pex19p, a farnesylated protein essential for peroxisome biogenesis

MOLECULAR AND CELLULAR BIOLOGY,0270-7306/98/$04.0010

Jan. 1998, p. 616–628 Vol. 18, No. 1

Copyright © 1998, American Society for Microbiology

Pex19p, a Farnesylated Protein Essential forPeroxisome Biogenesis

KLAUDIA GOTTE,1 WOLFGANG GIRZALSKY,1 MICHAEL LINKERT,1 EVELYN BAUMGART,2

STEFAN KAMMERER,3 WOLF-HUBERT KUNAU,1 AND RALF ERDMANN1*

Institut fur Physiologische Chemie, Ruhr-Universitat Bochum, 44780 Bochum,1 Institut fur Anatomie undZellbiologie, Universitat Heidelberg, 69120 Heidelberg,2 and Children’s Hospital, Laboratory

of Molecular Biology, University of Munich, 80337 Munich,3 Germany

Received 31 March 1997/Returned for modification 1 June 1997/Accepted 21 October 1997

We report the identification and molecular characterization of Pex19p, an oleic acid-inducible, farnesylatedprotein of 39.7 kDa that is essential for peroxisome biogenesis in Saccharomyces cerevisiae. Cells lacking Pex19pare characterized by the absence of morphologically detectable peroxisomes and mislocalization of peroxisomalmatrix proteins to the cytosol. The human HK33 gene product was identified as the putative human orthologof Pex19p. Evidence is provided that farnesylation of Pex19p takes place at the cysteine of the C-terminalCKQQ amino acid sequence. Farnesylation of Pex19p was shown to be essential for the proper function of theprotein in peroxisome biogenesis. Pex19p was shown to interact with Pex3p in vivo, and this interactionrequired farnesylation of Pex19p.

Eukaryotic cells have evolved an elaborate mechanism forthe biogenesis of peroxisomes which includes targeting andimport of proteins to the peroxisomal matrix, formation of theperoxisomal membrane, proliferation, and mitotic inheritanceof the organelles (16, 47, 59, 70).

Peroxisomal matrix proteins are synthesized on free ribo-somes and imported posttranslationally into preexisting per-oxisomes (47). Different types of peroxisomal targeting signals(PTS) can direct proteins from the cytosol to the peroxisomalmatrix. PTS1, which comprises the C-terminal 3 amino acids ofthe majority of peroxisomal matrix proteins, consists of spe-cies-specific and protein context-dependent variations of thetripeptide consensus Ser-Lys-Leu (34; for a review, see refer-ence 54). PTS2 is used by a smaller subset of peroxisomalmatrix proteins, and it consists of a conserved nonapeptidetypically localized at the N terminus of a protein (57, 72; for areview, see reference 15). The different PTS are recognized bydistinct import receptors (9, 52, 60, 80; for a review, see ref-erence 59) which have been suggested to target proteins fromthe cytosol to putative docking sites at the peroxisomal mem-brane and then might shuttle back to the cytosol (17, 51).However, the functional role of the import receptors is stillcontroversially discussed in the field (73, 79; for a review, seereference 59). In line with the idea that the import receptorsshuttle between the cytosol and peroxisomes, putative bindingproteins for the PTS receptors have been identified at theperoxisomal membrane (1, 19, 26, 35). Recent evidence sug-gests that both the PTS1- and PTS2-dependent import path-ways for matrix proteins converge at the peroxisomal mem-brane (1). How translocation of matrix proteins proceeds fromthere on is not yet known, but, interestingly, since peroxisomeshave been shown to import proteins in a folded state (32, 37,53, 75; for a review, see reference 54), the mechanism might bedifferent from that used to import proteins into the endoplas-mic reticulum or mitochondria.

The formation of the peroxisomal membrane also requires

an elaborate targeting and insertion of proteins. It is welldocumented that a subset of peroxisomal membrane proteinsis synthesized on free polysomes and imported posttranslation-ally into peroxisomes (for a review, see reference 47), butseveral lines of evidence suggest that this pathway is differentfrom the PTS1- and PTS2-dependent import routes (for areview, see reference 27). For instance, in cells lacking com-ponents of the common translocation complex for matrix pro-teins, posttranslational targeting and insertion of peroxisomalmembrane proteins are still functional (1, 19, 26, 35). More-over, a PTS for peroxisomal membrane proteins which is en-tirely different from PTS1 and PTS2 has recently been identi-fied (18). The constituents of the posttranslational importpathway for peroxisomal membrane proteins are still un-known.

Yeast mutants have been valuable tools in the identificationof proteins involved in the biogenesis of peroxisomes, the so-called peroxins (for reviews, see references 16, 20, 23, and 46).For most of the 15 peroxins identified to date, the role playedin peroxisome biogenesis remains to be elucidated. Five of theperoxins have been shown to fulfill a function in PTS1- andPTS2-dependent protein import (for a review, see reference27). So far, only one peroxin, Pex3p, has been suggested to berequired for the biogenesis of the peroxisomal membrane (3,77).

Here we report on the isolation and phenotypic character-ization of a pex19 mutant. Mutant cells exhibit characteristicdefects in peroxisome biogenesis, including the absence ofnormal peroxisomes and mislocalization of peroxisomal matrixenzymes to the cytosol. We describe the cloning and sequenc-ing of the PEX19 gene and the identification and characteriza-tion of the PEX19 gene product. Pex19p is a newly identifiedprotein essential for peroxisome biogenesis. We show thatPex19p is farnesylated in vivo, and we provide evidence thatthe protein physically interacts with Pex3p, a peroxin localizedat the peroxisomal membrane (39).

MATERIALS AND METHODS

Strains, media, and general methods. The yeast strains used in this study areshown in Table 1. The complete (YPD) and minimal (SD) yeast media used havebeen described earlier (22). Oleic acid medium (YNO) contained 0.1% oleic

* Corresponding author. Mailing address: Ruhr-Universitat Bo-chum, Institut fur Physiologische Chemie, 44780 Bochum, Germany.Phone: 234-7004947. Fax: 234-7094279. E-mail: [email protected].

616

on April 10, 2019 by guest

http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

acid, 0.05% Tween 40, 0.1% yeast extract, and 0.67% yeast nitrogen base withoutamino acids, adjusted to pH 6.0. For oleic acid induction, cells were preculturedin SD containing 0.3% dextrose to mid-log phase, shifted to YNO medium, andincubated for 13 to 15 h. When necessary, auxotrophic requirements were addedas described previously (2).

Recombinant DNA techniques were performed essentially as described pre-viously (2, 49).

Isolation of the pex19 mutant. The pex19 mutant was obtained after mutagen-esis of UTL-7A cells with ethyl methanesulfonate (67). The screening protocolincluded replica plating on YNO agar plates, fractionation of yeast cells, andmorphological characterization as described previously (22). Genetic analysiswas performed by standard yeast techniques (2).

Cloning and characterization of the PEX19 gene. PEX19 was cloned by func-tional complementation of the pex19 mutant with a genomic library of Saccha-romyces cerevisiae contained in the Escherichia coli-yeast shuttle vector YCp50(61). Transformation was carried out by a modified lithium acetate method (30).Transformants were screened on YNO agar plates for their ability to utilize oleicacid as the sole carbon source. The complementing region of the plasmid iso-lated, YCpPEX19 (insert, 13.5 kb), was narrowed down to a 1.8-kb ClaI-KpnIfragment which contained the entire PEX19 gene. The 1.8-kb ClaI-KpnI frag-ment was subcloned into the CEN plasmid pRS316 (68), resulting in pRSPEX19.For overexpression of PEX19, the 1.8-kb ClaI-KpnI fragment was cloned into theepisomal plasmid YEp352 (38), resulting in YEpPEX19.

DNA sequencing. For DNA sequencing, the complementing 1.8-kb ClaI-KpnIfragment was subcloned into the pBluescript (KS1) vector (Stratagene), result-ing in pKS-PEX19. Defined restriction fragments and deletion fragments gener-ated with exonuclease III were subcloned into pBluescript (KS1), and nucleo-tide sequence analysis of both strands was performed by the dideoxy sequencingmethod (65). Computer analysis of DNA and amino acid sequences was per-formed with the GENPRO program (Riverside Scientific Enterprises, Seattle,Wash.).

Gene replacement. The 0.182-kb ClaI-DraI fragment of the 59 noncodingregion was cloned into ClaI- and SmaI-digested pBluescript (SK1), resulting inpSKG20. The 2-kb XbaI-SacI fragment of pJJ283 (42) that contained the LEU2gene was introduced into pSKG20, leading to pSKG21. In a third step, the0.431-kb BglII-SacI fragment consisting of sequences flanking the 39 end ofPEX19 was inserted into BamHI- and SacI-digested pSKG21, resulting inpSKGD12, which was linearized with SacI and transformed into the wild-typestrain UTL-7A. The resulting leucine-prototrophic transformant pex19D wascrossed with wild-type strain JKR101. The resulting diploid was induced tosporulate, and the meiotic progenies were examined by standard tetrad analysis.The deletion was confirmed by Southern blot analysis.

Construction and expression of Pex19p-HK33 chimers. Four chimeric genesexpressing fusion proteins consisting of different parts of the yeast Pex19p pro-tein and the human HK33 gene product were created by splice overlap extensionPCR (40). The fusion primers which were used and the parts of the yeast andhuman proteins in the resulting chimeras are summarized in Table 2. The outsideprimers were KU82 (59 PEX19; 59CGCGGATCCTCCCGGGATGCCAAACATACAACAC39), KU74 (39 PEX19; 59CCATCGATACTAGTACTTTATTGTTGTTTGCAACC39), KU73 (59 HK33; 59CGCGGATCCTCCCGGGATGGCCG

CCGCTGAGGAAGGC39), and KU75 (39 HK33; 59CCATCGATACTAGTACTCATGATCAGACACTGTTC39). Fragments were amplified with Pwo DNApolymerase (Boehringer, Mannheim, Germany) in a reaction mixture containing10 ng of template plasmid and 100 pmol each of outside and correspondingfusion primers according to the manufacturer’s protocol. Templates were eitherpRSPEX19 or pYADE4-HK33, which was kindly provided by A. Roscher (Mu-nich, Germany). Equimolar amounts of the resulting fragments were mixed andsubjected to a second PCR with corresponding 59 and 39 outside primers. Theresulting fusion genes were subcloned into EcoRV-digested pBluescript (SK1).The fusions were confirmed by DNA sequencing and subcloned into the yeastshuttle vector pYPGE15 (10), using the primer-derived BamHI and SalI restric-tion sites. The nonfused fragment encoding amino acids 1 to 231 of S. cerevisiaePex19p was amplified by PCR with primers KU82 and KU79, subcloned intopBluescript (SK1), and subsequently cloned into pYPGE15, using the primer-derived BamHI site and the SalI site of the pBluescript (SK1) polylinker.Chimeras were tested for their ability to restore the mutant defects of pex19Dcells.

