evidence that increasing the levels of a single GABR subunit in DG can

inhibit the development of spontaneous seizures after SE.

Another unique aspect of this particular study involves the use of a condition-

specific promoter which when upregulated during a disease process, drives expression of

a therapeutic gene. In this case, the upregulation of the GABR α4 promoter drove

expression of the α1 transgene which enhanced α1 expression in DG. Unfortunately, this

vector-derived expression lasted for only the first two weeks after SE. To differentiate

whether the decline in α1 subunit levels by 4 weeks after SE was due to loss of

recombinant or endogenous α1 subunits, mRNA levels for eYFP (produced from the

vector containing the fused α1/eYFP cDNAs) were assayed in AAV-injected rats

sacrificed at 1 or 4 weeks after SE. With presence of eYFP mRNA as a marker for co-

presence of α1, recombinant α1 mRNA levels were found to decline over 6-fold in AAV

injected rats between 1 and 4 weeks after SE. This finding suggests that either the

GABRA4 promoter in the AAV vector was transcriptionally downregulated or that the

recombinant α1/eYFP mRNAs were degraded. A number of studies have demonstrated

robust, long-term gene expression in the hippocampus after AAV transduction (Klein et

al., 1998, Burger et al., 2004), but this stable expression is promoter dependent. For

example, McCown et al. (1996) showed that when gene expression was driven by a CMV

promoter, the initial level of AAV mediated gene expression in the hippocampus declined

over a period of 4 weeks whereas some other areas of brain exhibited no decline in gene

expression. Further studies will be required to define the precise mechanism responsible

for the proposed decrease in activity of the recombinant GABRA4 promoter over time

129

and to rule out whether a change in mRNA stability may also play a role in declining

levels of α1/eYFP transcript.

In addition to the effects on seizures, AAV-mediated elevation of α1 expression

was associated with a behavioral phenotype in a fraction of the AAV-α1 injected rats.

Most of the AAV-α1 injected rats behaved similar to sham-injected rats, but 30%

exhibited abnormal behaviors including excessive sedation, anorexia, and weight loss that

persisted for days to weeks following SE. This effect was not seen after SE in any of the

other groups (including the AAV-eYFP control), suggesting that the effect likely resulted

from elevated α1 levels rather than the effects of AAV injection or SE. Such effects are

not surprising given that α1-containing receptors are the major form of GABRs

mediating sedation in the nervous system (Mohler et al., 2002).

Genetic engineering approaches have also been used to augment other aspects of

GABAergic neurotransmission. Specifically, two groups have transplanted immortalized

neurons genetically engineered to stably express the GABA synthesizing enzyme

glutamic acid decarboxylase (GAD65 or GAD67) into different brain regions and

examined the effects on induced and spontaneous seizures. Transplant of these

conditionally immortalized neurons engineered to produce GABA into either substantia

nigra (SN) or piriform cortex of rats has been found to inhibit kindling (Thompson et al.,

2000; Gernert et al., 2002) and reduce the number and severity of kainic acid-induced

seizures (Castillo et al., 2006). Transplantation of GABA-producing neurons into SN

also has been shown to reduce spontaneous seizures in a TLE model (Thompson and

Suchomelova, 2004). Injection of GABA-producing neurons under the control of

tetracycline injected into SN 45-65 days following lithium-pilocarpine induced status

130

epilepticus reduced the number of spontaneous seizures and epileptiform discharges at 7-

8 days after transplantation compared to animals that received control cells or that

received the GABA-producing cells plus doxycycline to inhibit GABA production

(Thompson and Suchomelova, 2004). Similarly, transplantation of GABA-producing

cells into dentate gyrus raised GABA tissue concentrations, increased the afterdischarge

threshold, shortened the afterdischarge duration and prolonged the latency to expression

of the first stage 5 seizure in a hippocampal kindling model (Thompson, 2005). Although

the engineered cells show evidence of integration, this cell transplantation approach

remains hampered by the limited long-term survival of the transplanted cells (Thompson

and Suchomelova, 2004).

Taken together, it is clear that by controlling GABAergic signaling either through

discrete regulation of its receptor isoforms or through accessibility to its neurotransmitter

GABA, it may be possible in the future to treat a multitude of diseases that stem from an

imbalance between excitatory and inhibitory neurotransmission. The challenge remains

to develop better vehicles and approaches for the selective delivery of gene products over

time in a therapeutically useful manner.

Diverse Unrelated Targets

A number of diverse, unrelated targets also have emerged from basic research that

focused upon neuroprotection, not epilepsy. Glial cell line-derived neurotrophic factor

(GDNF) exerts a potent neuroprotective action in the CNS, especially on dopamine

containing neurons (Choi-Lundberg er al., 1997; Mandel et al., 1997), and when infused

131

intraventricularly, GDNF attenuates kainic acid-induced seizures (Martin et al., 1995).

Using viral vectors, Yoo et al. (2006) subsequently showed that AD mediated GDNF

expression in the hippocampus attenuated behavioral seizures and cell death induced by

peripheral kainic acid administration. Similarly, Kanter-Schlifke et al. (2007A) used an

AAV vector to overexpress glial cell line-derived neurotrophic factor (GDNF) in the

hippocampus and found that this overexpression reduced the seizure severity in both

hippocampal kindling, as well as kindled self-sustained status epilepticus. Thus, viral

vector-mediated expression of GDNF can influence seizure sensitivity. Another anti-

apoptotic agent was identified by Perkins et al., (2003) who reported that the herpes

simplex virus type 2 R1 protein kinase (ICP10 PK) exerted an antiapoptotic action in

hippocampal cultures. Based upon these findings, Laing et al. (2005) showed that nasal

inoculation with a herpes simplex virus type 2 that contains the anti-apoptotic gene

ICP10PK prevented both behavioral seizures and neuronal death elicited by peripheral

kainic acid administration. Thus, it appears that at least in these two instances, gene

products with neuroprotective actions also can significantly influence seizure sensitivity.

A second group of therapeutic targets have emerged from diverse modulators of

synaptic excitation. The protein homer 1a is induced by excessive excitation and is

thought not only to modulate synaptic plasticity, but also to reduce postsynaptic calcium

function (Ango et al., 2001). Using this information, Klugman et al. (2005) found that

AAV-mediated overexpression of Homer 1a attenuated electrographic seizure activity in

a hippocampal status epilepticus model. Another means to reduce excitation would be to

inhibit the efficacy of synaptic transmission. Clostridial toxin light chain digests the

vesicle docking protein, synaptobrevin, which results in impaired synaptic transmission,

132

so Yang et al (2007) used AD vectors to express this protein in rat cortex. AD-mediated

expression of this protein attenuated both electrographic and behavioral seizures elicited

by subsequent penicillin injection into the cortex. Finally, a number of studies have

established that adenosine potently inhibits neuronal activity (Dunwiddie and Masino,

2001), so Huber et al., (2001) engineered fibroblasts to secrete adenosine. When these

cells were implanted into the ventricles of rats, both behavioral and electrographic

seizures were attenuated in electrically kindled rats. Although these studies established

the anti-seizure potency of adenosine in vivo, the effect waned significantly 24 days post-

transplantation. In total, these studies illustrate the wide range of targets by which

various gene products can reduce neuronal excitation by in vivo viral gene therapy.

Neuroactive Peptides

Like other gene therapy studies, previous pharmacological findings with

neuroactive peptides have provided a strong rationale for application in anti-epileptic

gene therapy. Of the many neuropeptides that can modulate neuronal excitability,

galanin and neuropeptide Y have been most thoroughly characterized. For example, the

neuroactive peptides, galanin and neuropeptide Y (NPY), both attenuate seizure activity

in vivo (Woldbye et al.,1997; Mazzarati et al.,1998.). Key to any neuropeptide gene

therapy, though, is the consideration of endogenous neuropeptide function. Most

neuroactive peptides are expressed initially as prepro-peptides, a form that presumably

contains the appropriate information for trafficking to the pre-synaptic terminal and

packaging into vesicles. Thus, if a viral vector expresses a prepro-neuropeptide

133

sequence, one must assume that the transduced cells indeed contain the appropriate

pathways for trafficking and release. Whether determined by the vector or the promoter,

the actual tropism of viral vectors is unknown in the human CNS, so as demonstrated for

NMDA receptor gene therapy, successful neuropeptide gene therapy might require

transduction and gene expression in the appropriate neuronal population. Given these

potential pitfalls, Haberman et al. (2003) devised a novel approach to peptide gene

therapy focusing upon galanin. The laminar protein, fibronectin occurs in most cell types

and normally is secreted in a constitutive manner. This constitutive secretion is

determined by the secretory signal sequence for fibronectin. Using AAV vectors

Haberman et al. (2003) combined the secretory signal sequence for the laminar protein

fibronectin with coding sequence for the active galanin neuropeptide (AAV-FIB-GAL).

By attaching this secretory signal sequence to the coding sequence for the active galanin

peptide, it was reasoned that the viral vector mediated expression would lead to the

constitutive secretion of active galanin. Thus, if the appropriate receptors exist in the

area of transduction, different patterns of neuronal transduction should not adversely

influence the outcome. In fact these investigators showed that indeed AAV-FIB-GAL

supported constitutive secretion of galanin in vitro, and in vivo sufficient galanin was

secreted to significantly attenuate focal seizure activity and prevent kainic acid-induced

neuronal cell death in the hippocampus. If galanin was expressed in the absence of the

FIB, or GFP was constitutively secreted, no effects were found on focal seizure

sensitivity or cell death in the hippocampus. Using this gene therapy approach,

subsequent studies found that bilateral infusion of AAV-FIB-GAL into the piriform

cortex prevented both electrographic and behavioral seizure activity induced by

134

peripheral kainic acid administration and significantly elevated the seizure initiation

threshold in previously kindled rats (McCown, 2006). In contrast, Lin et al. (2003) used

AAV vectors to express human galanin in the hippocampus. Even though these studies

achieved much higher levels of vector derived gene expression in comparison to

Haberman et al. (2003), the effects upon local infusion of kainic acid were restricted to a

decrease in the number of seizures, not the seizure latency. Furthermore, no neuronal

protection was evident. When these investigators further explored the effects of this

approach, they found that galanin overexpression did not alter the course of electrical

hippocampal kindling or modulate short term plasticity of mossy fiber CA3 synapses.

Thus, just because high levels of a peptide are expressed in vivo, such expression does

not necessarily lead to an increase in the peptide’s in vivo actions.

Neuropeptide Y (NPY), like galanin, exhibits anti-seizure activity in vivo

(Woldbye et al., 1997; Mazarati and Wasterlain, 2002), and a recent set of studies by

Richichi et al. (2004) have shown that AAV-mediated expression of prepro-NPY exerts a

range of anti-seizure effects. Expression of a human prepro-NPY gene prevented the

appearance of status epilepticus after intracerebroventricular administration of kainic

acid. Also, hippocampal expression of prepro-NPY increased the electrical seizure

threshold in the hippocampus and significantly retarded the rate of kindling

epileptogenesis. Another important facet of these studies involved the exploitation of

different AAV serotypes. A hybrid AAV1/2 serotype transduced a substantially wider

range of neurons, when compared to the AAV2 serotype, and this increased transduction

135

translated to a greater effect of prepro-NPY expression. Thus, these studies clearly

established the anti-epileptic potential for vector derived prepro-NPY expression in vivo.

