on may 5, 2020 by guest - journal of bacteriology · 84 other staphylococcal surface-associated...
TRANSCRIPT
JB Accepts, published online ahead of print on 17 November 2014J. Bacteriol. doi:10.1128/JB.02231-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
1
Staphylococcus epidermidis SrrAB regulates bacterial growth and 1
biofilm formation differently under oxic and micro-aerobic conditions 2
3
Youcong Wu,a, b Yang Wu,a Tao Zhu,a, c Haiyan Han,a Huayong Liu,a Tao 4
Xu,a Patrice Francois,d Adrien Fischer,d Li Bai,b Friedrich Götz,e Di Qua* 5
6
Key Laboratory of Medical Molecular Virology of Ministries of Education and 7
Health, Institute of Medical Microbiology and Institutes of Biomedical Sciences, 8
Shanghai Medical College of Fudan University, 138 Yi Xue Yuan Road, 9
Shanghai 200032, Chinaa; Integrated Laboratory of Pathogenic Biology, 10
College of Preclinical Medicine, Dali University, 2 Hong Sheng Road, Dali 11
671000, Chinab; Department of Medical Parasitology, Wannan Medical 12
College, 22 West Wenchang Road, Wuhu, 241002, ChinaC; Genomic 13
Research Laboratory, Service of Infectious Diseases, University of Geneva 14
Hospitals, Rue Gabrielle-Perret-Gentil 4, Geneva, CH-1211, Switzerlandd; 15
Microbial Genetics, University of Tübingen, Auf der Morgenstelle 28, D-72076 16
Tübingen, Germanye 17
18
Running Title: Role of SrrAB in the S. epidermidis biofilm and growth 19
20
*Address correspondence to Di Qu, [email protected] 21
Y.C.W, Y.W and T.Z contributed equally to this work. 22
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
2
ABSTRACT 23
SrrAB expression in Staphylococcus epidermidis strain1457 (SE1457) was 24
up-regulated during a shift from oxic to micro-aerobic conditions. A 25
srrA-deletion mutant ( srrA) was constructed for studying the regulatory 26
function of SrrAB. The deletion resulted in retarded growth and abolished 27
biofilm formation, both in vitro and in vivo and under both oxic and 28
micro-aerobic conditions. Associated with the reduced biofilm formation, srrA 29
produced much less polysaccharide intercellular adhesion (PIA) and showed 30
decreased initial adherence capacity. Microarray analysis showed that srrA 31
mutation affected transcription of 230 genes under micro-aerobic conditions, 32
and 51 genes under oxic conditions. Quantitative real-time PCR (qRT-PCR), 33
confirmed this observation and showed down-regulation of genes involved in 34
maintaining the electron transport chain by supporting cytochrome and 35
quinol-oxidase assembly (e.g. qoxB, ctaA) and in anaerobic metabolism (e.g. 36
pflBA, nrdD). In srrA, expression of biofilm-formation related gene icaR was 37
up-regulated under oxic conditions and down-regulated under micro-aerobic 38
conditions, whereas icaA was down-regulated under both conditions. 39
Electrophoretic mobility shift assay further revealed that phosphorylated SrrA 40
bound to the promoter regions of icaR, icaA, qoxB and pflBA as well as its own 41
promoter region. These findings demonstrate that in S. epidermidis SrrAB is an 42
auto-regulator and regulates biofilm formation in an ica-dependent manner. 43
Under oxic conditions, SrrAB modulates electron transport chain activity by 44
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
3
positively regulating qoxBACD transcription. Under micro-aerobic conditions, it 45
regulates fermentation processes and DNA synthesis by modulating 46
expression of both pfl operon and nrdDG. 47
48
INTRODUCTION 49
Staphylococcus epidermidis is an opportunistic pathogen, seldom excreting 50
virulence factors and less aggressive in comparison to S. aureus, but capable 51
of forming a multilayered biofilm on implanted medical devices, such as 52
vascular catheters, prosthetic joints, and artificial heart valves, etc. (1, 2). The 53
bacteria within the biofilm are protected against killing by antibiotics and the 54
host immune system, which contributes to increasing resistance to 55
antimicrobial drugs and persistent infections (3-5). Biofilm-related infections 56
persist until the biomedical implant is removed, resulting in extra trauma and 57
cost to the patients. 58
Biofilm formation is a complicated process in staphylococci, being 59
regulated by multiple regulatory factors including Agr P2/P3, SarA, SigB and 60
two-component signal transduction systems (TCSs) (6-10). TCSs serve as a 61
basic stimulus-response coupling mechanism by which bacteria adapt the 62
environmental changes and consequently play a key role in pathogenesis 63
(11-13). Our previous study revealed that the TCSs LytSR, SaeRS, and ArlRS 64
are involved in S. epidermidis biofilm formation (14-16), whereas the role of the 65
SrrAB (staphylococcal respiratory response) remained unclear. 66
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
4
The SrrAB shares considerable homology with ResDE of B. subtilis (17, 67
18), and in S. aureus acts as a global regulator of virulence factors (SPA, 68
TSST-1, RNAIII, etc.) in response to oxygen tension (19-22). A study by 69
Yarwood et al. demonstrated that srrAB deletion (in S. aureus MN8) resulted in 70
growth reduction only under anaerobic conditions, and expression of RNAIII 71
was inversely related to expression of srrAB (20). Throup et al. found that srrA 72
deletion (in S. aureus WCUH29) led to changes in the expression of enzymes 73
involved in fermentative metabolism (e.g. alcohol dehydrogenase, L-lactate 74
dehydrogenase, NADH dehydrogenase, etc.), suggesting a role in the retarded 75
growth of S. aureus under anaerobic conditions (19). Additionally, a 76
transposon mutation in srrA resulted in reduction of biofilm formation in S. 77
aureus, although PIA production was increased, suggesting that in S. aureus 78
srrAB affects biofilm formation via an ica-independent pathway (23). 79
Development of biofilm formation has been described as a two-step 80
process involving an initial attachment, then an aggregation and maturation 81
phase (4, 8). The initial adhesion of bacterial cells to a polymer surfaces is 82
influenced by a number of factors in S. epidermidis, including AtlE, Embp, and 83
other staphylococcal surface-associated proteins (6, 7, 11). In the maturation 84
phase of biofilm development, the most important adhesive biofilm matrix is 85
PIA (polysaccharide intercellular adhesion) (12). The biosynthesis, exportation, 86
and modification of PIA are accomplished by the products of icaADBC operon, 87
and the icaA is negatively regulated by the divergently transcribed icaR gene 88
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
5
(3, 4, 24). Besides IcaR, several DNA-binding proteins regulate ica 89
transcription, including SarA, RsbU, and ArlR, etc. (10, 13, 16). However, it is 90
possible that other biofilm matrix components may be critical for 91
staphylococcal biofilm formation, such as accumulation-associated protein 92
(Aap), and extracellular DNA (eDNA), which mediated cell-cell aggregation 93
and multilayered biofilm formation (25, 26). Environmental factors (such as 94
oxygen limitation, alcohol, and NaCl, etc.) may also influence staphylococcal 95
biofilm formation (16, 27). 96
Much attention has been focused on the relevance of SrrAB as virulence 97
factors, while the mechanisms by which staphylococcal SrrAB regulates 98
biofilm formation have not been investigated in great detail. Here, we come up 99
with new aspects of the role of SrrAB in the regulatory network of biofilm 100
formation in S. epidermidis. 101
102
MATERIALS AND METHODS 103
Ethics statement. All procedures performed on rabbits were carried out 104
according to relevant national and international guidelines (the Regulations for 105
the Administration of Affairs Concerning Experimental Animals, China, and the 106
NIH Guide for the Care and Use of Laboratory Animals) and were approved by 107
the Institutional Animal Care and Use Committee (IACUC) of Shanghai 108
Medical College, Fudan University (IACUC Animal Project Number: 109
20110628-16-qu). 110
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
6
Bacterial strains, plasmids and growth conditions. The bacterial 111
strains and plasmids used in this study are listed in Table 1. S. epidermidis 112
1457 (SE1457) and S. aureus RN4220 were kindly provided by Dr. Yicun Gao 113
from Hong Kong University, S. epidermidis RP62A (accession number 114
NC_002976) (28) was purchased from the American Type Culture Collection 115
(ATCC, Manassas, USA).All staphylococci were routinely cultured in tryptone 116
soy broth (TSB; OXOID, Basingstoke, UK) or tryptone soy agar (TSA). For 117
detection of biofilm formation, S. epidermidis was cultured in TSA medium 118
supplemented with 0.5% glucose. For the transformation of recombinant 119
plasmids, B2 medium (1% casein hydrolysate, 2.5% yeast extract, 0.5% 120
glucose, 2.5% NaCl, 0.1% K2HPO4, pH 7.5) was used for the recovery of 121
staphylococcal cells after electroporation. Luria-Bertani (LB) medium was used 122
for culture of E. coli. Oxic conditions were created by incubation into a flask, in 123
which the culture medium did not exceed 15% of the flask volume, and 124
micro-aerobic conditions bacteria were incubated into a syringe fully filled with 125
medium. For static incubation under micro-aerobic conditions, polystyrene 126
plates inoculated with bacteria were placed in an anaerobic bag with 127
AnaerocultR C mini (Merck KGaA., Darmstadt, Germany). When appropriate, 128
antibiotics were used at the following concentrations: erythromycin (Em; 5 129
μg/ml), spectinomycin (Spc; 100 μg/ml), chloramphenicol (Cm; 10 μg/ml), 130
ampicillin (Am; 100 μg/ml) and kanamycin (Km; 50 μg/ml). 131
Extraction of bacterial DNA. Genomic DNA of S. epidermidis was 132
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
7
extracted as described by Flamm, et al. with minor modifications (29). In brief, 133
staphylococci cells were treated with lysostaphin (20 μg/ml, Sigma Co., St 134
Louis, MO, USA) and proteinase K (100 μg/ml, Merck KGaA, Darmstadt, 135
Germany), extracted with phenol and chloroform, and the nucleic acids were 136
precipitated with ethanol. 137
Plasmid DNA from E. coli was extracted with a plasmid purification kit 138
(Qiagen, Hilden, Germany), following manufacturers’ instructions. After 139
harvesting and re-suspension, bacterial cells were lysed under alkaline 140
conditions. The lysate was neutralized by the addition of potassium acetate. 141
The cleared lysate was loaded onto QIAGEN-tip by gravity flow, then the 142
eluted plasmid DNA was concentrated by isopropanol precipitation. Plasmid 143
