population genetic structure of leadbeater's possum ... · pdf filepopulation genetic...
TRANSCRIPT
Population genetic structure of Leadbeater's
possum Gymnobelideus leadbeateri, and its
implications for species conservation
A thesis submitted for the degree of Doctor of Philosophy
Birgita D Hansen B.Sc. (Hons)
School of Biological Sciences
Monash University
Melbourne, Australia
June 2008
2
to the possums, who taught me many hard lessons…
3
Table of contents
Abstract ........................................................................................................................... 6
General Declaration ....................................................................................................... 8
Acknowledgements ......................................................................................................... 9
Chapter One General Introduction........................................................................ 12 Historical records and current distribution ............................................................. 12 Habitat and resource requirements ......................................................................... 13 Yellingbo Conservation Nature Reserve and Lake Mountain alpine resort ........... 14 Life history ............................................................................................................. 15 Conservation issues ................................................................................................ 16 Population genetics as a tool for conservation ....................................................... 18 Application of genetic marker analysis to Leadbeater's possum conservation ...... 19 Genetic analysis of field populations...................................................................... 20 Intended management applications ........................................................................ 22 Thesis outline and the aims of the study ................................................................ 22
Declaration for Thesis Chapter Two .......................................................................... 24
Chapter Two A set of microsatellite markers for an endangered arboreal marsupial, Leadbeater’s possum. ............................................................................... 25
Table 1 ............................................................................................................ 28 Table 2 ............................................................................................................ 29
Declaration for Thesis Chapter Three........................................................................ 30
Addendum to Thesis Chapter Three .......................................................................... 31
Chapter Three Isolated remnant or recent introduction? Estimating the provenance of Yellingbo Leadbeater’s possums by genetic analysis and bottleneck simulation. ........................................................................................................ 32
Introduction ................................................................................................................ 32 Materials and Methods ............................................................................................... 35
Sample collection and microsatellite genotyping................................................... 35 Statistical analysis of genetic diversity and structure............................................. 36 Analysis of bottlenecking patterns ......................................................................... 36 Bottleneck simulations ........................................................................................... 37
Results ........................................................................................................................ 40 Genetic diversity and structure of real populations ................................................ 40 Bottlenecking patterns ............................................................................................ 42 Bottleneck simulations ........................................................................................... 43
Discussion................................................................................................................... 45 Table 1. ........................................................................................................... 48 Table 2. ........................................................................................................... 49 Table 3. ........................................................................................................... 50 Figure 1........................................................................................................... 51 Figure 2........................................................................................................... 52 Figure 3........................................................................................................... 53 Figure 4........................................................................................................... 54 Figure 5........................................................................................................... 55 Appendix 1. .................................................................................................... 56 Appendix 2. .................................................................................................... 60
4
Chapter Four Population genetic analysis reveals a long-term decline of a threatened endemic marsupial. ................................................................................... 61
Introduction ................................................................................................................ 61 Methods ...................................................................................................................... 64
Collection and preparation of genetic material....................................................... 64 Microsatellite genotyping....................................................................................... 65 Mitochondrial SSCP and sequencing ..................................................................... 66 Microsatellite DNA analysis .................................................................................. 66 Mitochondrial DNA analysis.................................................................................. 67
Results ........................................................................................................................ 69 Microsatellite DNA analyses.................................................................................. 69 Mitochondrial DNA analyses ................................................................................. 71
Discussion................................................................................................................... 75 Current genetic structure of wild populations ........................................................ 75 Historical population genetic structure................................................................... 76 Yellingbo as a source for translocation .................................................................. 79 Implications of the genetic data for future species conservation............................ 80
Table 1. ........................................................................................................... 83 Table 2. ........................................................................................................... 84 Table 3. ........................................................................................................... 85 Table 4. ........................................................................................................... 86 Table 5. ........................................................................................................... 87 Figure 1........................................................................................................... 88 Figure 2........................................................................................................... 89 Figure 3........................................................................................................... 90 Figure 4........................................................................................................... 91 Figure 5........................................................................................................... 93 Appendix 1. .................................................................................................... 94
Chapter Five Genetic analysis of social structure, mating system and dispersal in Leadbeater's possum................................................................................................ 95
Introduction ................................................................................................................ 95 Methods ...................................................................................................................... 98 Field Work.................................................................................................................. 98
Site descriptions.................................................................................................. 98 Animal sampling and determination of age and breeding condition.................. 98 Genotyping and Additional Genetic Marker Development................................ 99
Statistical Analyses................................................................................................... 100 Spatial genetic analyses ........................................................................................ 100 Genetic disequilibria............................................................................................. 102
Parentage Analyses................................................................................................... 102 Inference of parental / offspring relationships from field data............................. 102 Parentage testing................................................................................................... 103 Yellingbo exclusion criteria ................................................................................. 104 Lake Mountain exclusion criteria ......................................................................... 105
Results ...................................................................................................................... 106 Field Work................................................................................................................ 106
Sample collection ................................................................................................. 106 Patterns in colony composition / cases of multiple adults in a single colony ...... 106
Statistical Analyses................................................................................................... 107 Spatial genetic analysis......................................................................................... 107 Patterns in spatial relatedness and dispersal ......................................................... 108 Genetic disequilibrium and the potential for null alleles...................................... 109
5
Parentage Analyses................................................................................................... 112 CERVUS analysis and the power of assignments ............................................ 112 Yellingbo .......................................................................................................... 112
Paternity assignment success................................................................................ 112 Case studies from paternity analyses.................................................................... 113 Relatedness between candidate parents................................................................ 113 The case of movement of breeding individuals and successful dispersal events . 115
Lake Mountain.................................................................................................. 115 Paternity assignment success................................................................................ 115 Dispersal resulting in breeding ............................................................................. 116 Relatedness between candidate parents................................................................ 116
Tests for departures from monogamy - Yellingbo and Lake Mountain ........... 117 Patterns of breeding in colonies containing multiple adults - Yellingbo and Lake Mountain........................................................................................................... 118
Discussion................................................................................................................. 119 Spatial patterns in genetic variation ..................................................................... 119 Sex-biased patterns in dispersal............................................................................ 120 Sex-biased patterns in spatial relatedness............................................................. 122 Admixture disequilibria and the Wahlund principle ............................................ 123 The mating system and the reliability of ecological inferences of breeding ........ 124 The role of nesting sites in structuring populations.............................................. 126 Management implications..................................................................................... 126
Table 1. ......................................................................................................... 128 Table 2. ......................................................................................................... 130 Table 3. ......................................................................................................... 131 Table 4. ......................................................................................................... 132 Figure 1......................................................................................................... 133 Figure 2......................................................................................................... 136 Figure 3......................................................................................................... 138 Appendix 1. .................................................................................................. 140 Appendix 2. .................................................................................................. 141 Appendix 3. .................................................................................................. 142
Yellingbo .................................................................................................................. 143 Lake Mountain.......................................................................................................... 145
Chapter Six The conservation implications of fine scale and meta-population scale genetic structure of populations of Leadbeater's possum. ............................ 147
Background............................................................................................................... 147 Reasons for Conservation Status .............................................................................. 148 Major Conservation Objectives (recommended on the basis of the genetic data) ... 148 Management Issues................................................................................................... 149 Ecological Issues Specific to the Taxon................................................................... 149 Evolutionary Issues Specific to the Taxon ............................................................... 151 Past Population Processes in the Central Highlands ................................................ 151 The Evolutionary History of the Population at Yellingbo........................................ 152 Management Action ................................................................................................. 153 Intended Management Action .................................................................................. 153 Planning and Management Units.............................................................................. 154 Other Desirable Management Actions ..................................................................... 154
References ................................................................................................................... 156
6
Abstract
Since European colonisation, Leadbeater's possum (Gymnobelideus leadbeateri) has
declined across its range to the point where it is now only patchily distributed within the
montane ash forests of the Central Highlands of Victoria. Population viability analyses
(PVA) have modelled ongoing large-scale population declines under current timber
management prescriptions. The loss of large hollow bearing trees and failure to
maintain mature ash and recruit younger trees is predicted to result in the loss of up to
90% of Leadbeater's possums within the next 50 years.