Fractionation of yeast homogenates. Preparation and fractionation of yeasthomogenates by differential centrifugation were performed as described previ-ously (22). For subfractionation by isopycnic sucrose density centrifugation,homogenates or resuspended 25,000 3 g organellar pellets were loaded ontocontinuous 20 to 53% or 32 to 54% (wt/wt) sucrose density gradients (24-mlvolume). Centrifugation, fractionation of the gradient, and preparation of sam-ples for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)were carried out as described previously (39).

Pex19p antibodies. The protein fusion and purification system of New EnglandBioLabs (Beverly, Mass.) was used for overexpression of a maltose bindingprotein-Pex19p fusion protein in E. coli TB1 [araD (lac proAB) rpsL(f80dlacZDM15) hsd]. A 0.330-kb SmaI-XbaI fragment of the exonuclease III-derivedplasmid p9-65 (see below) encoding amino acids 4 to 112 of Pex19p was intro-duced into StuI- and XbaI-digested vector pMal-p. The expression was inducedwith 0.3 mM isopropyl-b-D-thiogalactopyranoside (IPTG), and cold osmoticshock of the periplasmatic fraction and affinity purification of the maltose bind-ing protein-Pex19p fusion protein on amylose resin were performed according tothe manufacturer’s protocol. Polyclonal antibodies were raised against the fusionprotein (Eurogentec, Seraing, Belgium). Antisera were affinity purified against a156-kDa Pex19p–b-galactosidase fusion protein which was expressed frompURPEX19, a pUR291 (64) derivative containing the 1.5-kb SmaI-HindIII frag-ment of plasmid p9-65 (see below) that encodes amino acids 4 to 350 of Pex19p.Affinity purification of antisera was performed as described earlier (39).

Immunoblot analysis. Immunoblot analysis was performed according to stan-dard protocols (36) with alkaline phosphatase-conjugated anti-rabbit immuno-globulin G (IgG) or horseradish peroxidase-conjugated anti-rabbit IgG as thesecondary antibody. Protein-antibody complexes were visualized by treatmentwith color or chemiluminescence developing reagents (ECL System; Amersham,Braunschweig, Germany). Synthetic peptides were used for immunization ofrabbits to generate polyclonal antibodies against peroxisomal Pex11p (25, 50)(Eurogentec, Seraing, Belgium). The polyclonal antibodies against Pex19p orPex3p (39) were affinity purified prior to Western blot analysis.

TABLE 1. Yeast strains used in this study

Yeast strain Genotype Source or reference

UTL-7A MATa ura3-52 trp1 leu2-3/112 W. Duntze (Bochum, Germany)JKR101 MATa ura3-52 leu2-3/112 ade2 his4 G. Schatz (Basel, Switzerland)pex19-1 MATa ura3-52 leu2-3/112 ade2-1 pex19 This studypex19D MATa ura3-52 trp1 pex19::LEU2 This studyram1 MATa ram1-1 cyrR leu2-3/112 try0 trp1 his4a SUP4-3 W. Duntze (Bochum, Germany)PCY2 MATa gal4D gal80D URA3::GAL1-lacZ lys2-80amber his3-200D trp1-63D leu2 ade2-101ochre P. M. Chevray (Baltimore, Md.)

TABLE 2. Chimeras of human HK33p and yeast Pex19p

Chimera name Oligonucleotides used for PCR fusionAmino acids from:

S. cerevisiae Pex19p HK33p

YH1 KU70, 59AAATGACGTCAAAAGAAGTGCTGTACCCATCACT39 (sense);KU79, 59AGTGATGGGTACAGCACTTCTTTTGACGTCATTT39 (antisense)

1–231 187–299

YH2 KU134, 59TAGATTTGCAAAATGGATTCGAGAAGGCAATGAA39 (sense);KU135, 59TTCATTGCCTTCTCGAACTCATTTTGCAAATCTA39 (antisense)

1–86 87–299

YH3 KU136, 59ACATTGTTTCCAATACGCTAAGTGGATTAGCCAA39 (sense);KU137, 59TTGGCTAATCCACTTAGTGTATTGGAAACAATGT39 (antisense)

1–154 133–299

HY1 KU71, 59ACCTACTCTCCAAGGATGTATTATATGAGCCTAT39 (sense);KU80, 59ATAGGCTCATATAATACATCCTTGGAGAGTAGGT39 (antisense)

232–350 1–186

VOL. 18, 1998 Pex19p AND PEROXISOME BIOGENESIS IN S. CEREVISIAE 617


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

In vitro isoprenylation assay. Mutant pex19D strains overexpressing eitherPex19p (pex19D[YEpPEX19]) or Pex19p-C347S (pex19D[YEpPEX19-C347S]), inwhich the cysteine at position 347 has been replaced by serine, were grown inYNO for 12 h. Cells were harvested, divided into 500-mg portions, and frozen at220°C, thereby inactivating the endogenous protein prenyltransferase activity(data not shown). For the preparation of cell extracts containing active prenyl-transferase, cells were grown in YPD to mid-log phase and were always usedimmediately to prevent the loss of enzyme activity. Cells were disrupted in 500 mlof a solution consisting of 10 mM Tris-HCl (pH 7.4), 1 mM EDTA, 0.5 mMEGTA, and 0.5 mM dithiothreitol plus proteinase inhibitors (1 mM phenylmeth-ylsulfonyl fluoride; leupeptin, pepstatin, and chymostatin, each at 1 mg/ml) byvortexing with glass beads (0.4-mm diameter). Insoluble material was removedby centrifugation in a microcentrifuge for 10 min at 4°C.

Isoprenylation assay conditions were essentially as described previously (12).A 50-ml reaction volume contained 50 mM Tris-HCl (pH 8.0), 20 mM KCl, 5 mMMgCl2, 10 mM ZnCl2, 10 mM dithiothreitol, S. cerevisiae extract (100 mg) fromthawed cells containing the target protein, 70 mg of S. cerevisiae extract fromfresh cells that served as the source of protein prenyltransferase, and 2 mM[3H]farnesylpyrophosphate (triammonium salt; 16.5 Ci/mmol; Amersham). Re-action mixtures were incubated for 1 h at 37°C, and reactions were terminated byaddition of SDS-PAGE sample buffer. Aliquots of the samples were analyzed bySDS-PAGE. Gels were fixed in 7% acetic acid–20% methanol for 30 min,washed twice with water, and immersed in Amplify fluorographic reagent (Am-ersham) for 30 min prior to fluorography.

Mutagenesis of Pex19p. Mutagenesis was performed by PCR with pKS-PEX19as the template. The sense primer was 59AATACGACTCACTATAG39; anti-sense primers were KG1 (59TATATAAGCTTTCCCGGGAGATCTTCAACCGTCGGTTAATTC39) for the deletion of the four carboxy-terminal amino ac-ids, KG2-1 (59TATATAAGCTTTCCCGGGAGATCTTTATTGTTGTTTGCGACCGTCGGTTAATTC39) for the replacement of Cys347 with Arg347, andKG2-2 (59TATATAAGCTTTCCCGGGAGATCTTTATTGTTGTTTGCTACCGTCGGTTAATTC39) for the Cys347-to-Ser347 change. PCR fragments weresubcloned into pBluescript (SK1), and regions to be subcloned further wereconfirmed by DNA sequence analysis. Taking advantage of the internal AccI siteof PEX19 and the primer-derived HindIII site, the last 0.240 kb of the originalPEX19 open reading frame was replaced with the corresponding regions of thePCR-derived fragments. This was done by ligation of AccI- and HindIII-re-stricted PCR fragments to the SacII-AccI fragment of pSK-PEX19 and subse-quent subcloning into SacII- and HindIII-digested pBluescript (SK1). The CYC1terminator (69) of pRSterm (21) was subcloned into YEp352 (38), resulting inYEpterm. The CYC1 terminator of YEpterm was subcloned behind the mutatedPEX19 genes, taking advantage of the vector-derived SalI and KpnI sites. ThePEX19 gene-CYC1 terminator constructs were subcloned into SacII- and KpnI-digested pRS316 (68). For overexpression, the constructs were subcloned intoSacI- and KpnI-digested YEp352 (38). The resulting plasmids pRSPEX19-C347S, pRSPEX19-C347R, pRSPEX19-C347*, YEpPEX19-C347S, YEpPEX19-C347R, and YEpPEX19-C347* encoded Pex19p proteins with the indicatedmutations of the CAAX box (with an asterisk indicating the deletion of the entireCAAX box), and expression was under the control of the PEX19 promoter.

Immunofluorescence, electron, and immunoelectron microscopy. Immunoflu-orescence microscopy was performed essentially according to the procedure ofRout and Kilmartin (63) with modifications as previously described (21). Rabbitantisera against yeast thiolase (24) and yeast Pcs60p (7) were used at dilutions of1:3,000; monoclonal 12CA5 antiserum against the hemagglutinin tag (BAbCO,Richmond, Calif.) was used at a dilution of 1:20. For detection, 6-mg/ml solutionsof CY3-conjugated donkey anti-mouse IgG (cross-absorbed against rabbit IgG)and fluorescein isothiocyanate-conjugated donkey anti-rabbit IgG (Jackson Im-munoResearch Laboratories, West Grove, Pa.) were used.

For electron microscopy, washed cells were fixed with 1.5% KMnO4 for 20 minat room temperature. After dehydration in a graded ethanol series, the sampleswere embedded in Epon 812, and ultrathin sections were cut with a diamondknife and examined. Immunogold labeling was performed as described previ-ously (5).

Two-hybrid methodology. The open reading frame of PEX19 was amplified byPCR with sense primer KU34 (59CCATCGATAAGATCTCCAGTACTATGCCAAACATACAACAC39), antisense primer KU35 (59GGAATTCGAAGCTTATTGTTGTTTGCAACC39), and pKS-PEX19 as the template. By taking ad-vantage of the primer-derived ClaI site and the internal XbaI site of the resultingPCR amplification product, the fragment encoding the N-terminal region ofPex19p was subcloned into the pBluescript (SK1) vector, and its presence wasconfirmed by DNA sequence analysis. The fragment was excised with KpnI andXbaI and ligated to an XbaI-BamHI fragment containing the 39 complement ofPEX19. The ligation product was first subcloned into KpnI- and BamHI-digestedpBluescript (SK1) vector, excised with BglII and SacII, and subcloned intopPC86. The resulting plasmid, pPCPEX19, contained an in-frame fusion ofPEX19 and the activation domain encoding part of GAL4 (13). For introductionof the mutation of the CAAX box, the XbaI-SacII fragment of pPCPEX19 wasreplaced by the corresponding region of PEX19 encoding the C-terminal regionof Pex19p with the Cys347-to-Ser347 change. The resulting plasmid was desig-nated pPCPEX19-C347S. The constructs encoding fusions of peroxins with theDNA-binding domain in pPC97 have been described previously (1, 26, 43).

