on may 5, 2020 by guest - journal of bacteriology · 84 other staphylococcal surface-associated...

JB Accepts, published online ahead of print on 17 November 2014J. Bacteriol. doi:10.1128/JB.02231-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.

on Septem

ber 3, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

on Septem


.org/D

ownloaded from

http://jb.asm.org/

1

Staphylococcus epidermidis SrrAB regulates bacterial growth and 1

biofilm formation differently under oxic and micro-aerobic conditions 2

3

Youcong Wu,a, b Yang Wu,a Tao Zhu,a, c Haiyan Han,a Huayong Liu,a Tao 4

Xu,a Patrice Francois,d Adrien Fischer,d Li Bai,b Friedrich Götz,e Di Qua* 5

6

Key Laboratory of Medical Molecular Virology of Ministries of Education and 7

Health, Institute of Medical Microbiology and Institutes of Biomedical Sciences, 8

Shanghai Medical College of Fudan University, 138 Yi Xue Yuan Road, 9

Shanghai 200032, Chinaa; Integrated Laboratory of Pathogenic Biology, 10

College of Preclinical Medicine, Dali University, 2 Hong Sheng Road, Dali 11

671000, Chinab; Department of Medical Parasitology, Wannan Medical 12

College, 22 West Wenchang Road, Wuhu, 241002, ChinaC; Genomic 13

Research Laboratory, Service of Infectious Diseases, University of Geneva 14

Hospitals, Rue Gabrielle-Perret-Gentil 4, Geneva, CH-1211, Switzerlandd; 15

Microbial Genetics, University of Tübingen, Auf der Morgenstelle 28, D-72076 16

Tübingen, Germanye 17

18

Running Title: Role of SrrAB in the S. epidermidis biofilm and growth 19

20

*Address correspondence to Di Qu, [email protected] 21

Y.C.W, Y.W and T.Z contributed equally to this work. 22

on Septem


.org/D

ownloaded from

http://jb.asm.org/

2

ABSTRACT 23

SrrAB expression in Staphylococcus epidermidis strain1457 (SE1457) was 24

up-regulated during a shift from oxic to micro-aerobic conditions. A 25

srrA-deletion mutant ( srrA) was constructed for studying the regulatory 26

function of SrrAB. The deletion resulted in retarded growth and abolished 27

biofilm formation, both in vitro and in vivo and under both oxic and 28

micro-aerobic conditions. Associated with the reduced biofilm formation, srrA 29

produced much less polysaccharide intercellular adhesion (PIA) and showed 30

decreased initial adherence capacity. Microarray analysis showed that srrA 31

mutation affected transcription of 230 genes under micro-aerobic conditions, 32

and 51 genes under oxic conditions. Quantitative real-time PCR (qRT-PCR), 33

confirmed this observation and showed down-regulation of genes involved in 34

maintaining the electron transport chain by supporting cytochrome and 35

quinol-oxidase assembly (e.g. qoxB, ctaA) and in anaerobic metabolism (e.g. 36

pflBA, nrdD). In srrA, expression of biofilm-formation related gene icaR was 37

up-regulated under oxic conditions and down-regulated under micro-aerobic 38

conditions, whereas icaA was down-regulated under both conditions. 39

Electrophoretic mobility shift assay further revealed that phosphorylated SrrA 40

bound to the promoter regions of icaR, icaA, qoxB and pflBA as well as its own 41

promoter region. These findings demonstrate that in S. epidermidis SrrAB is an 42

auto-regulator and regulates biofilm formation in an ica-dependent manner. 43

Under oxic conditions, SrrAB modulates electron transport chain activity by 44

on Septem


.org/D

ownloaded from

http://jb.asm.org/

3

positively regulating qoxBACD transcription. Under micro-aerobic conditions, it 45

regulates fermentation processes and DNA synthesis by modulating 46

expression of both pfl operon and nrdDG. 47

48

INTRODUCTION 49

Staphylococcus epidermidis is an opportunistic pathogen, seldom excreting 50

virulence factors and less aggressive in comparison to S. aureus, but capable 51

of forming a multilayered biofilm on implanted medical devices, such as 52

vascular catheters, prosthetic joints, and artificial heart valves, etc. (1, 2). The 53

bacteria within the biofilm are protected against killing by antibiotics and the 54

host immune system, which contributes to increasing resistance to 55

antimicrobial drugs and persistent infections (3-5). Biofilm-related infections 56

persist until the biomedical implant is removed, resulting in extra trauma and 57

cost to the patients. 58

Biofilm formation is a complicated process in staphylococci, being 59

regulated by multiple regulatory factors including Agr P2/P3, SarA, SigB and 60

two-component signal transduction systems (TCSs) (6-10). TCSs serve as a 61

basic stimulus-response coupling mechanism by which bacteria adapt the 62

environmental changes and consequently play a key role in pathogenesis 63

(11-13). Our previous study revealed that the TCSs LytSR, SaeRS, and ArlRS 64

are involved in S. epidermidis biofilm formation (14-16), whereas the role of the 65

SrrAB (staphylococcal respiratory response) remained unclear. 66

on Septem


.org/D

ownloaded from

http://jb.asm.org/

4

The SrrAB shares considerable homology with ResDE of B. subtilis (17, 67

18), and in S. aureus acts as a global regulator of virulence factors (SPA, 68

TSST-1, RNAIII, etc.) in response to oxygen tension (19-22). A study by 69

Yarwood et al. demonstrated that srrAB deletion (in S. aureus MN8) resulted in 70

growth reduction only under anaerobic conditions, and expression of RNAIII 71

was inversely related to expression of srrAB (20). Throup et al. found that srrA 72

deletion (in S. aureus WCUH29) led to changes in the expression of enzymes 73

involved in fermentative metabolism (e.g. alcohol dehydrogenase, L-lactate 74

dehydrogenase, NADH dehydrogenase, etc.), suggesting a role in the retarded 75

growth of S. aureus under anaerobic conditions (19). Additionally, a 76

transposon mutation in srrA resulted in reduction of biofilm formation in S. 77

aureus, although PIA production was increased, suggesting that in S. aureus 78

srrAB affects biofilm formation via an ica-independent pathway (23). 79

Development of biofilm formation has been described as a two-step 80

process involving an initial attachment, then an aggregation and maturation 81

phase (4, 8). The initial adhesion of bacterial cells to a polymer surfaces is 82

influenced by a number of factors in S. epidermidis, including AtlE, Embp, and 83

other staphylococcal surface-associated proteins (6, 7, 11). In the maturation 84

phase of biofilm development, the most important adhesive biofilm matrix is 85

PIA (polysaccharide intercellular adhesion) (12). The biosynthesis, exportation, 86

and modification of PIA are accomplished by the products of icaADBC operon, 87

and the icaA is negatively regulated by the divergently transcribed icaR gene 88

on Septem


.org/D

ownloaded from

http://jb.asm.org/

5

(3, 4, 24). Besides IcaR, several DNA-binding proteins regulate ica 89

transcription, including SarA, RsbU, and ArlR, etc. (10, 13, 16). However, it is 90

possible that other biofilm matrix components may be critical for 91

staphylococcal biofilm formation, such as accumulation-associated protein 92

(Aap), and extracellular DNA (eDNA), which mediated cell-cell aggregation 93

and multilayered biofilm formation (25, 26). Environmental factors (such as 94

oxygen limitation, alcohol, and NaCl, etc.) may also influence staphylococcal 95

biofilm formation (16, 27). 96

Much attention has been focused on the relevance of SrrAB as virulence 97

factors, while the mechanisms by which staphylococcal SrrAB regulates 98

biofilm formation have not been investigated in great detail. Here, we come up 99

with new aspects of the role of SrrAB in the regulatory network of biofilm 100

formation in S. epidermidis. 101

102

MATERIALS AND METHODS 103

Ethics statement. All procedures performed on rabbits were carried out 104

according to relevant national and international guidelines (the Regulations for 105

the Administration of Affairs Concerning Experimental Animals, China, and the 106

NIH Guide for the Care and Use of Laboratory Animals) and were approved by 107

the Institutional Animal Care and Use Committee (IACUC) of Shanghai 108

Medical College, Fudan University (IACUC Animal Project Number: 109

20110628-16-qu). 110

on Septem


.org/D

ownloaded from

http://jb.asm.org/

6

Bacterial strains, plasmids and growth conditions. The bacterial 111

strains and plasmids used in this study are listed in Table 1. S. epidermidis 112

1457 (SE1457) and S. aureus RN4220 were kindly provided by Dr. Yicun Gao 113

from Hong Kong University, S. epidermidis RP62A (accession number 114

NC_002976) (28) was purchased from the American Type Culture Collection 115

(ATCC, Manassas, USA).All staphylococci were routinely cultured in tryptone 116

soy broth (TSB; OXOID, Basingstoke, UK) or tryptone soy agar (TSA). For 117

detection of biofilm formation, S. epidermidis was cultured in TSA medium 118

supplemented with 0.5% glucose. For the transformation of recombinant 119

plasmids, B2 medium (1% casein hydrolysate, 2.5% yeast extract, 0.5% 120

glucose, 2.5% NaCl, 0.1% K2HPO4, pH 7.5) was used for the recovery of 121

staphylococcal cells after electroporation. Luria-Bertani (LB) medium was used 122

for culture of E. coli. Oxic conditions were created by incubation into a flask, in 123

which the culture medium did not exceed 15% of the flask volume, and 124

micro-aerobic conditions bacteria were incubated into a syringe fully filled with 125

medium. For static incubation under micro-aerobic conditions, polystyrene 126

plates inoculated with bacteria were placed in an anaerobic bag with 127

AnaerocultR C mini (Merck KGaA., Darmstadt, Germany). When appropriate, 128

antibiotics were used at the following concentrations: erythromycin (Em; 5 129

μg/ml), spectinomycin (Spc; 100 μg/ml), chloramphenicol (Cm; 10 μg/ml), 130

ampicillin (Am; 100 μg/ml) and kanamycin (Km; 50 μg/ml). 131

Extraction of bacterial DNA. Genomic DNA of S. epidermidis was 132

on Septem


.org/D

ownloaded from

http://jb.asm.org/

7

extracted as described by Flamm, et al. with minor modifications (29). In brief, 133

staphylococci cells were treated with lysostaphin (20 μg/ml, Sigma Co., St 134

Louis, MO, USA) and proteinase K (100 μg/ml, Merck KGaA, Darmstadt, 135

Germany), extracted with phenol and chloroform, and the nucleic acids were 136

precipitated with ethanol. 137

Plasmid DNA from E. coli was extracted with a plasmid purification kit 138

(Qiagen, Hilden, Germany), following manufacturers’ instructions. After 139

harvesting and re-suspension, bacterial cells were lysed under alkaline 140

conditions. The lysate was neutralized by the addition of potassium acetate. 141

The cleared lysate was loaded onto QIAGEN-tip by gravity flow, then the 142

eluted plasmid DNA was concentrated by isopropanol precipitation. Plasmid 143

DNA from S. epidermidis or S. aureus 4220 was extracted using the same 144

method except for an additional step of lysostaphin treatment. 145

Construction of S. epidermidis srrA deletion mutant and 146

complementary strains. We first characterized the S. epidermidis srrAB 147

genes in SE1457 by PCR and sequencing, and compared with that in genome 148

of ATCC 35984 strain (GenBank accession number: NC_002976). The srrA 149

gene was 726 bp and srrB was 1770 bp in length. Then, the srrA deletion 150

mutant was constructed by allelic replacement using the temperature-sensitive 151