There have been two recently discovered populations that occur in environs dissimilar
to that of the majority of central highlands populations. The first at Yellingbo Nature
Conservation Reserve occurs in lowland swamp, and the second at Lake Mountain,
occurs in sub-alpine woodland. The population at Yellingbo is distinct, not only in
terms of habitat differences, but also in being completely geographically isolated from
other conspecific population. Breeding colonies at Yellingbo and Lake Mountain make
use of artificial nesting hollows in addition to natural denning sites, the latter being
uncommon at both sites.
This study uses a panel of 15-20 highly resolving microsatellite markers and
mitochondrial D-loop sequence data, to infer historical gene flow and investigate
current population structure. Populations in the northern part of the central highlands
(including Lake Mountain) were highly admixed, and showed no signs of either current
or historical barriers to gene flow. The isolated population of Yellingbo was highly
genetically differentiated (on the basis of microsatellite data). Analyses of bottlenecking
confirmed it to have undergone a recent reduction in population size. The extent to
which the distinctiveness of the Yellingbo population might be expected solely through
bottlenecking of central highlands populations, was tested by simulating population
history scenarios seeded with genotypes from candidate sources. No bottleneck scenario
reproduced the genetic characteristics of the Yellingbo population, suggesting that it
does not share recent ancestry with other extant populations. Mitochondrial sequence
data confirmed that, not only had Yellingbo been isolated from the rest of the species
range since well before European colonisation, but that it may once have formed part of
7
a larger genetic unit that is now extinct. It therefore harbours a unique subset of genetic
diversity that is not represented by any other extant population.
In addition to inter-population genetic analyses, a fine-scale genetic analysis was also
conducted at both Lake Mountain and Yellingbo. This included an investigation into the
mating system and patterns of dispersal. The species’ was found to be largely
monogamous at both sites, although there was evidence of extra-pair paternity in less
than 5% of cases. At both sites, males and females were found to disperse much further
than previously recorded (during an earlier study at Yellingbo). Maximum inferred
dispersal distances were 2.5km in males and 2km in females. Importantly, population
genetic structure was found to coincide closely with the spatial arrangement of breeding
colonies, and genetic variation was highest within colonies than among them. Colonies
or groups of colonies were found to be discrete genetic units that do not experience
sufficient migration to homogenise them.
The mitochondrial genetic data collected in this study identified historic loss of maternal
lineages in the northern central highlands, probably indicative of past shifts in local
climate. This may translate to population declines across the broader range of the
species. This suggests that in addition to declines detected in the field and in line with
predictions from PVA, future declines are highly probable, potentially to the point of
extinction of this species.
8
General Declaration
9
Acknowledgements
This research was financed by the Holsworth Wildlife Research Fund (thanks heaps Bill), the Hermon Slade Foundation and an Australian Academy of Sciences Research Award for the Conservation of Endangered Australian Vertebrate Species. I started writing this after a boozy night with the coffee ladies, and decided that the dodgy red-wine induced bits should probably stay. This research would never have happened without the incredible support, tolerance and empathy of Andrea Taylor, my supervisor. She has really been quite the most excellent supervisor and if she hadn’t taken me on board where others wouldn’t, I’d be cleaning toilets at Broome Bird Observatory instead. Who knows, that may yet happen… This PhD would also never have started without the enthusiasm of Dan Harley, my collaborator and helpful expert in all things Leadbeater's possum. When David was despondent about the prospects of ever learning anything about Leadbeater's possum from genetic analysis because of his pitiful sample sizes, the project happened anyway - for better or worse. And of course, having mentioned him, thanks to David Lindenmayer whose vision for a future for Leadbeater's possum made the research to follow so much more significant. My appreciation and thanks must go to Parks Victoria staff, Tamara Karner, Glenn Mawson, Ian Foletta, DSE staff, Steve Smith, Jo Antrobus, for the logistical support provided, and to Kelly O'Sulllivan at Healesville Sanctuary for assistance with those nasty little pit tags at Lake Mountain. Thanks also to Brett Weinberg at the Lake Mountain resort for providing authorisation to access the site. Thanks to Chris MacGregor Damien Michael and Mason Crane for collecting precious samples. Dr Taylor and I are particularly grateful to the Museum of Victoria, and in particular, Janette Norman, for making available precious samples from historic and type specimens held in collections there. My thanks to Sid Larwill for his interest and enthusiasm in the project - never fear Sid, the project isn't done yet! We'll solve the mystery of the Mt Macedon possum in the coming months! My thanks and gratitude to Paul Sunnucks for allowing me to come to La Trobe and use his lab and share some good times with the students there, Mark, Dave, Mel L, Cheps, Christian and Ryan. And thanks especially to Paul for his support throughout my paper writing (and rejecting) dramas. A special thank you to Ken and Carlene Gosbel for allowing me to use their beautiful little house at Marysville when I was doing field work. That is definitely worth many good wines. The Taylor / Sunnucks lab gave me the most enormous amount of support over the years. Maxine Piggott and Sam Banks were there in the early days and have continued to provide what support they can from the icy landscapes of canberra. After that came an amazing array of people: Sasha (for pointing out to me what my coalescent analyses
10
were really telling me about LBP), Jody and Silvana (for advice on man troubles and good partying and dancing), Ash (fellow asbirder), Schmuki (so many encouraging and supportive talks), Tara (oh my god, this woman knows everything computer and technical - like endnote, thanks love!), Val and Trish (thankyou so much for reading drafts of my thesis, which sucked to write), Mel N for help with cloning, Nich, Kate, Juliey and the list is endless. My time at Monash has gone from OK, to good, to amazing and life-changing. I have met so many incredible people here… Thanks to the ever present coffee group and those extra-curricula coffee group events; BBQs and dinner parties: Gerry, Greg, Kirsten, Kate, Tricia, Sheila, Ellen, Trish, Matt, Andreas, Shaun. Mmm red wine and good food. We all love that. Thanks to the boys in the taj, Jim, Shaun, Danny, Dennis and Ralph. Where would I be without GIS support and more importantly earl grey tea, authorship counselling, many supportive talks about LBP and life as a phd (oh, and those special cups of strong black tea). Thanks to my fellow ACB members whose driving passion and massively focussed ambition lead me to finally believe in my own research. And thanks especially to some chumpy executive committee members (eg. Ross) for some good advice and good beer drinking nights. And thanks to Carla for being the only other woman and the only sensible character on the exec, helping even the balance. The freshwater boys, Paul Reich, Matt, Dimmer, Tommy, Nick and of course, Sam (I really enjoyed the orchestra with Sam!). My fellow PG rep and fiend of beer and bad behaviour, Amber The ACB PGs, Beth, Elise, Gillis, the lovely Brian Hawkins, lovely Susie for all her help in times of PG rep desperation and filling in for my demonstrating The boys in the workshop, the lovely office ladies (Carol, Jenny, Jana, Meghan) who made administrative life so much easier to deal with, the tea room classics (Peter, we will never agree on tea quality!). And other departmental characters, Tim Cavagnaro for not letting me store beer in his cold room, Alan Lill for good birding stories, Graeme Farrington for being a grumpy old man, Jodi Ryan for always being good value and cheerful, John Hamill for his appallingly bad humour in RDC meetings, the lovely Gen prep room staff, Trav for taking science seriously and wearing a lab coat, Bec, Nicole (oh the LiCor), Muzza for sharing his food with me at Aireys, John Beardall, Jodie Weller, Mel and Rich, Martin for trying to coax me back to frissa, Beth Gott for all things green (and no thanks to the powers that be at the university for destroying so much of our beautiful gardens), John A for being so much help in the lab, Steve McKechnie for agreeing to be a co-supervisor in those early days (someone should have warned him!), Sven for being a true hippy, Bob (I’ll be sure not to leave the chopsticks poking out of my food in future), Lorenz, Megan for good birding field work, Gene Likens for encouraging words when being PG rep was getting hard, Patrick Baker for leaving me to run his forestry management prac whilst he was living it up in Thailand. Joy.