Cotransformation of two-hybrid vectors into strain PCY2 (13) was performed

as described previously (60). Transformed yeast cells were plated on SD syntheticmedium lacking tryptophan and leucine. The b-galactosidase filter assay hasbeen described earlier (60).

Epitope tagging of Pex19p. The clone p9-65 was derived by exonuclease IIItreatment of pKS-PEX19 and contained bp 10 to 1053 of the PEX19 openreading frame followed by 450 bp of the 39 noncoding region of the gene. DNAsequencing revealed that the fourth codon of the PEX19 open reading frame wasadjacent to the SmaI site of the multiple cloning site of the pBluescript vector(59GGATCCCCCGGGATACAACACGAA39). The vector-derived BamHI-KpnI sites were used to subclone the PEX19-containing fragment of clone p9-65into BglII- and KpnI-digested SK/mycP7 (51), resulting in SK/myc19. The result-ing plasmid contained the CUP1 promoter (11) in front of an in-frame fusion ofthe myc epitope-encoding sequence with codon 4 of the PEX19 open readingframe. For expression in S. cerevisiae, the expression cassette containing thepromoter and the fusion gene was excised using vector-derived SacI and KpnIsites and subcloned into the yeast episomal plasmid YEp352 (38), resulting inYEp-mycPEX19. The fusion gene encoded N-terminally myc-tagged Pex19punder the control of the CUP1 promoter. Expression restored the peroxisomebiogenesis and oleic acid growth defects of pex19D cells, suggesting that thetagged Pex19p is functional.

Coimmunoprecipitation. Yeast cells expressing myc-tagged Pex19p weregrown on 0.3% SD medium to late log phase and, subsequently, for 15 h inYNOG (0.1% glucose, 0.1% oleic acid, 0.05% Tween 40, 0.1% yeast extract, and0.67% yeast nitrogen base). The CUP1 promoter was induced with 0.025-g/literCuSO4 as described previously (51). Cells were stored at 270°C, and 1 g of themwas used per immunoprecipitation experiment. A 3-ml aliquot of solution A (50mM Tris-HCl [pH 7.5], 50 mM NaCl), protease inhibitors (0.5 mM NaF, 0.02%phenylmethylsulfonyl fluoride [Serva]), 15 mg of bestatin per ml, 1.5 mg ofpepstatin per ml, 1 mg of leupeptin per ml, 0.1 mg of chymostatin per ml [all fromBoehringer]), and 3 g of glass beads (0.5-mm diameter) were added, and themixture was vortexed on ice eight times for 30 s each with at least 30 s betweenvortexings (45). Samples were filtered through cotton wool, and the filtrate wastransferred to Corex tubes and centrifuged at 1,000 3 g for 30 min. The resultingsupernatant was centrifuged again at 100,000 3 g for 30 min. The pellet wasresuspended in 3 ml of solution B (solution A with 0.4% [wt/vol] Triton X-100),incubated on ice for 10 min, and centrifuged as described above. Supernatantswere normalized for protein and volume and incubated with 50 ml of sheepanti-mouse IgG Dynabeads (Dynal, Hamburg, Germany) covered with mono-clonal anti-myc IgG (serum 9E10) (28) for 2 h at 4°C. The Dynabeads werewashed three times with 1 ml of solution B, and Dynabead-bound proteins wereeluted with 60 ml of SDS-PAGE sample buffer. For the decoration of Dynabeadswith anti-myc antibodies, 50 ml of Dynabeads was blocked with 5% bovine serumalbumin in phosphate-buffered saline for 2 hours, washed five times with 10volumes of phosphate-buffered saline, and saturated with the anti-myc antiserumat 4°C overnight. The supernatant was removed, and the beads were washed fivetimes with 1 ml of solution B and then resuspended in 50 ml of solution B.

Analytical procedures. Acetyl-coenzyme A (acetyl-CoA) acyltransferase (3-oxoacyl-CoA thiolase; EC 2.3.1.16), catalase (EC 1.11.1.6), and fumarate hy-dratase (fumarase; EC 4.2.1.2) were assayed by established procedures (55).Protein concentrations were determined by using the bicinchoninic acid proteinassay reagent (Pierce Chemical Co.) with bovine serum albumin as a standard.

Nucleotide sequence accession number. The nucleotide sequence of thePEX19 gene has been submitted to the EMBL-GenBank-DDBJ database andhas been assigned accession no. Z74113.

RESULTS

Isolation of the pex19 mutant and cloning of the PEX19 gene.The pex19-1 mutant strain was identified by its inability to growon oleic acid as the sole carbon source and by mislocalizationof peroxisomal matrix enzymes to the cytosol, characteristic ofa defect in peroxisome biogenesis (see below). The meioticsegregation behavior revealed that the defect was caused by asingle gene. The diploids resulting from backcrossing the mu-tant strain to wild-type cells did not show the mutant pheno-type, confirming the pex19-1 mutation to be recessive. Thecorresponding PEX19 wild-type gene was cloned by functionalcomplementation of the pex19-1 mutant with a genomic library(Fig. 1). Nucleotide sequencing of the smallest complementinginsert (a 1.793-kb ClaI-KpnI fragment) revealed an open read-ing frame of 1.050 kb encoding a protein with a calculatedmolecular mass of 39.7 kDa (Fig. 2A). Transformation ofPEX19 resulted in functional complementation of the mutantphenotype of pex19-1, demonstrating that the authentic PEX19gene had been cloned. More recently, this gene has also beensequenced as part of the S. cerevisiae genome sequencingproject (7a). Hydropathy analysis of the deduced amino acid

618 GOTTE ET AL. MOL. CELL. BIOL.


http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

sequence of PEX19 (Fig. 2B) revealed the extremely hydro-philic nature of Pex19p, with no region fulfilling the require-ments for a membrane spanning segment (44). Most interest-ingly, at the extreme C terminus is the tetrapeptide CKQQ,which resembles the consensus sequence for the so-calledCAAX motif, the recognition sequence for protein farnesyl-transferases (56).

A search of protein databases revealed a significant overallamino acid sequence similarity between Pex19p and a numberof proteins from different organisms, including PxF, a preny-lated peroxisomal protein from the Chinese hamster (41). Theproteins aligned in Fig. 3 are characterized by a C-terminalCAAX box, suggesting that they all might be farnesylated. Theoverall sequence similarity and the presence of the putativefarnesylation sites opened the possibility that these proteinsmight represent orthologs of Pex19p. For the human house-keeping gene HK33 (8), this assumption was further supportedby functional studies in S. cerevisiae (see below).

Cells lacking PEX19 are affected in peroxisome biogenesis.A PEX19 deletion mutant (pex19D) was generated by replacingthe entire PEX19 open reading frame with LEU2 as shown inFig. 1C. Backcrosses of pex19D with the original pex19-1 mu-tant resulted in diploids exhibiting the pex phenotype, indicat-ing that the cloned PEX19 gene is allelic to the original muta-tion and not a suppressor.

In S. cerevisiae, growth on oleic acid requires functionalperoxisomes and is usually accompanied by a massive increasein the size and number of these organelles (74). Cells deficientin PEX19 were viable on YPD, SD, and ethanol media butwere unable to grow on media with oleic acid as the solecarbon source (see below), typical for S. cerevisiae mutantstrains that are defective in proteins essential for either per-oxisome metabolism or biogenesis (oleic acid-nonutilizing[onu] phenotype [22, 23]). The assumption that Pex19p is morelikely involved in peroxisome biogenesis than in peroxisomemetabolism is supported by the ultrastructural appearance of

FIG. 1. (A) Location of the PEX19 gene within the 4.8-kb genomic SpeI-BamHI fragment of chromosome IV. The arrows denote the orientations ofPEX19 and adjacent genes. (B) Complementation analysis of the PEX19genomic region. Subclones of the 4.8-kb SpeI-BamHI genomic fragment areshown along with their ability to restore growth of the pex19 mutant on oleic acid.2, complementing activity was not shown; 1, full complementing activity wasshown. The location of the PEX19 open reading frame within each subclone isindicated by the black bars. The smallest complementing region identified wasthe 1.793-kb ClaI-KpnI fragment, which was subjected to nucleotide sequenceanalysis. (C) Targeted gene disruption strategy for replacement of PEX19 withLEU2.

FIG. 2. (A) Nucleotide sequence of the PEX19 gene and deduced amino acidsequence of Pex19p. The potential oleic acid response element of the PEX19promoter is underlined, and the putative TATA box is above the broken line.The CAAX box for farnesylation is double underlined. Asterisks indicate thestop codon. These sequence data are available from EMBL-GenBank-DDBJunder accession no. Z74113. (B) Hydropathy analysis of Pex19p. A hydropathyprofile of the predicted amino acid sequence of Pex19p was calculated (44) witha window size of 17 amino acids. The analysis showed that the PEX19 geneproduct is extremely hydrophilic, with no apparent hydrophobic domains withthe potential to span a membrane. X, axis, amino acids; y axis, hydrophobicityvalues.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

the oleic acid-induced pex19D mutant strain, which is charac-terized by the absence of morphologically recognizable peroxi-somes (Fig. 4A). Peroxisomes were restored upon transforma-tion with the PEX19 gene (Fig. 4B). The involvement ofPex19p in peroxisome biogenesis is further supported by theevidence of mislocalization of peroxisomal matrix proteins tothe cytosol which is observed by immunofluorescence micros-copy (Fig. 5A). Wild-type cells exhibited a peroxisome-charac-teristic punctate pattern when stained for the PTS1 proteinPcs60p (7) or the PTS2 protein thiolase (21, 32). In contrast, adiffuse staining pattern for both peroxisomal matrix proteinswas observed in pex19D cells, indicating their mislocalization tothe cytosol. A punctate staining pattern for both proteins wasrestored in mutant cells expressing PEX19. These data suggestthat pex19D cells exhibit a defect in import of peroxisomalmatrix proteins of the PTS1 as well as the PTS2 variety.