A subsequent study by Foti et al. (2007) utilized the constitutive secretion

approach to demonstrate not only the efficacy of vector derived NPY, but also , the

efficacy of the NPY receptor specific fragment NPY(13-36). Although some question

remains as to which of the NPY receptors (Y1-Y5) mediates the anti-seizure activity,

several studies have suggested a critical role for the Y2 receptor in mediating anti-

epileptic actions (Colmers et al., 1991; Greber et al., 1994; El Bahn et al., 2002, 2005;

Lin et al, 2006). Because acute intracerebral delivery of the Y2 receptor preferring

agonist NPY13-36 reduces seizure susceptibility following systemic kainic acid

administration (Vezzani et al., 2000), Foti et al. (2007) used an AAV vector to express

and constitutively secret NPY or NPY(13-36) in the rat piriform. Similar to previous

results with galanin (McCown, 2006), expression of either NPY or NPY(13-36)

significantly suppressed limbic seizures elicited by subsequent peripheral kainic acid

administration. Thus, these studies showed that the constitutive secretory approach can

effectively express and secrete receptor specific peptide fragments in vivo.

Critical Considerations and Future Directions:

The wide range of gene therapy studies amply illustrate the potential of viral

vector gene therapy as an effective treatment modality for epilepsy, but even with these

positive findings, there are a number of considerations that will inevitably impact both

the efficacy and the safety of this therapeutic approach. Although many viral vectors

136

exhibit a neuronal tropism in vivo, one must always take into account how specific

patterns of transduction might alter the outcome of therapeutic gene expression. Viral

vector tropism aside, as shown previously (Haberman et al., 2002) different promoters

can lead to differential gene expression even within the context of the same viral vector.

Because such a change can result in an unwanted outcome, one first must consider the

need to transduce a specific cellular population and the consequences if such specificity

is not achieved. One obvious solution involves the use of cell specific promoters, such as

that used by Raol et al. (2006) where expression would only be achieved in those cells

that contain GABR α4 promoter activity. However, as also seen by Raol et al. (2006)

endogenous promoters may be susceptible to promoter silencing. Secondly, the most

likely clinical population for gene therapy encompasses those individuals with intractable

temporal lobe epilepsy who are surgical candidates. In such a case, these individuals will

have extensive seizure histories and inevitably varying degrees of hippocampal sclerosis.

At present, most viral vector studies have examined the ability to transduce normal tissue.

Thus, a second consideration is whether the viral vectors will support sufficient neuronal

transduction in epileptic tissue with its associated pathology. Finally, it is incumbent to

demonstrate that the proposed gene therapy can prevent spontaneous seizure activity.

Thus, to best model an effective gene therapy, viral vector transduction should be

initiated in animals that exhibit spontaneous seizures. As studies focus upon these

aspects, it is likely that an effective anti-epileptic gene therapy will emerge.

137

References

Ango, R., Prezeau, L., Muller, T., Tu, J.C., Xiao, B., Worley, P.F., Pin, J.P., Bockaert, J., Fagni, L. (2001) Agonist-independent activation of metabotropic glutamate receptors by the intracellular protein Homer. Nature 411:962-965.

Brooks-Kayal, A.R., Shumate, M.D., Jin, H., Rikhter, T.Y., Coulter, D.A. (1998)

Selective changes in single cell GABAA receptor subunit expression and function in temporal lobe epilepsy. Nat. Med. 4:1166-1172.

Brooks-Kayal, A.R., Shumate, M.D., Jin, H., Lin, D.D., Rikhter, T.Y., Holloway, K.L.,

Coulter, D.A. (1999) Human neuronal γ-aminobutyric acidA receptors: coordinated subunit mRNA expression and functional correlates in individual dentate granule cells. J. Neurosci. 19:8312-8318.

Buhl, E., Otis, T., Mody, I. (1996) Zinc-induced collapse of augmented inhibition by

GABA in a temporal lobe epilepsy model. Science 271:369-373. Burger, C., Gorbatyuk, O.S., Velardo, M.J., Peden, C.S., Williams, P., Zolotukhin, S.,

Reir, P.J., Mandel, R.J., Muzyczka, N. (2004) Recombinant AAV viral vectors pseudotyped with viral capsids from serotypes 1, 2 and 5 display differential efficiency and cell tropism after delivery to different regions of the central nervous system. Mol. Ther. 10:302-317.

Castillo, C.G.., Mendoza, S., Freed, W.J., Giordano, M. (2006) Intranigral transplants of

immortalized GABAergic cells decrease the expression of kainic acid-induced seizures in the rat. Behav. Brain Res. 171: 109-115.

Choi-Lundberg, D.L., Lin, Q., Chang, Y.N., Hay, C.M., Mohajeri, H., Davidson, B.L.,

Bohn, M.C. (1997) Dopaminergic neurons protected from degeneration by GDNF gene therapy. Science 275:838-841.

Colmers, W.F., Klapstein, G.J., Fournier, A., St-Pierre, S., Treherne, K.A. (1991)

Presynaptic inhibition by neuropeptide Y in rat hippocampal slice in vitro is mediated by a Y2 receptor. Br. J. Pharmacol. 102: 41-44.

Dunwiddie, R.V., Masino, S.A. (2001) The role and regulation of adenosine in the central

nervous system. Annu. Rev. Neurosci. 24:31-55. El Bahh, B., Balosso, S., Hamilton, T., Herzog, H., Beck-Sickinger, A.G., Sperk, G,

Gehlert, D.R., Vezzani, A., Colmers, W.F. (2005) The anti-epileptic actions of neuropeptide Y in the hippocampus are mediated by Y and not Y receptors. Eur. J. Neurosci. 22: 1417-1430.

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Gehlert%20DR%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Vezzani%20A%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=Search&Term=%22Colmers%20WF%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVAbstract

138

El Bahh B, Cao JQ, Beck-Sickinger AG, Colmers WF. (2002) Blockade of neuropeptide Y(2) receptors and suppression of NPY's anti-epileptic actions in the rat hippocampal slice by BIIE0246. Br. J. Pharmacol. 136: 502-509.

Engel, J., Jr., M. F. Levesque, M.F., Shields, W.D. (1992). Surgical treatment of the

epilepsies: presurgical evaluation. Clin. Neurosurg. 38: 514-34. Foti, S., Haberman, R.P., Samulski, R.J., McCown, T.J. (2007) Adeno-associated virus-

mediated expression and constitutive secretion of NPY or NPY13-36 suppresses seizure activity in vivo. Gene Ther. 14:1534-1536.

Gernert, M., Thompson, K.W., Loscher, W., Tobin, A.J. (2002) Genetically engineered

GABA-producing cells demonstrate anticonvulsant effects and long-term transgene expression when transplanted into the central piriform cortex of rats. Exp. Neurol. 176: 183-192.

Gibbs, J.W. 3rd, Shumate, M.D., Coulter, D.A. (1997) Differential epilepsy-associated

alterations in postsynaptic GABAA receptor function in dentate granule cells and CA1 neurons. J. Neurophysiol. 77:1924-1938.

Greber, S., Schwarzer, C., Sperk, G.. (1994) Neuropeptide Y inhibits potassium-

stimulated glutamate release through Y2 receptors in rat hippocampal slices in vitro. Br. J. Pharmacol. 113: 737-740.

Guttinger, M., Fedele, D., Koch, P., Padrun, V., Pralong, W.F., Brustle, O., Boison, D.

(2005) Suppression of kindled seizures by paracrine adenosine release from stem cell-derived brain implants. Epilepsia 46:1162-1169.

Haberman, R.P., McCown, T.J., Samulski, R.J. (1998) Inducible long-term gene

expression in brain with adeno-associated virus gene transfer. Gene Ther 5:1604-1611.

Haberman, R.P., Criswell, H.E., Snowdy, S., Ming, Z., Breese, G.R., Samulski, R.J.,

McCown, T.J. (2002) Therapeutic Liabilities of In Vivo Viral Vector Tropism: Adeno-associated Virus (AAV) Vectors, NMDAR 1 Antisense and Focal Seizure Sensitivity . Mol Ther 6:495-500.

Haberman, R.P., Samulski, R.J., McCown, T.J. (2003) Attenuation of seizures and

neuronal death by adeno-associated virus (AAV) vector galanin expression and secretion. Nature Med 9:1076-1080.

Hauser, W. A., Hesdorffer, D.C. (1990). Epilepsy frequency, causes, and consequences.

Landover, MD; New York, NY, Demos Publications, New York.

139

Hirtz, D., Thurman, D.J., Gwinn-Hardy, K., Mohamed, M., Chaudhuri, A.R., Zalutsky, R. (2007). "How common are the "common" neurologic disorders?" Neurology 68(5): 326-37.

Hollmann, M., Heinemann, S. (1994) Cloned glutamate receptors. Ann. Rev. Neurosci.

17: 31-108. Huber, A., Padrun, V., Deglon, N., Aebischer, P., Mohler, H., Boison, D. (2001) Grafts

of adenosine-releasing cells suppress seizures in kindling epilepsy. Proc. Nat. Acad. Sci. USA 98:7611-7616.

Kanter-Schlifke, I., Georgievska, B., Kirik, D., Kokais, M. (2007A) Seizure suppression

by GDNF gene therapy in animal models of epilepsy. Mol. Ther. 15:1106-1113,2007.

Kanter-Schlifke, I., Sorensen, A.T., Ledri, M., Kuteeva, E., Hokfelt, R., Kokaia, M.

(2007B) Galanin gene transfer curtails generalized seizures in kindled rats without altering hippocampal synaptic plasticity. Neurosci. 150:984-992.

Klein, R.L., Meyer, E.M., Peel, A.L., Zolotukhin, S., Meyers, C., Muzyczka, N., King,

M.A. (1998) Neuron-specific transduction in the rat septohippocampal or nigrostriatal pathway by recombinant adeno-associated virus vectors. Exp. Neurol. 150:183-194.

Klugman, M., Symes, C.W., Leichtlein, C.B., Klaussner, B.K., Dunning, J., Fong, D.,

Young, D., During, M.J. (2005) AAV-mediated hippocampal expression of short and long Homer 1 proteins differentially affect cognition and seizure activity in adult rats. Mol. Cell. Neurosci. 28:347-360.

Laing, J.M., gober, M.D., Golembewski, E.K., Thompson, S.M., Gyure, K.A., Yarowsky,

P.J., Aurelian, L. (2006) Intranasal administration of the growth-compromised HSV-2 vector DeltaRR prevents kainate-induced seizure and neuronal loss in rats and mice. Mol. Ther. 13:870-881.

Lin, E.D., Richichi, C., Young, D., Baer, K., Vezzani, A., During, M.J. (2003)

Recombinant AAV-mediated expression of galanin in rat hippocampus suppresses seizure development. J. Neurosci. 18:2087-2003.

Lin, E.J., Young, D., Baer, K., Herzog, H., During, M.J. (2006) Differential actions of

NPY on seizure modulation via Y1 and Y2 receptors: evidence from receptor knockout mice. Epilepsia 47: 773-780.

Loscher, W., Leppik, I.E. (2002). Critical re-evaluation of previous preclinical strategies

for the discovery and the development of new antiepileptic drugs. Epilepsy Res. 50:17-20.

140

Macdonald, R.L., Gallagher, M.J., Feng, H.J., Kang, J. (2004) GABA(A) receptor epilepsy mutations. Biochem. Pharmacol. 68:1497-506.

