Original DNA sequence GGC [TACGAGCTTCGAAATTTGCCGATC] CCA mRNA:AUG CUC GAA GCU UUA AAC GGC UAG A.A.s MET LEU GLU ALA - LEU ASP GLY STOP 1.Identify the reading frame by transcribing the DNA & identifying the start codon. Then group the codons in 3s until you reach the stop codon. 2.Mutant one: FRAMESHIFT the original reading frame is affected GGC TACGAGCTTCGAAAATTTGCCGATCCCA Homework 1.Mutant 2: NONSENSE an internal stop codon is inserted GGC TACGAGCTTCGAACTTTGCCGATCCCA 2.Mutant 3: MISSENSE a new amino acid is made with the mutation GGC TACGAGCCTCGAAATTTGCCGATCCCA 3.Mutant 4: SILENT the gene isnt affected as GAC & GAG both code for the same amino acid GGC TACGACCTTCGAAATTTGCCGATCCCA Mutation Detection: Answers MET LEU GLU ALA STOP MET LEU GLU ALA GLU GLY MET LEU GLU ALA LEU LEU UUU AAA CGG CUA GGG MET LEU GLU ALA PHE LYS ARG LEU GLY Intro You all learned in MITOSIS that cells reproduce through the process of cell division. This includes mitosis & cytokinesis The process creates 2 identical daughter cells, also called clones for the reasons of replacing, growing the # of, and repairing our bodys cells. In this lesson you are going to learn the processes by which organisms reproduce. Next youll learn how gametes form through meiosis. Common Sense The chief function of the reproductive system is to ensure survival of the species. You all should know by now that, for humans, it takes a mom and a dad to produce a baby through the mechanism of sex. But questions we must answer: 1. Is this the only way organisms reproduce? 2. How do each of the methods that satisfy the need to reproduce work? (in general) 3. Why do the methods work? 4. What are the advantages and disadvantages? Objectives. Organism Reproduction Compare the genetics of offspring in asexual reproduction with the parent. Describe how the offspring in sexual reproduction compare genetically with the parent. Chromosome Number Objectives: Explain why chromosomes are important to an organism. Compare the number of sets of chromosomes between a haploid cell and a diploid cell. Create a karyotype to determine chromosome number. Vocabulary Gamete Zygote Diploid Haploid Homologous chromosome Asexual Reproduction Asexual reproduction is broken down into 4 types: Binary fission Fragmentation Budding Parthenogenesis In asexual reproduction (like MITOSIS) a single parent passes a complete copy of its genetic information to each of its offspring. The offspring formed by asexual reproduction are genetically identical to its parent. Clones Asexual Reproduction Prokaryotes reproduce asexually by a kind of cell division called binary fission. Similar to MITOSIS without the nucleus. One parent bacteria Many unicellular eukaryotes also reproduce asexually. Does anyone know of a unicellular eukaryote? Amoebafor example Asexual Reproduction Some multicellular eukaryotes, such as starfish or Planarian, go through fragmentation. Fragmentation is a kind of asexual reproduction in which the body breaks into several pieces. Some or all of these fragments re- grow missing parts and develop into complete adults. Does anyone know what the re- growth of a lost appendage is called? Regeneration Asexual Reproduction Other animals, such as the hydra, go through budding. In budding, new individuals split off from existing ones. Some plants, such as potatoes, can form whole new plants from parts of stems. The knots found on old potatoes are called buds Other plants can reproduce from roots or leaves. Asexual Reproduction Many species have been reported to have the ability to reproduce by parthenogenesis. Parthenogenesis is a process in which a female makes a viable egg that grows into an adult without being fertilized by a male. Ex. Aphids (pictured) Water fleas Boas Komodo dragons Sharks Others. Check for Understanding What are 4 types of asexual reproduction we discussed so far? 1. binary fission 2. fragmentation 3. budding 4. parthenogenesis List the appropriate definition next to the word A. a viable egg produced by the mother that grows into an adult without fertilization B. new individuals split off from existing ones C. body breaks into several pieces D. reproduction through cell division Answers: d, c, b, a Sexual Reproduction Multicellular Organisms have two types of cells. Germ Cells and Somatic Cells Our body cells are called somatic cells. These are the major types of cells that form organisms: skin cells, muscle cells, nerve cells, etc. These grow in number (proliferate) through MITOSIS. Somatic cells do not participate in sexual reproduction. Cells that are created for sexual reproduction are called germ cells. These undergo MEIOSIS division to create gametes. Examples: Sperm, egg, pollen, spores Only germ cells can produce gametes. Sexual Reproduction Most eukaryotic organisms reproduce sexually. In sexual reproduction, gametes from genetically different parents produce offspring that are a genetic hybrid of the parents. Each parent produces a reproductive cell, called a gamete. Male Gamete = sperm Female Gamete = egg Gametes fuse during fertilization