oeb 192 – 10.09.13 “evolutionary speculation constitutes a kind of metascience, which has the...
Post on 20-Dec-2015
213 views
TRANSCRIPT
![Page 1: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/1.jpg)
OEB 192 – 10.09.13
“Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical speculation possessed for some mediaeval scholastics. It can be considered a relatively harmless habit, like eating peanuts, unless it assumes the form of an obsession; then it becomes a vice” (Stanier, 1970)
![Page 2: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/2.jpg)
Tree of Life: primary divisions
![Page 3: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/3.jpg)
Microbial systematics
• Formerly Pseudomonas (partial list): Ralstonia, Burkholderia, Hydrogenophaga, Sphingomonas, Methylobacterium, Cellvibrio, Xanthomonas, Acidovorax, Hydrogenophillus, Brevundimonas, Pandoraea
multi-C C1(& all use methanol)
![Page 4: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/4.jpg)
16S rRNA as phylogenetic marker• Why a good molecule?
70S 30S 50S
![Page 5: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/5.jpg)
Tree of Life: three “domains”• Based on 16S rRNA (Woese, 1987):
![Page 6: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/6.jpg)
Tree of Life: three “domains”• Based on 16S rRNA (Pace, 1997):
![Page 7: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/7.jpg)
Bacteria & Archaeal: all genomes as of 12 Feb., 2010
(Lee, Robinson & Marx, in prep)
![Page 8: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/8.jpg)
Tree basics: meaning
![Page 9: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/9.jpg)
Tree basics: rotation
![Page 10: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/10.jpg)
Tree basics: shape
![Page 11: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/11.jpg)
Tree basics: character change
![Page 12: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/12.jpg)
Key phylogenetic terms
![Page 13: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/13.jpg)
Key phylogenetic terms
![Page 14: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/14.jpg)
Phenetics vs. cladistics
![Page 15: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/15.jpg)
Lysozyme amino acid changes in unrelated ruminants
Phenetics vs. cladistics
![Page 16: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/16.jpg)
Maximum Parsimony• Parsimony – shortest tree (fewest homoplasies)
![Page 17: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/17.jpg)
Neutral theory• Developed by Motoo Kimura, 1968
![Page 18: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/18.jpg)
Good Dataset
[A1, A2, A3, A4] [A1, B2, A3, A4]
Bad Dataset
A B
species 1 species 2 species 3 species 4
A1B1
A2B2 A4
B4A3
B3
1. Collect Sequence DataOrtholog vs. paralog?
![Page 19: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/19.jpg)
2. Sequence Alignment
CGGATAAACCGGATAGACCGCTGATAAACCGGATAC
taxa1taxa2taxa3taxa4
Alignment
![Page 20: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/20.jpg)
Wednesday (9/15): Molecular evolution & phylogenetic inference:
case of HIV
& comment…
![Page 21: OEB 192 – 10.09.13 “Evolutionary speculation constitutes a kind of metascience, which has the same intellectual fascination for some biologists that metaphysical](https://reader034.vdocument.in/reader034/viewer/2022042821/56649d485503460f94a22d81/html5/thumbnails/21.jpg)
Upcoming talks in (microbial) evolution…
Wednesday, 9/15
11:00 AM Main Lecture HallBioLabs Building
OEB Weekly Seminar Series
Gunter WagnerYale University
Transcription factor protein evolution and the origin of evolutionary novelties
Host: Abzhanov Lab