To quantify the import defect, the subcellular distributionsof the peroxisomal matrix enzymes catalase and thiolase(Fox3p) as well as that of the mitochondrial fumarase weredetermined by cell fractionation analysis of both wild-type and

pex19D cells. Organelles of oleic acid-induced cells were sep-arated by differential centrifugation, and peroxisomal andmitochondrial marker enzyme activities of the sediment andsupernatant fractions were determined (Table 3). The mito-chondrial fumarase activity served as a control for the quan-tification of organelle breakage during homogenization. Inwild-type cells, the majority of the peroxisomal and mitochon-drial enzymes were detected in the organellar pellet. However,in pex19D cells, the peroxisomal matrix proteins were predom-inately found in the soluble fraction, consistent with theimmunofluorescence microscopy data that suggested their mis-localization to the cytosol. This observation was substantiatedby isopycnic sucrose density centrifugation of pex19D cell ho-mogenates and subsequent detection of peroxisomal and mi-tochondrial marker enzymes in gradient fractions (Fig. 5B).Based on the localization of fumarase, mitochondria peaked ata density of 1.18 g/cm3. The peroxisomal marker enzymes cata-

FIG. 3. Alignment of deduced amino acid sequences of the products of S.cerevisiae PEX19 (ScPex19p), Caenorhabditis elegans open reading frameF54F2.8 (CeF54F2.8), Chinese hamster PxF (CgPxF) (41), and the human HK33gene (HsHK33) (8). Amino acids identical or similar in S. cerevisiae Pex19p andat least one of the three other proteins are indicated by a black background.Similarity rules were as follows: G 5 A 5 S, A 5 V, V 5 I 5 L 5 M, I 5 L 5M 5 F 5 Y 5 W, K 5 R 5 H, D 5 E 5 Q 5 N, and S 5 T 5 Q 5 N. Dashesindicate gaps.

FIG. 4. Mutant pex19D cells lack morphologically detectable peroxisomes.Shown are electron micrographs of oleic acid-induced cells of null-mutantpex19D lacking Pex19p (A) and pex19D cells complemented with the isolatedPEX19 gene on a single-copy plasmid (pRS-PEX19) (B). In the case of thecomplemented mutant, growth on oleic acid resulted in marked peroxisomeproliferation. Peroxisomes were not detectable in sections of cells of the pex19Dmutant. L, lipid droplet; M, mitochondrion; N, nucleus; P, peroxisome. Bar, 1mm.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

lase and thiolase were almost exclusively found in the loadingzone of the gradient, indicating that they had been mislocalizedto the cytosol. Neither catalase nor thiolase activity was de-tected in fractions with a density of 1.23 g/cm3, the typicaldensity for peroxisomes. Taken together, the data on the sub-cellular localization of peroxisomal matrix proteins suggestthat pex19D mutant cells exhibit a defect in import of PTS1-and PTS2-containing peroxisomal matrix proteins.

Functional analysis of chimeras of yeast Pex19p and thehuman HK33 gene product. Based on sequence similarity, theHK33 gene product (8) was a candidate human ortholog of theyeast Pex19p (Fig. 3). To substantiate this assumption, theHK33 gene product was tested for its ability to functionallyreplace S. cerevisiae Pex19p in peroxisome biogenesis. Expres-sion of the human protein in mutant pex19D did not comple-ment the growth defect on oleic acid medium, suggesting thatthe yeast and human proteins might not be interchangeable(data not shown). However, growth of the mutant on oleic acidwas restored to normal upon expression of the chimeric pro-tein YH1 (Fig. 6A), containing amino acids 1 to 231 of Pex19pand amino acids 187 to 299 of the HK33 gene product, whichcorrespond to amino acids 232 to 350 of the yeast protein (Fig.3). Morphological characterization of the pex19D mutant ex-pressing the chimeric YH1 protein revealed the presence ofnormal-looking peroxisomes (Fig. 6B). These observations

suggested that the chimeric YH1 protein was functionally ac-tive. Since the yeast portion of the fusion protein alone (Y1)did not possess complementing activity (Fig. 6A), these dataindicate that the corresponding C-terminal regions of the yeastand human proteins might be interchangeable. Chimeric pro-teins containing larger portions of the HK33 gene product(YH2, YH3, and HY1) did not retain complementing activity.The outcome of the complementation studies supports thenotion of the HK33 gene product being the human ortholog ofS. cerevisiae Pex19p.

Time course of oleic acid induction. Polyclonal antibodiesraised against bacterially expressed Pex19p were used to detectPex19p in whole-cell lysates from wild-type S. cerevisiae and thecorresponding pex19D null mutant as shown in Fig. 7A. Twopolypeptides of 44 and 46 kDa were detected in wild-typeextracts, but not in the extracts from the pex19D deletion strain,suggesting that the antiserum specifically recognized Pex19p.Since a putative farnesylation site has been predicted by theprimary sequence of Pex19p, the simplest explanation for theappearance of the double band is the simultaneous intracellu-lar presence of prenylated and nonprenylated Pex19p (seebelow).

S. cerevisiae cells were shifted from growth in glucose-con-taining medium to growth in oleic acid-containing medium,which resulted in a massive proliferation of peroxisomes (74).At various time points, cell homogenates were prepared andprobed for Kar2p (a matrix protein of the endoplasmic retic-ulum), Fox3p (a peroxisomal matrix protein), and Pex19p.Even before the shift to oleic acid medium, cells containedreadily detectable levels of both forms of Pex19p, whereasFox3p was not detectable (Fig. 8A, lane 1). Upon oleic acidinduction, the amounts of both Pex19p forms increased ap-proximately fivefold over the entire induction period (Fig. 8A),whereas Fox3p increased from nondetectable to clearly detect-able levels. Interestingly, the profile of oleic acid induction ofPex19p is similar to the profile for Pex3p (25), which is abinding partner of Pex19p (see below). The results of theimmunoblot analysis were also reflected by Northern blot anal-ysis, as shown in Fig. 8B. A 1.8-kb transcript was detected inboth glucose-repressed and oleic acid-induced cells, but not inthe pex19D cells, with the transcript being more prominentupon oleic acid induction. Consistent with this observation, aputative oleic acid-responsive element is found at the 59 non-coding region of the PEX19 gene (Fig. 2A).

FIG. 5. Mutant pex19D cells are defective in peroxisomal matrix proteinimport. (A) Immunofluorescence microscopy localization of PTS2-containingthiolase (Fox3p) and PTS1-containing Pcs60p in wild-type, pex19D mutant, andcomplemented pex19D mutant cells expressing pRS-PEX19. Bar, 5 mm. (B)Localization of peroxisomal matrix proteins in pex19D cells. A homogenate ofoleic acid-induced pex19D cells was separated on a 20 to 54% (wt/wt) sucrosegradient by equilibrium density centrifugation. Peroxisomal marker enzymescatalase and 3-oxoacyl-CoA thiolase as well as the mitochondrial marker fuma-rase in gradient fractions were monitored by activity measurements. Mitochon-dria peaked in fraction 9 at a density of 1,185 g/cm3. Peroxisomal matrix enzymeswere nearly exclusively found in the loading zone of the gradient, consistent withtheir mislocalization to the cytosol.

TABLE 3. Distribution pattern of peroxisomal and mitochondrialmarker enzymes in supernatant and pellet fractions from a 25,000 3

g centrifugation of homogenates of oleic acid-induced wild-type,pex19D, and complemented pex19D cells

Strain Enzyme

Activity (nkat) in:

A1/A2ratio

Supernatantfraction

(A1)

Pelletfraction

(A2)

Wild type Thiolase 10.0 29.6 0.3Catalase 15.4 3 103 65.5 3 103 0.2Fumarase 1.4 11.1 0.1

pex19D Thiolase 17.8 0.9 20.0Catalase 97.1 3 103 2.7 3 103 39.0Fumarase 8.0 13.5 0.6

pex19D(pRSPEX19) Thiolase 25.6 34.1 0.7Catalase 35.8 3 103 76 3 103 0.3Fumarase 2.9 8.9 0.3



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Subcellular localization of Pex19p. To determine the sub-cellular localization of Pex19p, a whole-cell homogenate fromwild-type cells was separated into a supernatant, consistingpredominantly of cytosol and microsomes, and a pellet, con-taining mitochondria and peroxisomes, by centrifugation at25,000 3 g (Fig. 7B). Only a minute amount of Pex19p wasfound in the organellar pellet; the majority of both farnesy-lated and nonfarnesylated Pex19p was found in the superna-tant. A subsequent centrifugation of the supernatant at100,000 3 g did not result in additional sedimentation ofPex19p (42a). To examine the localization of the sedimentableportion of Pex19p, the 25,000 3 g sediment was further frac-tionated by sucrose density gradient centrifugation. While per-

oxisomes and mitochondria were nicely separated, the Pex19papplied to the gradient was distributed throughout all fractionsand, hence, could not be assigned to a specific organelle (datanot shown). Since the majority (.95%) of Pex19p did notsediment at 25,000 3 g or at 100,000 3 g, it is presumed thatthe protein predominately resides in the cytosol in oleic acid-induced wild-type yeast cells. However, the association of atleast a portion of Pex19p with organelles was also supported byimmunofluorescence microscopy localization of the endoge-nous protein, which revealed a weak punctate pattern thatcould not be assigned to a specific organelle (data not shown).The intracellular localization of Pex19p was further analyzedby immunocytochemical detection of the protein with poly-clonal anti-Pex19p antibodies. No labeling was observed inFIG. 6. The HK33 gene product is the putative human ortholog of Pex19p.

(A) Growth of pex19D transformants expressing S. cerevisiae PEX19-humanHK33 chimeras on oleic acid medium. Expression of the YH1 construct com-plements the growth defect of pex19D cells, suggesting that the fusion protein isfunctionally active. The yeast and human protein amino acid (aa) regions fusedare as follows: YH1 (yeast aa 1 to 231, human aa 187 to 299), YH2 (yeast aa 1to 86, human aa 87 to 299), YH3 (yeast aa 1 to 154, human aa 133 to 299), HY1(human aa 1 to 186, yeast aa 232 to 350), and Y1 (yeast aa 1 to 231). The solidboxes indicate the S. cerevisiae Pex19p portion; the open boxes indicate thehuman HK33 gene product portion. (B) Electron micrograph of oleic acid-induced pex19D cells expressing fusion construct YH1. Complementation of themutant strain is indicated by the presence of peroxisomes. p, peroxisome; n,nucleus, v, vacuole. Bar, 1 mm.