11
Thanks to PGs for supporting me as their rep. I’ve really enjoyed the experience. And thanks to all the great people in the school who have helped me out many times, especially for all the good chats and general hilarity, and turning up to beers in the tea room! A special thanks to my fellow Mammal Society council members, Peter M, Graeme N, Graeme C, Kath, Lynne, Jenny and Andie. And to the mammal society students who supported me in yet another of my rep roles! truly I am a chump. Thanks heaps to Alisha for allowing me live in her lovely home with her and the dogs for much less rent than it was worth! Thanks to all the members of the Victorian Wader Study Group for many awesome shorebirding times (my other life), especially thanks to Clive and Pat, Roz, Pete, Helen and Rod, Ken and Carlene, Chris and Andie, and so many more. To those oystercatchers and freezing to death in corner inlet in mid-winter, to the 2.88 million pratincole that turned up at Broome in 2004. To Les Underhill for his encouragement when a phd seemed so impossible. And of course, the PV boat drivers for fun times. Thanks also to the lovely April, to Teesh, and to Marg, to Rick and Socks, to Gary and Ollie, to Price Finally, thanks to my precious family. Mum, Dad and Gill, and Rogan, thanks for all your support over the years and especially to mum and dad for providing me with the opportunity for a good education. Lucky. Thanks always to my dear friends Inka, Hania, Elisa, Tania and Jan. I cannot express in words what these amazing women mean to me. Without them, I don’t think I’d still be here, or anywhere.
12
Chapter One General Introduction Leadbeater's possum is a small cryptic non-gliding member of the family Petauridae. It
is endemic to Victoria and is listed as endangered under state and federal legislation.
Leadbeater's possum is the sole member of the genus Gymnobelideus and represents a
very old lineage that diverged from its closest living relatives, the Dactylopsilines
(Striped Possums), around 32 million years ago (Edwards and Westerman 1992). Its
range has shifted concurrent with climate driven changes to the Pleistocene landscape
(Lindenmayer 1996). It is now almost entirely restricted to the montane ash forests of
the central highlands of Victoria. Its distribution is closely correlated with the presence
of large hollow-bearing ash trees, upon which it relies for nesting (Smith and
Lindenmayer 1988).
Historical records and current distribution
Leadbeater’s Possum was first described in 1867 (McCoy 1867) from two specimens
collected along the banks of the Bass River (which rises to 280m above sea level
(ASL)) in Western Port, although its exact collection location has not been documented
(Fleay 1933, Brazenor 1946). Two more specimens were collected in the early 20th
century, one from the Bass area, and one from Tynong North at the northern edge of the
Koo-Wee-Rup swamp (20m ASL), which covered much of the Western Port catchment
coastal plains and was drained not long after (Brazenor 1946, Smales 1994, Yugovic
and Mitchell 2006). These four specimens are the only representative samples from the
now-extinct lowland coastal population.
In 1932, Brazenor identified a fifth specimen in the museum collection, which had been
previously overlooked. This animal was recorded as being collected from Sunnyside,
Mt Wills in northeast Victoria, approximately 250 km from the Bass River area
(Brazenor 1946, Wilkinson 1961). Although numerous searches of the region were
undertaken (Brazenor 1931) no evidence was ever found of the existence of a
population in this area. No other sightings were ever recorded and in 1960, the species
was pronounced “certainly, or almost certainly extinct” (Calaby 1960).
In 1961, the species was rediscovered in the central highlands of Victoria during a
mammal survey at Tommy's Bend, near Cambarville (Brazenor 1946, Wilkinson 1961).
13
Thirty years later, over 160 records had accumulated from locations scattered across the
central highlands, varying in altitude between 440-1180m ASL (Lindenmayer et al.
1989, Lindenmayer et al. 1991). Virtually all records were made in ash-type wet
sclerophyll montane habitats. The current core range of the species is an 80 x 60km
region of montane forest extending from the upper Western Port catchment near
Gembrook (Loyn and McNabb 1982) to Rubicon and Taggerty in north (Lindenmayer
et al. 1991), and from Toolangi in the west to the south-east between Noojee and
Matlock (Lindenmayer 1996). Within this core range, the species occurs at low densities
and is patchily distributed.
Two populations have been discovered in the last 30 years that do not occur in ash-type
habitat. The first was discovered in 1986 at Yellingbo Nature Conservation Reserve on
Cockatoo Creek (Smales 1994), approximately 50km east of Melbourne and only 17km
from the nearest record of the species in montane ash (Harley et al. 2005). The second
population was discovered in 1994 in sub-alpine woodland at the popular ski resort of
Lake Mountain, 80km north-east of Melbourne (Jelinek et al. 1995) and approximately
10km north of Cambarville (site of the first intensive field study on the ecology of the
species).
Habitat and resource requirements
The montane ash forests of the central highlands contain virtually all records of
Leadbeater's possum in the wild (Lindenmayer et al. 1991). Montane ash refers to
temperate sclerophyllous forests dominated by Mountain Ash Eucalyptus regnans,
Alpine Ash E. delegatensis and/or Shining Gum E. nitrens (Lindenmayer et al. 1991).
The species is most abundant in ash habitat with a structurally complex understorey of
Acacia, namely Silver Wattle Acacia dealbata, Mountain Hickory Wattle A.
obliquinervia and/or Blackwood A. melanoxylon (Smith 1980, Smith 1984a,
Lindenmayer et al. 1991, Macfarlane and Seebeck 1991, Lindenmayer 2000).
The key component of the possum’s preferred habitat is mature hollow-bearing ash
trees, usually greater than 200 years old (Gibbons and Lindenmayer 2002). A dense
understorey of Acacia provides an interconnected structural layer used for nocturnal
movement as well as providing essential foraging habitat. An intensive field study at
Cambarville found that possums incised grooves in the bark of Acacia trunks to induce
the flow of energy-rich exudates (Smith 1984a). They also fed upon arthropods such as
14
tree crickets, which live under the decorticating bark of ash trees, and eucalypt-
associated products such as the flowers of Mountain Ash, manna and lerps (Smith
1984a).
Yellingbo Conservation Nature Reserve and Lake Mountain alpine resort
The populations at Yellingbo and Lake Mountain constitute atypical records of the
species, in that they occur outside the bioclimatic range that is thought to best predict
the presence / absence of the species within the central highlands. Yellingbo is lowland
swamp habitat (110m ASL) dominated by Mountain Swamp Gum Eucalytpus
camphora with tea-tree (Melaleuca spp. and paperbark (Leptospermum spp.) in the
middlestorey. The long-term viability of this population is questionable due to
suspected inbreeding as a function of its small size and its complete geographic
isolation from the rest of the species. At this site, possums reside in a riparian reserve
that is surrounded by a hostile matrix of mixed land-uses including livestock grazing
and urban development (Harley 2005).
The population at Lake Mountain occurs in Snow Gum E. pauciflora, on the sub-alpine
plateau (1100-1450m ASL). Habitat on the plateau is typically dominated by (often
open) Snow Gum woodland with Leptospermum grandifolium and Nothofagus
cunningham thickets occurring along drainage lines (Harley 2007). The plateau is
fringed by Alpine Ash forest, which tends to start abruptly at the Snow Gum edge,
usually below 1400m.
Yellingbo and Lake Mountain are atypical in two respects. First, they lack the key
habitat components identified as being important for Leadbeater's possum in ash-type
forest, namely large hollow-bearing trees and Acacia. Second, the majority of the
population currently resides in artificial nesting hollows (nest boxes). While these two
factors mean that each population is not necessarily a good representative of the rest of
the species, they are nevertheless extremely important in their contribution to the
species' reproductive output and potentially to meta-population genetic diversity. This
latter possibility is explored in detail in this study.