to form a zygote. The zygote develops through mitosis into an embryo. Because both parents give genetic material, the offspring has traits of both parents but is not exactly like either parent. Asexual Genetically identical Cellular reproduction: MITOSIS Binary fission Fragmentation Budding Parthenogenesis Sexual Genetically varied Parent Offspring Germ cell Meiosis Gametes Fertilization Zygote Reproduction We have learned the two types of reproduction. They are: 1. Asexual 2. Sexual How do the offspring produced from each of these types of reproduction compare to its parent? Asexual = they are genetically identical Sexual = they are genetically different (but express traits from both parents) Asexual Reproduction Advantages of Asexual Reproduction (cloning) Disadvantages of Asexual Reproduction Asexual reproduction is the simplest, most efficient method of reproduction. Asexual reproduction allows organisms to produce many offspring in a short period of time without using energy to make gametes or to find a mate. No genetic diversity means they cannot rapidly adapt in a changing environment. The downside is that the genetic material of these organisms varies little between individuals, so they may be at a disadvantage in a changing environment. Sexual Reproduction Advantages of Sexual Reproduction Disadvantages of Sexual Reproduction Sexual reproduction produces genetically diverse individuals. A population of diverse organisms with some variability is more likely to have some individuals that survive a major environmental change. This is the advantage, the benefit, of sexual reproduction. Takes WAY more energy. Think of how much energy it takes to find and keep a girlfriend/boyfriend. Recap To highlight the benefits of each restate. The benefits of asexual reproduction are Saves time & energy The benefits of sexual reproduction are Genetic diversity. Why is Genetic Variability A Benefit? Sexual reproduction is only beneficial if it creates a wide variety of traits in offspring. If every pregnancy yielded clones there would be no point to it. Within every population, due to numerous environmental pressures that have gone on throughout its history, there exists numerous versions of each thing that can be produced. This is fundamental in Natural Selection & Evolution. The Benefit of Diversity EX: Variation in eye color provides different benefits. Eye color has a direct correlation to absorbing sunlight or being able to see in the dark better. Light eyes can see better in the dark, dark eyes have less glare in the sun. EX: Variation in skin color provides different benefits. Skin color changes the overall affect of UV radiation due to melanin absorption. Dark skin converts UV radiation into heat, light skin has higher frequency of skin cancer but can tan to accommodate extra sunlight. [The photochemical properties of melanin make it an excellent photoprotectant. It absorbs harmful UV- radiation and transforms the energy into harmless heat through a process called "ultrafast internal conversion".] This property enables melanin to dissipate more than 99.9% of the absorbed UV radiation as heat[3]photoprotectantinternal conversion[3] Where theres more sunlight then the skin colors are generally, historically darker. The Benefits of Genetic Variability Each version of the gene has advantages in some circumstances, disadvantages in others. Trait: Skin color In sunny climateNoYesNoOkayYes In low-sun climateYesNoYesOkayNo Trait: Eye Color In sunny climateNo Yes In low-sun climateYes No What does this mean? Having two parents that are genetically different creating a genetically different offspring allows for several ways to keep genetic diversity evolving, and this is a good thing. 1 st : New combinations from parents with different genes allow for new, maybe unseen traits to be created. 2 nd : Because we carry two copies of each gene, sometimes a trait that is bad right now will be kept in the gene pool, hidden by a more dominant form. Sometimes these traits turn out to be good later on down the road. 3 rd : If the environment suddenly changes, the estimate is 10% of the human population contains the trait necessary to survive almost any biologically significant event. Viral or bacterial infection resistance. Metabolic stress = lack of food/water. Changes in O2 levels. Changes in amounts of sunlight. Temperature fluctuations. In Summary. Genetic Variation from Sexual Reproduction. Mixing versions of genes does several things. It hides bad recessive genes behind good dominant genes. Having multiple versions of a gene allows for a population to respond to changes. Part II Chromosome Number Organisms can be organized by how they reproduce. When an organism reproduces the same way as another an alternative way has been discovered to tell the difference between organisms. It has to do with the number of their chromosomes. Chromosomes Each species has a specific arrangement of chromosomes, both numbers and sizes. Recall that a chromosome is a huge continuous molecule of DNA & Each chromosome, for