FIG. 7. (A) Immunological detection of Pex19p. Equal amounts of oleicacid-induced wild-type and pex19D homogenates (50 mg of protein) were sub-jected to immunoblot analysis with rabbit antiserum against Pex19p. Pex19p wasdetected as a doublet of 44 and 46 kDa. (B) Immunoblot analysis of cell fractionsobtained by centrifugation of cell homogenates from oleic acid-induced wild-typecells at 25,000 3 g. Equal proportions of the supernatant and pellet fractionswere loaded on the gel. Molecular mass standards (in kilodaltons) are indicatedon the left. (C) Subcellular localization of myc-tagged Pex19p by immunogoldlabeling. Sections of pex19D cells expressing myc-PEX19 from the multicopyplasmid YEp-mycPEX19 were probed with polyclonal antiserum against Pex19pand goat anti-rabbit antibodies coupled to 10-nm-diameter gold particles. p,peroxisome. Bar, 0.2 mm.

FIG. 8. Time course of Pex19p induction during growth on oleic acid. (A)Wild-type cells were precultured in 0.3% SD and subsequently shifted to YNO.At the indicated time points, whole-cell extracts were prepared for immunolog-ical detection of oleic acid-inducible peroxisomal thiolase (Fox3p) (24), consti-tutively expressed Kar2p (62), and Pex19p. The amount loaded per lane corre-sponds to 0.3 mg of cells. (B) Northern blot analysis of total RNA from wild-type(wt) and pex19D mutant cells grown on either glucose (i.e., SD) or oleate (i.e.,YNO) as indicated. A radiolabeled internal fragment of the PEX19 open readingframe was used as a probe. Fifty micrograms of total RNA was loaded per lane.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

cells lacking Pex19p, indicating that the antibodies specificallyrecognized Pex19p (data not shown). Immunogold labeling ofthe endogenous Pex19p of oleic acid-induced wild-type cellswas very weak, but the few gold particles found were localizedin the cytosol (data not shown). An overexpressed myc-taggedversion of Pex19p was also primarily detected in the cytosol(Fig. 7C). Gold particles, however, were also found at theperoxisomal membranes, indicating that a portion of Pex19pmight be associated with that organelle (Fig. 7C). Since over-expression of the tagged Pex19p resulted in a functionalcomplementation of the growth defect of the pex19D mutanton oleic acid medium (data not shown) accompanied by thepresence of normal-looking peroxisomes (Fig. 7C), neither thetagging nor the overexpression apparently influenced the func-tion of Pex19p. Therefore, the subcellular localization of thetagged Pex19p could be expected to closely mirror that ofwild-type Pex19p. However, the experiment still has to be in-terpreted with caution, since it is well known that overexpres-sion can lead to an abnormal intracellular localization of pro-teins.

Pex19p is farnesylated at the C terminus. Pex19p contains atits C terminus the sequence CKQQ, resembling the consensussequence for a CAAX motif, which has been shown to be thetarget for isoprenylation in a number of proteins (56). Theamino acid in position X of the CAAX box determines thenature of the isoprenyl group transferred to the protein. Pro-teins with alanine, serine, methionine, cysteine, or glutamine atposition X are usually farnesylated, whereas a leucine marksthe protein for the transfer of a geranylgeranyl group (56). TheC-terminal glutamine of the Pex19p CAAX box suggests thatthe protein is farnesylated, usually via a thioether linkage tothe conserved cysteine of the CAAX box. Consistent with aputative farnesylation of Pex19p, two forms of the protein (44and 46 kDa) were detected by immunoblot analysis of whole-cell extracts (Fig. 7A). Previous studies of protein prenylationhad shown that this kind of modification typically results inslight increases in the electrophoretic mobilities of these pro-teins (12). According to this observation, the 44-kDa proteinwas expected to represent the farnesylated Pex19p. To test thisassumption, we generated a mutated Pex19p in which serinewas substituted for the conserved cysteine at position 347(Pex19p-C347S) (Fig. 9A). When the mutated Pex19p wasexpressed in cells lacking endogenous Pex19p, only the 46-kDaform of Pex19p was detectable in yeast lysates, while expres-sion of wild-type Pex19p resulted in the occurrence of bothprotein forms (Fig. 9B). The absence of the 44-kDa form uponexpression of the mutated Pex19p strongly suggested thatPex19p is farnesylated at Cys347.

To confirm the farnesylation of Pex19p, we performed an invitro farnesylation assay. In the presence of [3H]farnesylpyro-phosphate, cell extracts containing overexpressed wild-type ormutated Pex19p-C347S were incubated with extracts from ei-ther pex19D cells harboring the farnesyltransferase or ram1cells lacking the farnesyltransferase (58, 78). Farnesylation ofPex19p was monitored by fluorography as shown in Fig. 9C. Inthe presence of the farnesyltransferase, the wild-type Pex19p,but not the mutant Pex19p, incorporated the [3H]farnesylpy-rophosphate. Of the 44- and 46-kDa wild-type forms ofPex19p, only the 44-kDa band had incorporated the radioac-tivity, consistent with the idea that the increased electro-phoretic mobility was due to farnesylation of the protein.

Farnesylation of Pex19p is essential for its proper biologicalactivity. To analyze the significance of farnesylation for itsbiological activity, nonfarnesylated Pex19p species were testedfor their ability to complement cells lacking endogenousPex19p. In the constructs tested, cys347 of the CAAX box was

replaced by either serine (Pex19p-C347S) or arginine (Pex19p-C347R) or the entire CAAX box was deleted (Pex19p-C347*).The pex19D cells which expressed the mutated Pex19p speciesfrom a low-copy-number CEN plasmid under the control of thePEX19 promoter grew on oleic acid as the sole carbon source(Fig. 10A). However, growth was weak in comparison to that ofcells complemented with the wild-type gene (Fig. 10A). Or-ganellar and cytosolic fractions were prepared from pex19Dcells harboring either the wild-type or mutated Pex19p andwere analyzed for the presence of peroxisomal matrix enzymes.Between 85 and 95% of the peroxisomal marker enzyme cata-lase was found in the supernatant fraction of transformantsexpressing nonfarnesylated Pex19p (Fig. 10B, lanes 2 and 3).This observation was substantiated by immunofluorescence mi-croscopy localization of the peroxisomal marker Pcs60p inthese cells, which revealed a punctate staining pattern above acytosolic background labeling (Fig. 10C, panel b). These datasuggested that the complementation of pex19D cells with non-farnesylated Pex19p was only partial. Immunoblot analysis ofwhole-cell lysates revealed that the nonfarnesylated Pex19pspecies were expressed at a slightly higher level than the en-dogenous wild-type protein, indicating that a low expressionlevel did not account for the low complementing activity of theconstructs (data not shown). Nevertheless, the low comple-menting activity of nonfarnesylated Pex19p could be partiallyovercome by a massive overexpression of the protein. Theability of transformants expressing nonfarnesylated Pex19pspecies from multicopy plasmids to grow on oleic acid mediumwas nearly indistinguishable from that of wild-type cells (data

FIG. 9. In vivo and in vitro farnesylation of Pex19p. (A) C-terminal aminoacid sequence of wild-type Pex19p and mutated Pex19p-C347S. The letters inboldface type indicate amino acid substitutions within the CAAX box. (B) Im-munoblot analysis of Pex19p in whole-cell lysates from oleic acid-induced pex19Dmutant cells expressing wild-type or mutated Pex19p from pRSPEX19 orpRSPEX19-C347S, respectively. Note the disappearance of the faster-migratingform of Pex19p upon expression of the mutated Pex19p, suggesting that itrepresents the farnesylated Pex19p. (C) Fluorogram and immunoblot results ofin vitro farnesylation assays. Yeast homogenates expressing wild-type or mutatedPex19p from YEpPEX19 or YEpPEX19-C347S, respectively, were subjected toan in vitro assay with [3H]farnesyldiphosphate in the absence (2) or presence(1) of farnesyltransferase as indicated. Comparison with the immunoblot showsthat the faster-migrating Pex19p form had incorporated the farnesyl moiety. Theabsence of farnesylated Pex19p upon expression of the mutated Pex19p indicatedthat the CAAX box of Pex19p is essential for its farnesylation. Positions ofmolecular mass standards are indicated for both panels B and C.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

not shown). In these cells, the immunofluorescence microscopylocalization of the peroxisomal marker Pcs60p was also com-parable to that of fully complemented cells (Fig. 10C, panels cand d). Morphological characterization of these transformantsrevealed the presence of normal-looking peroxisomes (Fig.10D). The biochemical analysis depicted in Fig. 10B, however,showed that in pex19D cells complemented with overexpressednonfarnesylated Pex19p, the majority of the peroxisomal ma-trix marker catalase was still found in the supernatant fraction.To monitor the complementation activity of overexpressednonfarnesylated Pex19p in more detail, we examined the ex-tent to which peroxisomal matrix proteins are localized inperoxisomes in these apparently complemented cells. Homog-enates from transformants overexpressing either the wild-typeor nonfarnesylated Pex19p were separated on sucrose densitygradients, and fractions were probed for the peroxisomal ma-trix markers catalase and thiolase (Fox3p) and the membrane

markers Pex3p and Pex11p (Fig. 11). Peroxisomes from fullycomplemented cells peaked at a density of 1.22 g/cm3 andcontained the majority of the peroxisomal matrix and mem-brane enzymes. The peroxisomes of the cells expressing non-farnesylated Pex19p also peaked at a density of 1.22 g/cm3 butcontained only a minute amount of the peroxisomal matrix andmembrane proteins. The majority of the peroxisomal matrixprotein was found in the loading zone of the gradient; theperoxisomal membrane proteins were predominately found infractions of 1.18 g/cm3, cosegregating with mitochondria (Fig.11). This result clearly demonstrated that expression of thenonfarnesylated Pex19p resulted in only a partial complemen-tation of pex19D cells. The small amount of correctly targetedperoxisomal proteins might be sufficient to allow transformedpex19D cells to grow on oleic acid medium. However, ourresults do not exclude the possibility that in vivo the majority ofperoxisomal protein is correctly targeted to peroxisomes, as