15
Life history
The social ecology of Leadbeater's possum has been studied in detail at two sites. The
first is within the central highlands of Victoria, at Cambarville (Smith 1980,
Lindenmayer and Meggs 1996). The population there resided in natural nesting hollows
and was monitored intensively between 1978 and 1979 and again in 1990 -1991.
Possums were trapped near den entrances and either fitted with reflective ear tags to
enable individual identification with spotlights (earlier study) or fitted with radio-collars
(later study). The second study was conducted at Yellingbo (Harley 2005). Most of the
population makes ready use of nest boxes, allowing relatively easy access to
individuals, which were closely monitored between 1996 and 2003.
Leadbeater's possum are colonial, denning together in groups of related individuals.
Based on detailed trapping data, it is proposed that these groups, or breeding colonies,
are typically composed of a single dominant breeding pair with one or more of their
juvenile or sub-adult offspring (Smith 1980). Additional adults (usually males) are often
encountered and are assumed to be the matured offspring of the breeding pair in the
colony (Smith 1980, Lindenmayer and Meggs 1996, Harley 2005). Only rarely are
additional adult females present in the colonies and are almost never found to be
breeding (Smith 1980, Harley 2005).
Breeding is inferred from a suite of characteristics, which include obvious signs such as
lactation and the presence of pouch young, tail base staining, and discoloration of pouch
and scrotal fur (Smith 1980, Harley 2005). Tail base staining is the result of mutual tail
licking by the breeding pair (Smith 1980). This staining has been observed in pairs in
captivity and in wild possums denning in tree hollows (Smith 1980) and in nest boxes
(Harley 2005, this study), and is in field studies used to infer reproductive activity.
Previously parous females have a stained and stretched pouch, and if lactating,
obviously elongated teats (Harley 2005). Reproductively active males have dark
staining of the scrotal fur, which is a distinct yellow-orange colour (Harley 2005).
Leadbeater's possum are considered monogamous (Smith 1980, Smith 1984b, Harley
2005, Harley and Lill 2007). The observation of only a single reproductively active pair
of adults is present in a colony, is central to inferences of monogamy in this species
(Smith 1980, Harley and Lill 2007). These inferences were originally based upon
16
observations of mating in captivity and mating behaviours (mutual tail licking between
mated pair) in both captive and wild animals (Smith 1980).
Breeding was found to occur all year round at Yellingbo (Harley and Lill 2007). At
Cambarville, breeding was concentrated in the months of April to June and October to
December. The average number of litters produced per year is three (Smith 1980,
Harley 2005). The gestation period is 15-20 days, followed by an obligatory period of
attachment to the teat of between 80 and 93 days (Smith 1980). At Yellingbo, young
weigh between 15 and 18g when they permanently leave the pouch (Harley 2005). They
may remain in the nest up to 40 days before first emerging from the den. At the time of
first emergence they are usually around 110 days old and weigh ~30g (Harley 2005).
The youngest recorded age that females commenced breeding was 18 months at
Yellingbo, and 16 months at Cambarville (Harley 2005), indicating females reach
sexual maturity before they are two years old. However, most males and females at
Yellingbo did not commence breeding until a later age (typically two years or older)
when they had emigrated from their natal colony (Harley and Lill 2007).
Information on dispersal and recolonisation is limited to a single closed system
(Yellingbo) and its value in predicting gene flow in a wider context is unassessed.
Estimates of dispersal distances were obtained by radio tracking and recapturing
possums at Yellingbo (Harley 2005). Males tended to disperse more frequently than
females, but the average dispersal distances were similar, 480m for males and 450m for
females (Harley 2002). The maximum distance any individual dispersed at Yellingbo
was less than 1.5km and was considered the exception rather than the rule. As the
population is effectively isolated by a lack of connecting vegetation beyond the riparian
swamp and its immediate adjoining woodland, dispersal beyond the reserve is presumed
to be extremely limited. In his field studies at Cambarville, Smith (1980) was unable to
obtain any detailed information about dispersal distances owing to the extreme
difficulty in trapping and tracking possums in dense ash forests.
Conservation issues
Leadbeater's possum is most notable as Victoria’s faunal emblem. Nevertheless, it is
listed as endangered under international (IUCN 2006: www.iucnredlist.org), Australian
Federal Government (EPBC Act 1999: Department of Environment and Heritage,
17
Australian Government) and Victorian State Government legislation (Flora and Fauna
Guarantee Act 1988: Department of Sustainability and Environment).
Detailed field surveys, species' presence records and statistical modelling have
identified mature ash eucalypt trees as an important component of the possum’s
preferred habitat in the central highlands (Lindenmayer and Possingham 1996). The
majority of suitable and / or occupied montane ash habitat coincides with timber and
pulpwood production activities, as the bioclimatic conditions that are suitable for the
species also promote good growth rates for eucalypts (Lindenmayer 2000). Current
management prescriptions have a rotation time of 80 years, which is insufficient for the
development of hollows in Mountain Ash. Furthermore, many existing hollow-bearing
trees are either decaying or dead, largely as a result of the 1939 wildfire that burnt much
of the central highlands of Victoria. These trees are collapsing at a rate of ~3.5% per
annum (on the basis of data collection in the period 1983 to 1988; Lindenmayer et al.
1990). Therefore, suitable hollow-bearing trees are being lost faster than they are being
replaced, which is predicted to result in up to a 90% decline on the species abundance
within ash-type forest by 2020 (Smith et al. 1985, Lindenmayer 2000). Current
conservation efforts involve protection of remaining old-growth stands, and
maintenance of younger stands that are allowed to attain hollow-bearing age
(Macfarlane and Seebeck 1991). Such stands are comparatively rare within the central
highlands, and hence, the species faces an imminent habitat crisis as mature trees are
lost and not replaced.
The current population size of Leadbeater's possum in ash-type forests may be as low as
2500, based on extensive long-term monitoring data from 160 sites (Lindenmayer et al.
2003a). These same monitoring programs have detected a decline in abundance
(Lindenmayer et al. pers. comm.) concordant with the loss of large hollow-bearing trees.
A captive breeding program was established at Melbourne Zoo in 1981 from 10 wild-
caught possums that had been housed in a private residence in Blackburn, Melbourne
(1995 Studbook, P. Myroniuk). The breeding program ran successfully at Melbourne
Zoo and produced a surplus of individuals. Some of these were translocated to several
other international and national zoos, including Taronga Zoo in Sydney and Healesville
Sanctuary, to establish new breeding colonies. Collectively, these colonies were
intended to maintain a stable captive-breeding population of the species for community
18
education and research purposes (Macfarlane et al. 1995). In 2006, the last possum in
captivity in Australia died. There do not appear to be any plans to re-establish the
breeding program.
Population genetics as a tool for conservation
Population genetic analyses have become increasingly popular in conservation research
in recent decades. The advent of polymerase chain reaction (PCR) to amplify segments
of DNA from a small number of genome copies and the development of rapid, routine
screening protocols in laboratories has enabled many researchers to make use of
molecular genetic tools in diverse areas of biology (Sunnucks 2000). Single-locus
molecular markers are commonly employed and include microsatellites (short tandem
repeats), allozymes and SNPs (single nucleotide polymorphisms). Also commonly
utilised are sequence data from the mitochondrial genome (which is maternally
inherited, allowing tracking of maternal lineages). Hypervariable co-dominant neutral
markers like microsatellites have widespread application in conservation biology for the
purposes of elucidating cryptic population processes (Taylor et al. 1994, Piertney et al.
1998, Beaumont 1999, Eldridge et al. 1999, Banks et al. 2005, Lambert et al. 2005,
Piggott et al. 2006, Lada et al. 2008). There is much discussion in the literature
concerning available molecular markers and their application to conservation biology
(Sunnucks 2000, Manel et al. 2003, Selkoe and Toonen 2006) and therefore details are
not presented here.
