piggybac internal sequences are necessary for …...piggybac internal sequences are necessary for...

copy 2005 The Royal Entomological Society

17

Insect Molecular Biology (2005)

14

(1) 17ndash30

Blackwell Publishing Ltd

piggyBac

internal sequences are necessary for efficient transformation of target genomes

X Li R A Harrelldagger A M Handlerdagger T BeamDagger K Hennessy and M J Fraser Jr

Department of Biological Sciences and Center for Tropical Diseases Research and Training University of Notre Dame Notre Dame IN USA

dagger

USDA-ARS Center for Medical Agricultural amp Veterinary Entomology Gainesville FL USA and

Dagger

Department of Biological Sciences University of Saint Francis Fort Wayne IN USA

Abstract

A previously reported

piggyBac

minimal sequencecartridge which is capable of efficient transpositionin embryo interplasmid transposition assays failed toproduce transformants at a significant frequency in

Drosophila melanogaster

compared with full-length orless extensive internal deletion constructs We have re-examined the importance of these internal domain (ID)sequences for germline transformation using a PCRstrategy that effectively adds increasing lengths of IDsequences to each terminus A series of these

piggyBac

ID synthetic deletion plasmids containing the 3xP3-ECFPmarker gene are compared for germline transformationof

D melanogaster

Our analyses identify a minimalsequence configuration that is sufficient for movementof

piggyBac

vectored sequences from plasmids intothe insect genome Southern hybridizations confirmthe presence of the

piggyBac

transposon sequencesand insertion site analyses confirm these integrationstarget TTAA sites The results verify that ID sequencesadjacent to the 5primeprimeprimeprime

and 3primeprimeprimeprime

terminal repeat domains arecrucial for effective germline transformation with

piggyBac

even though they are not required for excisionor interplasmid transposition Using this informationwe reconstructed an inverted repeat cartridge ITR11kand a minimal

piggyBac

transposon vector pXL-BacII-ECFP each of which contains these identified IDsequences in addition to the terminal repeat configura-

tion previously described as essential for mobility Weconfirm in independent experiments that these newminimal constructs yield transformation frequenciessimilar to the control

piggyBac

vector Sequencinganalyses of our constructs verify the position and thesource of a point mutation within the 3primeprimeprimeprime

internal repeatsequence of our vectors that has no apparent effect ontransformation efficiency

Keywords

piggyBac

transposon transformation

Introduction

The

piggyBac

transposable element was originally isolatedfrom the Lepidopteran cell line TN-368 as a gene-disruptinginsertion within spontaneously arising baculovirus plaquemorphology mutants (Fraser

et al

1985 Cary

et al

1989)

piggyBac

encodes a transposase function that operatesusing a precise cut-and-paste mechanism targeting andduplicating TTAA tetranucleotide sequences upon insertionand reforming a single target site upon excision (Cary

et al

1989 Fraser

et al

1995 Elick

et al

1996ab Fraser

et al

1996) Structurally the

piggyBac

element is a 2472 bp shortinverted terminal repeat transposable element composedof a 2374 bp transposase-encoding internal domain (ID)flanked by asymmetric terminal repeat domains (TRD)The 5

prime

TRD consists of a 19 bp internal repeat sequenceseparated from the 13 bp terminal repeat sequence by3 bp while the 3

prime

TRD has a 31 bp spacer separating theinternal and terminal repeat sequences (Cary

et al

1989Fraser

et al

1995 Elick

et al

1996b)

piggyBac-

derived vectors are capable of mediating germlinetransformation in a wide variety of insect species including

Ceratitis capitata

(Handler

et al

1998)

Drosophila mela-nogaster

(Handler amp Harrell 1999 Berghammer

et al

1999Horn amp Wimmer 2000)

Tribolium castaneum

(Berghammer

et al

1999)

Bactrocera dorsalis

(Handler amp McCombs 2000)

Bombyx mori

(Tamura

et al

2000)

Pectinophora gossyp-iella

(Peloquin

et al

2000)

Aedes aegypti

(Kokoza

et al

2001 Lobo

et al

2002)

Anastrepha suspensa

(Handler ampHarrell 2001b)

Anopheles gambiae

(Grossman

et al

2001)

Musca domestica

(Hediger

et al

2001)

Anopheles albimanus

(Perera

et al

2002)

Anopheles stephensi

(Nolan

et al

2002) and

Lucilia cuprina

(Heinrich

et al

2002) Most

doi 101111j1365-2583200400525x

Received 10 September 2003 accepted after revision 29 July 2004 Corre-spondence Dr Malcolm Fraser Department of Biological Sciences andCenter for Tropical Diseases Research and Training University of NotreDame Notre Dame IN 46556 USA Tel +1 574 631 6209 fax +1 574 6317413 e-mail MalcolmJFraser1ndedu

18

X Li

et al


Insect Molecular Biology

14

17ndash30

recently a non-insect species the planarian

Girardia tigrina

has also been successfully transformed using

piggyBac

suggesting a wider range of utility for this element (Gonzalez-Estevez

et al

2003) A common feature of all of thesetransformations has been the use of either a complete or apartial internally deleted (08 kb deletion in the transposasecoding sequence Handler amp Harrell 1999 Horn amp Wimmer2000)

piggyBac

transposon as the transformation vectorUsing plasmid-based mobility assays Li

et al

(2001b)had previously reported that the 5

prime

and 3

prime

piggyBac

TRDsequences were sufficient for excision or transposition ininjected insect embryos However personal communica-tions from several labs attempting to utilize the previouslyidentified minimal

piggyBac

sequences in transformationexperiments indicated significant difficulty in obtaining germ-line transformants (John Peloquin UC Riverside RichardBeeman Kansas State University) Our own attempts totransform

D melanogaster

with one of our minimal

piggy-Bac

constructs also yielded an extremely low frequency of06 transformants significantly lower than the previouslyreported 26 transformation frequency for

piggyBac

in thisspecies (Handler amp Harrell 1999)

These results imply some

piggyBac

internal sequencesessential for efficient germline transformation of the insectgenome are absent in our previous internal deletion con-structs even though they are apparently not required forinterplasmid transposition Similar observations have beenreported for other Class II transposons such as the

Mos

1

mariner

element

Mariner

transposons lacking any internalsequences are inactive in transposition assays whileretention of a few additional nucleotides of the internalsequence restores full activity (Tosi amp Beverley 2000)However efficient germline transformation also requiresthe presence and proper spacing of multiple sequencesinternal to the element as well as the inverted repeats(Lohe amp Hartl 2001 Lozovsky

et al

2002)In this report we identify ID sequences adjacent to the 5

prime

and 3

prime

TRD of the

piggyBac

transposon that contribute to ahigh frequency of germline transformants in

D melanogaster

We analyse a series of PCR synthesized deletion vectorsconstructed with the 3xP3-ECFP gene as a transformationmarker (Horn amp Wimmer 2000) These vectors define aminimal ID configuration that is sufficient to effect efficientgermline transformation of

D melanogaster

Using thisinformation we construct a new ITR cartridge called ITR11kand verify its utility in converting an existing plasmid into amobilizable

piggyBac

vector that enables efficient germlinetransformation We also construct a transposon-basedcloning vector pXL-BacII for insertion of sequences withina minimal

piggyBac

transposon and verify its capabilitiesin germline transformations Sequence analysis of theseconstructs reveals an introduced point mutation within theinternal repeat sequence of the 3

prime

TRD that has no apparenteffect on mobility of the element

Results

Transformation experiments with synthetic deletion constructs

Initial attempts to transform

D melanogaster

with plasmidshaving only TRD sequences as specified in our previousreport (Li

et al

2001b) yielded transformation frequenciesfar less than full-length

piggyBac

constructs The p(PZ)-BacEYFP construct contains the ITR cartridge of Li

et al

(2001b) composed of the 5

prime

and 3

prime

TRD and the spacersequence while the pBS-pBacDsRed retains only 2 bpof 5

prime

ID and 36 bp of 3

prime

ID sequences in addition to the 5

prime

and 3

prime

TRD Neither of these constructs was able to gener-ate germline transformants at the frequencies previouslyreported for full-length vectors (Handler amp Harrell 1999)or the less extensive internal deletion construct pBac3xP3-ECFPafm (Horn amp Wimmer 2000) This forced us to re-examine the potential involvement of

piggyBac

ID sequencesin generating germline transformations

We examined the requirements for TRD adjacent IDsequences of the

piggyBac

transposon using a synthe-sized cartridge strategy based upon construction of thepreviously reported ITR cartridge (Li

et al

2001b) ratherthan digesting with an endonuclease and selecting clonesrepresenting an internal deletion series Each of the

piggy-Bac

synthetic internal deletion plasmids was formed fromthe pIAO-PL-589 plasmid (Li

et al

2001b) by PCR ampli-fication across the facing TRDs and spacer sequences withprimers that recognize 5

prime

or 3

prime

ID sequences adjacent to therespective TRDs (Fig 1) The fragments generated werecloned into a pBSII-3xP3-ECFP plasmid and sequenced(see Experimental procedures)