plasmid pMAD as described previously (30). In brief, the 152

spectromycin-resistance cassette (spc, about 1kb) digested with SmaI and 153

BamHI endonucleases (MBI Fermentas, Vilnius, Lithuania) was inserted into 154

on Septem


.org/D

ownloaded from

http://jb.asm.org/

8

the pMAD plasmid, named as pMAD-spc (15). About 0.9-kb PCR products 155

upstream and downstream flanking region of srrA were cloned into pMAD-spc. 156

The recombinant plasmid was successively transferred into E. coli DH5α, S. 157

aureus RN4220, and then into SE1457, followed by the process of allelic 158

replacement as performed previously (15, 30). The spectinomycin-resistant 159

and erythromycin-sensitive white colonies were screened as a srrA deletion 160

mutant ( srrA). The 662-bp fragment (+4 bp- +665 bp relative to the 161

transcription start site) of srrA including REC domain and major part of 162

Trans_reg-C domain (Fig. S1) was replaced by spectinomycin-resistance 163

cassette (spc, 1029 bp). The srrA was verified by PCR and DNA sequencing 164

(Fig. S2A). In srrA, srrA expression was below the detection level, and the 165

srrB expression was down-regulated to 14% of that in the wild-type strain, as 166

detected by qRT-PCR (Fig. S2B). 167

For complementation of srrA mutant, we constructed three recombinant 168

expression plasmids containing srrA, srrB, or srrAB genes, respectively. The 169

srrA, srrB, and srrAB genes with associated shine-dalgarno sequence in 170

SE1457 were separately amplified by PCR with primers as 171

pRAB11-srrA-F/pRAB11-srrA-R, pRAB11-srrB-F/pRAB11-srrB-R and 172

pCN51-srrAB-F/pCN51-srrAB-R, respectively (sequences listed in Table 2). 173

The pRAB11-srrA was constructed from pRAB11 inserted with a fragment of 174

srrA digested with KpnI and EcoRI, pRAB11-srrB from pRAB11 inserted with a 175

fragment of srrB with KpnI and BglII digest (31), and the pCN51-srrAB was 176

on Septem


.org/D

ownloaded from

http://jb.asm.org/

9

made by insertion of a fragment of srrAB with BamHI and KpnI digest into 177

pCN51 (32). The complementary plasmids were transferred into S. aureus 178

RN4220, and then into srrA by electroporation, yielding three complementary 179

strains, designated as srrA(pRAB11-srrA), srrA(pRAB11-srrB) or 180

srrA(pCN51-srrAB), respectively. The vector plasmids, pRAB11 or pCN51, 181

were introduced as blank controls into srrA and named srrA(pRAB11) or 182

srrA(pCN51). 183

Growth curves of SE1457 isogenic srrA mutants. The growth curves of 184

S. epidermidis strains were determined by measuring the optical density 185

(OD600) (15). For oxic growth, overnight bacteria cultures were inoculated into 186

flasks, incubated at 37 with shaking at 220 rpm and the OD600 value of 187

cultures were measured at 60 min intervals for 12 hours. For micro-aerobic 188

growth, cultures were transferred into screw-top 50-ml syringes which were 189

completely filled with medium (with no air bubbles), and incubated under 190

vigorous agitation (220 rpm) at 37 . Two hundred microliters of bacteria in the 191

syringe were removed by syringe every hour until 18 h and the OD600 values 192

were measured. 193

Semi-quantitative detection of biofilm formation of SE1457 isogenic 194

srrA mutants in vitro. The biofilm-forming ability of S. epidermidis strains in 195

vitro was determined by semi-quantitative plate assay (14). In brief, overnight 196

cultures of SE1457, srrA, srrA(pCN51-srrAB), srrA(pRAB11-srrA) and 197

srrA(pCN51) were diluted with TSB medium containing 0.5% glucose, 198

on Septem


.org/D

ownloaded from

http://jb.asm.org/

10

inoculated into a polystyrene 96-well microplate (Corning Inc., NY, USA), and 199

incubated statically at 37 for 6 h, 12 h, 24 h and 48 h under oxic conditions, 200

or for 12 h, 24 h, 48 h and 72 h under micro-aerobic conditions (AnaerocultR C 201

mini, Merck KGaA., Darmstadt, Germany). After incubation, the plates were 202

washed with phosphate-buffered saline (PBS), fixed with methanol, and 203

stained with 2% crystal violet. Optical density at 570 nm was measured using a 204

spectrophotometer (Beckman Coulter DTX880, Fullerton, CA, USA). Three 205

independent experiments were carried out. 206

Detection of biofilm formation of SE1457 isogenic srrA mutants in 207

vivo. The biofilm-forming ability of S. epidermidis strains in vivo was 208

determined by using a New Zealand rabbit subcutaneous foreign body 209

infection model as described by Nianan with minor modification (33). Disks 210

were cut from polyethylene 96-well plates (8 mm diameter, 1 mm thickness, 211

with 2mm projecting rim or chimb), sterilized with 75% ethanol, and washed 212

with sterile distilled water, then disinfected by ultraviolet light. The rabbit 213

(2.0-2.5 kg, female) was anaesthetised with pentobarbital sodium (5 mg/kg, 214

i.v.), and four incisions (10 mm) were made on the back bilaterally along the 215

spine after removal of the fur, then the sub-cutis was carefully dissected to 216

form a 2 cm×3 cm cavity. After three disks was implanted into each cavity, one 217

milliliter of bacteria (about 108 cfu) suspended in fresh TSB was injected into 218

the cavity. The same volume of TSB was injected as a control. To minimize the 219

effect of between-animal variation, SE1457, srrA and srrA(pCN51-srrAB) 220

on Septem


.org/D

ownloaded from

http://jb.asm.org/

11

were separately injected into cavities of the same rabbit. 221

Seventy two hours after bacteria inoculation, the rabbits were euthanized 222

and the implants were taken out, washed with PBS, and observed under 223

Scanning Electron Microscopy (SEM). The biofilms were scraped from the 224

disks, and the viable bacteria were determined by CFU counting as previously 225

described (16, 33). Five independent experiments were carried out. 226

Initial adherence capacity of SE1457 isogenic srrA mutants. Primary 227

attachment of SE1457 isogenic srrA mutant strains to a polystyrene surface 228

was assessed as described by Qin, et al. (7, 15, 34) with a modification. Briefly, 229

overnight cultures of SE1457, srrA, srrA(pCN51-srrAB) and srrA(pCN51) 230

were inoculated into TSB and cultured at 37 . After growth to the OD600 value 231

of 0.6~0.8, the bacteria were adjusted to OD600 value of 0.1 with PBS, and 232

inoculated into 6-well plates (2 ml/well) (Nunc, Roskilde, Denmark). After 233

incubation at 37 for 2 h, plates were washed gently with PBS, and observed 234

under microcopy using a 40-fold objective lens. Numbers of attached cells in 235

photomicrographs (at least 5 microscopic fields per sample) were counted by 236

using ImageJ software. In addition, the adhesion capacity of SE1457 isogenic 237

srrA mutant strains was determined by crystal violet staining. Staphylococcal 238

strains grown at 37 to the OD600 value of 1.0 were pipetted into a 96-well 239

microplate (200 μl/well), incubated at 37 for 2 h, followed by washing with 240

PBS, and the subsequent procedures were the same as those used for the 241

semi-quantitative biofilm formation assay measuring OD570 using a 242

on Septem


.org/D

ownloaded from

http://jb.asm.org/

12

spectrophotometer. Three independent experiments were carried out. 243

Assay of PIA in biofilms of SE1457 isogenic srrA mutants. 244

Polysaccharide intercellular adhesion (PIA) in the biofilms of SE1457 isogenic 245

srrA mutant strains was semi-quantified by dot blot assay with wheat germ 246

agglutinin (WGA-HRP conjugate) as described by Gerke, et al (16, 35). In brief, 247

overnight cultures of S. epidermidis strains were inoculated into a 6-well plates 248

(Nunc, Roskilde, Denmark), and incubated at 37 for 24 h under both oxic 249

and micro-aerobic conditions (AnaerocultR C mini, Merck KGaA., Darmstadt, 250

Germany). Biofilms were scraped off from the bottom of the wells, 251

re-suspended in 0.5 M EDTA (3 μl per 1 mg wet weight) and centrifuged 252

(13,000 g, 5 min) after heating at 100 for 5 min. The supernatant was 253

treated with proteinase K (20 mg/ml) at 37 for 3 h, and inactivated at 100 254

for 5 min. Serial dilutions of the PIA extract were transferred to a nitrocellulose 255

membrane (Millipore, Billerica, MA, USA) using a 96-well dot blot device 256

(Biometra GmbH., Goettingen, Germany). The air-dried membrane was 257

blocked with 5% (wt/vol) skim milk and subsequently incubated with wheat 258

germ agglutinin (3.2 μg/ml) conjugated for 1 h with horseradish peroxidase 259

(WGA-HRP conjugate; Lectinotest Laboratory, Lviv, Ukraine). HRP activity 260

was visualized via chromogenic detection using 4-Chloride-1-naphthol (Sigma, 261

St. Louis, MO, USA) as substrate. The quantitation (titer) of PIA was 262

represented as the highest dilution of the supernatant detectable. 263

Detection of accumulation-associated protein (Aap). Aap expression 264

on Septem


.org/D

ownloaded from

http://jb.asm.org/

13

of SE1457 isogenic srrA mutant strains was determined by Western blot 265

analysis with an Aap specific monoclonal antibody (MAb18B6) made in our 266

laboratory (26). In brief, 24-h biofilm and 12 h-planktonic cells of S. epidermidis 267

strains were collected and adjusted to an identical OD600 value after washing 268

with PBS. The bacteria was treated with lysostaphin (Sigma, St. Louis, MO, 269

USA), and centrifuged (20,000 g) at 4 for 30 min. The supernatants were 270

separated using SDS-PAGE (7%), and blotted onto polyvinylidene fluoride 271

(PVDF) membrane (0.45 μm, Millipore, Billerica, MA, USA) by 272

electro-transferring. The membrane was incubated with MAb18B6 (10 ng/ml) 273

and then with goat anti-mouse IgG conjugated with horseradish peroxidase 274

(HRP) (Santa Cruz, CA, USA), and visualized using an ECL Western blotting 275

system (Thermo Fisher Scientific, Waltham, USA). 276

Quantification of extracellular DNA. The isolation of extracellular DNA 277

(eDNA) from biofilms was performed as described previously (15, 26). In brief, 278

the 24-h biofilms cultured in a 96-well polystyrene plate were chilled at 4 for 279

1 h, EDTA was added at a final concentration of 2.5 mM. After measurement of 280

OD600 of unwashed biofilm (biofilm biomass), eDNA extraction solution (50 mM 281

Tris-HCl, 10 mM ETDA, and 500 mM NaCl, pH 8.0) was added into the wells. 282

The biofilms were scraped off, and centrifuged (13,000 g) for 5 min at 4 . The 283

eDNA in the supernatant was extracted with phenol/chloroform/isoamyl 284

alcohol (25:24:1), precipitated with 100% alcohol, and re-suspended in TE 285

buffer. 286

on Septem


.org/D

ownloaded from

http://jb.asm.org/

14

The amount of eDNA was quantified by q-PCR with SYBR Premix Ex Taq 287

(Takara Bio Inc., Shiga, Japan), using gyrB (gyrase B), serp0306 (ferrichrome 288

transport ATP-binding protein A), leuA (2-isopropylmalate synthase), and lysA 289