Genetic variability underpins a population’s capacity to adapt to disturbance and
changing environments. It is a crucial component of biodiversity (Banks and Taylor
2004) and the erosion of genetic diversity can lead to deleterious effects like inbreeding
(Taylor 2003), reduced reproductive capacity, loss of evolutionary potential, and at the
extreme, local extinction (Frankham 2005). The identification of populations at risk is
important for managing threatened or range-restricted species. In particular, populations
representing historically isolated lineages should be afforded special protection, as they
cannot be recovered (Moritz 2002).
Molecular genetics is an important tool in biodiversity conservation. It enables
identification of populations of significance (management units or evolutionary
significant units; Moritz 1995). It can be used to identify population structure for the
purpose of defining population boundaries / limits (Banks and Taylor 2004).
19
Populations at risk from inbreeding may only be identifiable with molecular marker
analyses (Saccheri et al. 1998, Eldridge et al. 1999). Regions / populations containing
high levels of genetic diversity important to species persistence, can be readily
identified and prioritised (Houlden et al. 1996, Kraaijeveld-Smit et al. 2005). At a
smaller scale, information about cryptic and difficult to study species is more easily
obtained using remote techniques such as non-invasive faecal or hair sampling (Piggott
et al. 2006, Walker et al. 2006). Life history strategies, for example mating systems and
dispersal, may be inferred from genetic analysis where field observations fail to produce
reliable estimates, often for logistical reasons (Pope 1992, Dobson 1998, Ross 2001,
Banks et al. 2005, Handley and Perrin 2007, Kendal 2008). It is therefore highly
desirable to incorporate information from genetic studies into management plans and
translate those plans into conservation actions in Australia (Banks and Taylor 2004).
Application of genetic marker analysis to Leadbeater's possum conservation
Due to the cryptic nature of Leadbeater's possum, molecular genetics can contribute
much to our understanding of the population processes of this species that otherwise
would not be obvious from field observations alone. Population viability analyses
(PVA; Lindenmayer and Lacy 1995, Lindenmayer and Possingham 1996) have
identified two key areas of missing information necessary to assess extinction risk for
the species: 1) its ability to recolonise logged and regenerated forest, and 2) its dispersal
capabilities. In montane ash forest, only limited dispersal information has been collected
from radio-tracking studies (Smith 1980, Lindenmayer and Meggs 1996). These studies
highlighted the importance of a better understanding of general life-history parameters
such as the mating system. In particular, the spatial distribution of breeding colonies
was considered critical for management of the species in ash forest, because, at the time
of the radio tracking study, timber harvesting activities were prohibited within 50m of
sightings of the species (Lindenmayer and Meggs 1996). Genetic analysis can provide
more detailed information on kin group sizes, dispersal and recolonisation capability,
and has the advantage of only needing a single encounter with an individual to gather
the equivalent or greater amount of information that potentially takes months of radio-
tracking to obtain.
Leadbeater's possum are notoriously difficult to sample in the wild. Information for
managing populations in ash-type forest currently relies largely on survey data alone,
and information gained from captures is virtually confined to the single study at
20
Cambarville (Smith 1980). Possums rarely enter traps and tracking of animals through
ash habitat, using either spotlighting or radio tracking, is extremely difficult owing to
the complexity of the habitat, the height of the vegetation and speed that possums move
through the middlestorey (Smith 1980, Lindenmayer 1996, Lindenmayer and Meggs
1996). The only way to reliably capture individuals is by installing artificial nesting
hollows and monitoring their use over time (Harley 2004a). As possums tend to use nest
boxes only when there is a paucity of natural den sites (Lindenmayer et al. 2003b,
Harley 2004a), this approach will necessarily be limited to habitats lacking sufficient
large hollow-bearing trees. However, this means that a population largely residing in
nest boxes will provide the best opportunity for collection of any detailed social and
genetic data. The degree to which ecological inferences from nest box studies can be
considered to represent the natural ecology of this species remains to be empirically
tested, although it is highly probable that such testing will never be possible owing to
the extremely low success rate of trapping and radiotracking (Smith 1984b,
Lindenmayer and Meggs 1996). Given that the results from two different ecological
studies (Yellingbo and Cambarville) produced similar mating systems results, the
reliance on population inferences from a nest box system is probably not unfounded.
Genetic analysis of field populations
In this study, I have made use of two large (>150 individuals) populations that use nest
boxes, Yellingbo and Lake Mountain. In addition, a collection of opportunistically
obtained samples from four other locations within the central highlands - Cambarville,
Mt Margaret, Powelltown and Toolangi - was made available (Lindenmayer and Meggs
1996). Genetic analysis of short-term population processes (using microsatellites) and
medium-term population processes (using mitochondrial control region sequences) were
conducted to elucidate current population structure and infer past changes in population
size and distribution.
Sampling of Leadbeater's possum at Lake Mountain was initiated during this study.
Three visits over a 12 month period (2006 to 2007) produced samples from most
breeding colonies residing in nest boxes installed on the sub-alpine plateau (Harley
2007). These samples were analysed in conjunction with concurrently collected
information on colony composition.
21
Genetic sampling of the population at Yellingbo was done during an earlier intensive
ecological study there between 1996 and 2003 (Harley 2005). The date on which each
individual was sexed, aged and genetically sampled was available from these field
studies. However, information on exact age and weight of each individual at first
encounter (which is not always the same date as first genetic sampling), and information
on recapture histories for each individual is not in an accessible format (for example an
electronic database), and hence has only been partially available for this study.
Therefore, the majority of results obtained using genetic analysis presented here make
inferences about population ecology and biology in the absence of complementary field
data.
22
Intended management applications
This study was conducted with the intention of supplementing information obtained
through detailed field studies on population processes and biology of Leadbeater's
possum. Its ultimate application is a considered synthesis of relevant findings for
contribution to the Leadbeater's Possum Flora and Fauna Guarantee Action Statement.
The current Action Statement was written in 1995, and has been identified by the
Department of Sustainability and Environment (DSE) as outdated. In particular, DSE
has highlighted the need to incorporate genetic information on the species into
management recommendations (L. Brook, DSE, pers. comm.). The new action
statement is in the initial stages of preparation by DSE staff and is intended for
reviewing by the Leadbeater's Possum Recovery Plan steering committee in winter
2008.
Thesis outline and the aims of the study
This thesis is constructed as a group of stand alone papers (either published, in review
or in preparation for publication) and is largely presented in that format, with the
abstract and acknowledgements removed (except in the case of Chapter 5). All
references are placed in a reference list at the end of the thesis. Chapter 2 (published in
Molecular Ecology Notes) details the development of microsatellite genetic markers for
Leadbeater's possum. Chapter 3 (published in Molecular Ecology) uses a simulation
approach to elucidate the provenance of the population at Yellingbo on the basis of
microsatellite genotypes. Chapter 4 (in revision for Molecular Ecology) provides a
detailed analysis of past and present genetic structure for all population samples using
both microsatellite and mitochondrial DNA. In addition, it explores historic
phylogenetic affinities of samples from the Western Port region using mitochondrial
sequence data obtained from the four museum specimens collected prior to the
extinction of the population/s there. Chapter 5 (for submission to Journal of
Mammalogy) investigates population sub-structure at Yellingbo and Lake Mountain,
and contains a detailed analysis of parentage and the mating system at those sites. The
final discussion chapter summarises the findings and management implications of this
study. It is written as a contribution to the updated Leadbeater's Possum Flora and
Fauna Guarantee Action Statement. It is therefore structured for direct incorporation
into the new action statement and is written in a management style with the intention of
making it accessible to industry and government organisations. The reader is
23
recommended to view the current (1995) action statement, which is available on the
web at http://www.dse.vic.gov.au.
The aims of this study were to:
1. Investigate meta-population patterns of microsatellite diversity and the extent of
recent gene flow among sampled central highlands populations and the isolated
population at Yellingbo.