Mandel, R.J., Spratt, S.K., Snyder, R.O., Leff, S.E. (1997) Midbrain injection of

recombinant adeno-associated virus encoding rat glial cell line-derived neurotrophic factor protects nigral neurons in a progressive 6-hydroxydopamine-induced degeneration model of Parkinson's disease in rats. Proc. Nat. Acad. Sci. 94:14083-14088.

Martin, D., Miller, G., Rosendahl, M., Russell, D.A. (1995) Potent inhibitory effects of

glial derived neurotrophic factor against kainic acid mediated seizures in the rat. Brain Res. 683:172-178.

Mazarati, A.M., Lie, H., Soomets, U., Sankar, R., Shin, D., Katsumori, H., Langel, U.,

Wasterlain, C.G. (1998) Galanin modulation of seizures and seizure modulation of hippocampal galanin in animal models of status epilepticus. J. Neurosci. 18:10070-10077.

McCown, T.J., Xiao, X., Li, J., Breese, G.R., Samulski, R.J. (1996) Differential and

persistent expression patterns of CNS gene transfer by an adeno-associated virus (AAV) vector. Brain Res. 713:99-107.

McCown, T. J. (2006) Adeno-associated virus-mediated expression and constitutive

secretion of galanin suppresses limbic seizure activity in vivo. Mol. Ther. 14:63-68.

Mohler, H., Fritschy, J.M., Rudolph, U. (2002) A new benzodiazepine pharmacology. J.

Pharmacol, Exp, Ther, 300:2-8. Monyer, H., Sprengel, R., Schoepfer, R., Herb, A., Higuchi, M., Lomeli, H., Burnashev,

N., Sakmann, B., Seeburg, P.H. (1992) Heteromeric NMDA receptors: molecular and functional distinction of subtypes. Science 256:1217-1221.

Peng, Z., Huang, C.S., Stell, B.M., Mody, I. Houser, C.R. (2004) Altered expression of

the delta subunit of the GABAA receptor in a mouse model of temporal lobe epilepsy. J. Neurosci. 24:10167-75.

Perkins, D., Pereira, E.F., Aurelian, L., (2003) The herpes simplex virus type 2 R1

protein kinase (ICP10 PK) functions as a dominant regulator of apoptosis in hippocampal neurons involving activation of the ERK survival pathway and upregulation of the antiapoptotic protein Bag-1. J. Virol. 77:1292-1305.

Raol, Y.H., Lund, I.V., Bandyopadhyay, S., Zhang, G., Roberts, D.S., Wolfe, J.H.,

Russek, S.J., Brooks-Kayal, A.R. (2006) Enhancing GABA(A) receptor α1 subunit levels in hippocampal dentate gyrus inhibits epilepsy development in an animal model of temporal lobe epilepsy. J. Neurosci. 26:11342-11346.

http://www.ncbi.nlm.nih.gov/sites/entrez?Db=pubmed&Cmd=ShowDetailView&TermToSearch=15451392&ordinalpos=32&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_RVDocSum

141

Richichi, C., Lin, E.J., Stefanin, D., Colella, D., Ravizza, T., Grignaschi, G., Veglianese,

P., Sperk, G., During, M.J., Vezzani, A. (2004) Anticonvulsant and antiepileptogenic effects mediated by adeno-associated virus vector neuropeptide Y expression in the rat hippocampus. J. Neurosci. 24: 3051-3059.

Roberts, D., Raol, Y.S.H., Budrick, E., Lund, I., Passini, M., Wolfe, J., Brooks-Kayal,

A.R., Russek, S.J. (2005) Egr3 stimulation of GABRA4 promoter activity as a mechanism for seizure-induced up-regulation of GABAA receptor alpha4 subunit expression. Proc. Natl. Acad. Sci. U S A 102:11894-11899.

Sander, J. W. (1993) Some aspects of prognosis in the epilepsies: a review. Epilepsia

34:1007-1016. Seki, T., Matsubayashi, H., Amano, T., Kitada, K., Serkawa, T., Sasa, M., Sakai, N.

(2004) Adenoviral gene transfer of aspartoacylase ameliorates tonic convulsions of spontaneously epileptic rats. Neurochem. Int. 45:171-178.

Semah, F., Picot, M.C., Adan, C., Broglin, D., Arzimanoglou, A., Bazin, B., Cavalcanti,

D., Baulac, M. (1998) Is the underlying cause of epilepsy a major prognostic factor for recurrence? Neurology 51:1256-1262.

Shafer, P. O., Begley, C. (2000). The Human and Economic Burden of Epilepsy.

Epilepsy Behav.1:91-92. Shafer, S. Q., Hauser, W.A., Annegers, J.F., Klass, D.W. (1988). EEG and other early

predictors of epilepsy remission: a community study. Epilepsia 29:590-600. Siegel, A. M. (2004). Presurgical evaluation and surgical treatment of medically

refractory epilepsy. Neurosurg. Rev. 27:1-18. Spencer, D. D., Spencer, S.S., Mattson, R.H., Williamson, P.D., Novelly, R.A. (1984).

Access to the posterior medial temporal lobe structures in the surgical treatment of temporal lobe epilepsy. Neurosurgery 15:667-671.

Thompson, K.W. (2005) Genetically engineered cells with regulatable GABA production

can affect afterdischarges and behavioral seizures after transplantation into the dentate gyrus. Neurosci. 133:1029-1037.

Thompson, K.W., Suchomelova, L.M. (2004) Transplants of cells engineered to produce

GABA suppress spontaneous seizures. Epilepsia 45: 4-12. Thompson, K.W., Anantharam, V., Sehrstock, S., Bongarzone, E., Campagnoni, A.,

Tobin, A.J. (2000) Conditionally immortalized cell lines, engineered to produce and release GABA, modulate the development of behavioral seizures. Exp. Neurol. 161:481-489.

142

Ure, J. A., Perassolo, M. (2000) Update on the pathophysiology of the epilepsies. J. Neurol. Sci. 177:1-17.

Woldbye, D.P.D., Larsen, P.J., Mikkelsen, J.D., Klemp, K., Madsen, T.M., Bolwig, T.G.

(1997) Powerful inhibition of kainic acid seizures by neuropeptide Y via Y5-like receptors. Nat. Med. 3:761-764.

Xiao, X., McCown, T.J., Li, J., Breese, G.R., Morrow, A.L.,Samulski, R.J. (1997)

Adeno-associated virus (AAV) vector antisense gene transfer in vivo decreases GABAA α1 containing receptors and increases collicular seizure sensitivity. Brain Res. 576:76-83.

Yang, J., Teng, Q., Fererici, T., Najm, I., Chabardes, S., Moffitt, M., Alexopoulos, A.,

Riley, J., Boulis, N. (2007) Viral clostridial light chain gene-based control of penicillin-induced neocortical seizures. Mol. Ther. 15:542-551.

Yoo, Y.M., Lee, C.J., Lee, U., Kim, Y.J. (2006) Neuroprotection of adenoviral-vector-

mediated GDNF expression against kainic-acid-induced excitotoxicity in the rat hippocampus. Exp. Neurol. 200:407-417.

Zhang N, Wei W, Mody I, Houser CR (2007). Altered localization of GABA(A) receptor

subunits on dentate granule cell dendrites influences tonic and phasic inhibition in a mouse model of epilepsy. J. Neurosci. 27(28):7520-7531.

Zhang, L.X., Li, X.L., Smith, M.A., Post, R.M., Han, J.S. (1997) Lipofectin-facilitated

transfer of cholecystokinin gene corrects behavioral abnormalities of rats with audiogenic seizures. Neurosci. 77:15-22.

143

Table 1. Potential Therapeutic Targets that Influence Seizure Behavior.

Target Placement Delivery vector

Experimental model

Functional effect

References

Adenosine


Grafting of fibroblasts or myoblasts


Suppression of generalized seizures

(Huber et al. ,2001; Guttinger et al., 2005)

Anti NMDA Collicular cortex AAV-CMV vector

Focal electrical stimulation

Increased seizure threshold

(Haberman et al., 2002)

AAV-TEToff vector

Decreased seizure threshold


ASPA


Ad-CB vector Spontaneous

seizures in SER

Transiently reduced incidence of tonic seizures (2 weeks)

(Seki et al., 2004)

Cholecystokinin Intracerebroventricular Lipofectin and plasmid

Audiogenic seizure-prone rats

Transient seizure inhibition (1 week)

(Zhang et al., 1997)

GABAAR Hippocampus AAV-GABAR4


Transiently reduced spontaneous seizures (4 weeks)

(Raol et al., 2006)

GAD65 Anterior SN Grafting of neuronal or glial cell lines

Entorhinal kindling

Delayed rate of kindling

(Thompson et al., 2000)

Posterior SN

Grafting of neuronal or

glial cell lines

Faster rate of kindling

(Thompsonet al., 2000)

Anterior SN



Reduced spontaneous seizures

(Thompson and Suchomelova 2004)

Piriform cortex


Amygdala kindling

Increased threshold to seizures

(Gernert et al., 2002)

GAD67 SN pars reticulata

Grafting of mixed neuronal and glial cell line

Kainic acid ip Delayed seizure behavior

(Castillo et al., 2006)

Galanin Collicular cortex




Hippocampus


Kainic acid ip

Neuroprotection


144

AAV-NSE vector+WPRE

Kainic acid ih

Reduced number of seizures

(Lin, et al., 2003)

Piriform cortex


Kainic acid ip

Seizure inhibition

(McCown, 2006)

Focal electrical stimulation


(McCown, 2006)

GDNF

Hippocampus

AAV-CB vector+WPRE


Decreased number of generalized seizures, increased seizure threshold

(Kanter-Schlifke et al., 2007)

Hippocampus

Ad-CMV vector

Kainic acid ip

Delayed seizure behaviors, neuroprotective

(Yoo et al., 2006)

ICP10PK

Intranasal vaccine

HSV-2∆RR –ICP10 vector

Kainic acid ip

Reduced seizure behaviors, neuroprotection

(Laing et al., 2006 )

NPY

Hippocampus

AAV-NSE vector+WPRE

Kainic acid ih Delayed seizure behavior

(Richichi et al. ,2004)


Increased seizure threshold and delayed rate of kindling

(Richichi et al., 2004)

Piriform cortex


Kainic acid ip

Reduced and delayed seizure behaviors

(Foti, et al., 2007)

NPY 13-36

Piriform cortex


Kainic acid ip

Reduced and delayed seizure behaviors

(Foti, et al. ,2007)

Abbreviations are: AAV: adeno-associated virus; ASPA: aspartoacylase; Ad: adenoviral; CB: cytomegalovirus enhancer, chicken beta-actin promoter; CMV: cytomegalovirus; GAD: glutamic acid decarboxylase; GDNF: glial-derived neurotrophic factor; ICP10PK: ICP 10 protein kinase; ih: intrahippocampal; ip: intraperitoneal; NMDA: N-methyl-D- aspartate; NPY: Neuropeptide Y; NSE: neuron- specific enolase; SER: spontaneously epileptic rats; SN: substantia nigra; TET off: tetracycline-off regulatable promoter; WPRE: woodchuck virus post-transcriptional regulatory element.

145

References Acland, G. M., G. D. Aguirre, et al. (2001). "Gene therapy restores vision in a canine

model of childhood blindness." Nat Genet 28(1): 92-5. Agarwal, M., T. W. Austin, et al. (1998). "Scaffold attachment region-mediated

enhancement of retroviral vector expression in primary T cells." J Virol 72(5): 3720-8.

Agnati, L. F., B. Bjelke, et al. (1995). "Volume versus wiring transmission in the brain: a

new theoretical frame for neuropsychopharmacology." Med Res Rev 15(1): 33-45.