FIG. 10. Farnesylation is essential for proper function of Pex19p in peroxisome biogenesis. (A) Growth behavior on oleic acid medium of wild-type cells, pex19Dmutant cells, and mutant cells expressing wild-type Pex19p or Pex19p containing the indicated mutations of the CAAX box. The pex19D null mutant was not able togrow on oleic acid medium. The mutant cells regained the wild-type growth behavior upon transformation with the wild-type PEX19 gene. Cells expressing Pex19pcontaining mutations in the CAAX box are characterized by a slow-growth phenotype on oleic acid medium. The plasmids used for the expression were pRSPEX19,pRSPEX19-C347S, pRSPEX19-C347R, and pRSPEX19-C347*. (B) Relative amount of catalase in supernatant (gray bars) and pellet (white bars) fractions derived by25,000 3 g centrifugation of cell homogenates from pex19D mutant (lane 1) and nontransformed wild-type (lane 10) cells and from pex19D mutant cells expressingwild-type or mutant PEX19 from plasmids pRSPEX19-C347S (lane 2), pRSPEX19-C347R (lane 3), pRSPEX19-C347* (lane 4), pRS-PEX19 (lane 5), YEpPEX19-C347S(lane 6), YEpPEX19-C347R (lane 7), YEpPEX19-C347* (lane 8), and YEp-PEX19 (lane 9). (C) Immunofluorescence microscopy localization of PTS1-containingPcs60p in pex19D cells expressing pRS316 (a), pRSPEX19-C347S (b), YEpPEX19-C347S (c), or YEpPEX19 (d). Bar, 10 mm. (D) Electron micrograph of oleicacid-induced pex19D cells expressing YEpPEX19-C347S. Complementation of the mutant strain is suggested by the presence of peroxisomes (p). m, mitochondria; n,nucleus; l, lipid droplets. Bar, 0.5 mm.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

suggested by the immunofluorescence microscopy data (Fig.10C, panel c). The observed presence of peroxisomal markersin soluble fractions in the subcellular localization fractionationstudies could also be explained by the assumption that theperoxisomes of the partially complemented cells are more frag-ile than wild-type peroxisomes and thus would release theircontents more easily during homogenization. The presence ofthe peroxisomal membrane proteins Pex3p and Pex11p in mi-tochondrial fractions might be due to mitochondrial mislocal-ization or aggregation; however, it could also indicate the pres-ence of light peroxisomes or peroxisomal membrane ghosts. Inany case, the inability of the nonfarnesylated Pex19p to fullyreplace the wild-type protein strengthens the importance offarnesylation for Pex19p function in peroxisome biogenesis.

Identification of Pex3p as a binding partner of Pex19p.Pex19p is one of 15 peroxins which have so far been shown tobe involved in peroxisome biogenesis in S. cerevisiae (16).There is striking evidence that some of these proteins require

interaction with other peroxins for their function in peroxi-some biogenesis (1, 27). Therefore, we used the two-hybridsystem (14, 29) to detect putative binding partners of Pex19p.Fusion constructs were prepared by cloning PEX genes intoplasmids encoding either the activation or the DNA-bindingdomains of Gal4p. Physical interactions of Pex19p with perox-ins were expected to result in the activation of lacZ transcrip-tion in transformants. Yeast cells coexpressing Pex19p andPex3p fused to the corresponding Gal4p domains expressedsignificant amounts of b-galactosidase, demonstrating thatPex19p is capable of binding Pex3p in vivo (Fig. 12A). Inter-action of both proteins was strongly increased by farnesylationof Pex19p. However, although weak, the interaction of nonfar-nesylated Pex19p with Pex3p was still significant, suggestingthat a simple hydrophobic interaction of both proteins is ratherunlikely. This interpretation is further supported by the obser-vation that Pex19p still interacts with a truncated Pex3p lackingthe N-terminal amino acids 1 to 107 that comprise both hy-drophobic regions of the protein. The controls included in theassay shown in Fig. 12A indicate that coexpression of either ofthe fusion proteins, together with the respective Gal4p do-mains encoded by pPC86 and pPC97, did not support activa-tion of transcription of the reporter genes. The yeast peroxinsPex1p, Pex4p, Pex5p, Pex6p, Pex7p, Pex8p, Pex13p, andPex14p did not interact with Pex19p in the two-hybrid system,since transformants showed b-galactosidase activities in therange of the negative controls of Fig. 12A (data not shown).

The interaction of Pex19p with Pex3p was independentlyconfirmed by coimmunoprecipitation (Fig. 12B). Pex3p couldbe coimmunoprecipitated with myc-tagged Pex19p from solu-bilized membranes of transformants expressing the fusion pro-tein but not from those of control strains. The immunoprecipi-tates contained neither the highly expressed peroxisomalmembrane protein Pex11p (25, 50) nor the peroxisomal matrixprotein Fox3p (24), indicating that micelle-associated preexist-ing or artifactual mixtures of proteins were not retained non-specifically (data not shown).

DISCUSSION

Here we have reported the molecular characterization ofPex19p, an oleic acid-inducible farnesylated protein essentialfor peroxisome biogenesis. Consistent with this function, cellsdeficient in Pex19p do not grow on oleic acid as the sole carbonsource, lack morphologically detectable peroxisomes, and arecharacterized by mislocalization of peroxisomal matrix en-zymes of the PTS1 and PTS2 variety to the cytosol. Bindingstudies identified the interaction of Pex19p with the peroxinPex3p, an integral protein of the peroxisomal membrane.

The gene product of the human housekeeping gene HK33(8) and the Chinese hamster peroxisomal prenylated proteinPxF (41) were identified as putative orthologs of the yeastperoxin (Fig. 3). Supporting the notion that the HK33 geneproduct is a true ortholog of Pex19p, the C-terminal region,which is essential for the function of yeast Pex19p, could bereplaced by the corresponding region of the human HK33 geneproduct. The chimeric protein retained the ability to function-ally complement the growth defect of the pex19D mutant onoleic acid medium (Fig. 6). The possibility that the HK33 geneproduct is a true ortholog of the peroxin Pex19p is of consid-erable clinical interest, since mutations in several peroxinshave been demonstrated to cause peroxisome biogenesis dis-orders, which are a heterogeneous group of autosomal reces-sive diseases that are lethal in early infancy (48). Cells frompatients with peroxisome biogenesis disorders are character-ized by defects in peroxisomal protein import, thus phenotyp-

FIG. 11. Activity of peroxisomal and mitochondrial marker enzymes in frac-tions derived by continuous 20 to 54% (wt/wt) sucrose density gradient centrif-ugation of cell homogenates from pex19D mutant cells expressing either wild-type or nonfarnesylated Pex19p. Expression was from YEpPEX19 or YEpPEX19-C347S, respectively. Expression of wild-type Pex19p resulted in the comi-gration of the majority of the peroxisomal enzymes and peroxisomal membraneproteins at a density of 1.23 g/cm3, typical for wild-type peroxisomes. Uponexpression of mutated Pex19p, only a minor portion of the peroxisomal markerswas found at 1.23 g/cm3, suggesting that nonfarnesylated Pex19p cannot fullycomplement the pex19D mutation. The majority of the peroxisomal membraneprotein was found in fractions of 1.18 g/cm3, cosegregating with mitochondrialfumarase activity. Peroxisomal and mitochondrial proteins were monitored byenzyme activity measurements. Equal volumes of each fraction were analyzed forthe presence of peroxisomal membrane proteins Pex3p (39) and Pex11p (25, 50)by immunoblotting.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

ically resembling most yeast pex mutants (16). Eleven comple-mentation groups of these disorders have been defined, and forsix of them the mutated gene has not yet been identified (71).

A striking feature of the Pex19p sequence is the C-terminalmotif referred to as the CAAX box that is contained in nu-merous proteins in which the cysteine represents the site ofprenylation. Proteins of S. cerevisiae in which the X residue isalanine, serine, cysteine, methionine, or glutamine are farne-sylated by the farnesyl protein transferase. Several lines ofevidence suggest that Pex19p is farnesylated at the cysteine ofthe C-terminal CKQQ sequence. Two forms of Pex19p, distin-guishable by their different electrophoretic mobilities, weredetected by Western blot analysis of whole-cell lysates (Fig. 7to 9). Replacement of the invariant cysteine of the CKQQsequence by either arginine or serine resulted in the disappear-ance of the faster-migrating form, suggesting that it representsthe farnesylated Pex19p (Fig. 9B). In S. cerevisiae, farnesylprotein transferase activity requires the RAM1 gene product.The dependence of Pex19p farnesylation on the presence ofRam1p was confirmed by in vitro incorporation of the farnesylmoiety into wild-type Pex19p (Fig. 9C). In oleic acid-inducedwild-type S. cerevisiae, both farnesylated and nonfarnesylatedPex19p are present, with the farnesylated form being the dom-inant species (Fig. 7A). One of the most frequently suggestedfunctional roles for protein isoprenylation is facilitation ofmembrane binding. In S. cerevisiae, proteins like Ypt1p, Sec4p,Ste18p, and Cdc42p require posttranslational prenylation formembrane association (4, 56, 76). However, if both the farne-sylated and nonfarnesylated forms of Pex19p predominatelyreside in the cytosol, as suggested by our biochemical data (Fig.7), Pex19p farnesylation might not directly mediate an associ-ation of the protein with the membrane. In this respect, it isinteresting that the physical association of prenylated proteinswith the target membranes does not necessarily occur via theprenyl group. Prenylated Ras, for example, is cytosolic; addi-tional palmitoylation is needed to target this protein to theplasma membrane (6). Based on our biochemical data, farne-

sylated Pex19p may also predominately reside in the cytosol.Furthermore, all of the above-mentioned prenylated proteinsare targeted to different subcellular locations; consequently,the targeting information may reside within the protein ratherthan in the prenyl groups. It has been suggested that targetingto the appropriate location is realized by the specific adherenceof defined prenylated proteins to organelle-specific membranereceptors (31, 33, 66). In agreement with this assumption,Pex19p was found to interact with the peroxisomal membraneprotein Pex3p (Fig. 12). The interaction of Pex19p and Pex3pdid strongly depend on the presence of the farnesyl group,consistent with the idea that the primary role of the farnesylmoiety may be to trigger the binding properties of Pex19p. Aprecedent for a protein-protein interaction enhanced by far-nesylation is found in the yeast Ras-dependent signal trans-duction pathway. Evidence that the essential role of the farne-syl moiety of yeast Ras is to enhance the interaction with itsdownstream target, adenylate cyclase, rather than to localizeRas to the plasma membrane has been provided (6). WhetherPex3p targets Pex19p to the peroxisomal membrane remains tobe shown, especially since biochemical data suggested that onlya fraction of the endogenous Pex19p is associated with theperoxisomal membrane in S. cerevisiae (Fig. 7). However, onthe basis of immunofluorescence microscopy data and immu-nogold labeling, PxF, the putative mammalian ortholog ofPex19p, has been determined to reside at the peroxisomalmembrane (41). Interestingly, in agreement with our observa-tions for Pex19p, the association of PxF with the peroxisomalmembrane was no longer detectable by biochemical means,which was interpreted to indicate that the protein was attachedloosely to the outer surface of peroxisomes. This is possible aswell for the yeast Pex19p protein. The idea of a peroxisomalassociation of Pex19p is also supported by other observations.Since Pex19p and Pex3p were coimmunoprecipitated fromsedimented membranes, at least a portion of Pex19p is appar-ently membrane associated. This would also explain the punc-tate pattern observed upon immunofluorescence localization