each organism, has thousands of genes that play an important role in determining how an organism develops and functions. Some genes are unique to the organism, but often many are very similar as variations of an original. Plus, an organism must have exactly the same number of chromosomes as other members of the species. If an organism has too many or too few chromosomes, the organism may not develop and function properly. On top of that, organisms must have the same number of chromosomes to mate effectively. (discussed more in ecology) Chromosome Number of Various Organisms Visual Concepts: Chromosome Number Click above to play the video. Chromosome Number Every organism has a specific number of chromosomes and sets. The number of chromosomes can be determined by observing the karyotype of the organism What is n? The number of chromosomes in an organism or cell is determined by inheritance patterns. n = the number of chromosomes in one set. Ex. Humans have 23 chromosomes in one set. Each parent contributes one set so humans have 2 sets of 23, for a total 46 chromosomes. n in the case is 23. Decide Here we have a karyotype from a human. How many chromosomes are there? How many sets? How many in one set? Human gametes have 23 chromosomes in their sets, so for humans n = 23. Chromosome Number Haploid and Diploid Cells If a cell has one set of chromosomes its considered haploid. Describes a cell, nucleus, or organism that has only one set of unpaired chromosomes A cell, such as a somatic cell, that has two sets of chromosomes is diploid. A cell that contains 2 haploid sets of chromosomes There does exist a third kind, polyploid, which can have many more than two copies of each chromosome. Polyploid types are labeled according to the number of chromosome sets in the nucleus:nucleus triploid (three sets; 3x), for example the phylum Tardigrada[3]phylumTardigrada[3] tetraploid (four sets; 4x), for example Salmonidae fishSalmonidae pentaploid (five sets; 5x), for example hexaploid (six sets; 6x), for example wheat, kiwifruit[4]wheatkiwifruit[4] octaploid (eight sets; 8x), for example Acipenser (genus of sturgeon fish)Acipensersturgeon decaploid (ten sets; 10x), for example certain strawberriesstrawberries dodecaploid (twelve sets; 12x), for example the plant Celosia argentea and the amphibian Xenopus ruwenzoriensisCelosia argenteaXenopus ruwenzoriensis Chromosome Number Haploid and Diploid Cells In organisms that reproduce with two parents there are two types of cells. Somatic Cells are also called body cells. These are cells that make up an organism. Examples: Skin, muscle, brain, blood, etc. Somatic cells are diploid (in humans) Gamete Cells are also called reproduction cells. These are cells that are used in sexual reproduction. Examples: Sperm, egg, pollen Gametes are haploid cells. Chromosome Types Homologous Chromosomes Each diploid cell has pairs of chromosomes made up of two homologous chromosomes. Homologous chromosomes are chromosomes that are similar in size, in shape, and in kinds of genes. Each chromosome in a homologous pair comes from one of the two parents. Homologous chromosomes can carry different forms of the same genes. Mom may have the black hair gene where dad could have blond. From Mom From Dad The same genes but usually different versions. Chromosome Types Autosomes and Sex Chromosomes In a nucleus, there are two types of chromosomes. Autosomes are chromosomes with genes that do not determine the sex of an individual. What are these genes? Sex chromosomes have genes that determine the sex of an individual. Chromosome Types Autosomes and Sex Chromosomes In humans and many other organisms, the two sex chromosomes are referred to as the X and Y chromosomes. The genes that cause a zygote to develop into a male are located on the Y chromosome. Human males have one X chromosome and one Y chromosome (XY), and human females have two X chromosomes (XX). Summary Tell me: What are the 4 types of asexual reproduction? As a result of asexual reproduction, how do offspring compare to their parents? How do offspring of sexual reproduction compare to their parents? What does haploid mean? What does diploid mean? Summary This is a karyotype. Tell me what homologous chromosomes are. Does this show a haploid or diploid organism? What is this individuals haploid number? n = ? What is this individuals diploid number? 2n = ? Whats Next? Now that you have the necessary information you will begin to explore the process of meiosis. You will have these assignments to help you practice with it. Today: Meiosis Notes. Read and Research the steps and highlights of meiosis in groups. By Monday: Complete the Meiosis Web Lesson. Pay really close attention to the web lesson. Go through it several times to completely understand it. By Monday: Have read and outlined CH10 Karyotyping. Today you will create and analyze a karyotype, one tool doctors & scientists use to determine ploidy number in an organism. A karyotype can also be used as a pre-natal diagnostic tool to determine & predict abnormal births.