DNA from S. epidermidis or S. aureus 4220 was extracted using the same 144
method except for an additional step of lysostaphin treatment. 145
Construction of S. epidermidis srrA deletion mutant and 146
complementary strains. We first characterized the S. epidermidis srrAB 147
genes in SE1457 by PCR and sequencing, and compared with that in genome 148
of ATCC 35984 strain (GenBank accession number: NC_002976). The srrA 149
gene was 726 bp and srrB was 1770 bp in length. Then, the srrA deletion 150
mutant was constructed by allelic replacement using the temperature-sensitive 151
plasmid pMAD as described previously (30). In brief, the 152
spectromycin-resistance cassette (spc, about 1kb) digested with SmaI and 153
BamHI endonucleases (MBI Fermentas, Vilnius, Lithuania) was inserted into 154
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
8
the pMAD plasmid, named as pMAD-spc (15). About 0.9-kb PCR products 155
upstream and downstream flanking region of srrA were cloned into pMAD-spc. 156
The recombinant plasmid was successively transferred into E. coli DH5α, S. 157
aureus RN4220, and then into SE1457, followed by the process of allelic 158
replacement as performed previously (15, 30). The spectinomycin-resistant 159
and erythromycin-sensitive white colonies were screened as a srrA deletion 160
mutant ( srrA). The 662-bp fragment (+4 bp- +665 bp relative to the 161
transcription start site) of srrA including REC domain and major part of 162
Trans_reg-C domain (Fig. S1) was replaced by spectinomycin-resistance 163
cassette (spc, 1029 bp). The srrA was verified by PCR and DNA sequencing 164
(Fig. S2A). In srrA, srrA expression was below the detection level, and the 165
srrB expression was down-regulated to 14% of that in the wild-type strain, as 166
detected by qRT-PCR (Fig. S2B). 167
For complementation of srrA mutant, we constructed three recombinant 168
expression plasmids containing srrA, srrB, or srrAB genes, respectively. The 169
srrA, srrB, and srrAB genes with associated shine-dalgarno sequence in 170
SE1457 were separately amplified by PCR with primers as 171
pRAB11-srrA-F/pRAB11-srrA-R, pRAB11-srrB-F/pRAB11-srrB-R and 172
pCN51-srrAB-F/pCN51-srrAB-R, respectively (sequences listed in Table 2). 173
The pRAB11-srrA was constructed from pRAB11 inserted with a fragment of 174
srrA digested with KpnI and EcoRI, pRAB11-srrB from pRAB11 inserted with a 175
fragment of srrB with KpnI and BglII digest (31), and the pCN51-srrAB was 176
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
9
made by insertion of a fragment of srrAB with BamHI and KpnI digest into 177
pCN51 (32). The complementary plasmids were transferred into S. aureus 178
RN4220, and then into srrA by electroporation, yielding three complementary 179
strains, designated as srrA(pRAB11-srrA), srrA(pRAB11-srrB) or 180
srrA(pCN51-srrAB), respectively. The vector plasmids, pRAB11 or pCN51, 181
were introduced as blank controls into srrA and named srrA(pRAB11) or 182
srrA(pCN51). 183
Growth curves of SE1457 isogenic srrA mutants. The growth curves of 184
S. epidermidis strains were determined by measuring the optical density 185
(OD600) (15). For oxic growth, overnight bacteria cultures were inoculated into 186
flasks, incubated at 37 with shaking at 220 rpm and the OD600 value of 187
cultures were measured at 60 min intervals for 12 hours. For micro-aerobic 188
growth, cultures were transferred into screw-top 50-ml syringes which were 189
completely filled with medium (with no air bubbles), and incubated under 190
vigorous agitation (220 rpm) at 37 . Two hundred microliters of bacteria in the 191
syringe were removed by syringe every hour until 18 h and the OD600 values 192
were measured. 193
Semi-quantitative detection of biofilm formation of SE1457 isogenic 194
srrA mutants in vitro. The biofilm-forming ability of S. epidermidis strains in 195
vitro was determined by semi-quantitative plate assay (14). In brief, overnight 196
cultures of SE1457, srrA, srrA(pCN51-srrAB), srrA(pRAB11-srrA) and 197
srrA(pCN51) were diluted with TSB medium containing 0.5% glucose, 198
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
10
inoculated into a polystyrene 96-well microplate (Corning Inc., NY, USA), and 199
incubated statically at 37 for 6 h, 12 h, 24 h and 48 h under oxic conditions, 200
or for 12 h, 24 h, 48 h and 72 h under micro-aerobic conditions (AnaerocultR C 201
mini, Merck KGaA., Darmstadt, Germany). After incubation, the plates were 202
washed with phosphate-buffered saline (PBS), fixed with methanol, and 203
stained with 2% crystal violet. Optical density at 570 nm was measured using a 204
spectrophotometer (Beckman Coulter DTX880, Fullerton, CA, USA). Three 205
independent experiments were carried out. 206
Detection of biofilm formation of SE1457 isogenic srrA mutants in 207
vivo. The biofilm-forming ability of S. epidermidis strains in vivo was 208
determined by using a New Zealand rabbit subcutaneous foreign body 209
infection model as described by Nianan with minor modification (33). Disks 210
were cut from polyethylene 96-well plates (8 mm diameter, 1 mm thickness, 211
with 2mm projecting rim or chimb), sterilized with 75% ethanol, and washed 212
with sterile distilled water, then disinfected by ultraviolet light. The rabbit 213
(2.0-2.5 kg, female) was anaesthetised with pentobarbital sodium (5 mg/kg, 214
i.v.), and four incisions (10 mm) were made on the back bilaterally along the 215
spine after removal of the fur, then the sub-cutis was carefully dissected to 216
form a 2 cm×3 cm cavity. After three disks was implanted into each cavity, one 217
milliliter of bacteria (about 108 cfu) suspended in fresh TSB was injected into 218
the cavity. The same volume of TSB was injected as a control. To minimize the 219
effect of between-animal variation, SE1457, srrA and srrA(pCN51-srrAB) 220
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
11
were separately injected into cavities of the same rabbit. 221
Seventy two hours after bacteria inoculation, the rabbits were euthanized 222
and the implants were taken out, washed with PBS, and observed under 223
Scanning Electron Microscopy (SEM). The biofilms were scraped from the 224
disks, and the viable bacteria were determined by CFU counting as previously 225
described (16, 33). Five independent experiments were carried out. 226
Initial adherence capacity of SE1457 isogenic srrA mutants. Primary 227
attachment of SE1457 isogenic srrA mutant strains to a polystyrene surface 228
was assessed as described by Qin, et al. (7, 15, 34) with a modification. Briefly, 229
overnight cultures of SE1457, srrA, srrA(pCN51-srrAB) and srrA(pCN51) 230
were inoculated into TSB and cultured at 37 . After growth to the OD600 value 231
of 0.6~0.8, the bacteria were adjusted to OD600 value of 0.1 with PBS, and 232
inoculated into 6-well plates (2 ml/well) (Nunc, Roskilde, Denmark). After 233
incubation at 37 for 2 h, plates were washed gently with PBS, and observed 234
under microcopy using a 40-fold objective lens. Numbers of attached cells in 235
photomicrographs (at least 5 microscopic fields per sample) were counted by 236
using ImageJ software. In addition, the adhesion capacity of SE1457 isogenic 237
srrA mutant strains was determined by crystal violet staining. Staphylococcal 238
strains grown at 37 to the OD600 value of 1.0 were pipetted into a 96-well 239
microplate (200 μl/well), incubated at 37 for 2 h, followed by washing with 240
PBS, and the subsequent procedures were the same as those used for the 241
semi-quantitative biofilm formation assay measuring OD570 using a 242
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
12
spectrophotometer. Three independent experiments were carried out. 243
Assay of PIA in biofilms of SE1457 isogenic srrA mutants. 244
Polysaccharide intercellular adhesion (PIA) in the biofilms of SE1457 isogenic 245
srrA mutant strains was semi-quantified by dot blot assay with wheat germ 246
agglutinin (WGA-HRP conjugate) as described by Gerke, et al (16, 35). In brief, 247
overnight cultures of S. epidermidis strains were inoculated into a 6-well plates 248
(Nunc, Roskilde, Denmark), and incubated at 37 for 24 h under both oxic 249
and micro-aerobic conditions (AnaerocultR C mini, Merck KGaA., Darmstadt, 250
Germany). Biofilms were scraped off from the bottom of the wells, 251
re-suspended in 0.5 M EDTA (3 μl per 1 mg wet weight) and centrifuged 252
(13,000 g, 5 min) after heating at 100 for 5 min. The supernatant was 253
treated with proteinase K (20 mg/ml) at 37 for 3 h, and inactivated at 100 254
for 5 min. Serial dilutions of the PIA extract were transferred to a nitrocellulose 255
membrane (Millipore, Billerica, MA, USA) using a 96-well dot blot device 256
(Biometra GmbH., Goettingen, Germany). The air-dried membrane was 257
blocked with 5% (wt/vol) skim milk and subsequently incubated with wheat 258
germ agglutinin (3.2 μg/ml) conjugated for 1 h with horseradish peroxidase 259
(WGA-HRP conjugate; Lectinotest Laboratory, Lviv, Ukraine). HRP activity 260
was visualized via chromogenic detection using 4-Chloride-1-naphthol (Sigma, 261
St. Louis, MO, USA) as substrate. The quantitation (titer) of PIA was 262
represented as the highest dilution of the supernatant detectable. 263
Detection of accumulation-associated protein (Aap). Aap expression 264
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
13
of SE1457 isogenic srrA mutant strains was determined by Western blot 265
analysis with an Aap specific monoclonal antibody (MAb18B6) made in our 266
laboratory (26). In brief, 24-h biofilm and 12 h-planktonic cells of S. epidermidis 267
strains were collected and adjusted to an identical OD600 value after washing 268
with PBS. The bacteria was treated with lysostaphin (Sigma, St. Louis, MO, 269
USA), and centrifuged (20,000 g) at 4 for 30 min. The supernatants were 270
separated using SDS-PAGE (7%), and blotted onto polyvinylidene fluoride 271
(PVDF) membrane (0.45 μm, Millipore, Billerica, MA, USA) by 272
electro-transferring. The membrane was incubated with MAb18B6 (10 ng/ml) 273
and then with goat anti-mouse IgG conjugated with horseradish peroxidase 274
(HRP) (Santa Cruz, CA, USA), and visualized using an ECL Western blotting 275
system (Thermo Fisher Scientific, Waltham, USA). 276
Quantification of extracellular DNA. The isolation of extracellular DNA 277
(eDNA) from biofilms was performed as described previously (15, 26). In brief, 278
the 24-h biofilms cultured in a 96-well polystyrene plate were chilled at 4 for 279