(diaminopimelate decarboxylase A) primers as listed in Table 2. Each gene in 290

the qPCR was assayed in triplicate for three independent experiments. The 291

relative quantitation of eDNA in each sample was calculated as total eDNA (ng) 292

divided by biofilm biomass (OD600). 293

Observation of biofilms with CLSM and SEM. For observation of 294

bacterial biofilms under Confocal Laser Scanning Microscopy (CLSM, Leica 295

TCS SP5, Mannheim, Germany), overnight cultures of SE1457, srrA and 296

srrA(pCN51-srrAB) were inoculated into Fluorodishes (2 ml/dish, FD35-100, 297

WPI, Sarasota, FL, USA), and incubated statically at 37°C for 24 h (7, 26). 298

Then the biofilms on the dishes were rinsed gently with 0.85% NaCl and 299

observed under CLSM with SYTO9 and propidium iodide (PI) staining 300

(Live/Dead kit, Invitrogen, Carlsbad, CA, USA). The Z-stack composite 301

confocal photomicrographs of viable cells (green) and dead cells (red) were 302

generated using Leica LAS AF software. The fluorescence of each stack was 303

quantified using ImageJ software. At least three independent experiments 304

were carried out. 305

For observation of bacterial biofilms under Scanning Electron Microscopy 306

(SEM, JSM-6700F, JEOL, Tokyo, Japan), staphylococcal strains SE1457, 307

srrA and srrA(pCN51-srrAB) were cultured in a 6-well plate (35 mm 308

on Septem


.org/D

ownloaded from

http://jb.asm.org/

15

diameter) with three sterile disks (8 mm diameter, 1 mm thickness, with 2 mm 309

chimb) in each well. After 24-h incubation at 37 , disks were rinsed with PBS, 310

fixed with 2.5% glutaraldehyde in PBS, vacuum drying for 72 h, sputtered with 311

platinum, and then observed under a field emission source instrument. 312

RNA isolation and microarray analysis. Total RNA was isolated using 313

the RNeasy Mini kit (QIAGEN, Hilden, Germany) according to the 314

manufacturer’s instructions. In brief, bacterial culture in a flask for oxic 315

condition or in 50-ml syringes for micro-aerobic condition were harvested after 316

6 h incubation at 37 with shaking. The cell pellets were washed with ice-cold 317

0.85% NaCl, and then homogenized using 0.1 mm Ziconia-silica beads in a 318

Mini-Beadbeater (Biospec, Bartlesville, OK, USA) at a speed of 4800 rpm for 319

40 sec as a cycle for 5 times with 1 min intervals on ice in each cycle. The RNA 320

eluted from the silica-based filter was extracted with 321

phenol/chloroform/isoamyl alcohol and precipitated with ethanol. The quantity 322

and quality of the total RNA were assessed by using the Nanodrop ND-1000 323

spectrophotometer (Nanodrop Technologies, Wilmington, DE, USA) and gel 324

electrophoresis. 325

Microarray analysis was performed by in situ synthesis of 14,527, 60-mer 326

long oligonucleotide probes (Agilent, Palo Alto, CA, USA) as previously 327

described by Charbonnier, et al.(15, 36), which cover more than 95% of ORFs 328

annotated in S. epidermidis strains ATCC12228 (accession number 329

NC_004461) and ATCC35984 (accession number NC_002976). Total RNAs 330

on Septem


.org/D

ownloaded from

http://jb.asm.org/

16

(10 μg) from SE1457 were labeled by Cyanine-3 dCTP (green Cy3, 331

Perkin-Elmer Life Sciences, Boston, MA, USA) using the SuperScript II 332

(Invitrogen, Basel, Switzerland). Purified genomic DNA from the reference 333

strains was labeled with Cyanine-5 dCTP (red Cy5) and used for microarray 334

normalization. Mixtures of Cy5-labeled DNA and Cy3-labeled cDNA were 335

hybridized and scanned in a dedicated oven as previously described (37). 336

Fluorescence intensities were quantified using Feature Extraction software 337

(Agilent, version 8). Data were normalized to baseline using red channel data 338

as control. A false discovery rate value of 5% (P value cutoff; 0.05) was used 339

for variance analysis of three biological replicates, and an arbitrary threshold of 340

3.0 fold for defining significant differences in expression ratios. The complete 341

microarray data set is posted on the Gene Expression Omnibus database, 342

available at http://www.ncbi.nlm.nih.gov/geo/, under accession numbers 343

GPL13532 for the platform design and GSE47101 for the original data set. 344

Quantitative real-time RT-PCR (qRT-PCR). The RNA extracted from 345

bacteria strains was treated with DNase I and reversely transcribed into cDNA 346

using iScript reverse transcriptase (Bio-Rad, Hercules, CA, USA) by incubation 347

for 5 min at 25 , followed by 30 min at 42 and 5 min at 85 . Then q-PCRs 348

were performed using SYBR green PCR reagents (Premix EX TaqTM, Takara 349

Biotechnology, Dalian, China) in the Mastercycler realplex system (Eppendorf 350

AG, Hamburg, Germany), with the amplification conditions as 95 for 30 sec, 351

40 cycles of 95 for 5 sec, 60 for 34 sec, followed by melting curve 352

on Septem


.org/D

ownloaded from

http://jb.asm.org/

17

analysis. A housekeeping gene gyrB (DNA gyrase subunit B) was used to 353

normalize the transcript levels of genes in the q-PCRs. All qRT-PCRs were 354

carried out in triplicate with at least three independent RNA samples. The 355

sequences of the primers were designed using Beacon designer software 356

(Premier Biosoft International Ltd., Pal Alto, CA, USA) and listed in Table 3. 357

Expression and purification of recombinant SrrA. To determine the 358

DNA-binding properties of SrrA, a recombinant expression plasmid 359

(pET28a-srrA) was constructed by inserting the srrA fragment amplified from 360

SE1457 with primers pET-28a-srrA-F/pET-28a-srrA-R (listed in Table 2) into 361

vector pET28a(+), and transferred into E. coli BL21 (DE3). When bacteria 362

were grown to OD600 value of 0.6 at 37 , 0.8 mM isopropyl 363

β-D-1-thiogalactopyranoside (IPTG) was added for overnight incubation at 364

22 . The cells re-suspended in lysis buffer (50 mM NaH2PO4, pH8.0, 300 mM 365

NaCl, 0.1 mM EDTA, 1 mM PMSF) were sonicated, centrifuged at 15,000 g for 366

30 min, and the supernatants were loaded onto a nickel-nitrilotriacetic acid 367

column (QIAGEN GmbH., Hilton, Germany). His-tagged SrrA was eluted using 368

a linear gradient of 20-300 mM imidazole, enriched by ultrafiltration, and the 369

protein concentration was determined using Bradford protein quantification kit 370

(TIANGEN, Beijing, China). 371

Electrophoresis Mobility Shift Assay. To determine the interaction 372

between SrrA and the promoter regions of putative target genes, 373

electrophoresis mobility shift assay (EMSA) was carried out using a digoxin gel 374

on Septem


.org/D

ownloaded from

http://jb.asm.org/

18

shift kit (Roche Diagnostics GmbH, Mannheim, Germany) according to the 375

manufacturer’s instructions. In brief, the predicted promoter regions of icaA, 376

icaR (approximately 80 bp fragments), srrAB, qoxB, pflB, sarA and rsbU 377

(approximately 140 bp fragments) were amplified by PCR with the primers 378

listed in Table 2. The DNA fragments were purified using a Gel Extraction Kit 379

(Qiagen, Hilton, Germany) and labeled with digoxin using terminal transferase. 380

Purified His-tagged SrrA was phosphorylated (SrrA-P) by incubating with 50 381

mM acetylphosphate (Sigma, St. Louis, MO, USA) for 1 h at room temperature. 382

Each gel shift assay included the probe labeled with digoxin plus increasing 383

concentrations of SrrA-P (ranging from 1.2 to 0.3 μM in twofold dilution), a 384

125-fold molar excess of unlabeled probe as a competitor was added into the 385

labeled probe plus 1.2 μM SrrA-P, and a labeled probe as a control. The 386

119-bp coding sequence of S. epidermidis rpsJ was designated as a negative 387

control for SrrA-DNA binding. All samples were incubated at 25 for 20 min, 388

separated by electrophoresis on 6% non-denaturing polyacrylamide gel, and 389

blotted onto a positively charged nylon membrane (Millipore, Bedford, MA, 390

USA). The blots were incubated with alkaline phosphatase conjugated 391

anti-digoxin antibody, followed by Chloro-5-substituted 392

adamantyl-1,2-dioxetane phosphate (CSPD) solution for chemiluminescent 393

detection, and exposed to X-ray film. 394

Statistical analysis. Data from the biofilm assay, initial attachment assay 395

and CFU enumeration assay were analyzed by the GraphPad Prism program 396

on Septem


.org/D

ownloaded from

http://jb.asm.org/

19

(San Diego, CA, USA) using the Student’s t-test. Differences with a P value 397

less than 0.05 were considered statistically significant. 398

399

RESULTS 400

The srrA displayed growth defect under oxic and micro-aerobic 401

conditions. To assess whether srrAB expression responds to oxygen stress, 402

transcription of srrAB in SE1457 was analyzed by qRT-PCR during the shift 403

fromoxic to micro-aerobic condition. Indeed, both srrA and srrB expressions 404

was up-regulated (2- or 3-fold increase) under micro-aerobic condition, 405

whereas the expression of arlRS monitored as a control showed no obvious 406

change (Fig. 1A), indicating that SrrAB displayed function differently under oxic 407

and micro-aerobic conditions. 408

The S. aureus (WCUH29) srrA mutant displayed a marked reduction in 409

growth under anaerobic conditions, whereas it showed no differences in 410

colony size or growth rate under oxic conditions compared with the parent 411

strain (19). In contrast, in this work we found that under oxic conditions 412

SE1457 srrA formed smaller colonies than parent strain, and under 413

micro-aerobic conditions, no srrA colonies were evident on TSA plates even 414

after 24-h incubation (Fig. 1B). 415

In liquid medium under oxic conditions, SE1457 entered early log phase 416

(OD600 of 0.65) by 4 h after inoculation, but srrA took about 6 h to reach a 417

similar growth level (OD600 of 0.74). Growth of the srrAB complementation 418

on Septem


.org/D

ownloaded from

http://jb.asm.org/

20

strain srrA(pCN51-srrAB) was restored to the wild-type level, whereas growth 419

of the srrA complementation strain srrA(pRAB11-srrA) was partially 420

recovered. Under micro-aerobic conditions, to reach OD600 1.0 srrA needed 421

15-h incubation, while the parent strain needed only 7 h. The complementation 422

strains srrA(pCN51-srrAB) and srrA(pRAB11-srrA) required 6-h or 9-h 423

incubation respectively to reach an OD600 of 1.0 (Fig. 1C). Under either oxic or 424

micro-aerobic conditions, transformation of pCN51 or pRAB11-srrB had no 425

effect on srrA growth.426

Deletion of srrA impaired biofilm development in vitro. The impact of 427

srrA deletion on the biofilm formation of S. epidermidis in vitro was investigated 428

by a semi-quantitative micro-plate assay. Bacterial biofilm formation was 429

monitoredat 6 h, 12 h, 24 h and 48 h under oxic conditions, or 12 h, 24 h, 48 h 430

and 72 h under micro-aerobic conditions. 431

Under oxic conditions, srrA also produced less biofilm than the parent 432

strain at the above time points, whereas the biofilm of srrA(OD570=0.61±0.03) 433

was dramatically decreased compared to wild-type strain (OD570=2.65±0.08) 434

(Fig. 2A, B). Under micro-aerobic conditions, no biofilm formation was 435

observed in srrA at 12 h or 24 h. After 48 h incubation, biofilm produced by 436

srrA had OD570=0.25±0.02, significantly less than its wild-type counterpart 437

(OD570=0.93±0.04) (Fig. 2A, C). 438

Under both oxic and micro-aerobic conditions, the biofilm-forming ability 439

was restored in the complementation strain srrA(pCN51-srrAB) 440

on Septem


.org/D

ownloaded from

http://jb.asm.org/

21

(OD570=1.93±0.14, 0.95±0.11 respectively), and partially restored in 441

srrA(pRAB11-srrA) (OD570=1.13±0.03, 0.67±0.02). Transformation of the 442

vector alone had no effect on srrA biofilm formation. 443

When biofilms of SE1457, srrA and srrA(pCN51-srrAB) that had been 444

cultured under oxic conditions were observed under CLSM with live/dead 445

staining, the thickness of srrA biofilm was much less (5.97±0.34 μm) than that 446

of the parent strain (22.2±2.06 μm) (p<0.01), and the thickness was restored 447

by complementation with pCN51-srrAB (10.16±1.51 μm). There were more 448

dead cells in srrA biofilm than in wild-type counterpart (PI/Total=0.23 versus 449