FIG. 12. Physical interaction of Pex19p with Pex3p. (A) PCY2 double transformants expressing the indicated combinations of fusion proteins were tested forb-galactosidase expression. The color intensities of these strains after the b-galactosidase filter assay are shown. (B) Coimmunoprecipitation of myc-Pex19p with Pex3p.Immunoprecipitations were performed with antibodies against the c-myc epitope and solubilized membranes prepared from pex19D cells and from pex19D cellsexpressing myc-Pex19p. The upper band that appears in both lanes corresponds to the heavy chain of IgG. Equal amounts of immunoprecipitates were separated bySDS-PAGE and subjected to immunoblot analysis with monoclonal antibodies against the myc epitope and polyclonal antibodies against Pex3p.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

of the endogenous protein (data not shown) and the immuno-cytochemically observed association of myc-tagged Pex19pwith the peroxisomal membrane (Fig. 7C). However, even adifferent subcellular localization of the two binding partners,Pex3p and Pex19p, in S. cerevisiae appears less disturbing if wetake into consideration the possibility that the interaction be-tween Pex19p and Pex3p is transient rather than stable. As aworking model, a transient interaction of the two proteinscould result in the modulation of one of the binding partners,which might trigger its function in peroxisome biogenesis.

Peroxisome biogenesis includes of matrix protein import,formation of the peroxisomal membrane, and proliferation ofthe organelle (16). To date, we do not know at which pointPex19p fulfills its functional role. Pex3p has been reported tobe required for the maintenance of the peroxisomal membrane(3) and has been suggested to be involved in the topogenesis ofat least some peroxisomal membrane proteins (77). Based onthe observed interaction of Pex19p with Pex3p, it is tempting tospeculate that both proteins act in tandem at the same step inperoxisome biogenesis, supposedly the formation of the per-oxisomal membrane.

ACKNOWLEDGMENTS

K.G., W.G., and M.L. contributed equally to this work.We are grateful to all members of our labs for fruitful discussions.

We thank Adalbert Roscher for kindly providing the HK33 gene. Wethank Gabriele Dodt, Peter Rehling, and Michael Schwierskott forreading the manuscript.

This work was funded by grants from the Deutsche Forschungsge-meinschaft (Er178/2-1, Ku329/17-1, Ku329/17-2, and Ro 727/1-2) andby the Fonds der Chemischen Industrie.

REFERENCES

1. Albertini, M., P. Rehling, R. Erdmann, W. Girzalsky, J. A. K. W. Kiel, M.Veenhuis, and W.-H. Kunau. 1997. Pex14p, a peroxisomal membrane proteinbinding both receptors of the two PTS-dependent import pathways. Cell89:1–20.

2. Ausubel, F. J., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A.Smith, and K. Struhl (ed.). 1989. Current protocols in molecular biology.Greene Publishing Associates and Wiley-Interscience, New York, N.Y.

3. Baerends, R. J. S., S. W. Rasmussen, R. E. Hilbrands, M. van der Heide,K. N. Faber, P. T. W. Reuvekamp, J. A. K. W. Kiel, J. M. Cregg, I. J. van derKlei, and M. Veenhuis. 1996. The Hansenula polymorpha PER9 gene encodesa peroxisomal membrane protein essential for peroxisome assembly andintegrity. J. Biol. Chem. 271:8887–8894.

4. Balch, W. E. 1990. Low molecular weight GTP-binding proteins (LMGPs)involved in vesicular transport: binary switches or biological transducers?Trends Biochem. Sci. 15:469–472.

5. Baumgart, E. 1994. Morphology of peroxisomes in light- and electron mi-croscopy, p. 37–57. In M. Bugaut and N. Latruffe (ed.), Peroxisomes: bio-chemistry, molecular biology and genetic diseases. Springer-Verlag, Heidel-berg, Germany.

6. Bhattacharya, S., L. Chen, J. R. Broach, and S. Powers. 1995. Ras membranetargeting is essential for glucose signaling but not for viability in yeast. Proc.Natl. Acad. Sci. USA 92:2984–2988.

7. Blobel, F., and R. Erdmann. 1996. Identification of a peroxisomal member ofthe AMP-binding protein family. Eur. J. Biochem. 240:468–476.

7a.Bloecker, H., and P. Brandt. Unpublished data.8. Braun, A., S. Kammerer, W. Weissenhorn, E. H. Weis, and H. Cleve. 1994.

Sequence of a putative human housekeeping gene (HK33) localized onchromosome 1. Gene 146:291–295.

9. Brocard, C., F. Kragler, M. M. Simon, T. Schuster, and A. Hartig. 1994. Thetetratricopeptide repeat-domain of the Pas10 protein of Saccharomyces cer-evisiae is essential for binding the peroxisomal targeting signal SKL. Bio-chem. Biophys. Res. Commun. 204:1016–1022.

10. Brunelli, J. P., and M. L. Pall. 1993. A series of yeast vectors for expressionof cDNAs and other DNA sequences. Yeast 9:1299–1308.

11. Butt, T. R., E. J. Sternberg, J. A. Gorman, P. Clark, D. Hamer, M. Rosen-berg, and S. T. Crooke. 1984. Copper metallothionein of yeast, structure ofthe gene, and regulation of expression. Proc. Natl. Acad. Sci. USA 81:3332–3336.

12. Caplan, A. J., J. Tsai, P. J. Casey, and M. G. Douglas. 1992. Farnesylation ofYDJ1p is required for function at elevated growth temperatures in Saccha-romyces cerevisiae. J. Biol. Chem. 267:18890–18895.

13. Chevray, P. M., and D. Nathans. 1992. Protein interaction cloning in yeast:

identification of mammalian proteins that react with the leucine zipper ofJun. Proc. Natl. Acad. Sci. USA 89:5789–5793.

14. Chien, C. T., P. L. Bartel, R. Sternglanz, and S. Fields. 1991. The two-hybridsystem: a method to identify and clone genes for proteins that interact witha protein of interest. Proc. Natl. Acad. Sci. USA 88:9578–9582.

15. De Hoop, H. J., and G. Ab. 1992. Import of proteins into peroxisomes andother microbodies. Biochem. J. 286:657–669.

16. Distel, B., R. Erdmann, S. J. Gould, G. Blobel, D. I. Crane, J. M. Cregg, G.Dodt, Y. Fujiki, J. M. Goodman, W. W. Just, J. A. K. W. Kiel, W.-H. Kunau,P. B. Lazarow, G. P. Mannaerts, H. W. Moser, T. Osumi, R. A. Rachubinski,A. Roscher, S. Subramani, H. F. Tabak, T. Tsukamoto, D. Valle, I. van derKlei, P. P. van Veldhoven, and M. Veenhuis. 1996. A unified nomenclaturefor peroxisome biogenesis. J. Cell Biol. 135:1–3.

17. Dodt, G., and S. J. Gould. 1996. Multiple PEX genes are required for propersubcellular distribution and stability of Pex5p, the PTS1 receptor: evidencethat PTS1 protein import is mediated by a cycling receptor. J. Cell Biol.135:1763–1774.

18. Dyer, J. M., J. A. McNew, and M. Goodman. 1996. The sorting sequence ofthe peroxisomal integral membrane protein PMP47 is contained within ashort hydrophilic loop. J. Cell Biol. 133:269–280.

19. Elgersma, Y., L. Kwast, A. Klein, T. Voorn-Brouwer, M. van den Berg, B.Metzig, T. America, H. F. Tabak, and B. Distel. 1996. The SH3 domain of theSaccharomyces cerevisiae peroxisomal membrane protein Pex13p functionsas a docking site for Pex5p, a mobile receptor for the import of PTS1containing proteins. J. Cell Biol. 135:97–109.

20. Elgersma, Y., and H. F. Tabak. 1996. Proteins involved in peroxisome bio-genesis and functioning. Biochim. Biophys. Acta 1286:269–283.

21. Erdmann, R. 1994. The peroxisomal targeting signal of 3-oxoacyl-CoA thio-lase from Saccharomyces cerevisiae. Yeast 10:935–944.

22. Erdmann, R., M. Veenhuis, D. Mertens, and W.-H. Kunau. 1989. Isolation ofperoxisome-deficient mutants of Saccharomyces cerevisiae. Proc. Natl. Acad.Sci. USA 86:5419–5423.

23. Erdmann, R., and W.-H. Kunau. 1992. A genetic approach to the biogenesisof peroxisomes in the yeast Saccharomyces cerevisiae. Cell Biochem. Funct.10:167–174.

24. Erdmann, R., and W.-H. Kunau. 1994. Purification and immunolocalizationof the peroxisomal 3-oxoacyl-CoA thiolase from Saccharomyces cerevisiae.Yeast 10:1173–1182.

25. Erdmann, R., and G. Blobel. 1995. Giant peroxisomes in oleic acid-inducedSaccharomyces cerevisiae lacking the peroxisomal membrane proteinPmp27p. J. Cell Biol. 128:509–523.

26. Erdmann, R., and G. Blobel. 1996. Identification of a peroxisomal membranereceptor for the C-terminal tripeptide signal recognition factor. J. Cell Biol.135:111–121.

27. Erdmann, R., M. Veenhuis, and W.-H. Kunau. 1997. Peroxisomes: organellesat the cross-roads. Trends Cell Biol. 7:400–407.

28. Evan, G. I., G. K. Lewis, G. Ramsay, and J. M. Bishop. 1985. Isolation ofmonoclonal antibodies specific for human c-myc proto-oncogene product.Mol. Cell. Biol. 5:3610–3616.

29. Fields, S., and O. K. Song. 1989. A novel genetic system to detect protein-protein interactions. Nature 340:245–246.

30. Gietz, R. D., and A. Sugino. 1988. New yeast-E. coli shuttle vectors con-structed with in vitro mutagenized yeast genes lacking six-base pair restric-tion sites. Gene 74:527–534.

31. Glomset, J. A., M. H. Gelb, and C. C. Farnsworth. 1990. Prenyl proteins ineukaryotic cells: a new type of membrane anchor. Trends Biochem. Sci.15:139–142.

32. Glover, J. R., D. W. Andrews, and R. A. Rachubinski. 1994. Saccharomycescerevisiae peroxisomal thiolase is imported as a dimer. Proc. Natl. Acad. Sci.USA 91:10541–10545.