2. Test for a recent reduction in population size at Yellingbo, indicative of a genetic
bottleneck. Patterns in recent population process were compared to Lake Mountain,
which is hypothesised to be non-bottlenecked owing to its location within
continuous montane forest.
3. Elucidate the origin of the population at Yellingbo by bottleneck simulation. This
was done to address the alternative hypotheses that (a) Yellingbo is an isolated
remnant of the central highlands, or (b) that Yellingbo exits as a result of a recent
un-recorded introduction event.
4. Investigate patterns of mitochondrial control region sequence variation in extant and
extinct populations, and to determine the relative time that Yellingbo has been
separated from the central highlands.
5. Test for past changes in population size within the central highlands that might
indicate population growth or decline.
6. Investigate fine-scale genetic structure at Yellingbo and Lake Mountain.
7. Investigate the mating system at Lake Mountain and Yellingbo, and to test the
theory of monogamy in this species. In doing so, breeding and social dynamics can
be identified that will be potentially important to the structuring and distribution of
extant populations within the central highlands.
8. Contribute data and recommendations to ongoing conservation management plans
for this species.
25
Chapter Two A set of microsatellite markers for an endangered
arboreal marsupial, Leadbeater’s possum. Leadbeater's possum (Gymnobelideus leadbeateri, Petauridae) is popularly known as
Victoria’s faunal emblem. Historically, it was distributed throughout the Great Dividing
Range into southern New South Wales and within coastal swampland near Western Port
Bay (Brazenor 1962, Harley 2004b). Sadly, it is now restricted to a small region of the
state centred on the ash forests of the central highlands. As with so many other native
species world wide, Leadbeater's possum has suffered a large scale reduction in range
and numbers due partly to long term climate change (Harley 2004b) and partly to
anthropogenic influences, namely land clearing for timber production and agriculture. In
particular, the Victorian central highlands is largely comprised of state forest designated
for timber production. Clear felling and salvage logging operations have had a
significant impact on the available habitat within the highlands (Macfarlane and
Seebeck 1991). In addition, the possum is further restricted by its reliance on large
hollow bearing ash trees for nesting and an Acacia-dominated undergrowth for foraging
(Smith and Lindenmayer 1988). Leadbeater's possum is now only found in a number of
small populations within pockets of suitable ash habitat in the highlands, and in an
isolated swamp at Yellingbo on the fringe of the highlands.
Concerns about fragmentation effects on populations within the highlands and
inbreeding at Yellingbo, has led to the collection of genetic material from animals at
those regions. From these samples we have developed a panel of polymorphic
microsatellite markers to enable us to investigate inbreeding, interpopulation divergence
and intrapopulation diversity, and to analyse where possible parentage, dispersal and the
finer aspects of the possum’s social system.
Whole genomic DNA was extracted from either ear biopsies according to the salting out
protocol of Sunnucks & Hales (1996), or from blood samples using a DNeasyTM Tissue
Kit (Qiagen GmbH, Germany) according to the manufacturer’s protocol for animal
blood. 10µg gDNA was digested with HaeIII, RsaI and AluI. A microsatellite-enriched
genomic library was constructed from size-selected DNA (300-700bp) and screened
according to Taylor et al. (1994). Simultaneous probing with copolymers CA and GA
(Boehringer, Pharmacia) revealed 45 putative positive clones. Clones (50ng plasmid)
26
were PCR screened in a 20µL reaction using 20pmole of each primer M13 (-20)
(GTAAAACGACGGCCAGT) and M13 pUC (-40) (CAGGAAACAGCTATGAC) with 20mM
Tris-HCl, 100mM KCl, 1.6% Nonidet P40, 4mM MgCL2, 0.4mM of each dNTP and 2U
Taq DNA polymerase (MBI Fermentas, MD). PCR products were isolated using a glass
beads purification kit according to the manufacturer’s protocol (Mobio, CA) and
sequenced by Macrogen (Seoul, Korea) using the same primers on an ABI sequencer.
Mono/polynucleotide repeats were identified in 25 clones and primers were designed to
span the repeat region of each clone using the web-based program Primer3
(http://frodo.wi.mit.edu/cgi-bin/primer3).
Primers were tested for amplification using a gradient (45-65oC) cycling PCR program
on an Eppendorf Gradient MasterCycler. PCR cycling conditions were determined
according to the optimum amplification temperature revealed by the gradient program.
Polymorphisms at most loci were tested for using ‘touchdown’ PCR cycling for 30 to
40 cycles (see Table 1). 2µL of template gDNA was amplified with 5pmole of each
primer pair in 10µL PCR reaction using 75mM Tris-HCl, 20mM (NH4)2SO4), 0.01%
Tween 20, 2.5mM MgCL2 (or 2mM depending on the locus, see Table 1), 0.2mM each
of dCTP, dGTP and dTTP, 0.02mM dATP (or 0.125mM & 0.0125mM, respectively
depending on the locus, see Table 1), 0.1% Bovine Serum Albumin (Panvera, Madison),
0.2U Taq DNA polymerase (MBI Fermentas) and 0.02µL [α33P]-dATP (10mCi/mL,
Perkin Elmer). PCR products were resolved on denaturing polyacrylamide gels with an
A- or T-terminating M13 control sequencing reaction size marker, and visualised by
autoradiography. A total of 17 polymorphic loci were identified. A total of 236 animals
(representing 5 populations) were genotyped for each locus, 56 of these were known
females and 93 known males. Heterozygotes were observed in both sexes at each locus,
suggesting that none are X-linked. Genotype frequencies of the Lake Mountain sample
(the largest non-isolated population, n=24) were tested for conformance to Hardy-
Weinberg expectation using exact tests implemented in GENEPOP 3.2 (Raymond and
Rousset 1995). One locus (GL35) displayed a highly significant heterozygote deficit
(p<0.0001). However, a similar deficiency at this locus was not observed in any other
population. Four loci pairs showed significant linkage disequilibrium after a Bonferroni
correction for multiple tests. These were GL28/GL17, GL6/GL28, GL4/GL28 and
GL13/GL44 (all p<0.00013±0.00013).
27
Amplification of these loci in four other petaurid species (the striped possum
Dactylopsila trivirgata, the sugar glider Petaurus breviceps, the squirrel glider P.
norfolcensis and the mahogany glider P. gracilis) was not very successful and little
polymorphism was evident (see Table 2). This is not unexpected given that G.
leadbeateri is thought to have diverged from other petaurids as long ago as 32 million
years, and that other available petaurid primers hybridise to only a limited degree in G.
leadbeateri (Edwards and Westerman 1992, Hansen et al. 2003).
Preliminary analyses have revealed a very high level of genetic diversity in animals
from populations in the central highlands, suggesting these populations are probably not
isolated and / or have not experienced genetic drift. However, allelic diversity is very
low within the Yellingbo population, suggesting the population may be highly inbred.
Whether this is the result of long-term isolation of the Yellingbo population or a more
recent bottleneck will be the subject of future analyses.
28
Table 1
Details of the 17 Leadbeater's possum microsatellite loci. ‘Touchdown’ cycling is
indicated by a temperature range, for example 55-47oC
Locus
name
Sequence 5’→3’ Repeat Allele size
range (bp)
No.
alleles
TA (oC) GenBank
Accession
no.