1 h, EDTA was added at a final concentration of 2.5 mM. After measurement of 280
OD600 of unwashed biofilm (biofilm biomass), eDNA extraction solution (50 mM 281
Tris-HCl, 10 mM ETDA, and 500 mM NaCl, pH 8.0) was added into the wells. 282
The biofilms were scraped off, and centrifuged (13,000 g) for 5 min at 4 . The 283
eDNA in the supernatant was extracted with phenol/chloroform/isoamyl 284
alcohol (25:24:1), precipitated with 100% alcohol, and re-suspended in TE 285
buffer. 286
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
14
The amount of eDNA was quantified by q-PCR with SYBR Premix Ex Taq 287
(Takara Bio Inc., Shiga, Japan), using gyrB (gyrase B), serp0306 (ferrichrome 288
transport ATP-binding protein A), leuA (2-isopropylmalate synthase), and lysA 289
(diaminopimelate decarboxylase A) primers as listed in Table 2. Each gene in 290
the qPCR was assayed in triplicate for three independent experiments. The 291
relative quantitation of eDNA in each sample was calculated as total eDNA (ng) 292
divided by biofilm biomass (OD600). 293
Observation of biofilms with CLSM and SEM. For observation of 294
bacterial biofilms under Confocal Laser Scanning Microscopy (CLSM, Leica 295
TCS SP5, Mannheim, Germany), overnight cultures of SE1457, srrA and 296
srrA(pCN51-srrAB) were inoculated into Fluorodishes (2 ml/dish, FD35-100, 297
WPI, Sarasota, FL, USA), and incubated statically at 37°C for 24 h (7, 26). 298
Then the biofilms on the dishes were rinsed gently with 0.85% NaCl and 299
observed under CLSM with SYTO9 and propidium iodide (PI) staining 300
(Live/Dead kit, Invitrogen, Carlsbad, CA, USA). The Z-stack composite 301
confocal photomicrographs of viable cells (green) and dead cells (red) were 302
generated using Leica LAS AF software. The fluorescence of each stack was 303
quantified using ImageJ software. At least three independent experiments 304
were carried out. 305
For observation of bacterial biofilms under Scanning Electron Microscopy 306
(SEM, JSM-6700F, JEOL, Tokyo, Japan), staphylococcal strains SE1457, 307
srrA and srrA(pCN51-srrAB) were cultured in a 6-well plate (35 mm 308
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
15
diameter) with three sterile disks (8 mm diameter, 1 mm thickness, with 2 mm 309
chimb) in each well. After 24-h incubation at 37 , disks were rinsed with PBS, 310
fixed with 2.5% glutaraldehyde in PBS, vacuum drying for 72 h, sputtered with 311
platinum, and then observed under a field emission source instrument. 312
RNA isolation and microarray analysis. Total RNA was isolated using 313
the RNeasy Mini kit (QIAGEN, Hilden, Germany) according to the 314
manufacturer’s instructions. In brief, bacterial culture in a flask for oxic 315
condition or in 50-ml syringes for micro-aerobic condition were harvested after 316
6 h incubation at 37 with shaking. The cell pellets were washed with ice-cold 317
0.85% NaCl, and then homogenized using 0.1 mm Ziconia-silica beads in a 318
Mini-Beadbeater (Biospec, Bartlesville, OK, USA) at a speed of 4800 rpm for 319
40 sec as a cycle for 5 times with 1 min intervals on ice in each cycle. The RNA 320
eluted from the silica-based filter was extracted with 321
phenol/chloroform/isoamyl alcohol and precipitated with ethanol. The quantity 322
and quality of the total RNA were assessed by using the Nanodrop ND-1000 323
spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA) and gel 324
electrophoresis. 325
Microarray analysis was performed by in situ synthesis of 14,527, 60-mer 326
long oligonucleotide probes (Agilent, Palo Alto, CA, USA) as previously 327
described by Charbonnier, et al.(15, 36), which cover more than 95% of ORFs 328
annotated in S. epidermidis strains ATCC12228 (accession number 329
NC_004461) and ATCC35984 (accession number NC_002976). Total RNAs 330
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
16
(10 μg) from SE1457 were labeled by Cyanine-3 dCTP (green Cy3, 331
Perkin-Elmer Life Sciences, Boston, MA, USA) using the SuperScript II 332
(Invitrogen, Basel, Switzerland). Purified genomic DNA from the reference 333
strains was labeled with Cyanine-5 dCTP (red Cy5) and used for microarray 334
normalization. Mixtures of Cy5-labeled DNA and Cy3-labeled cDNA were 335
hybridized and scanned in a dedicated oven as previously described (37). 336
Fluorescence intensities were quantified using Feature Extraction software 337
(Agilent, version 8). Data were normalized to baseline using red channel data 338
as control. A false discovery rate value of 5% (P value cutoff; 0.05) was used 339
for variance analysis of three biological replicates, and an arbitrary threshold of 340
3.0 fold for defining significant differences in expression ratios. The complete 341
microarray data set is posted on the Gene Expression Omnibus database, 342
available at http://www.ncbi.nlm.nih.gov/geo/, under accession numbers 343
GPL13532 for the platform design and GSE47101 for the original data set. 344
Quantitative real-time RT-PCR (qRT-PCR). The RNA extracted from 345
bacteria strains was treated with DNase I and reversely transcribed into cDNA 346
using iScript reverse transcriptase (Bio-Rad, Hercules, CA, USA) by incubation 347
for 5 min at 25 , followed by 30 min at 42 and 5 min at 85 . Then q-PCRs 348
were performed using SYBR green PCR reagents (Premix EX TaqTM, Takara 349
Biotechnology, Dalian, China) in the Mastercycler realplex system (Eppendorf 350
AG, Hamburg, Germany), with the amplification conditions as 95 for 30 sec, 351
40 cycles of 95 for 5 sec, 60 for 34 sec, followed by melting curve 352
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
17
analysis. A housekeeping gene gyrB (DNA gyrase subunit B) was used to 353
normalize the transcript levels of genes in the q-PCRs. All qRT-PCRs were 354
carried out in triplicate with at least three independent RNA samples. The 355
sequences of the primers were designed using Beacon designer software 356
(Premier Biosoft International Ltd., Pal Alto, CA, USA) and listed in Table 3. 357
Expression and purification of recombinant SrrA. To determine the 358
DNA-binding properties of SrrA, a recombinant expression plasmid 359
(pET28a-srrA) was constructed by inserting the srrA fragment amplified from 360
SE1457 with primers pET-28a-srrA-F/pET-28a-srrA-R (listed in Table 2) into 361
vector pET28a(+), and transferred into E. coli BL21 (DE3). When bacteria 362
were grown to OD600 value of 0.6 at 37 , 0.8 mM isopropyl 363
β-D-1-thiogalactopyranoside (IPTG) was added for overnight incubation at 364
22 . The cells re-suspended in lysis buffer (50 mM NaH2PO4, pH8.0, 300 mM 365
NaCl, 0.1 mM EDTA, 1 mM PMSF) were sonicated, centrifuged at 15,000 g for 366
30 min, and the supernatants were loaded onto a nickel-nitrilotriacetic acid 367
column (QIAGEN GmbH., Hilton, Germany). His-tagged SrrA was eluted using 368
a linear gradient of 20-300 mM imidazole, enriched by ultrafiltration, and the 369
protein concentration was determined using Bradford protein quantification kit 370
(TIANGEN, Beijing, China). 371
Electrophoresis Mobility Shift Assay. To determine the interaction 372
between SrrA and the promoter regions of putative target genes, 373
electrophoresis mobility shift assay (EMSA) was carried out using a digoxin gel 374
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
18
shift kit (Roche Diagnostics GmbH, Mannheim, Germany) according to the 375
manufacturer’s instructions. In brief, the predicted promoter regions of icaA, 376
icaR (approximately 80 bp fragments), srrAB, qoxB, pflB, sarA and rsbU 377
(approximately 140 bp fragments) were amplified by PCR with the primers 378
listed in Table 2. The DNA fragments were purified using a Gel Extraction Kit 379
(Qiagen, Hilton, Germany) and labeled with digoxin using terminal transferase. 380
Purified His-tagged SrrA was phosphorylated (SrrA-P) by incubating with 50 381
mM acetylphosphate (Sigma, St. Louis, MO, USA) for 1 h at room temperature. 382
Each gel shift assay included the probe labeled with digoxin plus increasing 383
concentrations of SrrA-P (ranging from 1.2 to 0.3 μM in twofold dilution), a 384
125-fold molar excess of unlabeled probe as a competitor was added into the 385
labeled probe plus 1.2 μM SrrA-P, and a labeled probe as a control. The 386
119-bp coding sequence of S. epidermidis rpsJ was designated as a negative 387
control for SrrA-DNA binding. All samples were incubated at 25 for 20 min, 388
separated by electrophoresis on 6% non-denaturing polyacrylamide gel, and 389
blotted onto a positively charged nylon membrane (Millipore, Bedford, MA, 390
USA). The blots were incubated with alkaline phosphatase conjugated 391
anti-digoxin antibody, followed by Chloro-5-substituted 392
adamantyl-1,2-dioxetane phosphate (CSPD) solution for chemiluminescent 393
detection, and exposed to X-ray film. 394
Statistical analysis. Data from the biofilm assay, initial attachment assay 395
and CFU enumeration assay were analyzed by the GraphPad Prism program 396
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
19
(San Diego, CA, USA) using the Student’s t-test. Differences with a P value 397
less than 0.05 were considered statistically significant. 398
399
RESULTS 400
The srrA displayed growth defect under oxic and micro-aerobic 401
conditions. To assess whether srrAB expression responds to oxygen stress, 402
transcription of srrAB in SE1457 was analyzed by qRT-PCR during the shift 403
fromoxic to micro-aerobic condition. Indeed, both srrA and srrB expressions 404
was up-regulated (2- or 3-fold increase) under micro-aerobic condition, 405
whereas the expression of arlRS monitored as a control showed no obvious 406
change (Fig. 1A), indicating that SrrAB displayed function differently under oxic 407
and micro-aerobic conditions. 408
The S. aureus (WCUH29) srrA mutant displayed a marked reduction in 409
growth under anaerobic conditions, whereas it showed no differences in 410
colony size or growth rate under oxic conditions compared with the parent 411
strain (19). In contrast, in this work we found that under oxic conditions 412
SE1457 srrA formed smaller colonies than parent strain, and under 413
micro-aerobic conditions, no srrA colonies were evident on TSA plates even 414
after 24-h incubation (Fig. 1B). 415
In liquid medium under oxic conditions, SE1457 entered early log phase 416
(OD600 of 0.65) by 4 h after inoculation, but srrA took about 6 h to reach a 417
similar growth level (OD600 of 0.74). Growth of the srrAB complementation 418