Each of the synthetic deletion series plasmids and thecontrol plasmid pBac3xP3-ECFPafm were co-injected withthe

hsp70

-regulated transposase helper into

w

1118

embryoswith surviving adults backcrossed and G1 adult progenyscreened for fluorescence Positive transformants exhibitedfluorescent eyes with cyan and green filter sets but not withthe yellow filter set Transformation frequencies from all injec-tions are listed in Table 1 The p(PZ)-Bac-EYFP plasmidwhich was constructed using the ITR cartridge previouslydescribed (Li

et al

2001b) yielded a relatively low trans-formation frequency of 06 compared with the controlplasmid pBac3xP3-ECFPafm frequency of 129 (Table 1)

Eight of the eleven synthetic ID deletion plasmids yieldedpositive transformants at an acceptable frequency com-pared with the control The 5

prime

ID deletion constructs pBSII-ECFP-R1L5 pBSII-ECFP-R2L5 pBSII-ECFP-R3L5 andpBSII-ECFP-R4L5 had variable deletions of the

piggyBac

5

prime

ID retaining sequences from 66 bp (nucleotides 36ndash101GenBank accession number AR307779) to 542 bp (nucle-otides 36ndash567) of the

piggyBac

sequence Each of these 5

prime

ID deletions yielded ECFP-positive germline transformantsat frequencies from 89 (

plusmn

10) to 150 (

plusmn

06)

piggyBac internal sequences and transformation of target genomes 19

copy 2005 The Royal Entomological Society Insect Molecular Biology 14 17ndash30

(Table 1) when paired with 1 kb of the 3prime ID sequence(nucleotides 1454ndash2409) These results demonstrated aminimal sequence of no more than 66 bp of the 5prime ID isessential for effective germline transposition

The R4 minimum 5prime ID sequence primer was then usedin combination with a series of 3prime ID deletion primers to gen-erate the constructs pBSII-ECFP-R4L4 pBSII-ECFP-R4L3 pBSII-ECFP-R4L2 and pBSII-ECFP-R4L1 Of these fourconstructs only pBSII-ECFP-R4L1 which represented thegreatest deletion of 3prime ID sequence (2284ndash2409 of thepiggyBac sequence) failed to yield transformants Againfrequencies for the constructs that yielded positive trans-formants compared favourably with the control (Table 1) Wetherefore deduced that the minimal 3prime ID sequence require-ment for efficient germline transformation was between 125 bp(L1) and 378 bp (L2) of the 3prime TRD adjacent ID sequence

Construction of the ITR11k minimal sequence piggyBac cartridge

To construct a minimal sequence cartridge using the infor-mation gained from the synthetic deletion analysis we first

assembled combinations of 5prime and 3prime minimal sequencesand tested their transformation capabilities The pBSII-ECFP-R-TRL construct is composed of a 35 bp 5prime TRD lackingany 5prime ID sequence coupled to a fragment containing the63 bp 3prime TRD and 172 bp of the adjacent 3prime ID sequenceThis combination did not yield any transformants confirm-ing the necessity for having 5prime ID sequences in combinationwith 3prime ID sequences for efficient transformation

Unexpectedly addition of 66 bp of the 5prime ID sequencesto the 5prime TRD sequences in the construct pBSII-ECFP-R1L was not sufficient to recover transformation capa-city when paired with the 172 bp 3prime ID sequences eventhough the lower limit of essential 5prime ID sequences hadbeen previously defined as 66 bp using pBSII-ECFP-R1L5(Table 2) Increasing the 5prime ID sequences to 276 bp inthe pBSII-ITR11k-ECFP plasmid recovered the full trans-formation capability when paired with the 172 bp 3prime IDsequence (Table 2) The minimal operational sequencerequirement for 5prime ID sequences is therefore between 276and 66 bp when coupled to a minimal 3prime ID sequence of172 bp

Figure 1 Construction of important plasmids developed in this study (A) Diagram of the pCaSpeR-hs-orf helper used for the transformation assays The piggyBac ORF BamHI cassette was cloned as a PCR product into the BamHI site of the pCaSpeR-hs adjacent to the hsp70 promoter (B) Diagram of the p(PZ)-Bac-EYFP construct demonstrating the inefficiency of the ITR cartridge (Li et al 2001b) for transformation A 7 kb HindIII fragment containing LacZ hsp70 and Kanori sequences was excised from plasmid p(PZ) (Rubin amp Spradling 1983) and ligated to form a p(PZ)-7kb intermediate plasmid The ITR cartridge was excised from pBSII-ITR (Li et al 2001b) using Not I and Sal I blunt ended and inserted into the blunt-ended HindIII site of the p(PZ)-7kb plasmid A 3xP3-EYFP SpeI fragment excised from pBac3xP3-EYFPafm (Horn amp Wimmer 2000) was then inserted into the Xba I site to form p(PZ)-Bac-EYFP (C) Diagram of the pBSII-ITR11k-ECFP minimal piggyBac vector constructed by PCR amplification from the pIAO-PL 589 plasmid (Li et al 2001b) which contains a minimal piggyBac cartridge with inverted 5prime and 3prime TRDs separated by a 589 bp λ DNA spacer sequence and incorporate additional subterminal ID sequences necessary for efficient transformation This construct is tagged by the addition of the 3xP3-ECFP marker gene excised as an SpeI fragment from the plasmid pBac3xP3-ECFPafm (Horn amp Wimmer 2000) (D) Diagram of the piggyBac minimal vector pXL-BacII-ECFP constructed from the pBSII-ITR11k plasmid essentially as previously described (Li et al 2001b) with the addition of the 3xP3-ECFP Spe I fragment from pBac3xP3-ECFPafm

20 X Li et al


Two independent verifications of the pBSII-ITR11 k-ECFP plasmid transforming capabilities were conductedfor transformation of D melanogaster These transforma-tion experiments resulted in calculated frequencies of139 (Fig 1) and 36 (Table 1) We attribute the ratherlarge discrepancy in frequencies to differences in injectionprotocols between labs Unless otherwise indicated thetransformation frequencies presented in Table 1 andFig 1 were obtained with injections of 06 06 microgmicrolvectorndashhelper concentration ratios The increased effi-ciency of transformation for pBSII-ITR11k-ECFPobserved in the second independent trial seems to be

related to a decreased vectorndashhelper concentration inD melanogaster

Five recovered pBSII-ITR11k-ECFP transformed strainswere used to perform genetic mapping to identify theirchromosome locations Several of the strains had insertionson the second and third chromosomes (including strain 1)while strain 3 had an insertion on the X chromosome Wechose strains 1 and 3 for further analyses

Direct PCR analysis of integrations

Genomic DNAs from each of the transformed strainsobtained with the synthetic deletion constructs in Fig 1 as

Table 1 Transformation of Drosophila melanogaster

Plasmid ExperimentEmbryos injected

Embryos hatched

Adults mated

Transformedlines Frequency

Overall frequency SD SE

p(PZ)-Bac-EYFP 1 920 136 55 1 18 06 10 plusmn062 910 120 56 0 003 900 120 55 0 00

pBSII-ECFP-R1L5 1 350 86 21 2 95 89 18 plusmn102 280 70 16 1 633 360 84 33 3 91

pBSII-ECFP-R2L5 1 320 37 11 1 91 125 77 plusmn542 300 38 5 1 200






pBSII-ECFP-R4L1 1 350 89 30 0 00 00 NA NA2 160 33 16 0 003 330 78 25 0 004 150 31 15 0 00

pBSII-ECFP-R-TRL 1 280 73 31 0 00 00 NA NA2 330 96 40 0 00

pBSII-ECFP-R1L 1 220 63 19 0 00 00 NA NA2 290 80 23 0 003 330 104 27 0 00

pBac3xP3-ECFPafm 1 300 45 14 2 143 129 18 plusmn132 350 59 17 2 118

pBSII-ITR11K-ECFP 1 530 128 36 5 139 139 NA NA

pXL-BacII-ECFP 1 500 80 14 3 214 222 09 plusmn062 520 101 22 5 227

pBSII-ITR11k-ECFP 1 515 120 22 8 364 364 NA NA

pXL-BacII-ECFP 1 533 199 88 22 250 250 NA NA

These injections were done independently (Handler lab) using a 04 02 microgmicrol vectorndashhelper concentration ratio of DNA Statistical analysis of the data revealed no significant difference between frequencies obtained with any of the synthetic deletion mutants that yielded detectable numbers of transformants and the control plasmid pBac3xP3-ECFPafm The assay cannot be interpreted to represent relative efficiencies of transformation among these constructs but only whether a particular construct was able to generate transformants at a detectable frequency with the number of surviving injected flies analysed



well as the piggyBac-positive strain M231 and the negativewhite eye strain w1118 were used to perform two sets of PCRsto verify the presence of the piggyBac 5prime and 3prime terminalrepeat regions An additional negative control PCR wasperformed on all transformants to show the absence of theexternal lambda phage DNA stuffer sequence (Fig 2)

The first set of PCRs utilized the IFP2_R1 and MF34primers to amplify the 5prime terminal repeat regions and thesecond set of PCRs used the IFP2_L and MF34 primers toamplify the 3prime terminal repeat regions All of the syntheticdeletion transformed strains the M231 control strain andthe plasmid control yielded a strong PCR product of thecorrect size for each of the primer sets confirming the pre-sence of both of the piggyBac terminal repeat regions in allof the transformed strains Interestingly the white eye strainw1118 yielded a very weak product of the correct size with the5prime terminal repeat PCR amplification but failed to generatea product with the 3prime terminal specific primer set