Alberch, J., E. Perez-Navarro, et al. (2002). "Neuroprotection by neurotrophins and

GDNF family members in the excitotoxic model of Huntington's disease." Brain Res Bull 57(6): 817-22.

Araujo, D. M. and D. C. Hilt (1997). "Glial cell line-derived neurotrophic factor

attenuates the excitotoxin-induced behavioral and neurochemical deficits in a rodent model of Huntington's disease." Neuroscience 81(4): 1099-110.

Araujo, D. M. and D. C. Hilt (1998). "Glial cell line-derived neurotrophic factor

attenuates the locomotor hypofunction and striatonigral neurochemical deficits induced by chronic systemic administration of the mitochondrial toxin 3-nitropropionic acid." Neuroscience 82(1): 117-27.

Auricchio, A., G. P. Gao, et al. (2002). "Constitutive and regulated expression of

processed insulin following in vivo hepatic gene transfer." Gene Ther 9(14): 963-71.

Auricchio, A., V. M. Rivera, et al. (2002). "Pharmacological regulation of protein

expression from adeno-associated viral vectors in the eye." Mol Ther 6(2): 238-42.

Auten, J., M. Agarwal, et al. (1999). "Effect of scaffold attachment region on transgene

expression in retrovirus vector-transduced primary T cells and macrophages." Hum Gene Ther 10(8): 1389-99.

Bankiewicz, K. S., J. Forsayeth, et al. (2006). "Long-term clinical improvement in

MPTP-lesioned primates after gene therapy with AAV-hAADC." Mol Ther 14(4): 564-70.

Baraban, S. C. (2002). "Antiepileptic actions of neuropeptide Y in the mouse

hippocampus require Y5 receptors." Epilepsia 43 Suppl 5: 9-13.

146

Barker, C. F. and R. E. Billingham (1977). "Immunologically privileged sites." Adv Immunol 25: 1-54.

Baron, U. and H. Bujard (2000). "Tet repressor-based system for regulated gene

expression in eukaryotic cells: principles and advances." Methods Enzymol 327: 401-21.

Bartlett, J. S., R. J. Samulski, et al. (1998). "Selective and rapid uptake of adeno-

associated virus type 2 in brain." Hum Gene Ther 9(8): 1181-6. Bauer, H. J. and G. Monreal (1986). "Herpesviruses provide helper functions for avian

adeno-associated parvovirus." J Gen Virol 67 (Pt 1): 181-5. Bernard, C., J. C. Hirsch, et al. (1999). "Excitation and inhibition in temporal lobe

epilepsy: a close encounter." Adv Neurol 79: 821-8. Berns, K. I. and R. M. Linden (1995). "The cryptic life style of adeno-associated virus."

Bioessays 17(3): 237-45. Blacklow, N. R., M. D. Hoggan, et al. (1968). "Epidemiology of adenovirus-associated

virus infection in a nursery population." Am J Epidemiol 88(3): 368-78. Blomer, U., L. Naldini, et al. (1997). "Highly efficient and sustained gene transfer in

adult neurons with a lentivirus vector." J Virol 71(9): 6641-9. Bode, J., Y. Kohwi, et al. (1992). "Biological significance of unwinding capability of

nuclear matrix-associating DNAs." Science 255(5041): 195-7. Bonhaus, D. W., L. C. Rigsbee, et al. (1987). "Intranigral dynorphin-1-13 suppresses

kindled seizures by a naloxone-insensitive mechanism." Brain Res 405(2): 358-63.

Bosch, A., E. Perret, et al. (2000). "Reversal of pathology in the entire brain of

mucopolysaccharidosis type VII mice after lentivirus-mediated gene transfer." Hum Gene Ther 11(8): 1139-50.

Bowles, D. E., J. E. Rabinowitz, et al. (2003). "Marker rescue of adeno-associated virus

(AAV) capsid mutants: a novel approach for chimeric AAV production." J Virol 77(1): 423-32.

Branchek, T. A., K. E. Smith, et al. (2000). "Galanin receptor subtypes." Trends

Pharmacol Sci 21(3): 109-17. Brooks-Kayal, A. R., M. D. Shumate, et al. (1999). "Human neuronal gamma-

aminobutyric acid(A) receptors: coordinated subunit mRNA expression and

147

functional correlates in individual dentate granule cells." J Neurosci 19(19): 8312-8.

Brooks-Kayal, A. R., M. D. Shumate, et al. (1998). "Selective changes in single cell

GABA(A) receptor subunit expression and function in temporal lobe epilepsy." Nat Med 4(10): 1166-72.

Brooks, P. A., J. S. Kelly, et al. (1987). "Direct excitatory effects of neuropeptide Y

(NPY) on rat hippocampal neurones in vitro." Brain Res 408(1-2): 295-8. Buhl, E. H., T. S. Otis, et al. (1996). "Zinc-induced collapse of augmented inhibition by

GABA in a temporal lobe epilepsy model." Science 271(5247): 369-73. Buller, R. M., J. E. Janik, et al. (1981). "Herpes simplex virus types 1 and 2 completely

help adenovirus-associated virus replication." J Virol 40(1): 241-7. Burger, C., O. S. Gorbatyuk, et al. (2004). "Recombinant AAV viral vectors pseudotyped

with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central nervous system." Mol Ther 10(2): 302-17.

Burgess, T. L. and R. B. Kelly (1987). "Constitutive and regulated secretion of proteins."

Annu Rev Cell Biol 3: 243-93. Castillo, C. G., S. Mendoza, et al. (2006). "Intranigral transplants of immortalized

GABAergic cells decrease the expression of kainic acid-induced seizures in the rat." Behav Brain Res 171(1): 109-15.

Cearley, C. N. and J. H. Wolfe (2006). "Transduction characteristics of adeno-associated

virus vectors expressing cap serotypes 7, 8, 9, and Rh10 in the mouse brain." Mol Ther 13(3): 528-37.

Cearley, C. N. and J. H. Wolfe (2007). "A single injection of an adeno-associated virus

vector into nuclei with divergent connections results in widespread vector distribution in the brain and global correction of a neurogenetic disease." J Neurosci 27(37): 9928-40.

Chen, H., D. M. McCarty, et al. (1999). "Oligodendrocyte-specific gene expression in

mouse brain: use of a myelin-forming cell type-specific promoter in an adeno-associated virus." J Neurosci Res 55(4): 504-13.

Chenuaud, P., T. Larcher, et al. (2004). "Optimal design of a single recombinant adeno-

associated virus derived from serotypes 1 and 2 to achieve more tightly regulated transgene expression from nonhuman primate muscle." Mol Ther 9(3): 410-8.

148

Cheung, A. K., M. D. Hoggan, et al. (1980). "Integration of the adeno-associated virus genome into cellular DNA in latently infected human Detroit 6 cells." J Virol 33(2): 739-48.

Chirmule, N., K. Propert, et al. (1999). "Immune responses to adenovirus and adeno-

associated virus in humans." Gene Ther 6(9): 1574-83. Choi, V. W., D. M. McCarty, et al. (2005). "AAV hybrid serotypes: improved vectors for

gene delivery." Curr Gene Ther 5(3): 299-310. Chtarto, A., H. U. Bender, et al. (2003). "Tetracycline-inducible transgene expression

mediated by a single AAV vector." Gene Ther 10(1): 84-94. Chtarto, A., X. Yang, et al. (2007). "Controlled delivery of glial cell line-derived

neurotrophic factor by a single tetracycline-inducible AAV vector." Exp Neurol 204(1): 387-99.

Cohen, I., V. Navarro, et al. (2002). "On the origin of interictal activity in human

temporal lobe epilepsy in vitro." Science 298(5597): 1418-21. Colmers, W. F. and D. Bleakman (1994). "Effects of neuropeptide Y on the electrical

properties of neurons." Trends Neurosci 17(9): 373-9. Colmers, W. F., G. J. Klapstein, et al. (1991). "Presynaptic inhibition by neuropeptide Y

in rat hippocampal slice in vitro is mediated by a Y2 receptor." Br J Pharmacol 102(1): 41-4.

Cruz-Aguado, R., L. F. Turner, et al. (2000). "Nerve growth factor and striatal

glutathione metabolism in a rat model of Huntington's disease." Restor Neurol Neurosci 17(4): 217-221.

Davidson, B. L., C. S. Stein, et al. (2000). "Recombinant adeno-associated virus type 2,

4, and 5 vectors: transduction of variant cell types and regions in the mammalian central nervous system." Proc Natl Acad Sci U S A 97(7): 3428-32.

Davies, S. W. and K. Beardsall (1992). "Nerve growth factor selectively prevents

excitotoxin induced degeneration of striatal cholinergic neurones." Neurosci Lett 140(2): 161-4.

Day, R., M. K. Schafer, et al. (1993). "Region specific expression of furin mRNA in the

rat brain." Neurosci Lett 149(1): 27-30. de Felipe, P. (2002). "Polycistronic viral vectors." Curr Gene Ther 2(3): 355-78. de Lanerolle, N. C., J. H. Kim, et al. (1989). "Hippocampal interneuron loss and plasticity

in human temporal lobe epilepsy." Brain Res 495(2): 387-95.

149

Dillon, N. and F. Grosveld (1993). "Transcriptional regulation of multigene loci: multilevel control." Trends Genet 9(4): 134-7.

Dodge, J. C., J. Clarke, et al. (2005). "Gene transfer of human acid sphingomyelinase

corrects neuropathology and motor deficits in a mouse model of Niemann-Pick type A disease." Proc Natl Acad Sci U S A 102(49): 17822-7.

Donello, J. E., J. E. Loeb, et al. (1998). "Woodchuck hepatitis virus contains a tripartite

posttranscriptional regulatory element." J Virol 72(6): 5085-92. Donnelly, M. L., G. Luke, et al. (2001). "Analysis of the aphthovirus 2A/2B polyprotein

'cleavage' mechanism indicates not a proteolytic reaction, but a novel translational effect: a putative ribosomal 'skip'." J Gen Virol 82(Pt 5): 1013-25.

Duan, D., P. Sharma, et al. (1998). "Circular intermediates of recombinant adeno-

associated virus have defined structural characteristics responsible for long-term episomal persistence in muscle tissue." J Virol 72(11): 8568-77.

Duan, D., Y. Yue, et al. (2003). "Dual vector expansion of the recombinant AAV

packaging capacity." Methods Mol Biol 219: 29-51. Dumont, Y., A. Cadieux, et al. (2000). "Potent and selective tools to investigate

neuropeptide Y receptors in the central and peripheral nervous systems: BIB03304 (Y1) and CGP71683A (Y5)." Can J Physiol Pharmacol 78(2): 116-25.

Dumont, Y., A. Cadieux, et al. (2000). "BIIE0246, a potent and highly selective non-

peptide neuropeptide Y Y(2) receptor antagonist." Br J Pharmacol 129(6): 1075-88.

During, M. J., R. J. Samulski, et al. (1998). "In vivo expression of therapeutic human

genes for dopamine production in the caudates of MPTP-treated monkeys using an AAV vector." Gene Ther 5(6): 820-7.

During, M. J., C. W. Symes, et al. (2000). "An oral vaccine against NMDAR1 with

efficacy in experimental stroke and epilepsy." Science 287(5457): 1453-60. El Bahh, B., S. Balosso, et al. (2005). "The anti-epileptic actions of neuropeptide Y in the

hippocampus are mediated by Y and not Y receptors." Eur J Neurosci 22(6): 1417-30.