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
20
strain srrA(pCN51-srrAB) was restored to the wild-type level, whereas growth 419
of the srrA complementation strain srrA(pRAB11-srrA) was partially 420
recovered. Under micro-aerobic conditions, to reach OD600 1.0 srrA needed 421
15-h incubation, while the parent strain needed only 7 h. The complementation 422
strains srrA(pCN51-srrAB) and srrA(pRAB11-srrA) required 6-h or 9-h 423
incubation respectively to reach an OD600 of 1.0 (Fig. 1C). Under either oxic or 424
micro-aerobic conditions, transformation of pCN51 or pRAB11-srrB had no 425
effect on srrA growth.426
Deletion of srrA impaired biofilm development in vitro. The impact of 427
srrA deletion on the biofilm formation of S. epidermidis in vitro was investigated 428
by a semi-quantitative micro-plate assay. Bacterial biofilm formation was 429
monitoredat 6 h, 12 h, 24 h and 48 h under oxic conditions, or 12 h, 24 h, 48 h 430
and 72 h under micro-aerobic conditions. 431
Under oxic conditions, srrA also produced less biofilm than the parent 432
strain at the above time points, whereas the biofilm of srrA(OD570=0.61±0.03) 433
was dramatically decreased compared to wild-type strain (OD570=2.65±0.08) 434
(Fig. 2A, B). Under micro-aerobic conditions, no biofilm formation was 435
observed in srrA at 12 h or 24 h. After 48 h incubation, biofilm produced by 436
srrA had OD570=0.25±0.02, significantly less than its wild-type counterpart 437
(OD570=0.93±0.04) (Fig. 2A, C). 438
Under both oxic and micro-aerobic conditions, the biofilm-forming ability 439
was restored in the complementation strain srrA(pCN51-srrAB) 440
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
21
(OD570=1.93±0.14, 0.95±0.11 respectively), and partially restored in 441
srrA(pRAB11-srrA) (OD570=1.13±0.03, 0.67±0.02). Transformation of the 442
vector alone had no effect on srrA biofilm formation. 443
When biofilms of SE1457, srrA and srrA(pCN51-srrAB) that had been 444
cultured under oxic conditions were observed under CLSM with live/dead 445
staining, the thickness of srrA biofilm was much less (5.97±0.34 μm) than that 446
of the parent strain (22.2±2.06 μm) (p<0.01), and the thickness was restored 447
by complementation with pCN51-srrAB (10.16±1.51 μm). There were more 448
dead cells in srrA biofilm than in wild-type counterpart (PI/Total=0.23 versus 449
0.072, p<0.01), whereas fewer dead cells were observed in 450
srrA(pCN51-srrAB) biofilm (PI/Total= 0.017) (Fig. 3). 451
Deletion of srrA abolished biofilm formation in vivo. To determine 452
whether srrA deletion had an impact on in-vivo biofilm formation, a rabbit 453
subcutaneous foreign body infection model was used. Staphylococcal strains 454
(108 CFU) were injected into the cavities with implanted polystyrene disks on 455
the animal’s back. After 72 h, biofilm on the disks was observed under SEM. 456
SE1457 formed a compact biofilm covered with secreted substance on the 457
implanted disks, while srrA formed only a few bacterial clusters. The amount 458
of biofilm produced by complementation strain srrA(pCN51-srrAB) was 459
similar to that of the wild-type strain (Fig. 4A). The viable bacterial cells in 460
srrA biofilm formed in vivo (CFU=8.82×103) were significantly fewer than that 461
in those of SE1457 (CFU=5.49×104) (p<0.01) and srrA(pCN51-srrAB) 462
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
22
(CFU=6.14×104) (Fig. 4B). 463
Deletion of srrA diminished initial attachment of S. epidermidis. 464
Biofilm formation by S. epidermidis is generally a two-step process involving 465
an initial attachment and a subsequent maturation phase. The initial 466
attachment of srrA to polystyrene plates was determined by using ImageJ 467
software. Attached cells of srrA(about 1.35×103per field) were 3.4 fold less 468
than those of the parent strain (about 4.54×103per field) and of the 469
complementation strain srrA(pCN51-srrAB) (about 5.61×103) (Fig. 5A), and 470
this was confirmed by crystal violet staining with measurement at OD570 (Fig. 471
5B). 472
Deletion of srrA affected the biofilm matrix production in S. 473
epidermidis. To investigate the effect of srrA deletion on the biofilm matrix 474
production, the release of PIA, eDNA, and Aap were determined in SE1457, 475
srrA, srrA(pCN51-srrAB) and srrA(pCN51). PIA, a major factor affecting 476
biofilm accumulation, was detected semi-quantitatively with WGA-HRP. Under 477
both oxic and micro-aerobic conditions, srrA and the vector control strain 478
srrA(pCN51) produced less PIA than either SE1457 or the complementation 479
strain srrA(pCN51-srrAB)(Fig. 6A). No differences of Aap expression in 480
biofilms or planktonic cells of SE1457, srrA and srrA(pCN51-srrAB) were 481
detected by Western Blot with monoclonal antibody (18B6) against Aap protein 482
B repeat region (Fig. 6B). The relative concentrations of eDNA in 24-h biofilms 483
of srrA and vector control strain srrA(pCN51) were about 5-fold higher than 484
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
23
that of either the parent strain SE1457 (p<0.01) or the complementation strain 485
srrA(pCN51-srrAB), as shown in Fig. 6C. 486
In srrA transcriptional profile was severely altered compared to the 487
wild-type strain. DNA microarray was used to compare transcriptional profiles 488
of SE1457 and srrA under oxic or micro-aerobic conditions. Under 489
micro-aerobic conditions, 230 differentially expressed genes were found, 490
which were involved in respiratory and energy metabolism, biofilm formation, 491
and cell wall biosynthesis, etc. Among them, 118 genes were up-regulated and 492
112 were down-regulated in srrA. The latter included genes involved in 493
cytochrome and quinol-oxidase biosynthesis and assembly (e.g., qoxACD, 494
ctaAB, atpC), as well as anaerobic metabolism related genes such as pflBA 495
(formate acetyltransferase), nrdD (anaerobic ribonucleoside triphosphate 496
reductase), serp0257 (alcohol dehydrogenase), serp2257 (acetoin reductase), 497
serp2133 (D-lactate dehydrogenase), serp2381 (NADH: flavin 498
oxidoreductase/fumarate reductase flavoprotein subunit) (Table 4). Under oxic 499
conditions the srrA mutation affected expression of 51 genes; 33 genes were 500
up-regulated and 18 genes down-regulated. Similar to findings under 501
micro-aerobic conditions, down regulation was observed in respiratory and 502
energy metabolism related genes, including srrA, serp2324 (branched-chain 503
alpha-keto acid dehydrogenase subunit E2), serp2327 (acetoin 504
dehydrogenase, E3 component, dihydrolipoamide dehydrogenase), serp2379 505
(acetoindiacetyl reductase), ppdK (pyruvate phosphate dikinase), and nrdDG. 506
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
24
Protein synthesis related genes, including rpsORTD and rplNS were 507
up-regulated (Table 5). These results were confirmed by qRT-PCR, and 508
suggested that retarded growth may result from low expression levels of the 509
genes involved in the respiratory electron transport chain and anaerobic 510
metabolism. 511
Transcription levels of biofilm-related genes were also confirmed by 512
qRT-PCR. Compared to SE1457, icaR in srrA was down-regulated 3.1-fold 513
under micro-aerobic conditions, while up-regulated 5.1-fold under oxic 514
conditions. The transcription levels of icaA and atlE in srrA were 515
down-regulated about 10-fold and 5-fold respectively under micro-aerobic 516
conditions, and 8-fold and 4-fold under oxic conditions. In addition, no 517
significant difference in the expression of rsbU, sarA and aap was detected by 518
qRT-PCR between the SE1457 and srrA mutant under either condition (Table 519
4, 5). 520
Binding of recombinant SrrA protein to the putative promoter 521
regions. To further study the regulation role of SrrAB in the biofilm formation, 522
EMSA was carried out with digoxin-labeled putative promoter regions and 523
recombinant SrrA (His-tagged SrrA). The 132 bp DNA fragment upstream of 524
srr (p-srr) formed a shifted complex with phosphorylated SrrA (SrrA-P) in a 525
dose-dependent manner, but not with un-phosphorylated SrrA (Fig. 7A, B, lane 526
2 to lane 4). Addition of 125-fold excess of unlabeled p-srr as a specific 527
competitor blocked SrrA-DIG-DNA complex formation (Fig. 7B, lane 5). 528
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
25
SrrA-P resulted in a mobility shift of the 82-bp, 85-bp, 145-bp, or 151-bp 529
fragments upstream of icaR, icaA, qoxB, or pflB, respectively (Fig. 7C, D, E 530
and F). SrrA-P did not bind to the fragment upstream of sarA and rsbU (Fig. 7G, 531
H). As a negative control, a 119-bp DNA fragment of rpsJ gene did not form a 532
complex with Srr-P under the same conditions (Fig. 7I).The results indicated 533
that SrrA-P was able to bind specifically to the promoter regions of certain 534
biofilm-related genes as well as some genes involved in respiratory 535
metabolism. 536
537
DISCUSSION 538
SrrAB in S. aureus modulates biofilm formation and expression of virulence 539
factors (such as tst, spa, agr and ica, etc.) under oxic and anaerobic conditions 540
(20-22, 38-40). However, the role of SrrAB in regulation of S. epidermidis 541
biofilm formation and growth is not clear. In this study, we firstly compared 542
protein sequence of SrrA in S. epidermidis strain 1457 with that in S. aureus 543
strain COL. They shared 90.5% identity (Fig. S1A). SE1457 srrA and srrB 544
were oriented in tandem and overlapped by 20 nucleotides. srrAB forms an 545
operon with a putative promoter upstream of srrA and a transcription 546
terminator structure 547
(ATATATGAAAAACGCCTGCGACTCAGAGTGATGTCTCAGGCGTTTTTTTG548
TATATA) located at 81 bp downstream of srrB translational stop codon. By 549
RT-PCR a single mRNA covering srrAB was verified (Fig. S1B). Then we 550
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
26
found that oxygen limitation induced the expression of srrAB in S. epidermidis, 551
while stressors such as vancomycin, ethanol or high NaCl had no effect (Fig. 552
S3). This indicated that SrrAB of S. epidermidiss electively responds to 553
micro-aerobic stress. 554
To study the role of SrrAB in regulating biofilm formation and growth of S. 555
epidermidis, a srrA deletion mutant ( srrA) from SE1457 was constructed. 556
srrA exhibited impaired biofilm formation and delayed growth under both oxic 557
and micro-aerobic conditions, which was restored by complementation with 558
srrAB. A double genes deletion mutant, srrAB was constructed, and showed 559
similar phenotypes to srrA. It demonstrates that SrrAB regulates S. 560