A third set of PCRs was performed using the IFP2_R1and IFP2_L primers in an attempt to amplify the externallambda phage DNA stuffer sequence which would bepresent if an insertion resulted from recombination ofthe entire plasmid sequence rather than transposition Thecontrol product from this PCR reaction is a 925 bp fragment

and no such corresponding fragments were generated withany of the transformed strain genomic DNAs

Southern hybridization analysis

Southern hybridization analysis was performed to verifythe copy number and further confirm transposition of thepiggyBac deletion plasmids into the Drosophila genome(Figs 3 and 4) Genomic DNAs from two of the pBSII-ITR11k-ECFP strains (strains 1 and 3) and one of each ofthe other strains were digested with HindIII with the pBSII-ITR11k-ECFP plasmid HindIII digest as a plasmid controlThe HindIII digestion of all transformed strains is expectedto generate four fragments after transpositional insertionthe pBSII plasmid backbone fragment (2960 bp) the 3xP3-ECFP marker fragment (1158 bp) the piggyBac 5prime termi-nus fragment and the piggyBac 3prime terminus fragmentUsing the pBSII-ITR11k-ECFP plasmid as probe all fourfragments generated by the HindIII digestion may bedetected

The diagnostic 2960 bp pBSII backbone and 1158 bp ECFPmarker fragments were present in all of the transformedstrains examined All of these strains also exhibited at leasttwo additional bands corresponding to the piggyBac terminiand adjacent sequences at the integration site (Fig 3) These

Figure 2 Direct PCR analysis of transformed flies (A) Diagram of a generalized synthetic deletion construct indicating the position of primers and expected fragment Three sets of PCR primers were used to verify the piggyBac insertion The first primer set (IFP2_R1 + MF34) detects the 5prime terminal region (115bp) the second primer set ( IFP2_L + MF34) detects the 3prime terminal region (240bp) and the third primer set (IFP2_R1 + IFP2_L) detects the presence of the external spacer sequence (945bp) (B) Direct PCR results (a) The first primer set yields a 115 bp fragment in all transformed strains confirming the 5prime terminal region A less effectively amplified 115 bp fragment is also evident in the w1118 strain reflecting the probable presence of piggyBac-like sequences in the D melanogaster genome (b) The second primer set yields the expected 240 bp fragment in all transformed strains confirming the 3prime terminal region whereas this fragment is absent in the w1118 strain (c) The external spacer primer set failed to amplify a sequence in any of the transformed strains or the control w1118

22 X Li et al


results confirmed that the observed frequencies were theresult of transpositional integrations

Analysis of insertion site sequences

To further verify that piggyBac-mediated transposition of thesynthetic deletion constructs occurred in these transform-ants individual insertion sites were examined by isolatingjoining regions between the transposon and genomicsequences using either universal PCR or inverse PCRSubsequent sequencing analysis of these joining regions

demonstrated that all of the insertions occurred exclusivelyat single TTAA target sites that were duplicated uponinsertion and all insertion sites had adjacent sequencesthat were unrelated to the vector (Table 2) The two pBSII-ITR11k-ECFP strains 1 and 3 have a single insertion onthe third and X chromosome respectively These data areconsistent with the information obtained from geneticcrosses with balancer strains (data not shown)

During sequence analysis of the integration sites areported point mutation in our constructs was confirmed

Figure 3 Southern hybridization analysis of synthetic deletion plasmid transformed strains Genomic DNAs from selected strains and the pBSII-ITR11k-ECFP plasmid control were digested with HindIII and hybridized to the pBSII-ITR11k-ECFP plasmid probe (A) Map of the pBSII-ITR11k-ECFP plasmid showing the size of expected diagnostic fragments (B) All transformed strains exhibit the two diagnostic bands (296 and 116 kb) and at least two additional bands reflecting the piggyBac terminal adjacent sequences at the site of integration We also observe a weak 13 kb band in all strains that probably represents a piggyBac-like sequence in the w1118 genome The reduced intensity of the two additional bands representing joining sequences between the piggyBac termini and adjacent genomic DNA in each of the transformed strains is probably due to weaker hybridization of the 200sim300 bp of AT-rich sequences of this region of the probe

Figure 4 Southern hybridization analysis of the single p(PZ)-Bac-EYFP transformant Genomic DNA from the p(PZ)-Bac-EYFP strain and the w1118 white eye strain were digested with Sal I with a Sal I digest of the p(PZ)-Bac-EYFP plasmid serving as control The probe was PCR amplified from p(PZ)-Bac-EYFP using the primers 3xP3_for and M13_For (A) Map of the p(PZ)-Bac-EYFP plasmid illustrating the position of SalI sites the region used as the probe and expected size (36 kb) for the diagnostic hybridizing fragment (B) The two p(PZ)-Bac-EYFP transgenic sublines (lanes 2 and 3) exhibit the diagnostic 36 kb band and two additional bands representing junction fragments containing genomic sequences and piggyBac ends at the single insertion site



that occurs at position 2426 in the piggyBac sequencewithin the 3prime TRD at the boundary of the 31 bp spacer andthe internal repeat sequence This point mutation wasapparently generated in constructing the pIAO-PL plasmid(Li et al 2001b) and was therefore present in all of theconstructs generated by the PCR syntheses employed inthis study This point mutation had no apparent effect on thetransformation frequencies as evidenced by the efficiencyof transformation obtained with pBSII-ITR11k-ECFP

The available piggyBac insertion site data from previousreports and these studies were compiled and aligned usingClustalX to identify a potential common insertion sitemotif (Table 3) No apparent consensus motif arose fromthe comparison of these sequences outside of the requiredTTAA target site

Discussion

Attempts to transform insects using plasmids containinga previously reported piggyBac ITR minimal sequencecartridge (Li et al 2001b) which has facing 5prime and 3prime TRDswith their respective TTAA target sites and is completelydevoid of ID sequences failed to produce a transformationfrequency that was comparable with frequencies obtained

with full-length or conservative ID deletion constructs(Handler amp Harrell 1999 Horn amp Wimmer 2000) As isillustrated in this report frequencies of transpositionobtained for the ITR-based p(PZ)-Bac-EYFP and the similarlyconstructed pBS-pBacDsRed were far less than expectedAlthough Southern hybridization and inverse PCR analy-ses did confirm that the single transformant recovered withp(PZ)-Bac-EYFP had resulted from transpositional insertionthe efficient transposition of piggyBac minimal vectorsevidenced in interplasmid transposition assays (Li et al2001b) did not necessarily predict the properties of piggyBactransposon movement in germline transformations

The fact that germline transposition involves distinctlydifferent cell populations than interplasmid transposition ininjected embryos may explain these discrepancies Similardiscrepancies between transformation results and artificialtransposition assays have been reported with other ClassII transposons (Tosi amp Beverley 2000 Lohe amp Hartl 2001Lozovsky et al 2002) In addition the Hermes transposa-ble element undergoes normal cut-and-paste transpositionin plasmid-based transposition assays (Sarkar et al 1997b)but germline integrations in Ae aegypti seem to occur eitherthrough general recombination or through a partial replica-tive transposition mechanism (Jasinskiene et al 2000)

Table 2 Transformed Drosophila insertion sites

Strain nameChromosomelocation Insertion site sequence 3prime junction 5prime junction

p(PZ)-Bac-EYFP 3R CCAAACTTCGGCGATGTTTTCTTAA -- piggyBac --pBSII-ITR11k-ECFP-1 3R TAGAATTCATGTTTCCAATTTTTTAA -- piggyBac --pBSII-ITR11k-ECFP-3 X -- piggyBac -- TTAAATTCGCATATGTGCAAATGTTpBSII-ECFP-R1L5 3 l TCGGGTGGCACGTTGTGGATTTTAA -- piggyBac -- TTAAGCATGTCCTTAAGCATAAAATpBSII-ECFP-R2L5 2 l AAATACGTCACTCCCCTTCCCTTAA -- piggyBac -- TTAATGCTAGCTGCATGCAGGATGCpBSII-ECFP-R3L5 2R AGCTGCACTCACCGGATGTCCTTAA -- piggyBac -- TTAAACAAAAAATGAAACATAAGGpBSII-ECFP-R4L5 2R CCCAAAGTATAGTTAAATAGCTTAA -- piggyBac -- TTAAAGGAATTAATAAAAATACAApBSII-ECFP-R4L4 2R GTTTATTTATGATTAGAGCCTTTAA -- piggyBac -- TTAATCTCCTCCGCCCTTCTTCAATTpBSII-ECFP-R4L3 2R TGTTGTTTTTTTGTCCCCACGTTTAA -- piggyBac -- TTAAACAAACACCTTTGACAAATTTpBSII-ECFP-R4L2 2 l CTGCCTCTAGCCGCCTGCTTTATTAA -- piggyBac -- TTAATATTAATTGAAAATAAATGCA

The 5prime and 3prime flanking sequences for the inserted piggyBac sequences in each strain were obtained using end-specific inverse PCR (see Experimental procedures) followed by cloning and sequencing of the recovered fragments The chromosomal locations were determined from the sequences using the Blast search program against the available Drosophila sequence in the GenBank library