El Bahh, B., J. Q. Cao, et al. (2002). "Blockade of neuropeptide Y(2) receptors and

suppression of NPY's anti-epileptic actions in the rat hippocampal slice by BIIE0246." Br J Pharmacol 136(4): 502-9.

Engel, J., Jr. (1996). "Excitation and inhibition in epilepsy." Can J Neurol Sci 23(3): 167-

74.

150

Engel, J., Jr., M. F. Levesque, et al. (1992). "Surgical treatment of the epilepsies: presurgical evaluation." Clin Neurosurg 38: 514-34.

Ericson, C., K. Wictorin, et al. (2002). "Ex vivo and in vitro studies of transgene

expression in rat astrocytes transduced with lentiviral vectors." Exp Neurol 173(1): 22-30.

Erles, K., P. Sebokova, et al. (1999). "Update on the prevalence of serum antibodies (IgG

and IgM) to adeno-associated virus (AAV)." J Med Virol 59(3): 406-11. Fathi, Z., A. M. Cunningham, et al. (1997). "Cloning, pharmacological characterization

and distribution of a novel galanin receptor." Brain Res Mol Brain Res 51(1-2): 49-59.

Ferrari, F. K., T. Samulski, et al. (1996). "Second-strand synthesis is a rate-limiting step

for efficient transduction by recombinant adeno-associated virus vectors." J Virol 70(5): 3227-34.

Ferrari, F. K., X. Xiao, et al. (1997). "New developments in the generation of Ad-free,

high-titer rAAV gene therapy vectors." Nat Med 3(11): 1295-7. Festenstein, R., M. Tolaini, et al. (1996). "Locus control region function and

heterochromatin-induced position effect variegation." Science 271(5252): 1123-5. Fisher, K. J., G. P. Gao, et al. (1996). "Transduction with recombinant adeno-associated

virus for gene therapy is limited by leading-strand synthesis." J Virol 70(1): 520-32.

Fitzsimons, H. L., J. M. McKenzie, et al. (2001). "Insulators coupled to a minimal

bidirectional tet cassette for tight regulation of rAAV-mediated gene transfer in the mammalian brain." Gene Ther 8(22): 1675-81.

Flotte, T. R. (2001). "Recombinant adeno-associated virus vectors for cystic fibrosis gene

therapy." Curr Opin Mol Ther 3(5): 497-502. Flotte, T. R., S. A. Afione, et al. (1993). "Expression of the cystic fibrosis transmembrane

conductance regulator from a novel adeno-associated virus promoter." J Biol Chem 268(5): 3781-90.

Folliot, S., D. Briot, et al. (2003). "Sustained tetracycline-regulated transgene expression

in vivo in rat retinal ganglion cells using a single type 2 adeno-associated viral vector." J Gene Med 5(6): 493-501.

Foti, S., R. P. Haberman, et al. (2007). "Adeno-associated virus-mediated expression and

constitutive secretion of NPY or NPY13-36 suppresses seizure activity in vivo." Gene Ther 14(21): 1534-6.

151

Freese, A., M. G. Kaplitt, et al. (1997). "Direct gene transfer into human epileptogenic hippocampal tissue with an adeno-associated virus vector: implications for a gene therapy approach to epilepsy." Epilepsia 38(7): 759-66.

Frim, D. M., M. P. Short, et al. (1993). "Local protective effects of nerve growth factor-

secreting fibroblasts against excitotoxic lesions in the rat striatum." J Neurosurg 78(2): 267-73.

Frim, D. M., J. Simpson, et al. (1993). "Striatal degeneration induced by mitochondrial

blockade is prevented by biologically delivered NGF." J Neurosci Res 35(4): 452-8.

Frim, D. M., T. A. Uhler, et al. (1993). "Effects of biologically delivered NGF, BDNF

and bFGF on striatal excitotoxic lesions." Neuroreport 4(4): 367-70. Frush, D. P. and J. O. McNamara (1986). "Evidence implicating dentate granule cells in

wet dog shakes produced by kindling stimulations of entorhinal cortex." Exp Neurol 92(1): 102-13.

Fuqua, S. A., M. Blum-Salingaros, et al. (1989). "Induction of the estrogen-regulated

"24K" protein by heat shock." Cancer Res 49(15): 4126-9. Furler, S., J. C. Paterna, et al. (2001). "Recombinant AAV vectors containing the foot and

mouth disease virus 2A sequence confer efficient bicistronic gene expression in cultured cells and rat substantia nigra neurons." Gene Ther 8(11): 864-73.

Furtinger, S., S. Pirker, et al. (2001). "Plasticity of Y1 and Y2 receptors and neuropeptide

Y fibers in patients with temporal lobe epilepsy." J Neurosci 21(15): 5804-12. Gafni, Y., G. Pelled, et al. (2004). "Gene therapy platform for bone regeneration using an

exogenously regulated, AAV-2-based gene expression system." Mol Ther 9(4): 587-95.

Gaken, J., J. Jiang, et al. (2000). "Fusagene vectors: a novel strategy for the expression of

multiple genes from a single cistron." Gene Ther 7(23): 1979-85. Galpern, W. R., R. T. Matthews, et al. (1996). "NGF attenuates 3-nitrotyrosine formation

in a 3-NP model of Huntington's disease." Neuroreport 7(15-17): 2639-42. Galpern, W. R., L. G. Miller, et al. (1990). "Differential effects of chronic lorazepam and

alprazolam on benzodiazepine binding and GABAA-receptor function." Br J Pharmacol 101(4): 839-42.

Gao, G., M. R. Alvira, et al. (2003). "Adeno-associated viruses undergo substantial

evolution in primates during natural infections." Proc Natl Acad Sci U S A 100(10): 6081-6.

152

Gao, G. P., M. R. Alvira, et al. (2002). "Novel adeno-associated viruses from rhesus monkeys as vectors for human gene therapy." Proc Natl Acad Sci U S A 99(18): 11854-9.

Georgievska, B., D. Kirik, et al. (2002). "Aberrant sprouting and downregulation of

tyrosine hydroxylase in lesioned nigrostriatal dopamine neurons induced by long-lasting overexpression of glial cell line derived neurotrophic factor in the striatum by lentiviral gene transfer." Exp Neurol 177(2): 461-74.

Gernert, M., K. W. Thompson, et al. (2002). "Genetically engineered GABA-producing

cells demonstrate anticonvulsant effects and long-term transgene expression when transplanted into the central piriform cortex of rats." Exp Neurol 176(1): 183-92.

Gibbs, J. W., 3rd, M. D. Shumate, et al. (1997). "Differential epilepsy-associated

alterations in postsynaptic GABA(A) receptor function in dentate granule and CA1 neurons." J Neurophysiol 77(4): 1924-38.

Gigout, L., P. Rebollo, et al. (2005). "Altering AAV tropism with mosaic viral capsids."

Mol Ther 11(6): 856-65. Greber, S., C. Schwarzer, et al. (1994). "Neuropeptide Y inhibits potassium-stimulated

glutamate release through Y2 receptors in rat hippocampal slices in vitro." Br J Pharmacol 113(3): 737-40.

Grieger, J. C., V. W. Choi, et al. (2006). "Production and characterization of adeno-

associated viral vectors." Nat Protoc 1(3): 1412-28. Grieger, J. C. and R. J. Samulski (2005). "Packaging capacity of adeno-associated virus

serotypes: impact of larger genomes on infectivity and postentry steps." J Virol 79(15): 9933-44.

Guttinger, M., V. Padrun, et al. (2005). "Seizure suppression and lack of adenosine A1

receptor desensitization after focal long-term delivery of adenosine by encapsulated myoblasts." Exp Neurol 193(1): 53-64.

Haberman, R., H. Criswell, et al. (2002). "Therapeutic liabilities of in vivo viral vector

tropism: adeno-associated virus vectors, NMDAR1 antisense, and focal seizure sensitivity." Mol Ther 6(4): 495-500.

Haberman, R. P. and T. J. McCown (2002). "Regulation of gene expression in adeno-

associated virus vectors in the brain." Methods 28(2): 219-26. Haberman, R. P., T. J. McCown, et al. (1998). "Inducible long-term gene expression in

brain with adeno-associated virus gene transfer." Gene Ther 5(12): 1604-11.

153

Haberman, R. P., T. J. McCown, et al. (2000). "Novel transcriptional regulatory signals in the adeno-associated virus terminal repeat A/D junction element." J Virol 74(18): 8732-9.

Haberman, R. P., R. J. Samulski, et al. (2003). "Attenuation of seizures and neuronal

death by adeno-associated virus vector galanin expression and secretion." Nat Med 9(8): 1076-80.

Hadaczek, P., M. Kohutnicka, et al. (2006). "Convection-enhanced delivery of adeno-

associated virus type 2 (AAV2) into the striatum and transport of AAV2 within monkey brain." Hum Gene Ther 17(3): 291-302.

Hadaczek, P., H. Mirek, et al. (2004). "Basic fibroblast growth factor enhances

transduction, distribution, and axonal transport of adeno-associated virus type 2 vector in rat brain." Hum Gene Ther 15(5): 469-79.

Halbert, C. L., A. D. Miller, et al. (2006). "Prevalence of neutralizing antibodies against

adeno-associated virus (AAV) types 2, 5, and 6 in cystic fibrosis and normal populations: Implications for gene therapy using AAV vectors." Hum Gene Ther 17(4): 440-7.

Harui, A., S. Suzuki, et al. (1999). "Frequency and stability of chromosomal integration

of adenovirus vectors." J Virol 73(7): 6141-6. Hauck, B. and W. Xiao (2003). "Characterization of tissue tropism determinants of

adeno-associated virus type 1." J Virol 77(4): 2768-74. Hauser, W. A., D. C. Hesdorffer, et al. (1990). Epilepsy frequency, causes, and

consequences. Landover, MD; New York, NY, Epilepsy Foundation of America; Demos.

He, B., S. E. Counts, et al. (2005). "Ectopic galanin expression and normal galanin

receptor 2 and galanin receptor 3 mRNA levels in the forebrain of galanin transgenic mice." Neuroscience 133(2): 371-80.

Higashimoto, T., F. Urbinati, et al. (2007). "The woodchuck hepatitis virus post-

transcriptional regulatory element reduces readthrough transcription from retroviral vectors." Gene Ther 14(17): 1298-304.

Hildinger, M., A. Auricchio, et al. (2001). "Hybrid vectors based on adeno-associated

virus serotypes 2 and 5 for muscle-directed gene transfer." J Virol 75(13): 6199-203.

Hippenmeyer, P. J. and G. G. Krivi (1991). "Gene expression from heterologous

promoters in a replication-defective avian retrovirus vector in quail cells." Poult Sci 70(4): 982-92.

154

Hirtz, D., D. J. Thurman, et al. (2007). "How common are the "common" neurologic disorders?" Neurology 68(5): 326-37.

Hokfelt, T., T. Bartfai, et al. (2003). "Neuropeptides: opportunities for drug discovery."

Lancet Neurol 2(8): 463-72. Hollmann, M. and S. Heinemann (1994). "Cloned glutamate receptors." Annu Rev

Neurosci 17: 31-108. Holmes, G. L. (1997). "Epilepsy in the developing brain: lessons from the laboratory and

clinic." Epilepsia 38(1): 12-30. Holst, J. J., M. Bersani, et al. (1993). "On the effects of human galanin in man."