0.072, p<0.01), whereas fewer dead cells were observed in 450

srrA(pCN51-srrAB) biofilm (PI/Total= 0.017) (Fig. 3). 451

Deletion of srrA abolished biofilm formation in vivo. To determine 452

whether srrA deletion had an impact on in-vivo biofilm formation, a rabbit 453

subcutaneous foreign body infection model was used. Staphylococcal strains 454

(108 CFU) were injected into the cavities with implanted polystyrene disks on 455

the animal’s back. After 72 h, biofilm on the disks was observed under SEM. 456

SE1457 formed a compact biofilm covered with secreted substance on the 457

implanted disks, while srrA formed only a few bacterial clusters. The amount 458

of biofilm produced by complementation strain srrA(pCN51-srrAB) was 459

similar to that of the wild-type strain (Fig. 4A). The viable bacterial cells in 460

srrA biofilm formed in vivo (CFU=8.82×103) were significantly fewer than that 461

in those of SE1457 (CFU=5.49×104) (p<0.01) and srrA(pCN51-srrAB) 462

on Septem


.org/D

ownloaded from

http://jb.asm.org/

22

(CFU=6.14×104) (Fig. 4B). 463

Deletion of srrA diminished initial attachment of S. epidermidis. 464

Biofilm formation by S. epidermidis is generally a two-step process involving 465

an initial attachment and a subsequent maturation phase. The initial 466

attachment of srrA to polystyrene plates was determined by using ImageJ 467

software. Attached cells of srrA(about 1.35×103per field) were 3.4 fold less 468

than those of the parent strain (about 4.54×103per field) and of the 469

complementation strain srrA(pCN51-srrAB) (about 5.61×103) (Fig. 5A), and 470

this was confirmed by crystal violet staining with measurement at OD570 (Fig. 471

5B). 472

Deletion of srrA affected the biofilm matrix production in S. 473

epidermidis. To investigate the effect of srrA deletion on the biofilm matrix 474

production, the release of PIA, eDNA, and Aap were determined in SE1457, 475

srrA, srrA(pCN51-srrAB) and srrA(pCN51). PIA, a major factor affecting 476

biofilm accumulation, was detected semi-quantitatively with WGA-HRP. Under 477

both oxic and micro-aerobic conditions, srrA and the vector control strain 478

srrA(pCN51) produced less PIA than either SE1457 or the complementation 479

strain srrA(pCN51-srrAB)(Fig. 6A). No differences of Aap expression in 480

biofilms or planktonic cells of SE1457, srrA and srrA(pCN51-srrAB) were 481

detected by Western Blot with monoclonal antibody (18B6) against Aap protein 482

B repeat region (Fig. 6B). The relative concentrations of eDNA in 24-h biofilms 483

of srrA and vector control strain srrA(pCN51) were about 5-fold higher than 484

on Septem


.org/D

ownloaded from

http://jb.asm.org/

23

that of either the parent strain SE1457 (p<0.01) or the complementation strain 485

srrA(pCN51-srrAB), as shown in Fig. 6C. 486

In srrA transcriptional profile was severely altered compared to the 487

wild-type strain. DNA microarray was used to compare transcriptional profiles 488

of SE1457 and srrA under oxic or micro-aerobic conditions. Under 489

micro-aerobic conditions, 230 differentially expressed genes were found, 490

which were involved in respiratory and energy metabolism, biofilm formation, 491

and cell wall biosynthesis, etc. Among them, 118 genes were up-regulated and 492

112 were down-regulated in srrA. The latter included genes involved in 493

cytochrome and quinol-oxidase biosynthesis and assembly (e.g., qoxACD, 494

ctaAB, atpC), as well as anaerobic metabolism related genes such as pflBA 495

(formate acetyltransferase), nrdD (anaerobic ribonucleoside triphosphate 496

reductase), serp0257 (alcohol dehydrogenase), serp2257 (acetoin reductase), 497

serp2133 (D-lactate dehydrogenase), serp2381 (NADH: flavin 498

oxidoreductase/fumarate reductase flavoprotein subunit) (Table 4). Under oxic 499

conditions the srrA mutation affected expression of 51 genes; 33 genes were 500

up-regulated and 18 genes down-regulated. Similar to findings under 501

micro-aerobic conditions, down regulation was observed in respiratory and 502

energy metabolism related genes, including srrA, serp2324 (branched-chain 503

alpha-keto acid dehydrogenase subunit E2), serp2327 (acetoin 504

dehydrogenase, E3 component, dihydrolipoamide dehydrogenase), serp2379 505

(acetoindiacetyl reductase), ppdK (pyruvate phosphate dikinase), and nrdDG. 506

on Septem


.org/D

ownloaded from

http://jb.asm.org/

24

Protein synthesis related genes, including rpsORTD and rplNS were 507

up-regulated (Table 5). These results were confirmed by qRT-PCR, and 508

suggested that retarded growth may result from low expression levels of the 509

genes involved in the respiratory electron transport chain and anaerobic 510

metabolism. 511

Transcription levels of biofilm-related genes were also confirmed by 512

qRT-PCR. Compared to SE1457, icaR in srrA was down-regulated 3.1-fold 513

under micro-aerobic conditions, while up-regulated 5.1-fold under oxic 514

conditions. The transcription levels of icaA and atlE in srrA were 515

down-regulated about 10-fold and 5-fold respectively under micro-aerobic 516

conditions, and 8-fold and 4-fold under oxic conditions. In addition, no 517

significant difference in the expression of rsbU, sarA and aap was detected by 518

qRT-PCR between the SE1457 and srrA mutant under either condition (Table 519

4, 5). 520

Binding of recombinant SrrA protein to the putative promoter 521

regions. To further study the regulation role of SrrAB in the biofilm formation, 522

EMSA was carried out with digoxin-labeled putative promoter regions and 523

recombinant SrrA (His-tagged SrrA). The 132 bp DNA fragment upstream of 524

srr (p-srr) formed a shifted complex with phosphorylated SrrA (SrrA-P) in a 525

dose-dependent manner, but not with un-phosphorylated SrrA (Fig. 7A, B, lane 526

2 to lane 4). Addition of 125-fold excess of unlabeled p-srr as a specific 527

competitor blocked SrrA-DIG-DNA complex formation (Fig. 7B, lane 5). 528

on Septem


.org/D

ownloaded from

http://jb.asm.org/

25

SrrA-P resulted in a mobility shift of the 82-bp, 85-bp, 145-bp, or 151-bp 529

fragments upstream of icaR, icaA, qoxB, or pflB, respectively (Fig. 7C, D, E 530

and F). SrrA-P did not bind to the fragment upstream of sarA and rsbU (Fig. 7G, 531

H). As a negative control, a 119-bp DNA fragment of rpsJ gene did not form a 532

complex with Srr-P under the same conditions (Fig. 7I).The results indicated 533

that SrrA-P was able to bind specifically to the promoter regions of certain 534

biofilm-related genes as well as some genes involved in respiratory 535

metabolism. 536

537

DISCUSSION 538

SrrAB in S. aureus modulates biofilm formation and expression of virulence 539

factors (such as tst, spa, agr and ica, etc.) under oxic and anaerobic conditions 540

(20-22, 38-40). However, the role of SrrAB in regulation of S. epidermidis 541

biofilm formation and growth is not clear. In this study, we firstly compared 542

protein sequence of SrrA in S. epidermidis strain 1457 with that in S. aureus 543

strain COL. They shared 90.5% identity (Fig. S1A). SE1457 srrA and srrB 544

were oriented in tandem and overlapped by 20 nucleotides. srrAB forms an 545

operon with a putative promoter upstream of srrA and a transcription 546

terminator structure 547

(ATATATGAAAAACGCCTGCGACTCAGAGTGATGTCTCAGGCGTTTTTTTG548

TATATA) located at 81 bp downstream of srrB translational stop codon. By 549

RT-PCR a single mRNA covering srrAB was verified (Fig. S1B). Then we 550

on Septem


.org/D

ownloaded from

http://jb.asm.org/

26

found that oxygen limitation induced the expression of srrAB in S. epidermidis, 551

while stressors such as vancomycin, ethanol or high NaCl had no effect (Fig. 552

S3). This indicated that SrrAB of S. epidermidiss electively responds to 553

micro-aerobic stress. 554

To study the role of SrrAB in regulating biofilm formation and growth of S. 555

epidermidis, a srrA deletion mutant ( srrA) from SE1457 was constructed. 556

srrA exhibited impaired biofilm formation and delayed growth under both oxic 557

and micro-aerobic conditions, which was restored by complementation with 558

srrAB. A double genes deletion mutant, srrAB was constructed, and showed 559

similar phenotypes to srrA. It demonstrates that SrrAB regulates S. 560

epidermidis growth under both oxic and micro-aerobic conditions. However, in 561

S. aureus, srrAB regulated bacterial growth only under anaerobic conditions 562

(20-22, 38), suggesting that the role of SrrAB in the growth of S. epidermidis is 563

different from that in S. aureus. Then we further analyzed transcriptional profile 564

by microarray and qRT-PCR, it revealed that the mRNA levels of qoxBACD, 565

ctaA, pflBA, nrdDG, etc. were significantly reduced in the srrA mutant 566

compared to the parent strain (Table 4, 5). 567

The qoxBACD operon encodes the aa3-type quinol oxidase, one of the 568

two terminal oxidases in S. aureus. Terminal oxidases deficiency usually 569

results in an inability to respire and a severe growth defect in bacteria. 570

Hammer et al. (41) found that a double mutant lacking both qoxB and cydB 571

showed signi cantly reduced aerobic growth and a small-colony variant (SCVs) 572

on Septem


.org/D

ownloaded from

http://jb.asm.org/

27

phenotype, indicating that the mutant was unable to respire aerobically. Similar 573

results were found by Kinkel et al. (42): the qoxBACD mutant exhibited a 574

modest growth defect under aerobic condition, and either srrAB or qoxBACD 575

mutant strains were unable to reach maximal final cell density. In the present 576

study, expression of qoxBACD operon in srrA was down-regulated, and SrrA 577

was able to bind the promoter region of qoxBACD (Fig.7). Therefore, we 578

speculated that the aerobic growth retardation of the S. epidermidis srrA 579

mutant may have resulted from down-regulation of qoxBACD operon impairing 580

respiratory chain reaction. 581

Under anaerobic conditions, expression levels of pflBA operon and nrdDG 582

were reported highly induced in S. aureus (43, 44). PflA is an activating 583

enzyme of PflB, a pyruvate formatelyase that catalyzes the reversible 584

conversion of pyruvate to formate, thereby producing acetyl coenzyme A 585

(acetyl-CoA). Thus, pflBA operon is important for energy supply when pyruvate 586

is available and favors the growth of cells under fermentation conditions (45). 587