Table 3 Percentage of each nucleotide at piggyBac insertion sites flanking sequences from position minus10 to +10

Nucleotide ndash10 minus9 minus8 minus7 minus6 minus5 minus4 minus3 minus2 minus1 TTAA +1 +2 +3 +4 +5 +6 +7 +8 +9 +10

A 22 31 38 33 26 27 16 18 18 29 41 28 43 41 42 43 28 34 33 40C 20 19 22 17 17 23 15 20 26 15 11 20 18 20 15 17 21 23 16 11G 28 19 17 16 24 8 24 16 19 12 18 29 22 13 20 12 23 6 15 11T 30 31 23 34 33 42 45 46 37 44 30 23 17 26 23 28 28 37 36 38

The available piggyBac insertion sites include insertion sites in transformed insect genomes (Elick et al 1996ab Handler et al 1998 1999 Handler amp Harrell 1999 Peloquin et al 2000 Tamura et al 2000 Grossman et al 2001 Hediger et al 2001 Kokoza et al 2001 Li et al 2001a Heinrich et al 2002 Lobo et al 2002 Mandrioli amp Wimmer 2002 Nolan et al 2002 Perera et al 2002 Thomas et al 2002 Sumitani et al 2003 data from this report) insertion sites in baculoviruses (Cary et al 1989 Fraser et al 1995) and insertion sites in transposition assay target plasmid pGDV1 (Thibault et al 1999 Grossman et al 2000 Li et al 2001a Lobo Li and Fraser unpublished data) No consensus aside from the TTAA target site is apparent among these insertion sites However the piggyBac transposable element does have a preference of inserting in the TA-rich region with 4ndash5 Ts before and 5ndash6 As after the TTAA target site

24 X Li et al


The synthetic cartridge approach that we used to examinethe role of ID sequences in effecting efficient germlinetransposition has the advantage of examining the involve-ment of sequences through reconstruction rather than byanalysis of successive internal deletions The main disad-vantage of this approach in analysing piggyBac is the highAT content of the transposon which limits the position ofuseful primers As a result our present analyses cannotdefine the exact limits of the requisite sequences Howeverwe are able to delimit the critical sequences to a relativelynarrow 250 bp of TRD adjacent ID sequences

Transformation results from synthetic unidirectional dele-tion plasmids suggest that no more than 66 bp (nt 36ndash101)of the piggyBac 5prime ID sequence and 378 bp (nt 2031ndash2409)of the piggyBac 3prime ID sequence are necessary for efficienttransformation when these deletions are paired with long(378 or 311 bp respectively or longer) ID sequences fromthe opposite end of the transposon The transformationdata from the pBSII-ITR11k-ECFP plasmid further definesthe 3prime ID essential sequence as 172 bp (nt 2237ndash2409)Combining this same 172 bp 3prime ID sequence with only the5prime TRD in the pBSII-ECFP-R-TRL plasmid yielded notransformants demonstrating that the 3prime ID sequencealone was insufficient for full mobility Unexpectedly addingthe 66 bp 5prime ID sequence in pBSII-ECFP-R1L also doesnot allow recovery of full transformation capability while thesame 66 bp does allow full transformation capability whencoupled to the larger (955 bp) 3prime ID sequence in pBSII-ECFP-R1L5 This result cannot be explained by size alonebecause the ITR cartridge strategy used to test these dele-tion sequence constructs effectively replaces the rest of thepiggyBac ID with the 2961 bp pBSII plasmid sequence

Although the frequencies obtained for a given constructmay be higher or lower relative to the control these fre-quency estimates cannot be considered to have statisticalsignificance relative to one another because the actualnumber of transformed lines generated for each constructis too low to permit meaningful analyses In addition vari-ation between injection experiments can be quite high asevidenced by the control injections performed in the Han-dler laboratory vs those performed in the Fraser laboratoryUltimately our experiments were designed merely to detect

the limits of ID sequence that yielded acceptable transform-aton frequencies and not to evaluate the effectiveness ofthe deleted regions relative to one another

Taken together our results indicate the presence of crit-ical sequences between nucleotides 66 and 311 of the 5prime IDsequence used for construction of the pBSII-ITR11k-ECFP because this construct exhibits full transformingcapability when matched with the L 3prime ID sequence Wealso infer that compensating sequences must be presentin 3prime ID sequences longer than 172 bp because the 955 bp3prime ID sequence included with primer L5 is able to compen-sate for the 66 bp 5prime ID sequence (construct pBSII-ECFP-R1L5) Exactly what these signals are cannot be definedin this study but we do note the presence of small repeatsin the 5prime ID sequence of pBSII-ITR11k-ECFP that arematched by similar sequences in the 3prime ID sequencesincluded in construct pBSII-ECFP-R1L5 These small repeats(Fig 5) occur in direct or opposite orientations and arealso found in several other locations within the piggyBacID Although we cannot say at this point whether the numbercombination andor orientation of these repeats is significantin conferring efficient transpositional capability there doesseem to be a correlation between efficient transgenesisand the presence of at least one CAAAAT repeat in the 3primeID sequence combined with at least one in the 5prime IDsequence or the compensating presence of two or threesequence repeats in the 3prime ID Further analyses are neces-sary to confirm the importance if any of this small repeatin facilitating transpositional activity of piggyBac constructs

Previous observations of efficient interplasmid transpositionfor the piggyBac ITR construct completely devoid of piggy-Bac ID sequences support a mechanism for movement inwhich the piggyBac transposase binds at the terminal repeatregions (IR spacer and TR) to effect transposition (Li et al2001b) Because the cut-and-paste reactions of excisionand transposition do not appear to require ID sequencesthe relatively unsuccessful application of the previouslyconstructed ITR cartridge for germline transformation sug-gests the required ID sequences may be involved in otheraspects of the transformation process than the mechanicsof cut-and-paste These other aspects seem to be linked todifferential movement in germline cells

Figure 5 Schematic illustration of the locations of the two short repeat sequence motifs identified in the TRD adjacent ID sequences of piggyBac Several of these repeat motifs are within the regions between R and R1 or L and L2 which appear to be the critical regions based on our transformation results These repeats are also found in other positions of the piggyBac ID sequence



The presence of sequences important for full transform-ing capability within internal domains of transposons isnot without precedent Transposase binding to targetsequences at or near the ends of the element is necessaryto generate a synaptic complex that brings the ends ofthe element together for subsequent DNA cleavage(reviewed by Saedler amp Gierl 1996) but the efficiency ofthis interaction can be influenced by other sequences in thetransposon

Multiple transposase binding sites or accessory factor bind-ing sites are identified in other Class II transposon systemsEfficient transposition of mariner requires the continuity ofseveral internal regions of this element and their properspacing with respect to the terminal repeats (Lohe amp Hartl2001 Lozovsky et al 2002) although they are not essen-tial for in vitro transposition (Tosi amp Beverley 2000) The Pelement transposase binding occurs at 10 bp subterminalsequences present at both 5prime and 3prime ends while the 31 bpterminal inverted repeat is recognized by a Drosophila hostprotein IRBP (inverted repeat binding protein) and aninternally located 11 bp inverted repeat is shown to act asa transpositional enhancer in vivo (Rio amp Rubin 1988Kaufman et al 1989 Mullins et al 1989) The maize Actransposase binds specifically and co-operatively to repet-itive ACG and TCG trinucleotides which are found in morethan twenty copies in both 5prime and 3prime subterminal regionsalthough the Ac transposase also weakly interacts with theterminal repeats (Kunze amp Starlinger 1989 Becker ampKunze 1997) The TNPA transposase of the EnSpm ele-ment binds a 12 bp sequence found in multiple copieswithin the 5prime and 3prime 300 bp subterminal repeat regions(Gierl et al 1988 Trentmann et al 1993) The Arabidopsistransposon Tag1 also requires minimal subterminal se-quences and a minimal internal spacer between 238 bpand 325 bp for efficient transposition (Liu et al 2000) TheSleeping Beauty (SB) transposable element contains twotransposase binding sites (DRs) at the end of the sim230 bpterminal inverted repeats (Ivics et al 1997) The DNA-bending protein HMGB1 a cellular co-factor was found tointeract with the SB transposase in vivo to stimulate prefer-ential binding of the transposase to the DR further from thecleavage site and promoted bending of DNA fragmentscontaining the transposon IR (Zayed et al 2003)

These examples suggest that the piggyBac transposaseor some host accessory factors could be binding to theidentified critical TRD adjacent ID regions to promoteefficient transposition in germline cells These subterminalID sequences may serve as additional piggyBac transposasebinding sites thus increasing the efficiency of movementby co-operative binding of the transposase Alternativelythese sequences may serve as some accessory factorbinding site(s) responsible for efficient alignment of thetermini or facilitating association of the transposon withchromatin-complexed genomic sequences

Our results force a reassessment of the reliability of plasmid-based transposition assays in predicting piggyBac movementfor transgenesis Plasmid-based transposition assays althoughfacilitating mutational analyses of the transposon are likelyto be reliable predictors of in vivo movement only when altera-tions lead to a loss of movement This difference is probablydue to the fact that plasmid-based assays indicate the activityof the transposon in somatic cells whereas transformationassays assess movement in germline cells