Diabetologia 36(7): 653-7. Huang, L., M.-c. Hung, et al. (1999). Nonviral vectors for gene therapy. San Diego, CA,

Academic Press. Huber, A., V. Padrun, et al. (2001). "Grafts of adenosine-releasing cells suppress seizures

in kindling epilepsy." Proc Natl Acad Sci U S A 98(13): 7611-6. Huttner, N. A., A. Girod, et al. (2003). "Genetic modifications of the adeno-associated

virus type 2 capsid reduce the affinity and the neutralizing effects of human serum antibodies." Gene Ther 10(26): 2139-47.

Jenuwein, T., W. C. Forrester, et al. (1997). "Extension of chromatin accessibility by

nuclear matrix attachment regions." Nature 385(6613): 269-72. Jiang, H., G. F. Pierce, et al. (2006). "Evidence of multiyear factor IX expression by

AAV-mediated gene transfer to skeletal muscle in an individual with severe hemophilia B." Mol Ther 14(3): 452-5.

Jiang, L., S. Rampalli, et al. (2004). "Tight regulation from a single tet-off rAAV vector

as demonstrated by flow cytometry and quantitative, real-time PCR." Gene Ther 11(13): 1057-67.

Johnston, J., J. Tazelaar, et al. (2003). "Regulated expression of erythropoietin from an

AAV vector safely improves the anemia of beta-thalassemia in a mouse model." Mol Ther 7(4): 493-7.

Kamau, S. W., F. Grimm, et al. (2001). "Expression of green fluorescent protein as a

marker for effects of antileishmanial compounds in vitro." Antimicrob Agents Chemother 45(12): 3654-6.

Kanter-Schlifke, I., B. Georgievska, et al. (2007). "Seizure suppression by GDNF gene

therapy in animal models of epilepsy." Mol Ther 15(6): 1106-13.

155

Kaplitt, M. G., A. Feigin, et al. (2007). "Safety and tolerability of gene therapy with an adeno-associated virus (AAV) borne GAD gene for Parkinson's disease: an open label, phase I trial." Lancet 369(9579): 2097-105.

Kaspar, B. K., J. Llado, et al. (2003). "Retrograde viral delivery of IGF-1 prolongs

survival in a mouse ALS model." Science 301(5634): 839-42. Kells, A. P., D. M. Fong, et al. (2004). "AAV-mediated gene delivery of BDNF or GDNF

is neuroprotective in a model of Huntington disease." Mol Ther 9(5): 682-8. Kioussis, D. and R. Festenstein (1997). "Locus control regions: overcoming

heterochromatin-induced gene inactivation in mammals." Curr Opin Genet Dev 7(5): 614-9.

Kirik, D., C. Rosenblad, et al. (2000). "Long-term rAAV-mediated gene transfer of

GDNF in the rat Parkinson's model: intrastriatal but not intranigral transduction promotes functional regeneration in the lesioned nigrostriatal system." J Neurosci 20(12): 4686-700.

Klein, R. L., R. D. Dayton, et al. (2006). "Efficient neuronal gene transfer with AAV8

leads to neurotoxic levels of tau or green fluorescent proteins." Mol Ther 13(3): 517-27.

Klein, R. L., R. D. Dayton, et al. (2008). "AAV8, 9, Rh10, Rh43 Vector Gene Transfer in

the Rat Brain: Effects of Serotype, Promoter and Purification Method." Mol Ther 16(1): 89-96.

Klein, R. L., M. E. Hamby, et al. (2002). "Dose and promoter effects of adeno-associated

viral vector for green fluorescent protein expression in the rat brain." Exp Neurol 176(1): 66-74.

Klein, R. L., E. M. Meyer, et al. (1998). "Neuron-specific transduction in the rat

septohippocampal or nigrostriatal pathway by recombinant adeno-associated virus vectors." Exp Neurol 150(2): 183-94.

Klugmann, M., C. W. Symes, et al. (2005). "AAV-mediated hippocampal expression of

short and long Homer 1 proteins differentially affect cognition and seizure activity in adult rats." Mol Cell Neurosci 28(2): 347-60.

Kofler, N., E. Kirchmair, et al. (1997). "Altered expression of NPY-Y1 receptors in

kainic acid induced epilepsy in rats." Neurosci Lett 230(2): 129-32. Kopp, J., A. Nanobashvili, et al. (1999). "Differential regulation of mRNAs for

neuropeptide Y and its receptor subtypes in widespread areas of the rat limbic system during kindling epileptogenesis." Brain Res Mol Brain Res 72(1): 17-29.

156

Laing, J. M. and L. Aurelian (2008). "DeltaRR vaccination protects from KA-induced seizures and neuronal loss through ICP10PK-mediated modulation of the neuronal-microglial axis." Genet Vaccines Ther 6(1): 1.

Laing, J. M., M. D. Gober, et al. (2006). "Intranasal administration of the growth-

compromised HSV-2 vector DeltaRR prevents kainate-induced seizures and neuronal loss in rats and mice." Mol Ther 13(5): 870-81.

Lang, A. E. and A. M. Lozano (1998). "Parkinson's disease. First of two parts." N Engl J

Med 339(15): 1044-53. Li, T., J. A. Steinbeck, et al. (2007). "Suppression of kindling epileptogenesis by

adenosine releasing stem cell-derived brain implants." Brain 130(Pt 5): 1276-88. Lin, E. J., C. Richichi, et al. (2003). "Recombinant AAV-mediated expression of galanin

in rat hippocampus suppresses seizure development." Eur J Neurosci 18(7): 2087-92.

Lin, E. J., D. Young, et al. (2006). "Differential actions of NPY on seizure modulation

via Y1 and Y2 receptors: evidence from receptor knockout mice." Epilepsia 47(4): 773-80.

Lipshutz, G. S., D. Titre, et al. (2003). "Comparison of gene expression after

intraperitoneal delivery of AAV2 or AAV5 in utero." Mol Ther 8(1): 90-8. Lisovoski, F., J. P. Wahrmann, et al. (1997). "Long-term histological follow-up of

genetically modified myoblasts grafted into the brain." Brain Res Mol Brain Res 44(1): 125-33.

Lo, W. D., G. Qu, et al. (1999). "Adeno-associated virus-mediated gene transfer to the

brain: duration and modulation of expression." Hum Gene Ther 10(2): 201-13. Loacker, S., M. Sayyah, et al. (2007). "Endogenous dynorphin in epileptogenesis and

epilepsy: anticonvulsant net effect via kappa opioid receptors." Brain 130(Pt 4): 1017-28.

Lochrie, M. A., G. P. Tatsuno, et al. (2006). "Mutations on the external surfaces of

adeno-associated virus type 2 capsids that affect transduction and neutralization." J Virol 80(2): 821-34.

Loeb, J. E., W. S. Cordier, et al. (1999). "Enhanced expression of transgenes from adeno-

associated virus vectors with the woodchuck hepatitis virus posttranscriptional regulatory element: implications for gene therapy." Hum Gene Ther 10(14): 2295-305.

157

Longhi, L., D. J. Watson, et al. (2004). "Ex vivo gene therapy using targeted engraftment of NGF-expressing human NT2N neurons attenuates cognitive deficits following traumatic brain injury in mice." J Neurotrauma 21(12): 1723-36.

Loscher, W. and I. E. Leppik (2002). "Critical re-evaluation of previous preclinical

strategies for the discovery and the development of new antiepileptic drugs." Epilepsy Res 50(1-2): 17-20.

Lowenstein, P. R. (2002). "Immunology of viral-vector-mediated gene transfer into the

brain: an evolutionary and developmental perspective." Trends Immunol 23(1): 23-30.

Lundberg, C., P. Horellou, et al. (1996). "Generation of DOPA-producing astrocytes by

retroviral transduction of the human tyrosine hydroxylase gene: in vitro characterization and in vivo effects in the rat Parkinson model." Exp Neurol 139(1): 39-53.

Maheshri, N., J. T. Koerber, et al. (2006). "Directed evolution of adeno-associated virus

yields enhanced gene delivery vectors." Nat Biotechnol 24(2): 198-204. Maksimovic, I. D., M. D. Jovanovic, et al. (2002). "Effects of nerve and fibroblast growth

factors on the production of nitric oxide in experimental model of Huntington's disease." Vojnosanit Pregl 59(2): 119-23.

Margaritis, P., V. R. Arruda, et al. (2004). "Novel therapeutic approach for hemophilia

using gene delivery of an engineered secreted activated Factor VII." J Clin Invest 113(7): 1025-31.

Marsh, D. J., S. C. Baraban, et al. (1999). "Role of the Y5 neuropeptide Y receptor in

limbic seizures." Proc Natl Acad Sci U S A 96(23): 13518-23. Martinez-Serrano, A. and A. Bjorklund (1996). "Protection of the neostriatum against

excitotoxic damage by neurotrophin-producing, genetically modified neural stem cells." J Neurosci 16(15): 4604-16.

Martinez-Serrano, A. and A. Bjorklund (1997). "Immortalized neural progenitor cells for

CNS gene transfer and repair." Trends Neurosci 20(11): 530-8. Mastakov, M. Y., K. Baer, et al. (2002). "Immunological aspects of recombinant adeno-

associated virus delivery to the mammalian brain." J Virol 76(16): 8446-54. Mazarati, A., L. Lundstrom, et al. (2006). "Regulation of kindling epileptogenesis by

hippocampal galanin type 1 and type 2 receptors: The effects of subtype-selective agonists and the role of G-protein-mediated signaling." J Pharmacol Exp Ther 318(2): 700-8.

158

Mazarati, A. and C. G. Wasterlain (2002). "Anticonvulsant effects of four neuropeptides in the rat hippocampus during self-sustaining status epilepticus." Neurosci Lett 331(2): 123-7.

Mazarati, A. M. (2004). "Galanin and galanin receptors in epilepsy." Neuropeptides

38(6): 331-43. Mazarati, A. M., J. G. Hohmann, et al. (2000). "Modulation of hippocampal excitability

and seizures by galanin." J Neurosci 20(16): 6276-81. Mazarati, A. M., H. Liu, et al. (1998). "Galanin modulation of seizures and seizure

modulation of hippocampal galanin in animal models of status epilepticus." J Neurosci 18(23): 10070-7.

McBride, J. L., M. J. During, et al. (2003). "Structural and functional neuroprotection in a

rat model of Huntington's disease by viral gene transfer of GDNF." Exp Neurol 181(2): 213-23.

McCarty, D. M., H. Fu, et al. (2003). "Adeno-associated virus terminal repeat (TR)

mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo." Gene Ther 10(26): 2112-8.

McCarty, D. M., P. E. Monahan, et al. (2001). "Self-complementary recombinant adeno-

associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis." Gene Ther 8(16): 1248-54.

McCarty, D. M., S. M. Young, Jr., et al. (2004). "Integration of adeno-associated virus

(AAV) and recombinant AAV vectors." Annu Rev Genet 38: 819-45. McCown, T. J. (2004). "The clinical potential of antiepileptic gene therapy." Expert Opin

Biol Ther 4(11): 1771-6. McCown, T. J. (2006). "Adeno-associated virus-mediated expression and constitutive

secretion of galanin suppresses limbic seizure activity in vivo." Mol Ther 14(1): 63-8.

McCown, T. J., B. S. Givens, et al. (1987). "Amino acid influences on seizures elicited

within the inferior colliculus." J Pharmacol Exp Ther 243(2): 603-8. McCown, T. J., X. Xiao, et al. (1996). "Differential and persistent expression patterns of

CNS gene transfer by an adeno-associated virus (AAV) vector." Brain Res 713(1-2): 99-107.