epidermidis growth under both oxic and micro-aerobic conditions. However, in 561
S. aureus, srrAB regulated bacterial growth only under anaerobic conditions 562
(20-22, 38), suggesting that the role of SrrAB in the growth of S. epidermidis is 563
different from that in S. aureus. Then we further analyzed transcriptional profile 564
by microarray and qRT-PCR, it revealed that the mRNA levels of qoxBACD, 565
ctaA, pflBA, nrdDG, etc. were significantly reduced in the srrA mutant 566
compared to the parent strain (Table 4, 5). 567
The qoxBACD operon encodes the aa3-type quinol oxidase, one of the 568
two terminal oxidases in S. aureus. Terminal oxidases deficiency usually 569
results in an inability to respire and a severe growth defect in bacteria. 570
Hammer et al. (41) found that a double mutant lacking both qoxB and cydB 571
showed signi cantly reduced aerobic growth and a small-colony variant (SCVs) 572
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
27
phenotype, indicating that the mutant was unable to respire aerobically. Similar 573
results were found by Kinkel et al. (42): the qoxBACD mutant exhibited a 574
modest growth defect under aerobic condition, and either srrAB or qoxBACD 575
mutant strains were unable to reach maximal final cell density. In the present 576
study, expression of qoxBACD operon in srrA was down-regulated, and SrrA 577
was able to bind the promoter region of qoxBACD (Fig.7). Therefore, we 578
speculated that the aerobic growth retardation of the S. epidermidis srrA 579
mutant may have resulted from down-regulation of qoxBACD operon impairing 580
respiratory chain reaction. 581
Under anaerobic conditions, expression levels of pflBA operon and nrdDG 582
were reported highly induced in S. aureus (43, 44). PflA is an activating 583
enzyme of PflB, a pyruvate formatelyase that catalyzes the reversible 584
conversion of pyruvate to formate, thereby producing acetyl coenzyme A 585
(acetyl-CoA). Thus, pflBA operon is important for energy supply when pyruvate 586
is available and favors the growth of cells under fermentation conditions (45). 587
The protein encoded by nrdDG is a class III ribonucleotide reductase that 588
catalyzes synthesis of dNTPs via reduction of NTPs under anaerobic 589
conditions (17, 42, 46). In this study, under micro-aerobic condition, srrA of S. 590
epidermidis displayed severe growth retardation and inability to reach maximal 591
final cell density, which may be related with down-regulation of pflBA and 592
nrdDG expression, and subsequent decrease of fermentation and DNA 593
replication. Additionally, SrrA was able to bind the promoter region of pflBA 594
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
28
(Fig.7). It indicates that under micro-aerobic condition, SrrAB regulates S. 595
epidermidis growth via pflBA (Fig. 8). 596
Besides its effect on bacterial growth, SrrAB regulates S. aureus biofilm 597
formation (22, 39, 42). In the present study, srrA deletion resulted in decrease 598
of S. epidermidis biofilm formation under both oxic and micro-aerobic 599
conditions. Although under oxic condition srrA needed two more hours to 600
enter stationary phase than wild-type strain (Fig. 1), the optical density of the 601
two strains was similar after entering stationary phase (Fig. S4). This indicates 602
that under oxic conditions decreased biofilm formation by the srrA mutant 603
may not be directly related to growth defects. Nevertheless, under 604
micro-aerobic conditions, where the biofilm formed by srrA was less than that 605
by SE1457, and srrA was unable to reach the optical density as high as 606
SE1457 even if the culture time was extended to 48 h (Fig. 2A, C). This 607
suggests that under micro-aerobic conditions, an effect of growth retardation 608
on decreased biofilm formation in srrA mutant cannot be excluded. 609
Then, we further analyzed the possible mechanism that led to biofilm 610
reduction in S. epidermidis srrA. The initial adherence, as a crucial step of 611
biofilm formation, was decreased in srrA (Fig. 5), which indicated that SrrAB 612
participated in the early stage of biofilm development. PIA production, which is 613
regarded as the most important intercellular adherence factor and glue in the 614
accumulation stage of biofilm formation in staphylococci (4, 9), was decreased 615
in srrA compared to the parent strain, especially under micro-aerobic 616
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
29
condition (Fig. 6). In S. aureus srrA transposon mutant, PIA synthesis was 617
increased while biofilm formation was decreased (23). It suggests that the 618
mechanisms of biofilm formation regulated by SrrAB in S. epidermidis differ 619
from those of S. aureus. 620
In S. aureus, SrrAB regulate biofilm formation via IcaR, a repressor of ica 621
operon. Under aerobic conditions, S. aureus SrrAB decreased biofilm 622
formation through up-regulating icaR expression, while enhanced biofilm 623
formation through down-regulating icaR expression under micro-aerobic 624
conditions (39). In this study, it was found that transcription of icaR was 625
up-regulated in S. epidermidis srrA under oxic conditions, whereas 626
down-regulated under micro-aerobic conditions; icaA expression was 627
down-regulated under both conditions. Under oxic conditions, S. epidermidis 628
SrrAB positively regulated icaADBC expression and down-regulated icaR 629
expression which is correlated with PIA production and biofilm formation. 630
Under micro-aerobic conditions, transcription of both icaR and icaADBC in 631
srrA were down regulated, and PIA synthesis was decreased. We 632
demonstrated that phosphorylated SrrA of S. epidermidis bound to the 633
promoter regions of icaR, icaA. It suggests that S. epidermidis SrrAB response 634
to oxygen variation to modulate biofilm formation in an ica-dependent pathway 635
(Fig. 8). 636
Other intercellular matrix components may play important role in the 637
biofilm formation. Extracellular DNA (eDNA) is released following bacterial 638
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
30
autolysis (7, 15). The amount of eDNA within srrA biofilm was more than that 639
in parent strain. The percentage of dead cells in srrA biofilm was much higher 640
than that in the parent strain biofilm, although there was no difference between 641
srrA and SE1457 in cell viability in planktonic conditions or TritonX-100 642
induced autolysis (Fig. S5). Kinkel et al. (42) demonstrated that the srrAB 643
mutant of S. aureus UAMS-1 had reduced capacity to form biofilm under static 644
aeration conditions and its biofilm contained significantly more dead cells than 645
the wild-type biofilm, and this was correlated with the loss of its structural 646
integrity. It has been reported that pflBA was up-regulated in the deeper layer 647
of the biofilm, which may be related with the survival of biofilm cells in that 648
place (45). In the present study, transcription of pfl operon was down-regulated 649
in the srrA mutant of S. epidermidis, which maybe associated with the 650
increased proportion of dead cells found in srrA biofilm. 651
In summary, S. epidermidis SrrAB responds to micro-aerobic stress and 652
modulates biofilm formation in an ica-dependent manner. The mechanism that 653
SrrAB regulates bacterial growth varies with environmental oxygen 654
concentration: under oxic conditions, SrrAB modulates respiratory chain 655
reaction by positively regulating qoxBACD transcription, while under 656
micro-aerobic conditions it regulates fermentation processes and DNA 657
replication via pfl operon and nrdDG (Fig. 8). It provided a new insight into the 658
SrrAB mediated regulation of biofilm formation and growth of S. epidermidis. 659
660
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
31
ACKNOWLEDGEMENTS 661
We thank Prof. Caiguang Yang and Dr. Xing Liu from Chinese Academy of 662
Sciences for assistance with gel shift reactions. We also thank Prof. Li Chen 663
from Shanghai Medical College of Fudan University for helpful discussion. 664
This work was supported by the National Science and Technology Major 665
Project of China [2012ZX09301002-005, 2012ZX10003008-010], the National 666
Natural Science Foundation of China (No. 81271791, 81101214) and 667
Deutsche Forschungsgemeinschaft SFB766. 668
669
670
REFERENCES 671
1. Maduka-Ezeh AN, Greenwood-Quaintance KE, Karau MJ, Berbari EF, Osmon 672
DR, Hanssen AD, Steckelberg JM, Patel R. 2012. Antimicrobial susceptibility and 673
biofilm formation of Staphylococcus epidermidis small colony variants associated 674
with prosthetic joint infection. Diagn Microbiol Infect Dis 74:224-229. 675
2. Götz F, Peters G: 2000.Colonization of medical devices by coagulase-negative 676
staphylococci. In: Infections associated with indwelling medical devices. Edited by 677
Waldvogel FA, Bisno AL, 3rd edition edn. Washington, D.C.: ASM: 55 - 88. 678
3. Otto M. 2008. Staphylococcal biofilms. Curr Top Microbiol Immunol 322:207-228. 679
4. Götz F. 2002. Staphylococcus and biofilms. Molecular Microbiology 43:1367-1378. 680
5. Dunne WM, Jr. 2002. Bacterial adhesion: seen any good biofilms lately? Clin 681
Microbiol Rev 15:155-166. 682
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
32
6. Rupp ME, Fey PD, Heilmann C, Götz F. 2001. Characterization of the importance of 683
Staphylococcus epidermidis autolysin and polysaccharide intercellular adhesin in the 684
pathogenesis of intravascular catheter-associated infection in a rat model. J Infect 685
Dis 183:1038-1042. 686
7. Qin Z, Ou Y, Yang L, Zhu Y, Tolker-Nielsen T, Molin S, Qu D. 2007. Role of 687
autolysin-mediated DNA release in biofilm formation of Staphylococcus epidermidis. 688
Microbiology 153:2083-2092. 689
8. Otto M. 2012. Staphylococcal Infections: Mechanisms of Biofilm Maturation and 690
Detachment as Critical Determinants of Pathogenicity. Annu Rev Med. 691
9. Periasamy S, Joo HS, Duong AC, Bach TH, Tan VY, Chatterjee SS, Cheung GY, 692
Otto M. 2012. How Staphylococcus aureus biofilms develop their characteristic 693
structure. Proc Natl Acad Sci U S A 109:1281-1286. 694
10. Knobloch JK, Bartscht K, Sabottke A, Rohde H, Feucht HH, Mack D. 2001. 695
Biofilm formation by Staphylococcus epidermidis depends on functional RsbU, an 696
activator of the sigB operon: differential activation mechanisms due to ethanol and 697
salt stress. J Bacteriol 183:2624-2633. 698
11. Heilmann C, Hussain M, Peters G, Götz F. 1997. Evidence for autolysin-mediated 699