Chromatin in the primordial germ cells is structured andregulated differently than that of blastoderm cells (reviewedby Wolffe 1996) This difference could contribute to differentresults in the two types of assays Interplamsid transposi-tion assays utilize purified supercoiled DNA as the targetwhereas transformation assays target chromatin Nucleo-some formation on negatively supercoiled DNA occursvirtually instantaneously in vitro (Pfaffle amp Jackson 1990) andtarget plasmid DNA introduced into the embryo cells wouldmost likely form nucleosome structures but there will be asignificant difference in complexity compared with chromatinThis difference in complexity could be the cause of differenttransposition results Alternatively the absence of additionaltransposase or accessory factor binding sites on the trans-poson could result in less efficient translocation of the DNAto the nucleus or lessened affinity of the transposontrans-posase complex for the genomic DNA

Sequence analysis of integrated constructs and subsequentdetailed analysis of all the constructs confirms a point mutationfirst reported to us by Dr Peter Clyne (UC San Franciscopers comm) in the TRD of all constructs used in this study Thismutation is a CrarrA transversion in the 19 bp internal repeatsequence of the 3prime TRD (Fig 6) This point mutation originatedduring construction of the pIAO plasmid (Li et al 2001b)and is most likely the result of misincorporation during PCRamplification However our results confirm that this mutationhas no significant effect on the transformation efficiency

Under the conditions of our direct PCR amplificationusing piggyBac 5prime terminus-specific primers we generateda weak band of the same size as the expected piggyBacband from control w1118 flies The Southern hybridizationsdetected a 13 kb band in all of the transformants thatwas distinct from the pBSII backbone fragment (296 kb)and 3xP3-ECFP (116 kb) marker bands piggyBac-likesequences have been detected in many species by PCRand Southern hybridization analysis using probes derivedfrom the piggyBac 5prime terminal region including moths fliesand beetles (reviewed by Handler 2002) A homology searchagainst the available sequence database has identified theexistence of the piggyBac-like sequences in the D mela-nogaster genome (Sarkar et al 2003) We interpret ourresults as reflecting the presence of one of these degeneratepiggyBac-like sequences in the Drosophila genome

The insertion sites in the transformed fly strains wereidentified by either universal PCR or inverse PCR techniques

26 X Li et al


All insertions occurred exclusively at TTAA sites verifyingthat these insertions were due to a specific piggyBactransposase-mediated mechanism (Fraser et al 1995) AClustalX alignment of all piggyBac insertion sites identifiedin this and previous reports including insertion sites in thetransposition assay target plasmid pGDV1 (Sarkar et al1997a) baculoviruses and transformed insect genomesdoes not reveal any further significant similarities (Table 3)The proposed existence of a larger piggyBac insertion con-sensus sequence YYTTTTTTAARTAAYAG (Y = pyrimidineR = purine = insertion point) by Cary et al (1989) andGrossman et al (2000) and a short 8 bp consensussequence ATNATTTAAAT proposed by Li et al (2001a)seem to be contradicted by the accumulated insertion sitedata We do note a decided preference for piggyBac inser-tion within TTAA target sites flanked by 4ndash5 Ts on the 5prime sideand 5ndash6 As on the 3prime side (Table 3)

Based on the minimal piggyBac vector pBSII-ITR11k-ECFP we constructed a plasmid minimal vector pXL-BacII-ECFP which also yields a high frequency of trans-formation in D melanogaster (Table 1) Our results confirmthat both the pBSII-ITR11k-ECFP and the pXL-BacII-ECFPminimal vectors can serve as highly efficient piggyBactransformation vectors For more information on theseminimal vectors please visit the piggyBac website at httppiggyBacbiondedu

Experimental procedures

Plasmids

The pCaSpeR-hs-orf helper plasmid was constructed by PCRamplifying the piggyBac open reading frame using IFP2orf_Forand IFP2orf_Rev primers cloning into the pCRII vector (Invitro-gen) excising with BamHI and inserting into the BamHI site ofthe P element vector pCaSpeR-hs (Thummel amp Pirrotta 1992)A single clone with the correct orientation and sequence wasidentified and named pCaSpeR-hs-orf (Fig 1)

The p(PZ)-Bac-EYFP plasmid (Fig 1) was constructed from thep(PZ) plasmid (Rubin amp Spradling 1983) by digesting with HindIIIand recircularizing the 7 kb fragment containing LacZ hsp70 andKanori sequences to form the p(PZ)-7kb plasmid The ITR car-tridge was excised from pBSII-ITR (Li et al 2001b) using Not Iand Sal I and blunt-end cloned into the HindIII site of the p(PZ)-7kb plasmid A 3xP3-EYFP marker gene was PCR amplified frompBac3xP3-EYFPafm (Horn amp Wimmer 2000) digested with SpeIand inserted into the XbaI site to form p(PZ)-Bac-EYFP

The pBSII-3xP3-ECFP plasmid was constructed by PCR amplifyingthe 3xP3-ECFP marker gene from pBac3xP3-ECFPafm (Horn ampWimmer 2000) using the primer pair ExFP_For and ExFP_Rev

(Table 3) digesting the amplified fragment with SpeI and cloningit into the XbaI site of pBlueScript II plasmid (Stratagene)

The piggyBac synthetic internal deletion plasmids were con-structed by PCR amplification from the pIAO-PL-589 bp plasmid(Li et al 2001b) using a series of primers (Table 4) Nine PCRproducts were generated using the combination of IFP2_R4against all five IFP2_L primers and IFP2_L5 against all fourIFP2_R primers Two additional PCR products were also obtainedusing the IPF2_R-TR + IFP2_L and IFP2_R1 + IFP2_L primerpairs These PCR products were then cloned into the pCR II vector(Invitrogen) excised by SpeI digestion and cloned into the SpeIsite of the pBSII-3xP3-ECFP plasmid to form the piggyBac internaldeletion series (Fig 7) The pBSII-ITR11K-ECFP plasmid (Fig 1)was constructed by cloning the EcoR VDraI fragment from pIAO-PL-589 bp which contained both piggyBac terminal repeats intothe EcoRV site of pBSII-3xP3-ECFP The pXL-BacII-ECFP plas-mid (Fig 1) was constructed essentially as described previously(Li et al 2001b) by PCR amplifying the ITR11k cartridge frompBSII-ITR11k-ECFP plasmid using MCS_For and MCS_Revprimers each containing flanking Bgl II sites cutting with Bgl IIre-ligating and cutting again with BssHII then inserting into theBssHII sites of the pBSII plasmid

The pBS-pBacDsRed1 plasmid was constructed by excisingthe 731 bp AseI fragment from p3E12 including 99 bp of 3prime piggyBacterminal sequence and adjacent NPV insertion site sequenceand ligating it as a blunt fragment into a unique KpnI-bluntedsite in pBS-KS (Stratagene) The resulting plasmid was digestedwith SacI and blunted digested with PstI and ligated to a173 bp HincII-Nsi I fragment from p3E12 including 38 bp of 5primepiggyBac terminal sequence The pBS-pBac minimal vector wasmarked with the polyubiquitin-regulated DsRed1 digested frompB[PUbDsRed1] (Handler amp Harrell 2001a) and inserted into anEcoRI-HindIII deletion in the internal cloning site within the terminalsequences

Transformation of D melanogaster

The D melanogaster w1118 white eye strain was used for all micro-injections employing a modification of the standard proceduredescribed by Rubin amp Spradling (1982) in which the dechorionationstep was eliminated Equal concentrations (05 microgmicrol) of each ofthe internal deletion plasmids or the control plasmid pBac3xP3-ECFPafm were injected along with an equal amount of thepCaSpeR-hs-orf helper plasmid into embryos followed by a 1 hheat shock at 37 degC and recovery overnight at room temperatureEmerging adults were individually mated with w1118 flies and progenywere screened as larvae using an Olympus SZX12 fluorescentdissecting microscope equipped with GFP (480 nm excitation510 nm barrier) CFP (436 nm excitation480 nm barrier) and YFP(500 nm excitation530 barrier) filter sets Two positive adults fromeach of the vials were crossed with w1118 to establish germline-transformed strains The pBS-pBacDsRed1 minimal vector wasalso injected and screened using a HQ Texas Redreg filter no 41004(Handler amp Harrell 2001a)

Figure 6 Identified point mutation in the 3prime internal repeat sequence A point mutation was discovered in the 19 bp internal repeat sequence (IR) of the 3prime TRD in all of the constructs derived from the pIAO-PL 589 plasmid (Li et al 2001b) This nucleotide substitution from C to A (bold and underlined) had no apparent affect on the transposition frequency of any of these constructs relative to the pBac3xP3-EYFP control plasmid



Direct PCR analysis

Genomic DNAs from each of the transformed stains the w1118 wild-type strain and a piggyBac-positive strain M231 (Handler amp Har-rell 1999) were prepared using a modified DNAzol procedureAbout sixty flies from each strain were combined with 150 microl ofDNAzol (Molecular Research Center Inc) in a 15 ml eppendorftube The flies were homogenized an additional 450 microl of DNAzolwas added and the homogenates were incubated at roomtemperature for 1 h The DNAs were extracted twice with phenolndashchloroform (1 1 ratio) and the aqueous fractions were transferredto new tubes for precipitation of the DNA with an equal volume of2-propanol The DNA pellets were washed with 70 ethanol airdried and resuspended in 150 microl of dH2O containing 10 microg ofRNase A