McMenamin, M. M., T. Lantos, et al. (2004). "Neuropathological consequences of

delivering an adenoviral vector in the rat brain." J Gene Med 6(7): 740-50.

159

McPhee, S. W., C. G. Janson, et al. (2006). "Immune responses to AAV in a phase I study for Canavan disease." J Gene Med 8(5): 577-88.

Menei, P., J. M. Pean, et al. (2000). "Intracerebral implantation of NGF-releasing

biodegradable microspheres protects striatum against excitotoxic damage." Exp Neurol 161(1): 259-72.

Meyer, A., P. Chretien, et al. (1996). "Kainic acid increases the expression of the

prohormone convertases furin and PC1 in the mouse hippocampus." Brain Res 732(1-2): 121-32.

Miller, D. G., L. M. Petek, et al. (2004). "Adeno-associated virus vectors integrate at

chromosome breakage sites." Nat Genet 36(7): 767-73. Miyoshi, H., U. Blomer, et al. (1998). "Development of a self-inactivating lentivirus

vector." J Virol 72(10): 8150-7. Mizuguchi, H., Z. Xu, et al. (2000). "IRES-dependent second gene expression is

significantly lower than cap-dependent first gene expression in a bicistronic vector." Mol Ther 1(4): 376-82.

Monyer, H., R. Sprengel, et al. (1992). "Heteromeric NMDA receptors: molecular and

functional distinction of subtypes." Science 256(5060): 1217-21. Muzyczka, N. (1992). "Use of adeno-associated virus as a general transduction vector for

mammalian cells." Curr Top Microbiol Immunol 158: 97-129. Muzzin, P., R. C. Eisensmith, et al. (1997). "Hepatic insulin gene expression as treatment

for type 1 diabetes mellitus in rats." Mol Endocrinol 11(6): 833-7. Nakajima, K., K. Ikenaka, et al. (1993). "An improved retroviral vector for assaying

promoter activity. Analysis of promoter interference in pIP211 vector." FEBS Lett 315(2): 129-33.

Nakayama, K. (1997). "Furin: a mammalian subtilisin/Kex2p-like endoprotease involved

in processing of a wide variety of precursor proteins." Biochem J 327 (Pt 3): 625-35.

Nguyen, J. B., R. Sanchez-Pernaute, et al. (2001). "Convection-enhanced delivery of

AAV-2 combined with heparin increases TK gene transfer in the rat brain." Neuroreport 12(9): 1961-4.

No, D., T. P. Yao, et al. (1996). "Ecdysone-inducible gene expression in mammalian cells

and transgenic mice." Proc Natl Acad Sci U S A 93(8): 3346-51.

160

Novak, U., E. A. Harris, et al. (1990). "High-level beta-globin expression after retroviral transfer of locus activation region-containing human beta-globin gene derivatives into murine erythroleukemia cells." Proc Natl Acad Sci U S A 87(9): 3386-90.

O'Donnell, D., S. Ahmad, et al. (1999). "Expression of the novel galanin receptor subtype

GALR2 in the adult rat CNS: distinct distribution from GALR1." J Comp Neurol 409(3): 469-81.

Oiwa, Y., R. Yoshimura, et al. (2002). "Dopaminergic neuroprotection and regeneration

by neurturin assessed by using behavioral, biochemical and histochemical measurements in a model of progressive Parkinson's disease." Brain Res 947(2): 271-83.

Pardridge, W. M. (2001). "Crossing the blood-brain barrier: are we getting it right?" Drug

Discov Today 6(1): 1-2. Parker, E. M., D. G. Izzarelli, et al. (1995). "Cloning and characterization of the rat

GALR1 galanin receptor from Rin14B insulinoma cells." Brain Res Mol Brain Res 34(2): 179-89.

Parker, R. M. and H. Herzog (1999). "Regional distribution of Y-receptor subtype

mRNAs in rat brain." Eur J Neurosci 11(4): 1431-48. Passini, M. A., S. L. Macauley, et al. (2005). "AAV vector-mediated correction of brain

pathology in a mouse model of Niemann-Pick A disease." Mol Ther 11(5): 754-62.

Paterna, J. C., T. Moccetti, et al. (2000). "Influence of promoter and WHV post-

transcriptional regulatory element on AAV-mediated transgene expression in the rat brain." Gene Ther 7(15): 1304-11.

Peden, C. S., C. Burger, et al. (2004). "Circulating anti-wild-type adeno-associated virus

type 2 (AAV2) antibodies inhibit recombinant AAV2 (rAAV2)-mediated, but not rAAV5-mediated, gene transfer in the brain." J Virol 78(12): 6344-59.

Peel, A. L., S. Zolotukhin, et al. (1997). "Efficient transduction of green fluorescent

protein in spinal cord neurons using adeno-associated virus vectors containing cell type-specific promoters." Gene Ther 4(1): 16-24.

Perabo, L., J. Endell, et al. (2006). "Combinatorial engineering of a gene therapy vector:

directed evolution of adeno-associated virus." J Gene Med 8(2): 155-62. Pereira, D. J., D. M. McCarty, et al. (1997). "The adeno-associated virus (AAV) Rep

protein acts as both a repressor and an activator to regulate AAV transcription during a productive infection." J Virol 71(2): 1079-88.

161

Perez-Navarro, E., E. Arenas, et al. (1999). "Intrastriatal grafting of a GDNF-producing cell line protects striatonigral neurons from quinolinic acid excitotoxicity in vivo." Eur J Neurosci 11(1): 241-9.

Perez-Navarro, E., E. Arenas, et al. (1996). "Glial cell line-derived neurotrophic factor

protects striatal calbindin-immunoreactive neurons from excitotoxic damage." Neuroscience 75(2): 345-52.

Philippe, S., C. Sarkis, et al. (2006). "Lentiviral vectors with a defective integrase allow

efficient and sustained transgene expression in vitro and in vivo." Proc Natl Acad Sci U S A 103(47): 17684-9.

Phillips, M. I., Y. Tang, et al. (2002). "Vigilant vector: heart-specific promoter in an

adeno-associated virus vector for cardioprotection." Hypertension 39(2 Pt 2): 651-5.

Plavec, I., T. Papayannopoulou, et al. (1993). "A human beta-globin gene fused to the

human beta-globin locus control region is expressed at high levels in erythroid cells of mice engrafted with retrovirus-transduced hematopoietic stem cells." Blood 81(5): 1384-92.

Provost, N., G. Le Meur, et al. (2005). "Biodistribution of rAAV vectors following

intraocular administration: evidence for the presence and persistence of vector DNA in the optic nerve and in the brain." Mol Ther 11(2): 275-83.

Qi, J. S., J. Yao, et al. (2006). "Downregulation of tonic GABA currents following

epileptogenic stimulation of rat hippocampal cultures." J Physiol 577(Pt 2): 579-90.

Qian, J., W. F. Colmers, et al. (1997). "Inhibition of synaptic transmission by

neuropeptide Y in rat hippocampal area CA1: modulation of presynaptic Ca2+ entry." J Neurosci 17(21): 8169-77.

Qing, K. and Y. Chen (2007). "Central CART gene delivery by recombinant AAV vector

attenuates body weight gain in diet-induced-obese rats." Regul Pept 140(1-2): 21-6.

Rabinowitz, J. E., D. E. Bowles, et al. (2004). "Cross-dressing the virion: the

transcapsidation of adeno-associated virus serotypes functionally defines subgroups." J Virol 78(9): 4421-32.

Rabinowitz, J. E., F. Rolling, et al. (2002). "Cross-packaging of a single adeno-associated

virus (AAV) type 2 vector genome into multiple AAV serotypes enables transduction with broad specificity." J Virol 76(2): 791-801.

162

Racine, R. J. (1972). "Modification of seizure activity by electrical stimulation. II. Motor seizure." Electroencephalogr Clin Neurophysiol 32(3): 281-94.

Raol, Y. H., I. V. Lund, et al. (2006). "Enhancing GABA(A) receptor alpha 1 subunit

levels in hippocampal dentate gyrus inhibits epilepsy development in an animal model of temporal lobe epilepsy." J Neurosci 26(44): 11342-6.

Rattenholl, A., M. Ruoppolo, et al. (2001). "Pro-sequence assisted folding and disulfide

bond formation of human nerve growth factor." J Mol Biol 305(3): 523-33. Redrobe, J. P., Y. Dumont, et al. (1999). "Multiple receptors for neuropeptide Y in the

hippocampus: putative roles in seizures and cognition." Brain Res 848(1-2): 153-66.

Ren, G., T. Li, et al. (2007). "Lentiviral RNAi-induced downregulation of adenosine

kinase in human mesenchymal stem cell grafts: a novel perspective for seizure control." Exp Neurol 208(1): 26-37.

Richichi, C., E. J. Lin, et al. (2004). "Anticonvulsant and antiepileptogenic effects

mediated by adeno-associated virus vector neuropeptide Y expression in the rat hippocampus." J Neurosci 24(12): 3051-9.

Rivera, V. M., T. Clackson, et al. (1996). "A humanized system for pharmacologic

control of gene expression." Nat Med 2(9): 1028-32. Rivera, V. M., X. Ye, et al. (1999). "Long-term regulated expression of growth hormone

in mice after intramuscular gene transfer." Proc Natl Acad Sci U S A 96(15): 8657-62.

Rose, J. A., J. V. Maizel, Jr., et al. (1971). "Structural proteins of adenovirus-associated

viruses." J Virol 8(5): 766-70. Samulski, R. J., L. S. Chang, et al. (1987). "A recombinant plasmid from which an

infectious adeno-associated virus genome can be excised in vitro and its use to study viral replication." J Virol 61(10): 3096-101.

Samulski, R. J., L. S. Chang, et al. (1989). "Helper-free stocks of recombinant adeno-

associated viruses: normal integration does not require viral gene expression." J Virol 63(9): 3822-8.

Samulski, R. J., X. Zhu, et al. (1991). "Targeted integration of adeno-associated virus

(AAV) into human chromosome 19." Embo J 10(12): 3941-50. Sander, J. W. (1993). "Some aspects of prognosis in the epilepsies: a review." Epilepsia

34(6): 1007-16.

163

Sanftner, L. M., V. M. Rivera, et al. (2006). "Dimerizer regulation of AADC expression and behavioral response in AAV-transduced 6-OHDA lesioned rats." Mol Ther 13(1): 167-74.

Sanftner, L. M., B. M. Suzuki, et al. (2004). "Striatal delivery of rAAV-hAADC to rats

with preexisting immunity to AAV." Mol Ther 9(3): 403-9. Schiedner, G., N. Morral, et al. (1998). "Genomic DNA transfer with a high-capacity

adenovirus vector results in improved in vivo gene expression and decreased toxicity." Nat Genet 18(2): 180-3.

Schwarzer, C., N. Kofler, et al. (1998). "Up-regulation of neuropeptide Y-Y2 receptors in

an animal model of temporal lobe epilepsy." Mol Pharmacol 53(1): 6-13. Schwarzer, C., J. M. Williamson, et al. (1995). "Somatostatin, neuropeptide Y,

neurokinin B and cholecystokinin immunoreactivity in two chronic models of temporal lobe epilepsy." Neuroscience 69(3): 831-45.

Searle, P. F., G. W. Stuart, et al. (1985). "Building a metal-responsive promoter with

synthetic regulatory elements." Mol Cell Biol 5(6): 1480-9. Seidah, N. G. and M. Chretien (1999). "Proprotein and prohormone convertases: a family

of subtilases generating diverse bioactive polypeptides." Brain Res 848(1-2): 45-62.