The protein encoded by nrdDG is a class III ribonucleotide reductase that 588

catalyzes synthesis of dNTPs via reduction of NTPs under anaerobic 589

conditions (17, 42, 46). In this study, under micro-aerobic condition, srrA of S. 590

epidermidis displayed severe growth retardation and inability to reach maximal 591

final cell density, which may be related with down-regulation of pflBA and 592

nrdDG expression, and subsequent decrease of fermentation and DNA 593

replication. Additionally, SrrA was able to bind the promoter region of pflBA 594

on Septem


.org/D

ownloaded from

http://jb.asm.org/

28

(Fig.7). It indicates that under micro-aerobic condition, SrrAB regulates S. 595

epidermidis growth via pflBA (Fig. 8). 596

Besides its effect on bacterial growth, SrrAB regulates S. aureus biofilm 597

formation (22, 39, 42). In the present study, srrA deletion resulted in decrease 598

of S. epidermidis biofilm formation under both oxic and micro-aerobic 599

conditions. Although under oxic condition srrA needed two more hours to 600

enter stationary phase than wild-type strain (Fig. 1), the optical density of the 601

two strains was similar after entering stationary phase (Fig. S4). This indicates 602

that under oxic conditions decreased biofilm formation by the srrA mutant 603

may not be directly related to growth defects. Nevertheless, under 604

micro-aerobic conditions, where the biofilm formed by srrA was less than that 605

by SE1457, and srrA was unable to reach the optical density as high as 606

SE1457 even if the culture time was extended to 48 h (Fig. 2A, C). This 607

suggests that under micro-aerobic conditions, an effect of growth retardation 608

on decreased biofilm formation in srrA mutant cannot be excluded. 609

Then, we further analyzed the possible mechanism that led to biofilm 610

reduction in S. epidermidis srrA. The initial adherence, as a crucial step of 611

biofilm formation, was decreased in srrA (Fig. 5), which indicated that SrrAB 612

participated in the early stage of biofilm development. PIA production, which is 613

regarded as the most important intercellular adherence factor and glue in the 614

accumulation stage of biofilm formation in staphylococci (4, 9), was decreased 615

in srrA compared to the parent strain, especially under micro-aerobic 616

on Septem


.org/D

ownloaded from

http://jb.asm.org/

29

condition (Fig. 6). In S. aureus srrA transposon mutant, PIA synthesis was 617

increased while biofilm formation was decreased (23). It suggests that the 618

mechanisms of biofilm formation regulated by SrrAB in S. epidermidis differ 619

from those of S. aureus. 620

In S. aureus, SrrAB regulate biofilm formation via IcaR, a repressor of ica 621

operon. Under aerobic conditions, S. aureus SrrAB decreased biofilm 622

formation through up-regulating icaR expression, while enhanced biofilm 623

formation through down-regulating icaR expression under micro-aerobic 624

conditions (39). In this study, it was found that transcription of icaR was 625

up-regulated in S. epidermidis srrA under oxic conditions, whereas 626

down-regulated under micro-aerobic conditions; icaA expression was 627

down-regulated under both conditions. Under oxic conditions, S. epidermidis 628

SrrAB positively regulated icaADBC expression and down-regulated icaR 629

expression which is correlated with PIA production and biofilm formation. 630

Under micro-aerobic conditions, transcription of both icaR and icaADBC in 631

srrA were down regulated, and PIA synthesis was decreased. We 632

demonstrated that phosphorylated SrrA of S. epidermidis bound to the 633

promoter regions of icaR, icaA. It suggests that S. epidermidis SrrAB response 634

to oxygen variation to modulate biofilm formation in an ica-dependent pathway 635

(Fig. 8). 636

Other intercellular matrix components may play important role in the 637

biofilm formation. Extracellular DNA (eDNA) is released following bacterial 638

on Septem


.org/D

ownloaded from

http://jb.asm.org/

30

autolysis (7, 15). The amount of eDNA within srrA biofilm was more than that 639

in parent strain. The percentage of dead cells in srrA biofilm was much higher 640

than that in the parent strain biofilm, although there was no difference between 641

srrA and SE1457 in cell viability in planktonic conditions or TritonX-100 642

induced autolysis (Fig. S5). Kinkel et al. (42) demonstrated that the srrAB 643

mutant of S. aureus UAMS-1 had reduced capacity to form biofilm under static 644

aeration conditions and its biofilm contained significantly more dead cells than 645

the wild-type biofilm, and this was correlated with the loss of its structural 646

integrity. It has been reported that pflBA was up-regulated in the deeper layer 647

of the biofilm, which may be related with the survival of biofilm cells in that 648

place (45). In the present study, transcription of pfl operon was down-regulated 649

in the srrA mutant of S. epidermidis, which maybe associated with the 650

increased proportion of dead cells found in srrA biofilm. 651

In summary, S. epidermidis SrrAB responds to micro-aerobic stress and 652

modulates biofilm formation in an ica-dependent manner. The mechanism that 653

SrrAB regulates bacterial growth varies with environmental oxygen 654

concentration: under oxic conditions, SrrAB modulates respiratory chain 655

reaction by positively regulating qoxBACD transcription, while under 656

micro-aerobic conditions it regulates fermentation processes and DNA 657

replication via pfl operon and nrdDG (Fig. 8). It provided a new insight into the 658

SrrAB mediated regulation of biofilm formation and growth of S. epidermidis. 659

660

on Septem


.org/D

ownloaded from

http://jb.asm.org/

31

ACKNOWLEDGEMENTS 661

We thank Prof. Caiguang Yang and Dr. Xing Liu from Chinese Academy of 662

Sciences for assistance with gel shift reactions. We also thank Prof. Li Chen 663

from Shanghai Medical College of Fudan University for helpful discussion. 664

This work was supported by the National Science and Technology Major 665

Project of China [2012ZX09301002-005, 2012ZX10003008-010], the National 666

Natural Science Foundation of China (No. 81271791, 81101214) and 667

Deutsche Forschungsgemeinschaft SFB766. 668

669

670

REFERENCES 671

1. Maduka-Ezeh AN, Greenwood-Quaintance KE, Karau MJ, Berbari EF, Osmon 672

DR, Hanssen AD, Steckelberg JM, Patel R. 2012. Antimicrobial susceptibility and 673

biofilm formation of Staphylococcus epidermidis small colony variants associated 674

with prosthetic joint infection. Diagn Microbiol Infect Dis 74:224-229. 675

2. Götz F, Peters G: 2000.Colonization of medical devices by coagulase-negative 676

staphylococci. In: Infections associated with indwelling medical devices. Edited by 677

Waldvogel FA, Bisno AL, 3rd edition edn. Washington, D.C.: ASM: 55 - 88. 678

3. Otto M. 2008. Staphylococcal biofilms. Curr Top Microbiol Immunol 322:207-228. 679

4. Götz F. 2002. Staphylococcus and biofilms. Molecular Microbiology 43:1367-1378. 680

5. Dunne WM, Jr. 2002. Bacterial adhesion: seen any good biofilms lately? Clin 681

Microbiol Rev 15:155-166. 682

on Septem


.org/D

ownloaded from

http://jb.asm.org/

32

6. Rupp ME, Fey PD, Heilmann C, Götz F. 2001. Characterization of the importance of 683

Staphylococcus epidermidis autolysin and polysaccharide intercellular adhesin in the 684

pathogenesis of intravascular catheter-associated infection in a rat model. J Infect 685

Dis 183:1038-1042. 686

7. Qin Z, Ou Y, Yang L, Zhu Y, Tolker-Nielsen T, Molin S, Qu D. 2007. Role of 687

autolysin-mediated DNA release in biofilm formation of Staphylococcus epidermidis. 688

Microbiology 153:2083-2092. 689

8. Otto M. 2012. Staphylococcal Infections: Mechanisms of Biofilm Maturation and 690

Detachment as Critical Determinants of Pathogenicity. Annu Rev Med. 691

9. Periasamy S, Joo HS, Duong AC, Bach TH, Tan VY, Chatterjee SS, Cheung GY, 692

Otto M. 2012. How Staphylococcus aureus biofilms develop their characteristic 693

structure. Proc Natl Acad Sci U S A 109:1281-1286. 694

10. Knobloch JK, Bartscht K, Sabottke A, Rohde H, Feucht HH, Mack D. 2001. 695

Biofilm formation by Staphylococcus epidermidis depends on functional RsbU, an 696

activator of the sigB operon: differential activation mechanisms due to ethanol and 697

salt stress. J Bacteriol 183:2624-2633. 698

11. Heilmann C, Hussain M, Peters G, Götz F. 1997. Evidence for autolysin-mediated 699

primary attachment of Staphylococcus epidermidis to a polystyrene surface. 700

Molecular Microbiology 24:1013-1024. 701

12. Olson ME, Garvin KL, Fey PD, Rupp ME. 2006. Adherence of Staphylococcus 702

epidermidis to biomaterials is augmented by PIA. Clin Orthop Relat Res 451:21-24. 703

13. Tormo MA, Marti M, Valle J, Manna AC, Cheung AL, Lasa I, Penades JR. 2005. 704

on Septem


.org/D

ownloaded from

http://jb.asm.org/

33

SarA is an essential positive regulator of Staphylococcus epidermidis biofilm 705

development. J Bacteriol 187:2348-2356. 706

14. Zhu T, Lou Q, Wu Y, Hu J, Yu F, Qu D. 2010. Impact of the Staphylococcus 707

epidermidis LytSR two-component regulatory system on murein hydrolase activity, 708

pyruvate utilization and global transcriptional profile. BMC Microbiol 10:287. 709

15. Lou Q, Zhu T, Hu J, Ben H, Yang J, Yu F, Liu J, Wu Y, Fischer A, Francois P, 710

Schrenzel J, Qu D. 2011. Role of the SaeRS two-component regulatory system in 711

Staphylococcus epidermidis autolysis and biofilm formation. BMC Microbiol 11:146. 712

16. Wu Y, Wang J, Xu T, Liu J, Yu W, Lou Q, Zhu T, He N, Ben H, Hu J, Götz F, Qu D. 713

2012. The two-component signal transduction system ArlRS regulates 714

Staphylococcus epidermidis biofilm formation in an ica-dependent manner. PLoS 715

One 7:e40041. 716

17. Sun G, Sharkova E, Chesnut R, Birkey S, Duggan MF, Sorokin A, Pujic P, 717

Ehrlich SD, Hulett FM. 1996. Regulators of aerobic and anaerobic respiration in 718

Bacillus subtilis. J Bacteriol 178:1374-1385. 719

18. Nakano MM, Zuber P, Glaser P, Danchin A, Hulett FM. 1996. Two-component 720

regulatory proteins ResD-ResE are required for transcriptional activation of fnr upon 721

oxygen limitation in Bacillus subtilis. J Bacteriol 178:3796-3802. 722

19. Throup JP, Zappacosta F, Lunsford RD, Annan RS, Carr SA, Lonsdale JT, 723

Bryant AP, McDevitt D, Rosenberg M, Burnham MK. 2001. The srhSR gene pair 724

from Staphylococcus aureus: genomic and proteomic approaches to the identification 725

and characterization of gene function. Biochemistry-Us 40:10392-10401. 726

on Septem


.org/D

ownloaded from

http://jb.asm.org/

34

20. Yarwood JM, McCormick JK, Schlievert PM. 2001. Identification of a novel 727

two-component regulatory system that acts in global regulation of virulence factors of 728

Staphylococcus aureus. J Bacteriol 183:1113-1123. 729

21. Pragman AA, Yarwood JM, Tripp TJ, Schlievert PM. 2004. Characterization of 730

virulence factor regulation by SrrAB, a two-component system in Staphylococcus 731

aureus. J Bacteriol 186:2430-2438. 732

22. Ulrich M, Bastian M, Cramton SE, Ziegler K, Pragman AA, Bragonzi A, Memmi G, 733

Wolz C, Schlievert PM, Cheung A, Döring G. 2007. The staphylococcal respiratory 734

response regulator SrrAB induces ica gene transcription and polysaccharide 735

intercellular adhesin expression, protecting Staphylococcus aureus from neutrophil 736

killing under anaerobic growth conditions. Molecular Microbiology 65:1276-1287. 737

23. Tu Quoc PH, Genevaux P, Pajunen M, Savilahti H, Georgopoulos C, Schrenzel J, 738

Kelley WL.2007. Isolation and characterization of biofilm formation-defective mutants 739

of Staphylococcus aureus. Infect Immun 75:1079-1088. 740

24. Cerca N, Brooks JL, Jefferson KK. 2008. Regulation of the intercellular adhesin 741

locus regulator (icaR) by SarA, sigmaB, and IcaR in Staphylococcus aureus. J 742

Bacteriol 190:6530-6533. 743

25. Rohde H, Burdelski C, Bartscht K, Hussain M, Buck F, Horstkotte MA, Knobloch 744

JK, Heilmann C, Herrmann M, Mack D. 2005. Induction of Staphylococcus 745

epidermidis biofilm formation via proteolytic processing of the 746

accumulation-associated protein by staphylococcal and host proteases. Molecular 747