Two sets of direct PCRs were performed to identify the presenceof piggyBac sequences in transformed fly genomes PrimersMF34 and IFP2_L were used to identify the presence of the piggy-Bac 3prime terminal repeat and MF34 and IFP2_R1 were used to iden-tify the piggyBac 5prime terminal repeat To exclude the possibility ofrecombination a second PCR was also performed using theIFP2_R1 and IFP2_L primers to amplify the external stuffer frag-ment (Li et al 2001b) between the terminal repeat regions


Southern hybridization analysis was performed using a standardprocedure with minor modifications (Ausubel et al 1994) Approx-imately 8 microg of genomic DNA (isolated as above) from each of thetransformed fly strains was digested with 40 units of HindIII for 4 hfollowed by agarose gel electrophoresis The gel was then dena-tured neutralized transferred to nylon membranes and baked at80 degC for 4 h and the membranes were prehybridized overnightA synthetic probe was prepared by nick translation (Invitrogen kit)using 32P-labelled dGTP against the pBSII-ITR11K-ECFP plas-mid template Purified probe was hybridized at 65 degC overnight fol-lowed by several washes and the membranes were first exposedon phosphor screens (Kodak) overnight for scanning with a Stormphosphor Scanner (Molecular Dynamics System) and thenexposed on X-ray film (Kodak)

Universal PCR and inverse PCR analysis

The piggyBac insertion sites in the transformed fly strains wereidentified using either universal PCR (Beeman amp Stauth 1997) orinverse PCR techniques (Ochman et al 1988) For the universalPCR the IFP2_L (3prime TR) or IPR2_R1 (5prime TR) primer was combined

Figure 7 Schematic illustration of TRD and adjacent ID regions present in plasmids and synthetic piggyBac internal deletion series constructs tested for transformation efficiency The plasmids p(PZ)-Bac-EYFP and all pBSII-ECFP synthetic deletions are based on sequences amplified from the pIAO-PL-589 construct of Li et al (2001b) All plasmids have the 35 bp 5prime TRD and 63 bp 3prime TRD and include variable lengths of 5prime and 3prime adjacent ID sequence The relative transformation frequency for each plasmid is listed to the right for convenience

28 X Li et al


with one of seven universal primers (Table 4) during the first roundof PCR (94 degC 1 min 40 degC 1 min 72 degC 2 min thirty-five cycles)Two microlitres of the reaction mix from the first-round PCR wasthen used for a second round of PCR (94 degC 1 min 50 degC 1 min72 degC 2 min thirty-five cycles) using IFP2_L1 (3prime TR) or iPCR_R1(5prime TR) together with a T7 primer (nested on the universal primer)

Inverse PCRs were performed by digesting 5 microg of the genomicDNAs from each of the transformed strains completely with HinP1Ifor the 3prime end or Taq I for the 5prime end followed by purification usingthe Geneclean kit (Q-Biogene) and self-ligation in a 100 microl volumeovernight The self-ligated DNAs were precipitated and resus-pended in 30 microl ddH2O A 5 microl portion of each ligation was used forfirst-round PCR (94 degC 1 min 40 degC 1 min 72 degC 2 min thirty-fivecycles) with primer pairs IFP2_R1 + MF14 for the 5prime end andJF3 + IFP2_Lb for the 3prime end (Table 4) Two microlitres of the first-round PCR products were used as templates for the second-roundPCR (94 degC 1 min 50 degC 1 min 72 degC 2 min thirty-five cycles)using primer pairs iPCR_R1 + iPCR_6 for the 5prime end andiPCR_L1 + MF04 for the 3prime end The primer pair iPCR_L1 +IFP2_L-R was used for the second-round PCR of the 3prime end ofpBSII-ITR11k-ECFP strains All the PCR products were clonedinto the pCRII vector (Invitrogen) and sequenced Sequenceswere subjected to a Blast search of the NCBI database to identify

the locations of the insertions MacVector 653 (Oxford MolecularGroup) and ClustalX (Jeanmougin et al 1998) were used forsequence alignments

Acknowledgements

We would like to thank Ms Anna Wysinski for helping withinjections and maintaining fly stocks and Dr Neil Lobo forhelping with sequencing analysis This research was sup-ported by National Institutes of Health grant AI48561 to MJF

References

Ausubel FM Brent R Kingston RE Moore DD Seidman JGSmith JA and Struhl K (1994) Current Protocols in MolecularBiology John Wiley amp Sons Inc New York

Becker HA and Kunze R (1997) Maize Activator transposasehas a bipartite DNA binding domain that recognizes subterminalsequences and the terminal inverted repeats Mol Gen Genet254 219ndash230

Beeman RW and Stauth DM (1997) Rapid cloning of insecttransposon insertion junctions using lsquouniversalrsquo PCR InsectMol Biol 6 83ndash88

Berghammer AJ Klingler M and Wimmer EA (1999) A univer-sal marker for transgenic insects Nature 402 370ndash371

Cary LC Goebel M Corsaro BG Wang HG Rosen E andFraser MJ (1989) Transposon mutagenesis of baculovirusesanalysis of Trichoplusia ni transposon IFP2 insertions within theFP-locus of nuclear polyhedrosis viruses Virology 172 156ndash169

Elick TA Bauser CA and Fraser MJ (1996a) Excision of thepiggyBac transposable element in vitro is a precise event thatis enhanced by the expression of its encoded transposaseGenetica 98 33ndash41

Elick TA Bauser CA Principe NM and Fraser MJ Jr(1996b) PCR analysis of insertion site specificity transcriptionand structural uniformity of the Lepidopteran transposable ele-ment IFP2 in the TN-368 cell genome Genetica 97 127ndash139

Fraser MJ Brusca JS Smith GE and Summers MD (1985)Transposon-mediated mutagenesis of a baculovirus Virology145 356ndash361

Fraser MJ Cary L Boonvisudhi K and Wang HG (1995)Assay for movement of Lepidopteran transposon IFP2 in insectcells using a baculovirus genome as a target DNA Virology211 397ndash407

Fraser MJ Ciszczon T Elick T and Bauser C (1996) Preciseexcision of TTAA-specific lepidopteran transposons piggyBac(IFP2) and tagalong (TFP3) from the baculovirus genome incell lines from two species of Lepidoptera Insect Mol Biol 5141ndash151

Gierl A Lutticke S and Saedler H (1988) TnpA productencoded by the transposable element En-1 of Zea mays is aDNA binding protein EMBO J 7 4045ndash4053

Gonzalez-Estevez C Momose T Gehring WJ and Salo E(2003) Transgenic planarian lines obtained by electroporationusing transposon-derived vectors and an eye-specific GFPmarker Proc Natl Acad Sci USA 100 14046ndash14051

Grossman GL Rafferty CS Fraser MJ and Benedict MQ(2000) The piggyBac element is capable of precise excisionand transposition in cells and embryos of the mosquito Anoph-eles gambiae Insect Biochem Mol Biol 30 909ndash914

Table 4 A listing of the synthetic oligonucleotide primers used in this study

Primer Sequence

Internal deletion primersIFP2_R1 ACTTCTAGAGTCCTAAATTGCAAACAGCGACIFP2_R2 ACTTCTAGACACGTAAGTAGAACATGAAATAACIFP2_R3 ACTTCTAGATCACTGTCAGAATCCTCACCAACIFP2_R4 ACTTCTAGAAGAAGCCAATGAAGAACCTGGIFP2_L1 ACTTCTAGAAATAAATAAATAAACATAAATAAATTGIFP2_L2 ACTTCTAGAGAAAGGCAAATGCATCGTGCIFP2_L3 ACTTCTAGACGCAAAAAATTTATGAGAAACCIFP2_L4 ACTTCTAGAGATGAGGATGCTTCTATCAACGIFP2_L5 ACTTCTAGACGCGAGATACCGGAAGTACTGIFP2_L ACTTCTAGACTCGAGAGAGAATGTTTAAAAGTTTTGTTIFP2_R-TR ACTTCTAGACATGCGTCAATTTTACGCAGACTATCTTTC

TAGGG TTAATCTAGCTGCATCAGG

Other primersExFP_For ACGACTAGTGTTCCCACAATGGTTAATTCGExFP_Rev ACGACTAGTGCCGTACGCGTATCGATAAGCIFP2orf_For GGATCCTATA TAATAAAATG GGTAGTTCTTIFP2orf_Rev GGATCCAAATTCAACAAACAATTTATTTATGMF34 GGATCCTCTAGATTAACCCTAGAAAGATAUniv-1 TAATACGACTCACTATAGGGNNNNNNNNNNCTATUniv-2 TAATACGACTCACTATAGGGNNNNNNNNNNAGTGCUniv-3 TAATACGACTCACTATAGGGNNNNNNNNNNGAATTCUniv-4 TAATACGACTCACTATAGGGNNNNNNNNNNAGTACTUniv-5 TAATACGACTCACTATAGGGNNNNNNNNNNAAGCTTUniv-6 TAATACGACTCACTATAGGGNNNNNNNNNNGGATCCUniv-7 TAATACGACTCACTATAGGGNNNNNNNNNNCTAGiPCR_R1 ATTTTACGCAGACTATCTTTCTAT7 TTAATACGACTCACTATMF14 GGATCCGCGGTAAGTGTCACTGAJF3 GGATCCTCGATATACAGACCGATAAAAACACATGIFP2_Lb ACTGGGCCCATACTAATAATAAATTCAACAAACiPCR_6 TTATTTCATGTTCTACTTACGTGiPCR_L1 TGATTATCTTTAACGTACGTCACMF04 GTCAGTCCAGAAACAACTTTGGCIFP2_L-R+ CTAGAAATTTATTTATGTTTATTTATTTATTAMCS_For ACGCGTAGATCTTAATACGACTCACTATAGGGMCS_Rev ACGCGTAGATCTAATTAACCCTCACTAAAGGG