primary attachment of Staphylococcus epidermidis to a polystyrene surface. 700
Molecular Microbiology 24:1013-1024. 701
12. Olson ME, Garvin KL, Fey PD, Rupp ME. 2006. Adherence of Staphylococcus 702
epidermidis to biomaterials is augmented by PIA. Clin Orthop Relat Res 451:21-24. 703
13. Tormo MA, Marti M, Valle J, Manna AC, Cheung AL, Lasa I, Penades JR. 2005. 704
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
33
SarA is an essential positive regulator of Staphylococcus epidermidis biofilm 705
development. J Bacteriol 187:2348-2356. 706
14. Zhu T, Lou Q, Wu Y, Hu J, Yu F, Qu D. 2010. Impact of the Staphylococcus 707
epidermidis LytSR two-component regulatory system on murein hydrolase activity, 708
pyruvate utilization and global transcriptional profile. BMC Microbiol 10:287. 709
15. Lou Q, Zhu T, Hu J, Ben H, Yang J, Yu F, Liu J, Wu Y, Fischer A, Francois P, 710
Schrenzel J, Qu D. 2011. Role of the SaeRS two-component regulatory system in 711
Staphylococcus epidermidis autolysis and biofilm formation. BMC Microbiol 11:146. 712
16. Wu Y, Wang J, Xu T, Liu J, Yu W, Lou Q, Zhu T, He N, Ben H, Hu J, Götz F, Qu D. 713
2012. The two-component signal transduction system ArlRS regulates 714
Staphylococcus epidermidis biofilm formation in an ica-dependent manner. PLoS 715
One 7:e40041. 716
17. Sun G, Sharkova E, Chesnut R, Birkey S, Duggan MF, Sorokin A, Pujic P, 717
Ehrlich SD, Hulett FM. 1996. Regulators of aerobic and anaerobic respiration in 718
Bacillus subtilis. J Bacteriol 178:1374-1385. 719
18. Nakano MM, Zuber P, Glaser P, Danchin A, Hulett FM. 1996. Two-component 720
regulatory proteins ResD-ResE are required for transcriptional activation of fnr upon 721
oxygen limitation in Bacillus subtilis. J Bacteriol 178:3796-3802. 722
19. Throup JP, Zappacosta F, Lunsford RD, Annan RS, Carr SA, Lonsdale JT, 723
Bryant AP, McDevitt D, Rosenberg M, Burnham MK. 2001. The srhSR gene pair 724
from Staphylococcus aureus: genomic and proteomic approaches to the identification 725
and characterization of gene function. Biochemistry-Us 40:10392-10401. 726
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
34
20. Yarwood JM, McCormick JK, Schlievert PM. 2001. Identification of a novel 727
two-component regulatory system that acts in global regulation of virulence factors of 728
Staphylococcus aureus. J Bacteriol 183:1113-1123. 729
21. Pragman AA, Yarwood JM, Tripp TJ, Schlievert PM. 2004. Characterization of 730
virulence factor regulation by SrrAB, a two-component system in Staphylococcus 731
aureus. J Bacteriol 186:2430-2438. 732
22. Ulrich M, Bastian M, Cramton SE, Ziegler K, Pragman AA, Bragonzi A, Memmi G, 733
Wolz C, Schlievert PM, Cheung A, Döring G. 2007. The staphylococcal respiratory 734
response regulator SrrAB induces ica gene transcription and polysaccharide 735
intercellular adhesin expression, protecting Staphylococcus aureus from neutrophil 736
killing under anaerobic growth conditions. Molecular Microbiology 65:1276-1287. 737
23. Tu Quoc PH, Genevaux P, Pajunen M, Savilahti H, Georgopoulos C, Schrenzel J, 738
Kelley WL.2007. Isolation and characterization of biofilm formation-defective mutants 739
of Staphylococcus aureus. Infect Immun 75:1079-1088. 740
24. Cerca N, Brooks JL, Jefferson KK. 2008. Regulation of the intercellular adhesin 741
locus regulator (icaR) by SarA, sigmaB, and IcaR in Staphylococcus aureus. J 742
Bacteriol 190:6530-6533. 743
25. Rohde H, Burdelski C, Bartscht K, Hussain M, Buck F, Horstkotte MA, Knobloch 744
JK, Heilmann C, Herrmann M, Mack D. 2005. Induction of Staphylococcus 745
epidermidis biofilm formation via proteolytic processing of the 746
accumulation-associated protein by staphylococcal and host proteases. Molecular 747
Microbiology 55:1883-1895. 748
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
35
26. Hu J, Xu T, Zhu T, Lou Q, Wang X, Wu Y, Huang R, Liu J, Liu H, Yu F, Ding B, 749
Huang Y, Tong W, Qu D. 2011. Monoclonal antibodies against 750
accumulation-associated protein affect EPS biosynthesis and enhance bacterial 751
accumulation of Staphylococcus epidermidis. PLoS One 6:e20918. 752
27. Christner M, Heinze C, Busch M, Franke G, Hentschke M, Bayard Duhring S, 753
Buttner H, Kotasinska M, Wischnewski V, Kroll G, Buck F, Molin S, Otto M, 754
Rohde H. 2012. sarA negatively regulates Staphylococcus epidermidis biofilm 755
formation by modulating expression of 1 MDa extracellular matrix binding protein and 756
autolysis-dependent release of eDNA. Molecular Microbiology 86:394-410. 757
28. Gill SR, Fouts DE, Archer GL, Mongodin EF, Deboy RT, Ravel J, Paulsen IT, 758
Kolonay JF, Brinkac L, Beanan M, Dodson RJ, Daugherty SC, Madupu R, 759
Angiuoli SV, Durkin AS, Haft DH, Vamathevan J, Khouri H, Utterback T, Lee C, 760
Dimitrov G, Jiang L, Qin H, Weidman J, Tran K, Kang K, Hance IR, Nelson KE, 761
Fraser CM. 2005. Insights on evolution of virulence and resistance from the complete 762
genome analysis of an early methicillin-resistant Staphylococcus aureus strain and a 763
biofilm-producing methicillin-resistant Staphylococcus epidermidis strain. J Bacteriol 764
187:2426-2438. 765
29. Flamm RK, Hinrichs DJ, Thomashow MF. 1984. Introduction of pAM beta 1 into 766
Listeria monocytogenes by conjugation and homology between native L. 767
monocytogenes plasmids. Infect Immun 44:157-161. 768
30. Arnaud M, Chastanet A, Debarbouille M. 2004. New vector for efficient allelic 769
replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. 770
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
36
Appl Environ Microbiol 70:6887-6891. 771
31. Helle L, Kull M, Mayer S, Marincola G, Zelder ME, Goerke C, Wolz C, Bertram R. 772
2011. Vectors for improved Tet repressor-dependent gradual gene induction or 773
silencing in Staphylococcus aureus. Microbiology 157:3314-3323. 774
32. Charpentier E, Anton AI, Barry P, Alfonso B, Fang Y, Novick RP. 2004. Novel 775
cassette-based shuttle vector system for gram-positive bacteria. Appl Environ 776
Microbiol 70:6076-6085. 777
33. He N, Hu J, Liu H, Zhu T, Huang B, Wang X, Wu Y, Wang W, Qu D. 2011. 778
Enhancement of vancomycin activity against biofilms by using ultrasound-targeted 779
microbubble destruction. Antimicrob Agents Chemother 55:5331-5337. 780
34. Liu Q, Fan J, Niu C, Wang D, Wang J, Wang X, Villaruz AE, Li M, Otto M, Gao Q. 781
2011. The eukaryotic-type serine/threonine protein kinase Stk is required for biofilm 782
formation and virulence in Staphylococcus epidermidis. PLoS One 6:e25380. 783
35. Gerke C, Kraft A, Sussmuth R, Schweitzer O, Götz F. 1998. Characterization of 784
the N-acetylglucosaminyltransferase activity involved in the biosynthesis of the 785
Staphylococcus epidermidis polysaccharide intercellular adhesin. J Biol Chem 786
273:18586-18593. 787
36. Charbonnier Y, Gettler B, Francois P, Bento M, Renzoni A, Vaudaux P, Schlegel 788
W, Schrenzel J. 2005. A generic approach for the design of whole-genome 789
oligoarrays, validated for genomotyping, deletion mapping and gene expression 790
analysis on Staphylococcus aureus. BMC Genomics 6:95. 791
37. Scherl A, Francois P, Charbonnier Y, Deshusses JM, Koessler T, Huyghe A, 792
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
37
Bento M, Stahl-Zeng J, Fischer A, Masselot A, Vaezzadeh A, Galle F, Renzoni A, 793
Vaudaux P, Lew D, Zimmermann-Ivol CG, Binz PA, Sanchez JC, Hochstrasser 794
DF, Schrenzel J. 2006. Exploring glycopeptide-resistance in Staphylococcus aureus: 795
a combined proteomics and transcriptomics approach for the identification of 796
resistance-related markers. BMC Genomics 7:296. 797
38. Pragman AA, Herron-Olson L, Case LC, Vetter SM, Henke EE, Kapur V, 798
Schlievert PM. 2007. Sequence analysis of the Staphylococcus aureus srrAB loci 799
reveals that truncation of srrA affects growth and virulence factor expression. J 800
Bacteriol 189:7515-7519. 801
39. Pragman AA, Ji YD, Schlievert PM. 2007. Repression of Staphylococcus aureus 802
SrrAB using inducible antisense srrA alters growth and virulence factor transcript 803
levels. Biochemistry-Us 46:314-321. 804
40. Cramton SE, Ulrich M, Götz F, Doring G. 2001. Anaerobic conditions induce 805
expression of polysaccharide intercellular adhesin in Staphylococcus aureus and 806
Staphylococcus epidermidis. Infect Immun 69:4079-4085. 807
41. Hammer ND, Reniere ML, Cassat JE, Zhang Y, Hirsch AO, Indriati Hood M, 808
Skaar EP. 2013. Two heme-dependent terminal oxidases power Staphylococcus 809
aureus organ-specific colonization of the vertebrate host. MBio 4. 810
42. Kinkel TL, Roux CM, Dunman PM, Fang FC. 2013. The Staphylococcus aureus 811
SrrAB two-component system promotes resistance to nitrosative stress and hypoxia. 812
MBio 4:e00696-00613. 813
43. Fuchs S, Pane-Farre J, Kohler C, Hecker M, Engelmann S. 2007. Anaerobic gene 814
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
38
expression in Staphylococcus aureus. J Bacteriol 189:4275-4289. 815
44. Masalha M, Borovok I, Schreiber R, Aharonowitz Y, Cohen G. 2001. Analysis of 816
transcription of the Staphylococcus aureus aerobic class Ib and anaerobic class III 817
ribonucleotide reductase genes in response to oxygen. J Bacteriol 183:7260-7272. 818
45. Leibig M, Liebeke M, Mader D, Lalk M, Peschel A, Gotz F. 2011. Pyruvate formate 819
lyase acts as a formate supplier for metabolic processes during anaerobiosis in 820
Staphylococcus aureus. J Bacteriol 193:952-962. 821
46. Roca I, Ballana E, Panosa A, Torrents E, Gibert I. 2008. Fumarate and nitrate 822
reduction (FNR) dependent activation of the Escherichia coli anaerobic 823
ribonucleotide reductase nrdDG promoter. Int Microbiol 11:49-56. 824
825
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
39
FIGURE LEGENDS 826
FIG 1 Effect of srrA deletion on the S. epidermidis growth. (A) Transcriptional level of 827
srrA/srrB in the S. epidermidis strain 1457 under micro-aerobic stress. After culture for 4 h 828
under oxic conditions, SE1457 was transferred into a 50-ml syringe (sealed entirely with 829
no bubbles inside) for 0.5-h or 1-h incubation under micro-aerobic conditions (-O2). 830
Bacterial cells were collected and total RNA was extracted. Relative expression levels of 831
srrA/srrB were analyzed by qRT-PCR in comparison to the transcription level of gyrB 832
(housekeeping gene). The two-component regulatory system (TCS) arlRS was used as a 833
control. Data was represented as mean±SD from three independent experiments. (B) The 834
srrA deletion mutant displayed a defect in growth of S. epidermidis. SE1457 and its 835
isogenic srrA mutant strains were streaked on TSA plates, and incubated at 37 for 24 h 836