Seki, T., H. Matsubayashi, et al. (2004). "Adenoviral gene transfer of aspartoacylase

ameliorates tonic convulsions of spontaneously epileptic rats." Neurochem Int 45(1): 171-8.

Semenza, G. L., B. H. Jiang, et al. (1996). "Hypoxia response elements in the aldolase A,

enolase 1, and lactate dehydrogenase A gene promoters contain essential binding sites for hypoxia-inducible factor 1." J Biol Chem 271(51): 32529-37.

Shafer, P. O. and C. Begley (2000). "The Human and Economic Burden of Epilepsy."

Epilepsy Behav 1(2): 91-92. Shafer, S. Q., W. A. Hauser, et al. (1988). "EEG and other early predictors of epilepsy

remission: a community study." Epilepsia 29(5): 590-600. Shen, F., Y. Fan, et al. (2008). "Adeno-associated viral vector-mediated hypoxia-

regulated VEGF gene transfer promotes angiogenesis following focal cerebral ischemia in mice." Gene Ther 15(1): 30-9.

Shen, F., H. Su, et al. (2006). "Adeno-associated viral-vector-mediated hypoxia-inducible

vascular endothelial growth factor gene expression attenuates ischemic brain injury after focal cerebral ischemia in mice." Stroke 37(10): 2601-6.

164

Shenouda, S. M., C. Johns, et al. (2006). "Long-term inhibition of the central alpha(2B)-adrenergic receptor gene via recombinant AAV-delivered antisense in hypertensive rats." Am J Hypertens 19(11): 1135-43.

Shevtsova, Z., J. M. Malik, et al. (2005). "Promoters and serotypes: targeting of adeno-

associated virus vectors for gene transfer in the rat central nervous system in vitro and in vivo." Exp Physiol 90(1): 53-9.

Siegel, A. M. (2004). "Presurgical evaluation and surgical treatment of medically

refractory epilepsy." Neurosurg Rev 27(1): 1-18; discussion 19-21. Simonato, M. and P. Romualdi (1996). "Dynorphin and epilepsy." Prog Neurobiol 50(5-

6): 557-83. Sloviter, R. S. (1991). "Permanently altered hippocampal structure, excitability, and

inhibition after experimental status epilepticus in the rat: the "dormant basket cell" hypothesis and its possible relevance to temporal lobe epilepsy." Hippocampus 1(1): 41-66.

Smith, K. E., C. Forray, et al. (1997). "Expression cloning of a rat hypothalamic galanin

receptor coupled to phosphoinositide turnover." J Biol Chem 272(39): 24612-6. Smith, K. E., M. W. Walker, et al. (1998). "Cloned human and rat galanin GALR3

receptors. Pharmacology and activation of G-protein inwardly rectifying K+ channels." J Biol Chem 273(36): 23321-6.

Song, S., M. Morgan, et al. (1998). "Sustained secretion of human alpha-1-antitrypsin

from murine muscle transduced with adeno-associated virus vectors." Proc Natl Acad Sci U S A 95(24): 14384-8.

Spencer, D. D., S. S. Spencer, et al. (1984). "Access to the posterior medial temporal lobe

structures in the surgical treatment of temporal lobe epilepsy." Neurosurgery 15(5): 667-71.

Sperk, G., J. Marksteiner, et al. (1992). "Functional changes in neuropeptide Y- and

somatostatin-containing neurons induced by limbic seizures in the rat." Neuroscience 50(4): 831-46.

Suzuki, K. and M. Taniike (1995). "Murine model of genetic demyelinating disease: the

twitcher mouse." Microsc Res Tech 32(3): 204-14. Taymans, J. M., L. H. Vandenberghe, et al. (2007). "Comparative analysis of adeno-

associated viral vector serotypes 1, 2, 5, 7, and 8 in mouse brain." Hum Gene Ther 18(3): 195-206.

165

Thomas, C. E., D. Birkett, et al. (2001). "Acute direct adenoviral vector cytotoxicity and chronic, but not acute, inflammatory responses correlate with decreased vector-mediated transgene expression in the brain." Mol Ther 3(1): 36-46.

Thompson, K., V. Anantharam, et al. (2000). "Conditionally immortalized cell lines,

engineered to produce and release GABA, modulate the development of behavioral seizures." Exp Neurol 161(2): 481-9.

Thompson, K. W. and L. M. Suchomelova (2004). "Transplants of cells engineered to

produce GABA suppress spontaneous seizures." Epilepsia 45(1): 4-12. Tobiasch, E., M. Rabreau, et al. (1994). "Detection of adeno-associated virus DNA in

human genital tissue and in material from spontaneous abortion." J Med Virol 44(2): 215-22.

Toth, P. T., V. P. Bindokas, et al. (1993). "Mechanism of presynaptic inhibition by

neuropeptide Y at sympathetic nerve terminals." Nature 364(6438): 635-9. Ure, J. A. and M. Perassolo (2000). "Update on the pathophysiology of the epilepsies." J

Neurol Sci 177(1): 1-17. Van de Ven, W. J., J. W. Creemers, et al. (1991). "Furin: the prototype mammalian

subtilisin-like proprotein-processing enzyme. Endoproteolytic cleavage at paired basic residues of proproteins of the eukaryotic secretory pathway." Enzyme 45(5-6): 257-70.

Venero, J. L., K. D. Beck, et al. (1994). "Intrastriatal infusion of nerve growth factor after

quinolinic acid prevents reduction of cellular expression of choline acetyltransferase messenger RNA and trkA messenger RNA, but not glutamate decarboxylase messenger RNA." Neuroscience 61(2): 257-68.

Vezzani, A., M. Michalkiewicz, et al. (2002). "Seizure susceptibility and epileptogenesis

are decreased in transgenic rats overexpressing neuropeptide Y." Neuroscience 110(2): 237-43.

Vezzani, A., D. Moneta, et al. (2000). "Plastic changes in neuropeptide Y receptor

subtypes in experimental models of limbic seizures." Epilepsia 41 Suppl 6: S115-21.

Vezzani, A., M. Rizzi, et al. (2000). "Modulatory role of neuropeptides in seizures

induced in rats by stimulation of glutamate receptors." J Nutr 130(4S Suppl): 1046S-8S.

Vezzani, A. and G. Sperk (2004). "Overexpression of NPY and Y2 receptors in epileptic

brain tissue: an endogenous neuroprotective mechanism in temporal lobe epilepsy?" Neuropeptides 38(4): 245-52.

166

Virella-Lowell, I., B. Zusman, et al. (2005). "Enhancing rAAV vector expression in the lung." J Gene Med 7(7): 842-50.

Walther, W. and U. Stein (1996). "Cell type specific and inducible promoters for vectors

in gene therapy as an approach for cell targeting." J Mol Med 74(7): 379-92. Wang, Y., S. Y. Tsai, et al. (2000). "An antiprogestin regulable gene switch for induction

of gene expression in vivo." Adv Pharmacol 47: 343-55. Wang, Z., H. I. Ma, et al. (2003). "Rapid and highly efficient transduction by double-

stranded adeno-associated virus vectors in vitro and in vivo." Gene Ther 10(26): 2105-11.

Woldbye, D. P., P. J. Larsen, et al. (1997). "Powerful inhibition of kainic acid seizures by

neuropeptide Y via Y5-like receptors." Nat Med 3(7): 761-4. Wood, M. J., H. M. Charlton, et al. (1996). "Immune responses to adenovirus vectors in

the nervous system." Trends Neurosci 19(11): 497-501. Wu, J., W. Zhao, et al. (2007). "Self-complementary recombinant adeno-associated viral

vectors: packaging capacity and the role of rep proteins in vector purity." Hum Gene Ther 18(2): 171-82.

Wu, Z., A. Asokan, et al. (2006). "Adeno-associated virus serotypes: vector toolkit for

human gene therapy." Mol Ther 14(3): 316-27. Xiao, W., N. Chirmule, et al. (1999). "Gene therapy vectors based on adeno-associated

virus type 1." J Virol 73(5): 3994-4003. Xiao, X., J. Li, et al. (1998). "Production of high-titer recombinant adeno-associated virus

vectors in the absence of helper adenovirus." J Virol 72(3): 2224-32. Xu, J., C. Ma, et al. (2005). "A combination of mutations enhances the neurotropism of

AAV-2." Virology 341(2): 203-14. Xu, R., C. G. Janson, et al. (2001). "Quantitative comparison of expression with adeno-

associated virus (AAV-2) brain-specific gene cassettes." Gene Ther 8(17): 1323-32.

Yalkinoglu, A. O., R. Heilbronn, et al. (1988). "DNA amplification of adeno-associated

virus as a response to cellular genotoxic stress." Cancer Res 48(11): 3123-9. Yamakura, T. and K. Shimoji (1999). "Subunit- and site-specific pharmacology of the

NMDA receptor channel." Prog Neurobiol 59(3): 279-98.

167

Yanez-Munoz, R. J., K. S. Balaggan, et al. (2006). "Effective gene therapy with nonintegrating lentiviral vectors." Nat Med 12(3): 348-53.

Yang, G. S., M. Schmidt, et al. (2002). "Virus-mediated transduction of murine retina

with adeno-associated virus: effects of viral capsid and genome size." J Virol 76(15): 7651-60.

Yao, S., M. A. Smith-White, et al. (2002). "Stabilization of the helical structure of Y2-

selective analogues of neuropeptide Y by lactam bridges." J Med Chem 45(11): 2310-8.

Ye, X., V. M. Rivera, et al. (1999). "Regulated delivery of therapeutic proteins after in

vivo somatic cell gene transfer." Science 283(5398): 88-91. Ying, Z. and I. M. Najm (2002). "Mechanisms of epileptogenicity in focal malformations

caused by abnormal cortical development." Neurosurg Clin N Am 13(1): 27-33, vii.

Yoo, Y. M., C. J. Lee, et al. (2006). "Neuroprotection of adenoviral-vector-mediated

GDNF expression against kainic-acid-induced excitotoxicity in the rat hippocampus." Exp Neurol 200(2): 407-17.

Yuan, L., I. Kurek, et al. (2005). "Laboratory-directed protein evolution." Microbiol Mol

Biol Rev 69(3): 373-92. Yue, Y. and D. Duan (2003). "Double strand interaction is the predominant pathway for

intermolecular recombination of adeno-associated viral genomes." Virology 313(1): 1-7.

Zaboikin, M. M. and F. G. Schuening (1998). "Poor expression of MDR1 transgene in

HeLa cells by bicistronic Moloney murine leukemia virus-based vector." Hum Gene Ther 9(15): 2263-75.

Zeng, G. (1998). "Sticky-end PCR: new method for subcloning." Biotechniques 25(2):

206-8. Zhang, G., Y. H. Raol, et al. (2004). "Effects of status epilepticus on hippocampal

GABAA receptors are age-dependent." Neuroscience 125(2): 299-303. Zhang, L. X., X. L. Li, et al. (1997). "Lipofectin-facilitated transfer of cholecystokinin

gene corrects behavioral abnormalities of rats with audiogenic seizures." Neuroscience 77(1): 15-22.

Zini, S., M. P. Roisin, et al. (1993). "Galanin reduces release of endogenous excitatory

amino acids in the rat hippocampus." Eur J Pharmacol 245(1): 1-7.

novel aav-mediated therapeutic strategies for epilepsy

Documents