Microbiology 55:1883-1895. 748

on Septem


.org/D

ownloaded from

http://jb.asm.org/

35

26. Hu J, Xu T, Zhu T, Lou Q, Wang X, Wu Y, Huang R, Liu J, Liu H, Yu F, Ding B, 749

Huang Y, Tong W, Qu D. 2011. Monoclonal antibodies against 750

accumulation-associated protein affect EPS biosynthesis and enhance bacterial 751

accumulation of Staphylococcus epidermidis. PLoS One 6:e20918. 752

27. Christner M, Heinze C, Busch M, Franke G, Hentschke M, Bayard Duhring S, 753

Buttner H, Kotasinska M, Wischnewski V, Kroll G, Buck F, Molin S, Otto M, 754

Rohde H. 2012. sarA negatively regulates Staphylococcus epidermidis biofilm 755

formation by modulating expression of 1 MDa extracellular matrix binding protein and 756

autolysis-dependent release of eDNA. Molecular Microbiology 86:394-410. 757

28. Gill SR, Fouts DE, Archer GL, Mongodin EF, Deboy RT, Ravel J, Paulsen IT, 758

Kolonay JF, Brinkac L, Beanan M, Dodson RJ, Daugherty SC, Madupu R, 759

Angiuoli SV, Durkin AS, Haft DH, Vamathevan J, Khouri H, Utterback T, Lee C, 760

Dimitrov G, Jiang L, Qin H, Weidman J, Tran K, Kang K, Hance IR, Nelson KE, 761

Fraser CM. 2005. Insights on evolution of virulence and resistance from the complete 762

genome analysis of an early methicillin-resistant Staphylococcus aureus strain and a 763

biofilm-producing methicillin-resistant Staphylococcus epidermidis strain. J Bacteriol 764

187:2426-2438. 765

29. Flamm RK, Hinrichs DJ, Thomashow MF. 1984. Introduction of pAM beta 1 into 766

Listeria monocytogenes by conjugation and homology between native L. 767

monocytogenes plasmids. Infect Immun 44:157-161. 768

30. Arnaud M, Chastanet A, Debarbouille M. 2004. New vector for efficient allelic 769

replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. 770

on Septem


.org/D

ownloaded from

http://jb.asm.org/

36

Appl Environ Microbiol 70:6887-6891. 771

31. Helle L, Kull M, Mayer S, Marincola G, Zelder ME, Goerke C, Wolz C, Bertram R. 772

2011. Vectors for improved Tet repressor-dependent gradual gene induction or 773

silencing in Staphylococcus aureus. Microbiology 157:3314-3323. 774

32. Charpentier E, Anton AI, Barry P, Alfonso B, Fang Y, Novick RP. 2004. Novel 775

cassette-based shuttle vector system for gram-positive bacteria. Appl Environ 776

Microbiol 70:6076-6085. 777

33. He N, Hu J, Liu H, Zhu T, Huang B, Wang X, Wu Y, Wang W, Qu D. 2011. 778

Enhancement of vancomycin activity against biofilms by using ultrasound-targeted 779

microbubble destruction. Antimicrob Agents Chemother 55:5331-5337. 780

34. Liu Q, Fan J, Niu C, Wang D, Wang J, Wang X, Villaruz AE, Li M, Otto M, Gao Q. 781

2011. The eukaryotic-type serine/threonine protein kinase Stk is required for biofilm 782

formation and virulence in Staphylococcus epidermidis. PLoS One 6:e25380. 783

35. Gerke C, Kraft A, Sussmuth R, Schweitzer O, Götz F. 1998. Characterization of 784

the N-acetylglucosaminyltransferase activity involved in the biosynthesis of the 785

Staphylococcus epidermidis polysaccharide intercellular adhesin. J Biol Chem 786

273:18586-18593. 787

36. Charbonnier Y, Gettler B, Francois P, Bento M, Renzoni A, Vaudaux P, Schlegel 788

W, Schrenzel J. 2005. A generic approach for the design of whole-genome 789

oligoarrays, validated for genomotyping, deletion mapping and gene expression 790

analysis on Staphylococcus aureus. BMC Genomics 6:95. 791

37. Scherl A, Francois P, Charbonnier Y, Deshusses JM, Koessler T, Huyghe A, 792

on Septem


.org/D

ownloaded from

http://jb.asm.org/

37

Bento M, Stahl-Zeng J, Fischer A, Masselot A, Vaezzadeh A, Galle F, Renzoni A, 793

Vaudaux P, Lew D, Zimmermann-Ivol CG, Binz PA, Sanchez JC, Hochstrasser 794

DF, Schrenzel J. 2006. Exploring glycopeptide-resistance in Staphylococcus aureus: 795

a combined proteomics and transcriptomics approach for the identification of 796

resistance-related markers. BMC Genomics 7:296. 797

38. Pragman AA, Herron-Olson L, Case LC, Vetter SM, Henke EE, Kapur V, 798

Schlievert PM. 2007. Sequence analysis of the Staphylococcus aureus srrAB loci 799

reveals that truncation of srrA affects growth and virulence factor expression. J 800

Bacteriol 189:7515-7519. 801

39. Pragman AA, Ji YD, Schlievert PM. 2007. Repression of Staphylococcus aureus 802

SrrAB using inducible antisense srrA alters growth and virulence factor transcript 803

levels. Biochemistry-Us 46:314-321. 804

40. Cramton SE, Ulrich M, Götz F, Doring G. 2001. Anaerobic conditions induce 805

expression of polysaccharide intercellular adhesin in Staphylococcus aureus and 806

Staphylococcus epidermidis. Infect Immun 69:4079-4085. 807

41. Hammer ND, Reniere ML, Cassat JE, Zhang Y, Hirsch AO, Indriati Hood M, 808

Skaar EP. 2013. Two heme-dependent terminal oxidases power Staphylococcus 809

aureus organ-specific colonization of the vertebrate host. MBio 4. 810

42. Kinkel TL, Roux CM, Dunman PM, Fang FC. 2013. The Staphylococcus aureus 811

SrrAB two-component system promotes resistance to nitrosative stress and hypoxia. 812

MBio 4:e00696-00613. 813

43. Fuchs S, Pane-Farre J, Kohler C, Hecker M, Engelmann S. 2007. Anaerobic gene 814

on Septem


.org/D

ownloaded from

http://jb.asm.org/

38

expression in Staphylococcus aureus. J Bacteriol 189:4275-4289. 815

44. Masalha M, Borovok I, Schreiber R, Aharonowitz Y, Cohen G. 2001. Analysis of 816

transcription of the Staphylococcus aureus aerobic class Ib and anaerobic class III 817

ribonucleotide reductase genes in response to oxygen. J Bacteriol 183:7260-7272. 818

45. Leibig M, Liebeke M, Mader D, Lalk M, Peschel A, Gotz F. 2011. Pyruvate formate 819

lyase acts as a formate supplier for metabolic processes during anaerobiosis in 820

Staphylococcus aureus. J Bacteriol 193:952-962. 821

46. Roca I, Ballana E, Panosa A, Torrents E, Gibert I. 2008. Fumarate and nitrate 822

reduction (FNR) dependent activation of the Escherichia coli anaerobic 823

ribonucleotide reductase nrdDG promoter. Int Microbiol 11:49-56. 824

825

on Septem


.org/D

ownloaded from

http://jb.asm.org/

39

FIGURE LEGENDS 826

FIG 1 Effect of srrA deletion on the S. epidermidis growth. (A) Transcriptional level of 827

srrA/srrB in the S. epidermidis strain 1457 under micro-aerobic stress. After culture for 4 h 828

under oxic conditions, SE1457 was transferred into a 50-ml syringe (sealed entirely with 829

no bubbles inside) for 0.5-h or 1-h incubation under micro-aerobic conditions (-O2). 830

Bacterial cells were collected and total RNA was extracted. Relative expression levels of 831

srrA/srrB were analyzed by qRT-PCR in comparison to the transcription level of gyrB 832

(housekeeping gene). The two-component regulatory system (TCS) arlRS was used as a 833

control. Data was represented as mean±SD from three independent experiments. (B) The 834

srrA deletion mutant displayed a defect in growth of S. epidermidis. SE1457 and its 835

isogenic srrA mutant strains were streaked on TSA plates, and incubated at 37 for 24 h 836

under oxic condition (+O2) or under micro-aerobic condition (-O2). It represents one of 837

three independent experiments. (C) Growth curves of SE1457 isogenic srrA mutants. 838

Under oxic conditions (+O2), S. epidermidis strains were cultured in a flask (1:8 839

culture-to-flask volume ratio) at 37 with shaking. For micro-aerobic conditions (-O2), 840

cultures were inoculated into 50-ml syringes and all air bubbles removed and the syringes 841

were incubated at 37 with shaking. The cultures were hourly measured at OD600. The 842

experiments were repeated at least three times and a representative set of growth curves 843

is shown. 844

845

FIG 2 Effect of srrA deletion on the in-vitro biofilm formation of S. epidermidis. Overnight 846

cultures of the S. epidermidis strains were 1:200 diluted with TSB medium and inoculated 847

into 96-well polystyrene plates in triplicate. After static incubation for 6 h, 12 h, 24 h and 48 848

on Septem


.org/D

ownloaded from

http://jb.asm.org/

40

h under oxic conditions (+O2), or for 12 h, 24 h, 48 h and 72 h under micro-aerobic 849

conditions (-O2), biofilms were stained with crystal violet and observed (A). Biofilm 850

formation under oxic and micro-aerobic conditions was detected at OD570 (B, C). The 851

experiments was repeated three times and data is represented as mean±SD; **, p<0.01 852

( srrA versus SE1457).853

854

FIG 3 Observation of S. epidermidis biofilm under CLSM. The 24-h biofilms cultured in 855

vitro were visualized using Live/Dead viability staining under the confocal laser scanning 856

microscopy (CLSM). The three-dimension structural images (Zoom 1, 63×, magnification) 857

were reconstructed, and the thickness of biofilm was measured using Imaris software. A 858

top layer, middle layer and bottom layer within a biofilm are shown. The viable and dead 859

cells were stained in green (SYTO9) and red (PI), respectively. The amount of 860

fluorescence from the bottom to top layer of biofilm was determined using ImageJ 861

software (Zoom 3, 63×, magnification). The value of PI/Total florescence indicates 862

proportion of dead cells within biofilm. The figures represent one of three independent 863

experiments. 864

865

FIG 4 Effect of srrA deletion on biofilm formation by S. epidermidis in vivo. The New 866

Zealand rabbit model of local S. epidermidis biofilm infection was used. Subcutaneous 867

incisions were made on the back of the animal. Sterile polyethylene disks were implanted, 868

then overnight bacterial cultures (108 cfu) were re-suspended in 1 ml TSB and inoculated 869

into the cavities. After 72 h, the disks were removed, fixed with 2.5% glutaraldehyde and 870

observed under a scanning electron microscopy (SEM). As a control, 24-h biofilms 871

on Septem


.org/D

ownloaded from

http://jb.asm.org/

41

cultured in vitro were observed under SEM (A). The biofilms were scraped from the disks, 872

and the viable bacteria were determined by CFU counting (B). The data are from one of 873

three independent experiments; **, p<0.01 ( srrA versus SE1457). 874

875

FIG 5 Effect of srrA deletion on initial adherence capacity in vitro. Mid-log phase bacterial 876

cells were adjusted to OD600 value 0.1 in PBS, and then added into a 6-well plate (2 877

ml/well) (A), or into a 96-well microplate (200 μl/well) (B). Plates were then incubated at 37878

for 2 h. The attached bacterial cells on the 6-well plate were counted by microcopy (A); 879

attached cells on the 96-well microplate were determined at OD570 after crystal violet 880

staining (B). The data represent one of three independent experiments; **, p<0.01 ( srrA 881

versus SE1457). 882

883

FIG 6 Effect of srrA deletion on the extracellular matrix biosynthesis of S. epidermidis. (A) 884