under oxic condition (+O2) or under micro-aerobic condition (-O2). It represents one of 837
three independent experiments. (C) Growth curves of SE1457 isogenic srrA mutants. 838
Under oxic conditions (+O2), S. epidermidis strains were cultured in a flask (1:8 839
culture-to-flask volume ratio) at 37 with shaking. For micro-aerobic conditions (-O2), 840
cultures were inoculated into 50-ml syringes and all air bubbles removed and the syringes 841
were incubated at 37 with shaking. The cultures were hourly measured at OD600. The 842
experiments were repeated at least three times and a representative set of growth curves 843
is shown. 844
845
FIG 2 Effect of srrA deletion on the in-vitro biofilm formation of S. epidermidis. Overnight 846
cultures of the S. epidermidis strains were 1:200 diluted with TSB medium and inoculated 847
into 96-well polystyrene plates in triplicate. After static incubation for 6 h, 12 h, 24 h and 48 848
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
40
h under oxic conditions (+O2), or for 12 h, 24 h, 48 h and 72 h under micro-aerobic 849
conditions (-O2), biofilms were stained with crystal violet and observed (A). Biofilm 850
formation under oxic and micro-aerobic conditions was detected at OD570 (B, C). The 851
experiments was repeated three times and data is represented as mean±SD; **, p<0.01 852
( srrA versus SE1457).853
854
FIG 3 Observation of S. epidermidis biofilm under CLSM. The 24-h biofilms cultured in 855
vitro were visualized using Live/Dead viability staining under the confocal laser scanning 856
microscopy (CLSM). The three-dimension structural images (Zoom 1, 63×, magnification) 857
were reconstructed, and the thickness of biofilm was measured using Imaris software. A 858
top layer, middle layer and bottom layer within a biofilm are shown. The viable and dead 859
cells were stained in green (SYTO9) and red (PI), respectively. The amount of 860
fluorescence from the bottom to top layer of biofilm was determined using ImageJ 861
software (Zoom 3, 63×, magnification). The value of PI/Total florescence indicates 862
proportion of dead cells within biofilm. The figures represent one of three independent 863
experiments. 864
865
FIG 4 Effect of srrA deletion on biofilm formation by S. epidermidis in vivo. The New 866
Zealand rabbit model of local S. epidermidis biofilm infection was used. Subcutaneous 867
incisions were made on the back of the animal. Sterile polyethylene disks were implanted, 868
then overnight bacterial cultures (108 cfu) were re-suspended in 1 ml TSB and inoculated 869
into the cavities. After 72 h, the disks were removed, fixed with 2.5% glutaraldehyde and 870
observed under a scanning electron microscopy (SEM). As a control, 24-h biofilms 871
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
41
cultured in vitro were observed under SEM (A). The biofilms were scraped from the disks, 872
and the viable bacteria were determined by CFU counting (B). The data are from one of 873
three independent experiments; **, p<0.01 ( srrA versus SE1457). 874
875
FIG 5 Effect of srrA deletion on initial adherence capacity in vitro. Mid-log phase bacterial 876
cells were adjusted to OD600 value 0.1 in PBS, and then added into a 6-well plate (2 877
ml/well) (A), or into a 96-well microplate (200 μl/well) (B). Plates were then incubated at 37878
for 2 h. The attached bacterial cells on the 6-well plate were counted by microcopy (A); 879
attached cells on the 96-well microplate were determined at OD570 after crystal violet 880
staining (B). The data represent one of three independent experiments; **, p<0.01 ( srrA 881
versus SE1457). 882
883
FIG 6 Effect of srrA deletion on the extracellular matrix biosynthesis of S. epidermidis. (A) 884
PIA biosynthesis semi-quantified by dot blot assay with wheat germ agglutinin. 24-h 885
biofilms, cultured aerobically (+O2) or micro-aerobically (-O2) were scraped off and 886
suspended in EDTA (3 μl per 1 mg wet weight). Serial dilutions of the PIA extractions were 887
spotted onto nitrocellulose membranes, subsequently incubated with wheat germ 888
agglutinin conjugated with HRP, and visualized using chromogenic detection. (B) Aap 889
expression of SE1457 and its isogenic srrA deletion mutants. 24-h biofilms and 12-h 890
planktonic bacteria were collected after washing with PBS. Lysostaphin-treated samples 891
with identical OD600 value were centrifuged at 20,000 g for 30 min at 4 . The supernatant 892
were separated using 7% SDS-PAGE, and the gel pieces that carried more than 130-kDa 893
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
42
proteins were used for Western Blot (upper panel).The remaining gel pieces were stained 894
using Coomassie blue as endogenous reference (lower panel). MAb18B6 (10 ng/ml) was 895
used for the primary antibody. The immno-reactivity was detected with ECL Western 896
Blotting system after incubation with HRP-conjugated secondary antibody. (C) eDNA 897
quantified by q-PCRs of four chromosomal loci (gyrB, serp0306, leuA and lysA). 898
Unwashed 24-h biofilms were measured at OD600 in order to normalize to biofilm biomass, 899
and then used for eDNA isolation by phenol/chloroform/isoamyl alcohol extraction and 900
ethanol precipitation. The results are shown as nanogram per biomass of eDNA 901
(means±SD) and were derived from three independent experiments; **, p<0.01 ( srrA 902
versus SE1457). 903
904
FIG 7 EMSA analysis of S. epidermidis SrrA with the putative promoter regions. 905
His-tagged SrrA was purified and phosphorylated (SrrA-P) by incubation with 50 mM 906
acetylphosphate. The putative promoter regions of srrAB, icaR, icaA, qoxB, pflB, sarA and 907
rsbU genes were PCR-amplified. DNA probes were purified and labeled with digoxigenin. 908
Gel shift reactions were performed by incubating labeled probe with increasing 909
concentrations of SrrA-P (range, 0.3 μM to 1.2 μM). Lane 1 and lane 5 of each blot 910
contained a no-protein control and a 125-fold excess of unlabeled probe competitor 911
control, respectively. All samples were electrophoresed on a non-denaturing 912
polyacrylamide gel and blotted onto nylon membrane. After incubation with 913
anti-digoxigenin antibody, CSPD chemiluminescent reagent was added. The arrows 914
indicate the positions of phosphorylated SrrA-bound probes; triangles indicated the 915
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
43
positions of free probes. The DNA fragment within the rpsJ coding region was used as a 916
negative control. 917
918
FIG 8 Proposed model of srrAB regulation in S. epidermidis. SrrB represents the 919
membrane associated sensor kinase that becomes activated and auto-phosphorylated (P) 920
in the absence of O2 (bright red spheres). The SrrB-P phosphorylates SrrA to SrrA-P, 921
which acts as a response regulator that directly positively controls its own srrAB operon, 922
as well as the ica-, qox- and pfl-operons (Solid lines). Genes that are indirectly positively 923
regulated are indicated by dotted lines. At the same time SrrA-P acts also as a repressor 924
for icaR, which encodes the repressor of ica operon. +O2: under oxic condition; -O2: under 925
micro-aerobic condition. 926
927 on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
44
TABLE 1 Bacterial strains and plasmids used in this study 928
Plasmids or strains Description a Source or reference
Plasmids pET28a E. coli expression plasmid, KmR Novagen
pET28a-srrA pET28a harboring the srrA gene, used for SrrA expression
This study
pMAD Shuttle vector, temperature sensitive, AmpR, ErmR
(30)
pMAD- srrA Recombinant plasmid This study
pCN51 shuttle vector, AmpR, ErmR (32)
pCN51-srrAB the srrAB gene cloned into pCN51 This study
pRAB11 shuttle vector, AmpR, CmR (31)
pRAB11-srrA the srrA gene cloned into pRAB11 This study
pRAB11-srrB the srrB gene cloned into pRAB11 This study
Bacterial strains S. epidermidis RP62A
Biofilm positive, genome sequenced and published
(26,28)
S. epidermidis 1457 Biofilm positive, clinical isolate, wild-type strain
(7,16)
srrA srrA deletion, spcR, derivative of S. epidermidis 1457
This study
srrA(pCN51-srrAB) srrA complemented with plasmid pCN51-srrAB
This study
srrA (pRAB11-srrA) srrA complemented with plasmid pRAB11-srrA
This study
srrA(pRAB11-srrB) srrA complemented with plasmid pRAB11-srrB
This study
srrA(pCN51) srrA introduced with plasmid pCN51 This study
S. aureus 4220 Restriction negative, modification positive (14, 32)
E. coli DH5α supE44 lacU169 (φ80dlacZ M15) hsdR17 recA1 endA1gyrA96 thi-1 relA1
Invitrogen
E. coli BL21(DE3) B F-ompThsdSB (rB-, mB-) galdcm (DE3) Invitrogen
a KmR, kanamycin resistance; AmpR, ampicillin resistance; CmR, chloramphenicol 929
resistance; ErmR, erythromycin resistance; spcR, spectinomycin resistance. 930
931
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
45
TABLE 2 Primers used in this study 932
Primers Sequence (5’ 3’) location Restriction enzymes Products (bp)
Primers used for construction and identification of srrA deletion mutant srrA-US-F GAAGATCTGGAGAGTCAAATGAGTAAAGAAC 1103298-1103320 BglII
884 srrA-US-R TCCCCCGGGCATACTTTCTACTACCTCCTACA 1102437-1102459 SmaI
srrA-DS-F CGGAATTCAACTGTGTGGGGTGTCGG 1101757-1101774 EcoRI 907
srrA-DS-R CGGGATCCTCATCAGCCATCTTGTTCG 1100868-1100886 BamHI
spc-F TGGTTCAGCAGTAAATGGTGG 1029
spc-R CATCTGTGGTATGGCGGGTA Primers used for srrA, srrB, srrAB complementation pCN51-srrAB-F CGCGGATCCCCTTTGAGTCACTCAATAAC 1102500-1102519 BamHI
2572 pCN51-srrAB-R CGGGGTACCTGATACTTTTCAGTTTCTAA 1099948-1099967 KpnI
pRAB11-srrA-F GGGGTACCCCTTTGAGTCACTCAATAAC 1102500-1102519 KpnI 806
pRAB11-srrA-R CGGAATTCCTATTTAGTCGGTTCATCAC 1101714-1101733 EcoRI
pRAB11-srrB-F CGGGGTACCAATGATACAAACTGTGTGG 1101765-1101783 KpnI 1836
pRAB11-srrB-R GGAAGATCTTGATACTTTTCAGTTTCTAA 1099948-1099967 BglII
Primers used for eDNA quantification using qPCR gyrB-F GCTGGACAGATACAAGTT 2611681-2611698
137 gyrB-R GCTAATGCCTCGTCAATA 2611562-2611579
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
46
serp0306-F ATGCCACATCCACGAAAGA 309331-309349 179
serp0306-R TGTAACTGACAATGCCCAATC 309489-309509 lysA-F TGACAATGGGAGGTACAAGC 988594-988613
76 lysA-R TGGTCTTCATCGTAAACAATCG 988648-988669 leuA-F GTGAACGGTATTGGTGAAAGAG 1708472-1708493
78 leuA-R GTGGTCCTTCCTTACATATAAAGC 1708526-1708549 Primers used for SrrA expression pET-28a-srrA-F CCGGAATTCATGACTAACGAAATTTTAATCGTTG 1102415-1102439 EcoRI
723 pET-28a-srrA-R CCGCTCGAGTTTAGTCGGTTCATCACTAGGTT 1101717-1101739 XhoI
Primers used for amplification of promoter fragments Psrr-F ACTTTCTACTACCTCCTA 1102440-1102457