HE/HO
GL7 tcaaatctggcctcagatacc (CA)7 (AC)12 126-138 8 60 AY884070 0.66/0.66 ggggaaagttgggtaattgg GL4 atggagaggtgatgggtgac (CA)21 180-200 10 55→47 AY884071 0.85/0.88 atttccccacgagccatatc GL13† cacattctctgggattctgc (CA)20 154-176 8 62→55 AY884072 0.85/0.83 aagagccttgggttcatgc GL38* tatccccagccctaagcac (TTTA)3 (TC)30 179-198 13 55→47 AY884073 0.81/0.71 ctccaattccatcctgtcatc GL6 gaccctctcccctttctttg (AC)15 244-256 8 65→60 AY884074 0.80/0.71 cactcccagcgggtaagag GL35 acaatttgcccaggtttcag (TC)8 183-217 9 60 AY884075 0.70/0.33 ctttatcacgaccctgtaaaacg GL5A tgcagggaaccatacagaac (AC)14 236-252 8 55→47 AY884076 0.86/0.70 agagttctctcatccacaagagg GL26** gagcactggcacttgagacc (AC)23 116-146 11 55→47 AY884077 0.87/0.71 attggggaaaaaggacttgc GL28† gagtggggtcatgagaatactg (TG)22 (CT)8 158-192 11 65 AY884078 0.88/0.88 ctccaattgccctgccttc GL33 ggagctcaatcccaagtctg (AC)10 161-203 9 62→55 AY884079 0.76/0.71 ggagcaggagaaggtcagg GL39 tgatatttgtctcacaaagttgc (TC)24 (TTGA)6 209-223 10 62→55 AY884080 0.82/0.96 tggctctattattgcagcctaag GL44 tgactcagtaagaaaatggtg (CCT)7 (TTC)24 144-252 18 62→55 AY884081 0.90/0.79 acgtatacaacacttttcaaatc GL24 cctccctcctccctcatc (CA)14 111-133 6 58→53 AY884082 0.78/0.79 ggaatctgggcaggaagaac GL42 ggatatgaatttagacagattggac (TC)19 158-174 8 62→55 AY884083 0.77/0.71 ttctggctggggtactgttc GL19B gatatgaaaaggggcaccag (TC)30 (CCTT)11 239-277 17 65→60 AY884084 0.94/0.82 ccatcccctacaagaaagacag GL17 tgctgatcacatgggtttttag (CT)10 †† 130-150 6 55→47 AY884085 0.81/0.79 gctattgaaaggggtgttgc GL27B† tagccggttacctggttcag (CA)34 117-141 12 65→60 AY884086 0.89/0.96 gagaactcactgcgggagag * alleles at this locus were separated by multiples of either 1 or 2 base pairs, the most common alleles
being 180, 183, 185 and 186.
† these loci where amplified using a lower concentration of MgCL2 and dNTPs
†† The complete repeat region was: (CT)10 TT (CTCTCTGT)2 (CTCTGT)2 (CTCTCTGT) (CT)5 (C)11.
Odd and even alleles were amplified in all populations, the most common being 134, 135 and 136
29
Table 2
Details of cross-hybridisation of G. leadbeateri microsatellites in other petaurid
species. Loci not included did not amplify in any other species. ‘P’ indicates the
locus was polymorphic. ‘M’ indicates the locus was monomorphic. ‘N’ indicates no
PCR amplification for that species. Details of cycling conditions are in parentheses,
followed by sample size/number of alleles/size range
Locus name D. trivirgata P. breviceps P. norfolcensis P. gracilis
GL33 P (62→55) P (62→55) P (62→55) P (62→55) 15/6/173-189 8/4/163-177 8/6/171-191 4/4/165-199
GL5A N P (55→47) P (55→47) P (55→47) 8/7/242-264 8/3/254-264 8/5/256-264
GL38 P (55→47) N N N 8/6/141-155
GL7 P (60) P (60) P (60) P (60) 4/3/114-128 4/3/122-130 4/4/114-126 4/3/116-124
GL13 P (62→55) P (62→55) P (62→55) P (62→55) 8/6/190-206 8/6/176-196 8/3/168-194 8/2/188&192
GL42 P (55→47) P (55→47) N N 13/9/156-184 8/7/234-288
GL24 P (58→53) M M M 8/3/129-135
GL27B P (65→60) P (65→60) P (65→60) P (65→60) 2/2/111&121 4/4/113-135 4/7/149-213 3/3/147-157
GL17 P (55→47) P (55→47) P (55→47) P (55→47) 5/2/130&148 6/2/136&150 5/2/136&150 4/2/136&150
31
Addendum to Thesis Chapter Three Since production of this thesis in June 2008, Chapter Three has been published in
Molecular Ecology (17, 4039-4052). Major changes to the chapter for
publication are the expansion of the M ratio analyses, removal of the RST
analyses, display of the results of the STRUCTURE analyses in tabulated format,
placement of Figure 4 in the Appendices and editing of the final discussion
paragraph to draw conclusions about the potential utility of the methodology
used in this chapter.
32
Chapter Three Isolated remnant or recent introduction?
Estimating the provenance of Yellingbo Leadbeater’s possums by
genetic analysis and bottleneck simulation.
Introduction
The decline of native species is almost always attributable to degradation and
fragmentation of habitat, introduction of exotic competitors and predators and /
or disease. If a threatened species suffers through loss of habitat or the
introduction of non-native competitors, information on the evolutionary history
of populations of that species may be important in guiding management
programs. In the case of some threatened Australian fauna introduced to regions
outside their native range information on the source of introduced animals is
important for guiding re-introduction programs (Taylor and Cooper 2000,
Eldridge et al. 2001). With the refinement and application of population genetic
techniques to conservation, it is possible to investigate these scenarios using
molecular markers such as microsatellites. Here we apply this approach to
Leadbeater's possum, a threatened Australian endemic, in order to elucidate the
ancestry of a population with a questionable genetic and demographic history.
Leadbeater's possum (Gymnobelideus leadbeateri) is most notable for its status
as Victoria’s faunal emblem, but this status has not prevented a widespread
decline in its range since European colonisation. It was first described in the late
19th century from two specimens collected near Bass in the Western Port region
along Victoria’s coast (Brazenor 1962) (Figure 1). Only four records from
Western Port were ever made and by the mid-20th century it was presumed
extinct. The species was subsequently re-discovered in 1961 in the montane
habitats of Victoria’s Central Highlands (Wilkinson 1961) (Figure 1). Since that
time the species has been found in a variety of locations throughout the
highlands, although patchily distributed and at low densities. The habitat at these
locations is characterised by montane ash forest with large, hollow-bearing trees
and a complex understory of Acacia (Lindenmayer et al. 1989, Lindenmayer et
al. 1991, Lindenmayer and Possingham 1995). The distribution of G. leadbeateri
in the central highlands is restricted by the availability of trees of suitable age
33
and size for provision of nesting hollows (Smith and Lindenmayer 1988). This is
seen as a major conservation issue, as suitable nesting trees are either being
felled for timber, succumbing to post-logging fire operations, or collapsing due
to wildfire-induced decay (Macfarlane and Seebeck 1991, Lindenmayer 2000).
In 1986, a small, geographically isolated population of G. leadbeateri was
discovered in lowland swamp near Yellingbo, some 50km east of Melbourne
(Smales 1994), 16km from the nearest known Central Highlands population
(Harley 2004b) and approximately 70km north of Bass Valley in Western Port.
The population is restricted to a narrow, linear reserve located within an
agricultural landscape. The high rate of occupancy of most available artificial
denning sites (85% in suitable habitat; Harley 2005) suggests the population is at
carrying capacity. The local rarity of suitable unoccupied habitat, the absence of
corridors for movement between Yellingbo and the highlands (Harley 2005), and
the low average dispersal distance of individuals - between 450 and 500 metres
at this site, with the maximum being 1.5km (Harley 2002) - suggest it is highly
unlikely that Yellingbo exchanges migrants with highlands populations.
The unexpected discovery of a successfully breeding population in lowland
swamp changed the perspective on the conservation priorities of this rare species.
The habitat at Yellingbo is clearly deficient in large hollow-bearing ash trees and
the possum’s major food source, Acacia spp. (Smith 1984a). Furthermore,
animals readily occupy nest boxes (Harley 2002, Harley 2005), which attests to
the lack of natural denning sites upon which they are so reliant in the highlands.