PIA biosynthesis semi-quantified by dot blot assay with wheat germ agglutinin. 24-h 885

biofilms, cultured aerobically (+O2) or micro-aerobically (-O2) were scraped off and 886

suspended in EDTA (3 μl per 1 mg wet weight). Serial dilutions of the PIA extractions were 887

spotted onto nitrocellulose membranes, subsequently incubated with wheat germ 888

agglutinin conjugated with HRP, and visualized using chromogenic detection. (B) Aap 889

expression of SE1457 and its isogenic srrA deletion mutants. 24-h biofilms and 12-h 890

planktonic bacteria were collected after washing with PBS. Lysostaphin-treated samples 891

with identical OD600 value were centrifuged at 20,000 g for 30 min at 4 . The supernatant 892

were separated using 7% SDS-PAGE, and the gel pieces that carried more than 130-kDa 893

on Septem


.org/D

ownloaded from

http://jb.asm.org/

42

proteins were used for Western Blot (upper panel).The remaining gel pieces were stained 894

using Coomassie blue as endogenous reference (lower panel). MAb18B6 (10 ng/ml) was 895

used for the primary antibody. The immno-reactivity was detected with ECL Western 896

Blotting system after incubation with HRP-conjugated secondary antibody. (C) eDNA 897

quantified by q-PCRs of four chromosomal loci (gyrB, serp0306, leuA and lysA). 898

Unwashed 24-h biofilms were measured at OD600 in order to normalize to biofilm biomass, 899

and then used for eDNA isolation by phenol/chloroform/isoamyl alcohol extraction and 900

ethanol precipitation. The results are shown as nanogram per biomass of eDNA 901

(means±SD) and were derived from three independent experiments; **, p<0.01 ( srrA 902

versus SE1457). 903

904

FIG 7 EMSA analysis of S. epidermidis SrrA with the putative promoter regions. 905

His-tagged SrrA was purified and phosphorylated (SrrA-P) by incubation with 50 mM 906

acetylphosphate. The putative promoter regions of srrAB, icaR, icaA, qoxB, pflB, sarA and 907

rsbU genes were PCR-amplified. DNA probes were purified and labeled with digoxigenin. 908

Gel shift reactions were performed by incubating labeled probe with increasing 909

concentrations of SrrA-P (range, 0.3 μM to 1.2 μM). Lane 1 and lane 5 of each blot 910

contained a no-protein control and a 125-fold excess of unlabeled probe competitor 911

control, respectively. All samples were electrophoresed on a non-denaturing 912

polyacrylamide gel and blotted onto nylon membrane. After incubation with 913

anti-digoxigenin antibody, CSPD chemiluminescent reagent was added. The arrows 914

indicate the positions of phosphorylated SrrA-bound probes; triangles indicated the 915

on Septem


.org/D

ownloaded from

http://jb.asm.org/

43

positions of free probes. The DNA fragment within the rpsJ coding region was used as a 916

negative control. 917

918

FIG 8 Proposed model of srrAB regulation in S. epidermidis. SrrB represents the 919

membrane associated sensor kinase that becomes activated and auto-phosphorylated (P) 920

in the absence of O2 (bright red spheres). The SrrB-P phosphorylates SrrA to SrrA-P, 921

which acts as a response regulator that directly positively controls its own srrAB operon, 922

as well as the ica-, qox- and pfl-operons (Solid lines). Genes that are indirectly positively 923

regulated are indicated by dotted lines. At the same time SrrA-P acts also as a repressor 924

for icaR, which encodes the repressor of ica operon. +O2: under oxic condition; -O2: under 925

micro-aerobic condition. 926

927 on Septem


.org/D

ownloaded from

http://jb.asm.org/

44

TABLE 1 Bacterial strains and plasmids used in this study 928

Plasmids or strains Description a Source or reference

Plasmids pET28a E. coli expression plasmid, KmR Novagen

pET28a-srrA pET28a harboring the srrA gene, used for SrrA expression

This study

pMAD Shuttle vector, temperature sensitive, AmpR, ErmR

(30)

pMAD- srrA Recombinant plasmid This study

pCN51 shuttle vector, AmpR, ErmR (32)

pCN51-srrAB the srrAB gene cloned into pCN51 This study

pRAB11 shuttle vector, AmpR, CmR (31)

pRAB11-srrA the srrA gene cloned into pRAB11 This study

pRAB11-srrB the srrB gene cloned into pRAB11 This study

Bacterial strains S. epidermidis RP62A

Biofilm positive, genome sequenced and published

(26,28)

S. epidermidis 1457 Biofilm positive, clinical isolate, wild-type strain

(7,16)

srrA srrA deletion, spcR, derivative of S. epidermidis 1457

This study

srrA(pCN51-srrAB) srrA complemented with plasmid pCN51-srrAB

This study

srrA (pRAB11-srrA) srrA complemented with plasmid pRAB11-srrA

This study

srrA(pRAB11-srrB) srrA complemented with plasmid pRAB11-srrB

This study

srrA(pCN51) srrA introduced with plasmid pCN51 This study

S. aureus 4220 Restriction negative, modification positive (14, 32)

E. coli DH5α supE44 lacU169 (φ80dlacZ M15) hsdR17 recA1 endA1gyrA96 thi-1 relA1

Invitrogen

E. coli BL21(DE3) B F-ompThsdSB (rB-, mB-) galdcm (DE3) Invitrogen

a KmR, kanamycin resistance; AmpR, ampicillin resistance; CmR, chloramphenicol 929

resistance; ErmR, erythromycin resistance; spcR, spectinomycin resistance. 930

931

on Septem


.org/D

ownloaded from

http://jb.asm.org/

45

TABLE 2 Primers used in this study 932

Primers Sequence (5’ 3’) location Restriction enzymes Products (bp)

Primers used for construction and identification of srrA deletion mutant srrA-US-F GAAGATCTGGAGAGTCAAATGAGTAAAGAAC 1103298-1103320 BglII

884 srrA-US-R TCCCCCGGGCATACTTTCTACTACCTCCTACA 1102437-1102459 SmaI

srrA-DS-F CGGAATTCAACTGTGTGGGGTGTCGG 1101757-1101774 EcoRI 907

srrA-DS-R CGGGATCCTCATCAGCCATCTTGTTCG 1100868-1100886 BamHI

spc-F TGGTTCAGCAGTAAATGGTGG 1029

spc-R CATCTGTGGTATGGCGGGTA Primers used for srrA, srrB, srrAB complementation pCN51-srrAB-F CGCGGATCCCCTTTGAGTCACTCAATAAC 1102500-1102519 BamHI

2572 pCN51-srrAB-R CGGGGTACCTGATACTTTTCAGTTTCTAA 1099948-1099967 KpnI

pRAB11-srrA-F GGGGTACCCCTTTGAGTCACTCAATAAC 1102500-1102519 KpnI 806

pRAB11-srrA-R CGGAATTCCTATTTAGTCGGTTCATCAC 1101714-1101733 EcoRI

pRAB11-srrB-F CGGGGTACCAATGATACAAACTGTGTGG 1101765-1101783 KpnI 1836

pRAB11-srrB-R GGAAGATCTTGATACTTTTCAGTTTCTAA 1099948-1099967 BglII

Primers used for eDNA quantification using qPCR gyrB-F GCTGGACAGATACAAGTT 2611681-2611698

137 gyrB-R GCTAATGCCTCGTCAATA 2611562-2611579

on Septem


.org/D

ownloaded from

http://jb.asm.org/

46

serp0306-F ATGCCACATCCACGAAAGA 309331-309349 179

serp0306-R TGTAACTGACAATGCCCAATC 309489-309509 lysA-F TGACAATGGGAGGTACAAGC 988594-988613

76 lysA-R TGGTCTTCATCGTAAACAATCG 988648-988669 leuA-F GTGAACGGTATTGGTGAAAGAG 1708472-1708493

78 leuA-R GTGGTCCTTCCTTACATATAAAGC 1708526-1708549 Primers used for SrrA expression pET-28a-srrA-F CCGGAATTCATGACTAACGAAATTTTAATCGTTG 1102415-1102439 EcoRI

723 pET-28a-srrA-R CCGCTCGAGTTTAGTCGGTTCATCACTAGGTT 1101717-1101739 XhoI

Primers used for amplification of promoter fragments Psrr-F ACTTTCTACTACCTCCTA 1102440-1102457

132 Psrr-R CACCAAAAAGATGTAATT 1102554-1102571 PicaA-F GTATAACAACATTCTATT 2334137-2334154

85 PicaA-R ATTTTTTCACCTACCTTT 2334204-2334221 PicaR-F ATTCTAAAATCTCCCCCT 2334055-2334072

82 PicaR-R TGAAACAGTAATATTTGT 2334119-2334136 PqoxB-F TTTTTGACCTCCTAATAC 641914-641931 145

on Septem


.org/D

ownloaded from

http://jb.asm.org/

47

PqoxB-R AATCTTACAAACCCCGTC 642041-642058 PpflB-F ACTCTCCGCCTCCATTTC 2414402-2414419

151 PpflB-R TTTATTCACAAACTGTTA 2414535-2414552 PrsbU-F GAAATGCGCCTCCTTACT 1725459-1725476

147 PrsbU-R GCTTTAGGTTATCCATTC 1725588-1725605 PsarA-F GACACTTTCGTATTTTCATAAGA 279934-279956

160 PsarA-R ATTAATGAAACCTCCCTATTTA 279797-279818 PrpsJ-F AAGATTCTCGTGAACAATTC 1862226-1862245

119 PrpsJ-R GATGTCTACACCTGATGG 1862127-1862144

The primers were designed using Primer Premier 5 software according to the genomic sequence of S. epidermidis RP62A (GenBank accession 933

number: NC002976). 934

935

on Septem


.org/D

ownloaded from

http://jb.asm.org/

48

TABLE 3 Primers used for transcriptional analysis by quantitative RT-PCR 936

Primers Sequence (5’ 3’) Location Products (bp)