132 Psrr-R CACCAAAAAGATGTAATT 1102554-1102571 PicaA-F GTATAACAACATTCTATT 2334137-2334154
85 PicaA-R ATTTTTTCACCTACCTTT 2334204-2334221 PicaR-F ATTCTAAAATCTCCCCCT 2334055-2334072
82 PicaR-R TGAAACAGTAATATTTGT 2334119-2334136 PqoxB-F TTTTTGACCTCCTAATAC 641914-641931 145
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
47
PqoxB-R AATCTTACAAACCCCGTC 642041-642058 PpflB-F ACTCTCCGCCTCCATTTC 2414402-2414419
151 PpflB-R TTTATTCACAAACTGTTA 2414535-2414552 PrsbU-F GAAATGCGCCTCCTTACT 1725459-1725476
147 PrsbU-R GCTTTAGGTTATCCATTC 1725588-1725605 PsarA-F GACACTTTCGTATTTTCATAAGA 279934-279956
160 PsarA-R ATTAATGAAACCTCCCTATTTA 279797-279818 PrpsJ-F AAGATTCTCGTGAACAATTC 1862226-1862245
119 PrpsJ-R GATGTCTACACCTGATGG 1862127-1862144
The primers were designed using Primer Premier 5 software according to the genomic sequence of S. epidermidis RP62A (GenBank accession 933
number: NC002976). 934
935
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
48
TABLE 3 Primers used for transcriptional analysis by quantitative RT-PCR 936
Primers Sequence (5’ 3’) Location Products (bp)
sarA-F GTAATGAACACGATGAAAGAACT 279526-279548 103
sarA-R GCTTCTGTGATACGGTTGT 279446-279464
rsbU-F GCTTATGGACATTCACAA 1724925-1724942 121
rsbU-R GATTCATCTCTTCATACAGT 1724822-1724841
icaA-F ATCAAGCGAAGTCAATCTC 2334781-2334799 127
icaA-R CAGCAATATCCTCAGTAATCA 2334887-2334907
icaR-F GCACATCGCTTTGGATAA 2333646-2333663 146
icaR-R TTAACAGTGAATATACTTGGTCTT 2333518-2333541
atlE-F CAATTACAGGAGACACAAT 631207-631225 149
atlE-R TCATTATCATTAGAAGCAGTT 631077-631097
aap-F CGAGGAATTACAATCATCACA 2460758-2460778 166
aap-R CGTAGTTGGCGGTATATCTA 2460613-2460632
srrA-F TCACCTAGAGAAGTAGTATT 1102108-1102127 130
srrA-R GAGCGTCATTATCAATCA 1101998-1102015
srrB-F TCCATAGTAGACGGTATAGT 1100559-1100578 136
srrB-R ATAATCCTTCAGCATCCATA 1100443-1100462
ctaA-F CTACGATTATTATGACCTT 703606-703624 146
ctaA-R ACTCAGTTCTATAATTGTT 703479-703497
qoxB-F TCTATGGATACAATGACAAGTT 641416-641437 126
qoxB-R TGAGTTACGACCTCTGAA 641312-641329
serp0257-F AACCTGGAGAAGCATTAG 265234-265251 101
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
49
serp0257-R TAGCGTTACACCTGTTAC 265317-265334
serp2257-F AGGTAATGCTGGCTTATCT 2286255-2286273 110
serp2257-R CGAATGCGTTGACTGTAA 2286164-2286181
pflA-F ACACTTACACTCCGTTGA 2412105-2412122 140
pflA-R CTTCTCTTGATGGTTCGTTA 2411983-2412002
serp2381-F AGAAGGTAATCAAGTTGT 2428977-2428994 136
serp2381-R CGTATTATATTGTTGTAGCA 2428859-2428878
lacA-F GGAAGACAACGATTATGAT 1841284-1841302 135
lacA-R GCACCATAGGCATCTATA 1841168-1841185
ureF-F TTAGGTGTAGATGTGGAAT 1898186-1898204 148
ureF-R CGTGTCTTCTCAATATGG 1898317-1898334
rbsK-F GCAGGTATTCATACACAAT 2125633-2125651 150
rbsK-R CACACTCATCTCAACATC 2125502-2125519
betB-F TATCCATTACTTCAAGCATCT 2209851-2209871 128
betB-R CCAACTTCCTCCATCAAT 2209744-2209761
cysH-F TTGGTGCTGAGAGTATGG 2227130-2227147 148
cysH-R TTAATGCGTAATTGCGGATAT 2227000-2227020
rplB-F AAGATGGAATCATTGCTAA 1860237-1860255 130
rplB-R TGACCTACTTGTAATCCT 1860126-1860143
rpsJ-F AAGATTCTCGTGAACAATTC 1862226-1862245 119
rpsJ-R GATGTCTACACCTGATGG 1862127-1862144
opp1B-F TGATTCCATTATTGATTGTAGTGA 2419641-2419664 111
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
50
opp1B-R GCGTTATATTAGGCGTTCC 2419554-2419572
rpoA-F TGAAGTTAGTGAAGATGCTA 1849776-1849795 113
rpoA-R CTGGTAATGAAGATAGTAGGA 1849683-1849703
nrdD-F GATAGTAATACATTCTCAACAA 2217415-2217436 145
nrdD-R ATGGATGGTAATCTAAGTC 2217292-2217310 Primers used in qRT-PCR were designed with Beacon Designer 7 software according to the genomic sequence of S. epidermidis RP62A (GenBank 937
accession number: NC002976). 938
939
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
51
TABLE 4 Transcription levels of genes involved in growth and biofilm formation of S. epidermidis srrA under micro-aerobic conditions 940
ORF Gene Description or predicted function Expression ratio (mutant/WT)
Microarray qRT-PCR
Genes involved in respiratory chain and energy metabolism SERP1055 srrA DNA-binding response regulator 0.10 0.00001
SERP1054 srrB histidine kinase sensor UD 0.09±0.02
SERP0705 ctaA cytochrome oxidase assembly protein 0.22 0.04±0.01
SERP0706 ctaB protoheme IX farnesyltransferase 0.28 ND
SERP0646 qoxB quinol oxidase subunit II UD 0.31±0.08
SERP0645 qoxA quinol oxidase subunit I 0.30 ND
SERP0644 qoxC quinol oxidase polypeptide III 0.20 ND
SERP0643 qoxD quinol oxidase polypeptide IV 0.25 ND
SERP2381 NADH: flavinoxidoreductase/fumarate reductase flavoprotein subunit 0.21 0.20±0.17
SERP0257 alcohol dehydrogenase 0.32 0.08±0.04
SERP2112 alcohol dehydrogenase, zinc-containing 0.28 ND
SERP2257 acetoin reductase, oxidoreductase, ligand is NAD 0.18 0.02±0.01
SERP2365 pflA pyruvate formate-lyase-activating enzyme 0.15 0.15±0.11
SERP2366 pflB formateacetyltransferase 0.31 ND
SERP2183 nrdD anaerobic ribonucleoside triphosphate reductase 0.33 ND
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
52
SERP1795 lacA galactose-6-phosphate isomerase LacA subunit 0.32 1.72±0.37
SERP1793 lacC tagatose-6-phosphate kinase 0.30 ND
SERP1791 lacF PTS system, lactose-specific IIA component 0.31 ND
SERP1873 ureF urease accessory protein UreF 0.34 1.38±0.6
SERP1874 ureG urease accessory protein UreG 0.33 ND
SERP1875 ureD urease accessory protein UreD 0.33 ND
SERP2100 rbsK ribokinase, catalyses the phosphorylation of ribose to ribose-5-phosphate using ATP, this reaction is the first step in the ribose metabolism
0.16 0.14±0.06
SERP2101 D-ribose pyranase 0.27 ND
SERP2102 rbsU ribose transporter RbsU 0.30 ND
SERP2347 bioB biotin synthase 0.32 0.44±0.20
SERP2396 bioD dethiobiotinsynthetase 0.34 ND
SERP2190 cysI sulfite reductase (NADPH) hemoprotein beta-component 3.68 ND
SERP2191 cysJ sulfite reductase (NADPH) flavoprotein 4.33 ND
SERP2192 cysH phosophoadenylyl-sulfate reductase 5.22 ND
SERP2176 betA choline dehydrogenase 3.84 ND
SERP2177 betB betaine aldehyde dehydrogenase, ligand is NAD 4.25 7.29±2.56
Genes involved in biofilm formation SERP2292 icaR intercellular adhesion regulator 0.33 0.32±0.07
SERP2293 icaA N-glycosyltransferase UD 0.10±0.02
SERP2398 aap accumulation associated protein UD 0.89±0.21
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
53
SERP0274 sarA accessory regulator A UD 0.87±0.33
SERP1680 rsbU sigma factor B regulator protein UD 1.35±0.26
Genes involved in protein synthesis SERP0044 rpsF 30S ribosomal protein S6 3.8 ND
SERP1832 rpsJ 30S ribosomal protein S10 5.09 6.85±2.06
SERP0186 rpsL 30S ribosomal protein S12 3.04 ND
SERP1807 rpsM 30S ribosomal protein S13 3.34 ND
SERP1818 rpsN 30S ribosomal protein S14 5.58 ND
SERP1822 rpsQ 30S ribosomal protein S17 3.11 ND
SERP1828 rplB 50S ribosomal protein L2 4.17 17.1±3.22
SERP1831 rplC 50S ribosomal protein L3 4.77 ND
SERP1821 rplN 50S ribosomal protein L14 3.09 ND
SERP1824 rplP 50S ribosomal protein L16 3.41 ND
SERP1815 rplR 50S ribosomal protein L18 4.37 ND
SERP1826 rplV 50S ribosomal protein L22 3.4 ND
SERP1820 rplX 50S ribosomal protein L24 3.11 ND
SERP2371 opp-1B Peptide ABC transporter, permease protein 1B 0.19 0.25±0.15
SERP2370 opp-1C Peptide ABC transporter, permease protein 1C 0.26 ND
Genes involved in transcription SERP1805 rpoA DNA-directed RNA polymerase subunit alpha 3.24 3.54±2.28
SERP0183 rpoB DNA-directed RNA polymerase subunit beta 2.96 ND
SERP0184 rpoC DNA-directed RNA polymerase subunit beta' 3.53 ND
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
54
SERP1127 rpoD RNA polymerase sigma factor 4.07 ND
SERP1677 rpoF RNA polymerase sigma factor SigB 3.2 ND UD: under detection level in microarray analysis. 941
ND: Not done. 942
Data from qRT-PCR is represented as mean±SD of three independent experiments. 943
944
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
55
TABLE 5 Transcription levels of genes involved in growth and biofilm formation of S. epidermidis srrA under oxic conditions 945
ORF Gene Descriptions or predicted function Expression ratio (mutant/WT)
Microarray qRT-PCR Genes involved in respiratory chain and energy metabolism SERP1055 srrA DNA-binding response regulator 0.30 0.00001 SERP1054 srrB histidine kinase sensor UD 0.10±0.02 SERP0705 ctaA cytochrome oxidase assembly protein UD 0.18±0.08 SERP0646 qoxB quinol oxidase subunit II UD 0.17±0.05
SERP2381 NADH: flavinoxidoreductase/fumarate reductase flavoprotein subunit UD 0.35±0.21
SERP0257 alcohol dehydrogenase UD 0.16±0.07 SERP2257 acetoin reductase, oxidoreductase, ligand is NAD UD 0.13±0.07
SERP2327 acetoin dehydrogenase, E3 component, dihydrolipoamide dehydrogenase 0.31 ND
SERP2379 acetoin (diacetyl) reductase 0.28 ND
SERP2324 branched-chain alpha-keto acid dehydrogenase subunit E2 0.32 ND
SERP2365 pflA pyruvate formate-lyase-activating enzyme UD 0.12±0.05 SERP2170 ppdK pyruvate phosphate dikinase 0.23 ND
SERP2182 nrdG anaerobic ribonucleoside-triphosphate reductase activating protein 0.33 ND
SERP2183 nrdD anaerobic ribonucleoside triphosphate reductase 0.30 ND SERP1795 lacA galactose-6-phosphate isomerase LacA subunit UD 0.39±0.12 SERP1873 ureF urease accessory protein UreF UD 0.27±0.15 SERP2192 cysH phosophoadenylyl-sulfate reductase UD 5.26±1.36 Genes involved in biofilm formation SERP2292 icaR intercellular adhesion regulator UD 5.14±0.63 SERP2293 icaA N-glycosyltransferase UD 0.13±0.06 SERP2295 icaB intercellular adhesion protein B UD 0.17±0.1
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from
56
SERP2294 icaD intercellular adhesion protein D UD ND SERP0636 atlE bifunctional autolysin UD 0.25±0.12 SERP2398 aap accumulation associated protein UD 0.68±0.14 SERP0274 sarA accessory regulator A UD 0.74±0.21 SERP1680 rsbU sigma factor B regulator protein UD 0.93±0.29 Genes involved in protein synthesis SERP0840 rpsO 30S ribosomal protein S15 3.16 ND SERP0046 rpsR 30S ribosomal protein S18 3.25 ND SERP1153 rpsT 30S ribosomal protein S20 4.56 ND SERP1284 rpsD 30S ribosomal protein S4 4.39 ND SERP1821 rplN 50S ribosomal protein L14 3.88 ND SERP0807 rplS 50S ribosomal protein L19 3.69 ND SERP0001 rpmH 50S ribosomal protein L34 3.54 ND SERP2371 opp-1B peptide ABC transporter, permease protein 1B 0.34 1.01±0.55 SERP2105 pgsA poly-gamma-glutamate synthesis protein pgsA 3.39 ND SERP2107 pgsB poly-gamma-glutamate synthesis protein pgsB 3.51 ND Genes involved in transcription SERP0926 parC DNA topoisomerase IV subunit A 2.96 ND SERP0838 truB tRNApseudouridine synthase B 3.10 ND SERP1307 trmB tRNA (guanine-N(7)-)-methyltransferase 2.95 ND
UD: under detection level in microarray analysis. 946
ND: Not done. 947
Data from qRT-PCR is represented as mean±SD of three independent experiments.948
949
on Septem
ber 3, 2020 by guesthttp://jb.asm
.org/D
ownloaded from