Grossman GL Rafferty CS Clayton JR Stevens TKMukabayire O and Benedict M (2001) Germline transforma-tion of the malaria vector Anopheles gambiae with the piggy-Bac transposable element Insect Mol Biol 10 597ndash604

Handler AM (2002) Use of the piggyBac transposon for germ-line transformation of insects Insect Biochem Mol Biol 321211ndash1220

Handler AM and Harrell RA 2nd (1999) Germline transforma-tion of Drosophila melanogaster with the piggyBac transposonvector Insect Mol Biol 8 449ndash457

Handler AM and Harrell RA 2nd (2001a) Polyubiquitin-regulated DsRed marker for transgenic insects Biotechniques31 824ndash828

Handler AM and Harrell RA 2nd (2001b) Transformation of theCaribbean fruit fly Anastrepha suspensa with a piggyBacvector marked with polyubiquitin-regulated GFP InsectBiochem Mol Biol 31 199ndash205

Handler AM and McCombs SD (2000) The piggyBac trans-poson mediates germ-line transformation in the Oriental fruitfly and closely related elements exist in its genome InsectMol Biol 9 605ndash612

Handler AM McCombs SD Fraser MJ and Saul SH (1998)The lepidopteran transposon vector piggyBac mediatesgerm-line transformation in the Mediterranean fruit fly ProcNatl Acad Sci USA 95 7520ndash7525

Hediger M Niessen M Wimmer EA Dubendorfer A andBopp D (2001) Genetic transformation of the housefly Muscadomestica with the lepidopteran derived transposon piggyBacInsect Mol Biol 10 113ndash119

Heinrich JC Li X Henry RA Haack N Stringfellow LHeath AC and Scott MJ (2002) Germ-line transformation ofthe Australian sheep blowfly Lucilia cuprina Insect Mol Biol 111ndash10

Horn C and Wimmer EA (2000) A versatile vector set for animaltransgenesis Dev Genes Evol 210 630ndash637

Ivics Z Hackett PB Plasterk RH and Izsvak Z (1997) Molecularreconstruction of Sleeping Beauty a Tc1-like transposon fromfish and its transposition in human cells Cell 91 501ndash510

Jasinskiene N Coates CJ and James AA (2000) Structure ofhermes integrations in the germline of the yellow fever mos-quito Aedes aegypti Insect Mol Biol 9 11ndash18

Jeanmougin F Thompson JD Gouy M Higgins DG andGibson TJ (1998) Multiple sequence alignment with ClustalX Trends Biochem Sci 23 403ndash405

Kaufman PD Doll RF and Rio DC (1989) Drosophila P elementtransposase recognizes internal P element DNA sequencesCell 59 359ndash371

Kokoza V Ahmed A Wimmer EA and Raikhel AS (2001)Efficient transformation of the yellow fever mosquito Aedesaegypti using the piggyBac transposable element vectorpBac[3xP3-EGFP afm] Insect Biochem Mol Biol 31 1137ndash1143

Kunze R and Starlinger P (1989) The putative transposase oftransposable element Ac from Zea mays L interacts withsubterminal sequences of Ac EMBO J 8 3177ndash3185

Li X Heinrich JC and Scott MJ (2001a) piggyBac-mediatedtransposition in Drosophila melanogaster an evaluation of theuse of constitutive promoters to control transposase geneexpression Insect Mol Biol 10 447ndash455

Li X Lobo N Bauser CA and Fraser MJ (2001b) Theminimum internal and external sequence requirements for

transposition of the eukaryotic transformation vector piggyBacMol Genet Gen 266 190ndash198

Liu D Mack A Wang R Galli M Belk J Ketpura NI andCrawford NM (2000) Functional dissection of the cis-actingsequences of the Arabidopsis transposable element Tag1reveals dissimilar subterminal sequence and minimal spacingrequirements for transposition Genetics 157 817ndash830

Lobo NF Hua-Van A Li X Nolen BM and Fraser MJ Jr(2002) Germ line transformation of the yellow fever mosquitoAedes aegypti mediated by transpositional insertion of apiggyBac vector Insect Mol Biol 11 133ndash139

Lohe AR and Hartl DL (2001) Efficient mobilization of marinerin vivo requires multiple internal sequences Genetics 160519ndash526

Lozovsky ER Nurminsky D Wimmer EA and Hartl DL (2002)Unexpected stability of mariner transgenes in DrosophilaGenetics 160 527ndash535

Mandrioli M and Wimmer EA (2002) Stable transformation of aMamestra brassicae (lepidoptera) cell line with the lepidopteran-derived transposon piggyBac Insect Biochem Mol Biol 331ndash5

Mullins MC Rio DC and Rubin GM (1989) cis-acting DNAsequence requirements for P-element transposition GenesDev 3 729ndash738

Nolan T Bower TM Brown AE Crisanti A and CatterucciaF (2002) piggyBac-mediated germline transformation of themalaria mosquito Anopheles stephensi using the red fluores-cent protein dsRED as a selectable marker J Biol Chem 2778759ndash8762

Ochman H Gerber AS and Hartl DL (1988) Genetic applica-tions of an inverse polymerase chain reaction Genetics 120621ndash623

Peloquin JJ Thibault ST Staten R and Miller TA (2000)Germ-line transformation of pink bollworm (Lepidopteragelechiidae) mediated by the piggyBac transposable elementInsect Mol Biol 9 323ndash333

Perera OP Harrell IIRA and Handler AM (2002) Germ-linetransformation of the South American malaria vector Anophelesalbimanus with a piggyBac EGFP transposon vector is routineand highly efficient Insect Mol Biol 11 291ndash297

Pfaffle P and Jackson V (1990) Studies on rates of nucleosomeformation with DNA under stress J Biol Chem 265 16821ndash16829

Rio DC and Rubin GM (1988) Identification and purification ofa Drosophila protein that binds to the terminal 31-base-pairinverted repeats of P transposable element Proc Natl AcadSci USA 85 8929ndash8933

Rubin GM and Spradling AC (1982) Genetic transformation ofDrosophila with transposable element vectors Science 218348ndash353

Rubin GM and Spradling AC (1983) Vectors for P element-mediated gene transfer in Drosophila Nucleic Acids Res 116341ndash6351

Saedler H and Gierl A (eds) (1996) Transposable ElementsSpringer-Verlag Berlin

Sarkar A Coates CJ Whyard S Willhoeft U Atkinson PWand OrsquoBrochta DA (1997a) The Hermes element from Muscadomestica can transpose in four families of cyclorrhaphan fliesGenetica 99 15ndash29

Sarkar A Yardley K Atkinson PW James AA and OrsquoBrochta DA(1997b) Transposition of the Hermes element in embryos of the

30 X Li et al


vector mosquito Aedes aegypti Insect Biochem Mol Biol 27359ndash363

Sarkar A Sim C Hong YS Hogan JR Fraser MJRobertson HM and Collins FH (2003) Molecular evolution-ary analysis of the widespread piggyBac transposon family andrelated lsquodomesticatedrsquo sequences Mol Genet Genomics 270173ndash180

Sumitani M Yamamoto DS Oishi K Lee JM andHatakeyama M (2003) Germline transformation of the sawflyAthalia rosae (Hymenoptera Symphyta) mediated by a piggyBac-derived vector Insect Biochem Mol Biol 33 449ndash458

Tamura T Thibert C Royer C Kanda T Abraham EKamba M Komoto N Thomas JL Mauchamp BChavancy G Shirk P Fraser M Prudhomme JC andCouble P (2000) Germline transformation of the silkwormBombyx mori L using a piggyBac transposon-derived vectorNat Biotechnol 18 81ndash84

Thibault ST Luu HT Vann N and Miller TA (1999) Preciseexcision and transposition of piggyBac in pink bollwormembryos Insect Mol Biol 8 119ndash123

Thomas JL Da Rocha M Besse A Mauchamp B andChavancy G (2002) 3xP3-EGFP marker facilitates screeningfor transgenic silkworm Bombyx mori L from the embryonicstage onwards Insect Biochem Mol Biol 32 247ndash253

Thummel CS and Pirrotta V (1992) New pCaSpeR P elementvectors Dros Info Service 71 150ndash150

Tosi LR and Beverley SM (2000) cis and trans factors affectingMos1 mariner evolution and transposition in vitro and itspotential for functional genomics Nucleic Acids Res 28 784ndash790

Trentmann SM Saedler H and Gierl A (1993) The transpos-able element EnSpm-encoded TNPA protein contains a DNAbinding and a dimerization domain Mol Gen Genet 238 201ndash208