sarA-F GTAATGAACACGATGAAAGAACT 279526-279548 103

sarA-R GCTTCTGTGATACGGTTGT 279446-279464

rsbU-F GCTTATGGACATTCACAA 1724925-1724942 121

rsbU-R GATTCATCTCTTCATACAGT 1724822-1724841

icaA-F ATCAAGCGAAGTCAATCTC 2334781-2334799 127

icaA-R CAGCAATATCCTCAGTAATCA 2334887-2334907

icaR-F GCACATCGCTTTGGATAA 2333646-2333663 146

icaR-R TTAACAGTGAATATACTTGGTCTT 2333518-2333541

atlE-F CAATTACAGGAGACACAAT 631207-631225 149

atlE-R TCATTATCATTAGAAGCAGTT 631077-631097

aap-F CGAGGAATTACAATCATCACA 2460758-2460778 166

aap-R CGTAGTTGGCGGTATATCTA 2460613-2460632

srrA-F TCACCTAGAGAAGTAGTATT 1102108-1102127 130

srrA-R GAGCGTCATTATCAATCA 1101998-1102015

srrB-F TCCATAGTAGACGGTATAGT 1100559-1100578 136

srrB-R ATAATCCTTCAGCATCCATA 1100443-1100462

ctaA-F CTACGATTATTATGACCTT 703606-703624 146

ctaA-R ACTCAGTTCTATAATTGTT 703479-703497

qoxB-F TCTATGGATACAATGACAAGTT 641416-641437 126

qoxB-R TGAGTTACGACCTCTGAA 641312-641329

serp0257-F AACCTGGAGAAGCATTAG 265234-265251 101

on Septem


.org/D

ownloaded from

http://jb.asm.org/

49

serp0257-R TAGCGTTACACCTGTTAC 265317-265334

serp2257-F AGGTAATGCTGGCTTATCT 2286255-2286273 110

serp2257-R CGAATGCGTTGACTGTAA 2286164-2286181

pflA-F ACACTTACACTCCGTTGA 2412105-2412122 140

pflA-R CTTCTCTTGATGGTTCGTTA 2411983-2412002

serp2381-F AGAAGGTAATCAAGTTGT 2428977-2428994 136

serp2381-R CGTATTATATTGTTGTAGCA 2428859-2428878

lacA-F GGAAGACAACGATTATGAT 1841284-1841302 135

lacA-R GCACCATAGGCATCTATA 1841168-1841185

ureF-F TTAGGTGTAGATGTGGAAT 1898186-1898204 148

ureF-R CGTGTCTTCTCAATATGG 1898317-1898334

rbsK-F GCAGGTATTCATACACAAT 2125633-2125651 150

rbsK-R CACACTCATCTCAACATC 2125502-2125519

betB-F TATCCATTACTTCAAGCATCT 2209851-2209871 128

betB-R CCAACTTCCTCCATCAAT 2209744-2209761

cysH-F TTGGTGCTGAGAGTATGG 2227130-2227147 148

cysH-R TTAATGCGTAATTGCGGATAT 2227000-2227020

rplB-F AAGATGGAATCATTGCTAA 1860237-1860255 130

rplB-R TGACCTACTTGTAATCCT 1860126-1860143

rpsJ-F AAGATTCTCGTGAACAATTC 1862226-1862245 119

rpsJ-R GATGTCTACACCTGATGG 1862127-1862144

opp1B-F TGATTCCATTATTGATTGTAGTGA 2419641-2419664 111

on Septem


.org/D

ownloaded from

http://jb.asm.org/

50

opp1B-R GCGTTATATTAGGCGTTCC 2419554-2419572

rpoA-F TGAAGTTAGTGAAGATGCTA 1849776-1849795 113

rpoA-R CTGGTAATGAAGATAGTAGGA 1849683-1849703

nrdD-F GATAGTAATACATTCTCAACAA 2217415-2217436 145

nrdD-R ATGGATGGTAATCTAAGTC 2217292-2217310 Primers used in qRT-PCR were designed with Beacon Designer 7 software according to the genomic sequence of S. epidermidis RP62A (GenBank 937

accession number: NC002976). 938

939

on Septem


.org/D

ownloaded from

http://jb.asm.org/

51

TABLE 4 Transcription levels of genes involved in growth and biofilm formation of S. epidermidis srrA under micro-aerobic conditions 940

ORF Gene Description or predicted function Expression ratio (mutant/WT)

Microarray qRT-PCR

Genes involved in respiratory chain and energy metabolism SERP1055 srrA DNA-binding response regulator 0.10 0.00001

SERP1054 srrB histidine kinase sensor UD 0.09±0.02

SERP0705 ctaA cytochrome oxidase assembly protein 0.22 0.04±0.01

SERP0706 ctaB protoheme IX farnesyltransferase 0.28 ND

SERP0646 qoxB quinol oxidase subunit II UD 0.31±0.08

SERP0645 qoxA quinol oxidase subunit I 0.30 ND

SERP0644 qoxC quinol oxidase polypeptide III 0.20 ND

SERP0643 qoxD quinol oxidase polypeptide IV 0.25 ND

SERP2381 NADH: flavinoxidoreductase/fumarate reductase flavoprotein subunit 0.21 0.20±0.17

SERP0257 alcohol dehydrogenase 0.32 0.08±0.04

SERP2112 alcohol dehydrogenase, zinc-containing 0.28 ND

SERP2257 acetoin reductase, oxidoreductase, ligand is NAD 0.18 0.02±0.01

SERP2365 pflA pyruvate formate-lyase-activating enzyme 0.15 0.15±0.11

SERP2366 pflB formateacetyltransferase 0.31 ND

SERP2183 nrdD anaerobic ribonucleoside triphosphate reductase 0.33 ND

on Septem


.org/D

ownloaded from

http://jb.asm.org/

52

SERP1795 lacA galactose-6-phosphate isomerase LacA subunit 0.32 1.72±0.37

SERP1793 lacC tagatose-6-phosphate kinase 0.30 ND

SERP1791 lacF PTS system, lactose-specific IIA component 0.31 ND

SERP1873 ureF urease accessory protein UreF 0.34 1.38±0.6

SERP1874 ureG urease accessory protein UreG 0.33 ND

SERP1875 ureD urease accessory protein UreD 0.33 ND

SERP2100 rbsK ribokinase, catalyses the phosphorylation of ribose to ribose-5-phosphate using ATP, this reaction is the first step in the ribose metabolism

0.16 0.14±0.06

SERP2101 D-ribose pyranase 0.27 ND

SERP2102 rbsU ribose transporter RbsU 0.30 ND

SERP2347 bioB biotin synthase 0.32 0.44±0.20

SERP2396 bioD dethiobiotinsynthetase 0.34 ND

SERP2190 cysI sulfite reductase (NADPH) hemoprotein beta-component 3.68 ND

SERP2191 cysJ sulfite reductase (NADPH) flavoprotein 4.33 ND

SERP2192 cysH phosophoadenylyl-sulfate reductase 5.22 ND

SERP2176 betA choline dehydrogenase 3.84 ND

SERP2177 betB betaine aldehyde dehydrogenase, ligand is NAD 4.25 7.29±2.56

Genes involved in biofilm formation SERP2292 icaR intercellular adhesion regulator 0.33 0.32±0.07

SERP2293 icaA N-glycosyltransferase UD 0.10±0.02

SERP2398 aap accumulation associated protein UD 0.89±0.21

on Septem


.org/D

ownloaded from

http://jb.asm.org/

53

SERP0274 sarA accessory regulator A UD 0.87±0.33

SERP1680 rsbU sigma factor B regulator protein UD 1.35±0.26

Genes involved in protein synthesis SERP0044 rpsF 30S ribosomal protein S6 3.8 ND

SERP1832 rpsJ 30S ribosomal protein S10 5.09 6.85±2.06

SERP0186 rpsL 30S ribosomal protein S12 3.04 ND

SERP1807 rpsM 30S ribosomal protein S13 3.34 ND

SERP1818 rpsN 30S ribosomal protein S14 5.58 ND

SERP1822 rpsQ 30S ribosomal protein S17 3.11 ND

SERP1828 rplB 50S ribosomal protein L2 4.17 17.1±3.22

SERP1831 rplC 50S ribosomal protein L3 4.77 ND

SERP1821 rplN 50S ribosomal protein L14 3.09 ND

SERP1824 rplP 50S ribosomal protein L16 3.41 ND

SERP1815 rplR 50S ribosomal protein L18 4.37 ND

SERP1826 rplV 50S ribosomal protein L22 3.4 ND

SERP1820 rplX 50S ribosomal protein L24 3.11 ND

SERP2371 opp-1B Peptide ABC transporter, permease protein 1B 0.19 0.25±0.15

SERP2370 opp-1C Peptide ABC transporter, permease protein 1C 0.26 ND

Genes involved in transcription SERP1805 rpoA DNA-directed RNA polymerase subunit alpha 3.24 3.54±2.28

SERP0183 rpoB DNA-directed RNA polymerase subunit beta 2.96 ND

SERP0184 rpoC DNA-directed RNA polymerase subunit beta' 3.53 ND

on Septem


.org/D

ownloaded from

http://jb.asm.org/

54

SERP1127 rpoD RNA polymerase sigma factor 4.07 ND

SERP1677 rpoF RNA polymerase sigma factor SigB 3.2 ND UD: under detection level in microarray analysis. 941

ND: Not done. 942

Data from qRT-PCR is represented as mean±SD of three independent experiments. 943

944

on Septem


.org/D

ownloaded from

http://jb.asm.org/

55

TABLE 5 Transcription levels of genes involved in growth and biofilm formation of S. epidermidis srrA under oxic conditions 945

ORF Gene Descriptions or predicted function Expression ratio (mutant/WT)

Microarray qRT-PCR Genes involved in respiratory chain and energy metabolism SERP1055 srrA DNA-binding response regulator 0.30 0.00001 SERP1054 srrB histidine kinase sensor UD 0.10±0.02 SERP0705 ctaA cytochrome oxidase assembly protein UD 0.18±0.08 SERP0646 qoxB quinol oxidase subunit II UD 0.17±0.05

SERP2381 NADH: flavinoxidoreductase/fumarate reductase flavoprotein subunit UD 0.35±0.21

SERP0257 alcohol dehydrogenase UD 0.16±0.07 SERP2257 acetoin reductase, oxidoreductase, ligand is NAD UD 0.13±0.07

SERP2327 acetoin dehydrogenase, E3 component, dihydrolipoamide dehydrogenase 0.31 ND

SERP2379 acetoin (diacetyl) reductase 0.28 ND

SERP2324 branched-chain alpha-keto acid dehydrogenase subunit E2 0.32 ND

SERP2365 pflA pyruvate formate-lyase-activating enzyme UD 0.12±0.05 SERP2170 ppdK pyruvate phosphate dikinase 0.23 ND

SERP2182 nrdG anaerobic ribonucleoside-triphosphate reductase activating protein 0.33 ND

SERP2183 nrdD anaerobic ribonucleoside triphosphate reductase 0.30 ND SERP1795 lacA galactose-6-phosphate isomerase LacA subunit UD 0.39±0.12 SERP1873 ureF urease accessory protein UreF UD 0.27±0.15 SERP2192 cysH phosophoadenylyl-sulfate reductase UD 5.26±1.36 Genes involved in biofilm formation SERP2292 icaR intercellular adhesion regulator UD 5.14±0.63 SERP2293 icaA N-glycosyltransferase UD 0.13±0.06 SERP2295 icaB intercellular adhesion protein B UD 0.17±0.1

on Septem


.org/D

ownloaded from

http://jb.asm.org/

56

SERP2294 icaD intercellular adhesion protein D UD ND SERP0636 atlE bifunctional autolysin UD 0.25±0.12 SERP2398 aap accumulation associated protein UD 0.68±0.14 SERP0274 sarA accessory regulator A UD 0.74±0.21 SERP1680 rsbU sigma factor B regulator protein UD 0.93±0.29 Genes involved in protein synthesis SERP0840 rpsO 30S ribosomal protein S15 3.16 ND SERP0046 rpsR 30S ribosomal protein S18 3.25 ND SERP1153 rpsT 30S ribosomal protein S20 4.56 ND SERP1284 rpsD 30S ribosomal protein S4 4.39 ND SERP1821 rplN 50S ribosomal protein L14 3.88 ND SERP0807 rplS 50S ribosomal protein L19 3.69 ND SERP0001 rpmH 50S ribosomal protein L34 3.54 ND SERP2371 opp-1B peptide ABC transporter, permease protein 1B 0.34 1.01±0.55 SERP2105 pgsA poly-gamma-glutamate synthesis protein pgsA 3.39 ND SERP2107 pgsB poly-gamma-glutamate synthesis protein pgsB 3.51 ND Genes involved in transcription SERP0926 parC DNA topoisomerase IV subunit A 2.96 ND SERP0838 truB tRNApseudouridine synthase B 3.10 ND SERP1307 trmB tRNA (guanine-N(7)-)-methyltransferase 2.95 ND

UD: under detection level in microarray analysis. 946

ND: Not done. 947

Data from qRT-PCR is represented as mean±SD of three independent experiments.948

949

on Septem


.org/D

ownloaded from

http://jb.asm.org/

on may 5, 2020 by guest - journal of bacteriology · 84 other staphylococcal surface-associated...

Documents