33. Goldstein, L. J., and M. S. Brown. 1990. Regulation of the mevalonatepathway. Nature 343:425–430.

34. Gould, S. J., G. A. Keller, and S. Subramani. 1987. Identification of aperoxisomal targeting signal at the carboxy terminus of firefly luciferase. J.Cell Biol. 105:2923–2931.

35. Gould, S. J., J. E. Kalish, J. E. Morrell, J. Bjorkman, A. J. Urquhart, andD. I. Crane. 1996. An SH3 protein in the peroxisome membrane is a dockingfactor for the PTS1 receptor. J. Cell Biol. 135:85–95.

36. Harlow, E., and D. Lane. 1988. Antibodies—a laboratory manual. ColdSpring Harbor Laboratory, Cold Spring Harbor, N.Y.

37. Hausler, T., Y. D. Stierhof, E. Wirtz, and C. Clayton. 1996. Import of aDHFR hybrid protein into glycosomes in vivo is not inhibited by the folate-analogue aminopterin. J. Cell Biol. 132:311–324.

38. Hill, J. E., A. M. Myers, T. J. Koerner, and A. Tzagaloff. 1986. Yeast E. colishuttle vectors with multiple unique restriction sites. Yeast 2:163–167.

39. Hohfeld, J., M. Veenhuis, and W.-H. Kunau. 1991. PAS3, a Saccharomycescerevisiae gene encoding a peroxisomal integral membrane protein essentialfor peroxisome biogenesis. J. Cell Biol. 114:1167–1178.

40. Horton, R. M., H. D. Hunt, S. N. Ho, J. K. Pullen, and L. R. Pease. 1989.Engineering hybrid genes without the use of restriction enzymes: gene splic-ing by overlap extension. Gene 77:61–68.

41. James, G. L., J. L. Goldstein, R. K. Pathak, R. G. W. Anderson, and M. S.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

Brown. 1994. PxF, a prenylated protein of peroxisomes. J. Biol. Chem.269:14182–14190.

42. Jones, J. S., and L. Prakash. 1990. Yeast Saccharomyces cerevisiae selectablemarkers in pUC18 polylinkers. Yeast 6:363–366.

42a.Kohl, R., and W.-H. Kunau. Unpublished data.43. Krause, T. 1995. Investigation on membrane proteins of Saccharomyces

cerevisiae with the focus on Pas3p. Ph.D. thesis. Ruhr-Universitat Bochum,Bochum, Germany.

44. Kyte, J., and R. F. Doolittle. 1982. A simple method for displaying thehydropathic character of a protein. J. Mol. Biol. 157:105–132.

45. Lamb, J. R., W. A. Michaud, R. S. Sikorski, and P. A. Hieter. 1994. Cdc16p,Cdc23p and Cdc27p form a complex for mitosis. EMBO J. 13:4321–4328.

46. Lazarow, P. B. 1993. Genetic approaches to study peroxisome biogenesis.Trends Cell Biol. 175:105–132.

47. Lazarow, P. B., and Y. Fujiki. 1985. Biogenesis of peroxisomes. Annu. Rev.Cell Biol. 1:489–530.

48. Lazarow, P. B., and H. W. Moser. 1995. Disorders in peroxisome biogenesis,p. 2287–2324. In C. R. Scriver, C. R. Beaudet, W. S. Sly, and D. Valle (ed.),The metabolic and molecular bases of inherited disease, 7th ed., vol. 2.McGraw-Hill Book Co., New York, N.Y.

49. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: alaboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Har-bor, N.Y.

50. Marshall, P. A., Y. I. Krimkevich, R. H. Lark, J. M. Deyer, M. Veenhuis, andJ. M. Goodman. 1995. PMP27 promotes peroxisome proliferation. J. CellBiol. 129:345–355.

51. Marzioch, M., R. Erdmann, M. Veenhuis, and W.-H. Kunau. 1994. PAS7encodes a novel yeast member of the WD-40 protein family essential forimport of 3-oxoacyl-CoA thiolase, a PTS2-containing protein, into peroxi-somes. EMBO J. 13:4908–4918.

52. McCollum, D., E. Monosov, and S. Subramani. 1993. The pas8 mutant ofPichia pastoris exhibits the peroxisomal protein deficiencies of Zellwegersyndrome cells—the PAS8 protein binds to the COOH-terminal tripeptideperoxisomal targeting signal, and is a member of the TPR protein family. J.Cell Biol. 121:761–774.

53. McNew, J. A., and J. M. Goodman. 1994. An oligomeric protein is importedinto peroxisomes in vivo. J. Cell Biol. 127:1245–1257.

54. McNew, J. A., and J. M. Goodman. 1996. The targeting and assembly ofperoxisomal proteins: some old rules do not apply. Trends Biochem. Sci.21:54–58.

55. Moreno de la Garza, M., U. Schultz-Borchardt, J. W. Crabb, and W.-H.Kunau. 1985. Peroxisomal b-oxidation system of Candida tropicalis. Eur.J. Biochem. 148:285–291.

56. Omer, C. A., and J. B. Gibbs. 1994. Protein prenylation in eukaryotic mi-croorganisms: genetics, biology and biochemistry. Mol. Microbiol. 11:219–225.

57. Osumi, T., T. Tsukamoto, S. Hata, S. Yokota, S. Miura, Y. Fujiki, M.Hijikata, S. Miyazawa, and T. Hashimoto. 1991. Amino-terminal prese-quence of the precursor of peroxisomal 3-ketoacyl-CoA thiolase is a cleav-able signal peptide for peroxisomal targeting. Biochem. Biophys. Res. Com-mun. 181:947–954.

58. Powers, S., S. Michaelis, D. Broek, S. Santa Anna, J. Field, I. Herskowitz,and M. Wigler. 1986. RAM1, a gene of yeast required for a functionalmodification of RAS proteins and for production of mating pheromonea-factor. Cell 47:413–422.

59. Rachubinski, R. A., and S. Subramani. 1995. How proteins penetrate per-oxisomes. Cell 83:525–528.

60. Rehling, P., M. Marzioch, F. Niesen, E. Wittke, M. Veenhuis, and W.-H.Kunau. 1996. The import receptor for the peroxisomal targeting signal 2(PTS2) in Saccharomyces cerevisiae is encoded by the PAS7 gene. EMBO J.15:2901–2913.

61. Rose, M. D., P. Novick, J. H. Thomas, D. Bothstein, and G. R. Fink. 1987. ASaccharomyces cerevisiae genomic plasmid bank based on a centromere-containing shuttle vector. Gene 60:237–243.

62. Rose, M. D., L. M. Misra, and J. P. Vogel. 1989. KAR2, a karyogamy gene,is the yeast homolog of the mammalian BiP/GRP78 gene. Cell 57:1211–1221.

63. Rout, M. P., and J. V. Kilmartin. 1990. Components of the yeast spindle polebody. J. Cell Biol. 111:1913–1927.

64. Ruther, U., and B. Muller-Hill. 1983. Easy identification of cDNA clones.EMBO J. 2:1791–1794.

65. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing withchain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467.

66. Schafer, W. R., and J. Rine. 1992. Protein prenylation: genes, enzymes,targets and functions. Annu. Rev. Genet. 30:209–237.

67. Sherman, F., G. R. Fink, and J. Hicks. 1986. Methods in yeast genetics. ColdSpring Harbor Laboratory Press, Cold Spring Harbor, N.Y.

68. Sikorski, R. S., and P. Hieter. 1989. A system of shuttle vectors and yeasthost strains designed for efficient manipulation of DNA in Saccharomycescerevisiae. Genetics 122:19–27.

69. Smith, M., D. W. Leung, S. Gillam, C. R. Astell, D. L. Montgomery, and B. D.Hall. 1979. Sequence of the gene for iso-1-cytochrome c in Saccharomycescerevisiae. Cell 16:753–761.

70. Subramani, S. 1996. Protein translocation into peroxisomes. J. Biol. Chem.271:32483–32486.

71. Subramani, S. 1997. PEX genes on the rise. Nat. Genet. 15:331–333.72. Swinkels, B. W., S. J. Gould, A. G. Bodnar, R. A. Rachubinski, and S.

Subramani. 1991. A novel, cleavable peroxisomal targeting signal at theamino-terminus of the rat 3-ketoacyl-CoA thiolase. EMBO J. 10:3255–3262.

73. Szilard, K. R., V. I. Titorenko, M. Veenhuis, and R. A. Rachubinski. 1995.Pay32p of the yeast Yarrowia lipolytica is an intraperoxisomal component ofthe matrix protein translocation machinery. J. Cell Biol. 131:1453–1469.

74. Veenhuis, M., M. Mateblowski, W.-H. Kunau, and W. Harder. 1987. Prolif-eration of microbodies in Saccharomyces cerevisiae. Yeast 3:77–84.

75. Walton, P. A., P. E. Hill, and S. Subramani. 1995. Import of stably foldedproteins into peroxisomes. Mol. Biol. Cell 6:675–683.

76. Walworth, N. C., B. Goud, A. Kastan Kabcenell, and P. J. Novick. 1989.Mutational analysis of SEC4 suggests a cyclical mechanism for the regulationof vesicular traffic. EMBO J. 8:1685–1693.

77. Wiemer, E. A. C., G. H. Luers, K. N. Faber, T. Wenzel, M. Veenhuis, and S.Subramani. 1996. Isolation and characterization of Pas2p, a peroxisomalmembrane protein essential for peroxisome biogenesis in the methylotrophicyeast Pichia pastoris. J. Biol. Chem. 271:18973–18980.

78. Wilson, K. L., and I. Herskowitz. 1987. STE16, a new gene required forpheromone production by cells of Saccharomyces cerevisiae. Genetics 115:441–449.

79. Zhang, J. W., and P. B. Lazarow. 1995. PEB1(PAS7) in Saccharomycescerevisiae encodes a hydrophilic, intra-peroxisomal protein that is a memberof the WD repeat family and is essential for the import of thiolase intoperoxisomes. J. Cell Biol. 129:65–80.

80. Zhang, J. W., and P. B. Lazarow. 1996. PEB1(PAS7) is an intraperoxisomalreceptor for the NH2-terminal, type 2, peroxisomal targeting sequence ofthiolase: Peb1p itself is targeted to peroxisomes by an NH2-terminal peptide.J. Cell Biol. 132:325–334.



http://mcb.asm

.org/D

ownloaded from

http://mcb.asm.org/

pex19p, a farnesylated protein essential for peroxisome biogenesis

Documents