Wolffe AP (1996) Histone deacetylase a regulator of transcrip-tion Science 272 371ndash372

Zayed H Izsvak Z Khare D Heinemann U and Ivics Z(2003) The DNA-bending protein HMGB1 is a cellular cofactorof Sleeping Beauty transposition Nucleic Acids Res 31 2313ndash2322

18

X Li

et al


Insect Molecular Biology

14

17ndash30

recently a non-insect species the planarian

Girardia tigrina

has also been successfully transformed using

piggyBac

suggesting a wider range of utility for this element (Gonzalez-Estevez

et al

2003) A common feature of all of thesetransformations has been the use of either a complete or apartial internally deleted (08 kb deletion in the transposasecoding sequence Handler amp Harrell 1999 Horn amp Wimmer2000)

piggyBac

transposon as the transformation vectorUsing plasmid-based mobility assays Li

et al

(2001b)had previously reported that the 5

prime

and 3

prime

piggyBac

TRDsequences were sufficient for excision or transposition ininjected insect embryos However personal communica-tions from several labs attempting to utilize the previouslyidentified minimal

piggyBac

sequences in transformationexperiments indicated significant difficulty in obtaining germ-line transformants (John Peloquin UC Riverside RichardBeeman Kansas State University) Our own attempts totransform

D melanogaster

with one of our minimal

piggy-Bac

constructs also yielded an extremely low frequency of06 transformants significantly lower than the previouslyreported 26 transformation frequency for

piggyBac

in thisspecies (Handler amp Harrell 1999)

These results imply some

piggyBac

internal sequencesessential for efficient germline transformation of the insectgenome are absent in our previous internal deletion con-structs even though they are apparently not required forinterplasmid transposition Similar observations have beenreported for other Class II transposons such as the

Mos

1

mariner

element

Mariner

transposons lacking any internalsequences are inactive in transposition assays whileretention of a few additional nucleotides of the internalsequence restores full activity (Tosi amp Beverley 2000)However efficient germline transformation also requiresthe presence and proper spacing of multiple sequencesinternal to the element as well as the inverted repeats(Lohe amp Hartl 2001 Lozovsky

et al

2002)In this report we identify ID sequences adjacent to the 5

prime

and 3

prime

TRD of the

piggyBac

transposon that contribute to ahigh frequency of germline transformants in

D melanogaster

We analyse a series of PCR synthesized deletion vectorsconstructed with the 3xP3-ECFP gene as a transformationmarker (Horn amp Wimmer 2000) These vectors define aminimal ID configuration that is sufficient to effect efficientgermline transformation of

D melanogaster

Using thisinformation we construct a new ITR cartridge called ITR11kand verify its utility in converting an existing plasmid into amobilizable

piggyBac

vector that enables efficient germlinetransformation We also construct a transposon-basedcloning vector pXL-BacII for insertion of sequences withina minimal

piggyBac

transposon and verify its capabilitiesin germline transformations Sequence analysis of theseconstructs reveals an introduced point mutation within theinternal repeat sequence of the 3

prime

TRD that has no apparenteffect on mobility of the element

Results

Transformation experiments with synthetic deletion constructs

Initial attempts to transform

D melanogaster

with plasmidshaving only TRD sequences as specified in our previousreport (Li

et al

2001b) yielded transformation frequenciesfar less than full-length

piggyBac

constructs The p(PZ)-BacEYFP construct contains the ITR cartridge of Li

et al

(2001b) composed of the 5

prime

and 3

prime

TRD and the spacersequence while the pBS-pBacDsRed retains only 2 bpof 5

prime

ID and 36 bp of 3

prime

ID sequences in addition to the 5

prime

and 3

prime

TRD Neither of these constructs was able to gener-ate germline transformants at the frequencies previouslyreported for full-length vectors (Handler amp Harrell 1999)or the less extensive internal deletion construct pBac3xP3-ECFPafm (Horn amp Wimmer 2000) This forced us to re-examine the potential involvement of

piggyBac

ID sequencesin generating germline transformations

We examined the requirements for TRD adjacent IDsequences of the

piggyBac

transposon using a synthe-sized cartridge strategy based upon construction of thepreviously reported ITR cartridge (Li

et al

2001b) ratherthan digesting with an endonuclease and selecting clonesrepresenting an internal deletion series Each of the

piggy-Bac

synthetic internal deletion plasmids was formed fromthe pIAO-PL-589 plasmid (Li

et al

2001b) by PCR ampli-fication across the facing TRDs and spacer sequences withprimers that recognize 5

prime

or 3

prime

ID sequences adjacent to therespective TRDs (Fig 1) The fragments generated werecloned into a pBSII-3xP3-ECFP plasmid and sequenced(see Experimental procedures)

Each of the synthetic deletion series plasmids and thecontrol plasmid pBac3xP3-ECFPafm were co-injected withthe

hsp70

-regulated transposase helper into

w

1118

embryoswith surviving adults backcrossed and G1 adult progenyscreened for fluorescence Positive transformants exhibitedfluorescent eyes with cyan and green filter sets but not withthe yellow filter set Transformation frequencies from all injec-tions are listed in Table 1 The p(PZ)-Bac-EYFP plasmidwhich was constructed using the ITR cartridge previouslydescribed (Li

et al

2001b) yielded a relatively low trans-formation frequency of 06 compared with the controlplasmid pBac3xP3-ECFPafm frequency of 129 (Table 1)

Eight of the eleven synthetic ID deletion plasmids yieldedpositive transformants at an acceptable frequency com-pared with the control The 5

prime

ID deletion constructs pBSII-ECFP-R1L5 pBSII-ECFP-R2L5 pBSII-ECFP-R3L5 andpBSII-ECFP-R4L5 had variable deletions of the

piggyBac

5

prime

ID retaining sequences from 66 bp (nucleotides 36ndash101GenBank accession number AR307779) to 542 bp (nucle-otides 36ndash567) of the

piggyBac

sequence Each of these 5

prime

ID deletions yielded ECFP-positive germline transformantsat frequencies from 89 (

plusmn

10) to 150 (

plusmn

06)










20 X Li et al









Embryos hatched

Adults mated






























22 X Li et al













Discussion










A 22 31 38 33 26 27 16 18 18 29 41 28 43 41 42 43 28 34 33 40C 20 19 22 17 17 23 15 20 26 15 11 20 18 20 15 17 21 23 16 11G 28 19 17 16 24 8 24 16 19 12 18 29 22 13 20 12 23 6 15 11T 30 31 23 34 33 42 45 46 37 44 30 23 17 26 23 28 28 37 36 38


24 X Li et al



















26 X Li et al





Plasmids












Direct PCR analysis








28 X Li et al





Acknowledgements


References















Primer Sequence










































30 X Li et al






















20 X Li et al









Embryos hatched

Adults mated






























22 X Li et al













Discussion










A 22 31 38 33 26 27 16 18 18 29 41 28 43 41 42 43 28 34 33 40C 20 19 22 17 17 23 15 20 26 15 11 20 18 20 15 17 21 23 16 11G 28 19 17 16 24 8 24 16 19 12 18 29 22 13 20 12 23 6 15 11T 30 31 23 34 33 42 45 46 37 44 30 23 17 26 23 28 28 37 36 38


24 X Li et al



















26 X Li et al





Plasmids












Direct PCR analysis








28 X Li et al





Acknowledgements


References















Primer Sequence










































30 X Li et al























22 X Li et al













Discussion










A 22 31 38 33 26 27 16 18 18 29 41 28 43 41 42 43 28 34 33 40C 20 19 22 17 17 23 15 20 26 15 11 20 18 20 15 17 21 23 16 11G 28 19 17 16 24 8 24 16 19 12 18 29 22 13 20 12 23 6 15 11T 30 31 23 34 33 42 45 46 37 44 30 23 17 26 23 28 28 37 36 38


24 X Li et al



















26 X Li et al





Plasmids












Direct PCR analysis








28 X Li et al





Acknowledgements


References















Primer Sequence










































30 X Li et al

















Discussion










A 22 31 38 33 26 27 16 18 18 29 41 28 43 41 42 43 28 34 33 40C 20 19 22 17 17 23 15 20 26 15 11 20 18 20 15 17 21 23 16 11G 28 19 17 16 24 8 24 16 19 12 18 29 22 13 20 12 23 6 15 11T 30 31 23 34 33 42 45 46 37 44 30 23 17 26 23 28 28 37 36 38


24 X Li et al



















26 X Li et al





Plasmids












Direct PCR analysis








28 X Li et al





Acknowledgements


References















Primer Sequence










































30 X Li et al













24 X Li et al



















26 X Li et al





Plasmids












Direct PCR analysis








28 X Li et al





Acknowledgements


References















Primer Sequence










































30 X Li et al























26 X Li et al





Plasmids












Direct PCR analysis








28 X Li et al





Acknowledgements


References















Primer Sequence










































30 X Li et al















Direct PCR analysis








28 X Li et al





Acknowledgements


References















Primer Sequence










































30 X Li et al













28 X Li et al





Acknowledgements


References















Primer Sequence










































30 X Li et al



















































30 X Li et al













piggybac internal sequences are necessary for …...piggybac internal sequences are necessary for...

Documents