These floristic and vegetation structure differences between Yellingbo and
montane ash habitats have led to speculation that the population was not a natural
remnant but had been introduced there. Such speculation was fuelled by rumours
that some animals from a private captive population, most of which were
ultimately housed at Melbourne Zoo, had been released at Yellingbo (Harley
2006).
The captive population was originally sourced from multiple locations within the
highlands. A breeding program was initiated at Melbourne Zoo in 1970, and
animals were subsequently transferred to establish breeding colonies at other
zoos / sanctuaries. Captive populations have since declined and have not been
34
replenished. The future outlook for G. leadbeateri in the wild is grim, with a
90% extinction probability predicted by 2025 (Smith et al. 1985). Thus the re-
establishment of captive populations and a translocation program, are high
priority short -term conservation priorities. The population at Yellingbo is a
potential source of animals for both conservation options due to its successful
breeding and apparent saturation of the available habitat. However, if the
population at Yellingbo is a long-term and locally-adapted isolate from those in
the highlands, then it may be inappropriate to mix them. Such a course of action
may result in loss of local adaptation (Frankham 2005) and/or outbreeding
depression (by mixing of genomes adapted to different environments; Marshall
and Spalton 2000).
Here we use microsatellite genetic variation to address the hypothesis that the
Yellingbo population is the result of a recent introduction rather than being a
natural remnant. Whether the population is introduced or remnant, it may
harbour reduced genetic diversity, because of a recent founder effect or long-
term isolation and small size, respectively. Thus genetic diversity per se will not
allow us to distinguish between these two scenarios. However, analysis of
experimentally bottlenecked populations of Drosophila melanogaster (England
1998, England et al. 2003) showed that intense (small number of animals for
brief periods) and diffuse (larger numbers for longer periods) bottlenecks
produced measurable differences in a variety of alternative genetic signatures.
We here apply these tests to microsatellite data from Yellingbo, to assess
whether they indicate an intense or diffuse bottleneck, which would mimic
introduction and remnant scenarios, respectively. In addition we utilise computer
simulations to produce artificial gene pools resulting from a variety of bottleneck
scenarios applied to potential source populations (wild central highlands
populations or captive colonies). We then assess whether simulated bottlenecks
produce populations with genetic characteristics (genotypic structure and allele
frequencies) resembling those observed at Yellingbo by using statistics that
describe differences in allelic frequencies.
35
Materials and Methods
Sample collection and microsatellite genotyping
Leadbeater's possum blood and ear biopsy samples were collected from animals
captured during previous studies at five locations within Victoria’s Central
Highlands: Cambarville (n=7), Lake Mountain (n=3), Mt Margaret (n=3),
Powelltown (n=4) and Toolangi (n=2), and at a sixth location, Yellingbo (n=11)
(Lindemayer and Meggs 1996, D. Lindenmayer pers. comm.). In addition to
these samples collected in earlier studies, ear clip samples were also taken from
adults and immature animals residing in nest boxes at Lake Mountain (n=159).
Ear clip samples were taken from all animals representing multiple cohorts of
adults and offspring, captured at Yellingbo (n=187) as part of an intensive
ecological study between 1996 and 2001 (Harley 2005). Blood samples were also
collected from captive animals held at Melbourne Zoo (n=19), Taronga Zoo
(Sydney) (n=7) and Healesville Sanctuary (Victoria) (n=16) (D. Lindenmayer
pers. comm.). The original colonies were established in Melbourne and
subsequent transfers of descendant individuals gave rise to new colonies at other
locations. Therefore, for the purpose of genetic analyses, all sampled captive
animals are treated as having come from a single captive population.
Whole genomic DNA was extracted from tissue samples using the salting out
protocol in Sunnucks and Hales (1996), and from blood samples using a
DNeasyTM Tissue Kit (Qiagen GmbH, Germany) according to the manufacturer’s
protocol.
All samples were genotyped using 14 polymorphic microsatellite markers
developed for G. leadbeateri (GL4, GL5A, GL6, GL7, GL13, GL19B, GL24,
GL28, GL33, GL35, GL38, GL39, GL42, GL44; Hansen et al. 2005) and one
from another petaurid, the striped possum, Dactylopsila trivirgata (DT1; Hansen
et al. 2003). Primer sequences and PCR conditions for amplification of
microsatellite markers are described in Hansen et al. (2005) except for DT1,
which was amplified using touchdown cycling from 62 to 55oC.
36
Statistical analysis of genetic diversity and structure
Standard measures of genetic diversity were obtained for the four largest
population samples (Cambarville, Lake Mountain, Yellingbo and the captive
colony). Conformance to Hardy-Weinberg expectations was tested using exact
probability tests with 10,000 permutations in GENEPOP Version 3.4 (Raymond
and Rousset 1995). Linkage disequilibrium between every pair of loci in every
population was tested in Arlequin 3.11 (Excoffier et al. 2005) at α/c
(0.05/no.loci*pops) (Quinn and Keough 2002). Pairwise population
differentiation FST were calculated in Arlequin and tested against a null
distribution obtained by permuting genotypes between populations. Pairwise RST
values were computed using Arlequin, using original allele size (and therefore
assuming a pure stepwise-mutation model). Expected heterozygosity and allelic
richness (which standardises allelic diversity by the smallest sample size) were
statistically compared using a Wilcoxon test for matched pairs.
Genotypes were analysed in STRUCTURE 2.0 (Pritchard et al. 2003), a model-
based Bayesian clustering method that identifies genetic groups and
probabilistically assigns individuals to them. The simulation was run with an
initial burn-in and thinning interval of 200,000 followed by 500,000 iterations,
for five replicates of each K from 1 to 10.
Analysis of bottlenecking patterns
A variety of genetic diversity measures was examined from the largest
populations (n>25 samples) of Lake Mountain and Yellingbo to reveal the
presence (if any) of genetic bottleneck signatures in those populations. Three
methods were used to test for bottleneck signatures in microsatellite data. The
first was the M ratio of number of alleles k divided by the allelic size range r,
averaged across all loci in each sample (Garza and Williamson 2001). This ratio
is intended to quantify gaps in the allele size frequency distribution resulting
from loss of alleles through bottlenecking. The critical value Mc for a
bottlenecked population is 0.7. Values lower than this tend to represent
populations that have experienced a recent reduction in size. Loci with alleles
that do not represent multiples of a recognised repeat unit violate the mutation
37
models upon which this method hinges (Garza and Williamson 2001) and were
not included in the simulation modelling process. On that basis GL5A, GL38 and
GL44 were removed from calculations of the M ratio.
The second method compares gene diversity excess relative to that expected if a
population were at mutation-drift equilibrium. That is, recently bottlenecked
populations lose relatively more allelic diversity than heterozygosity, which
results in a testable signal when more than 10 microsatellite loci are screened
(using the software BOTTLENECK, Cornuet and Luikart 1996). The third method
uses a Wilcoxon signed rank tests to evaluate estimators of bottleneck-induced
distortion under a two-phase mutation model (TPM). TPM settings were 90%
one-step changes (SMM) and 10% multi-step changes (after the IAM), with
estimates based on 10000 replications. BOTTLENECK also performs a qualitative
graphical assessment (“mode-shift indicator”) describing bottleneck-induced
changes in allele frequency distributions (Luikart et al. 1998). We concluded that
a bottleneck had occurred only if all three methods were in agreement.
Bottleneck simulations
Thirty-four (out of a total of 53) microsatellite alleles present at frequencies of
greater than 10% in the pooled highlands sample were absent from the large
sample taken from Yellingbo, giving a first indication that sampled highlands
populations were unlikely to have been the source of a recent Yellingbo
introduction. To investigate this more quantitatively, two simulated populations
established with the allele frequencies observed in the pooled Central Highlands
sample (all five highlands populations) and the captive colony, respectively, were
bottlenecked under various scenarios.
Bottleneck simulations were performed using modelling software, GENELOSS
(England and Osler 2001), which randomly re-samples alleles in each of a given
number of generations from replicate simulated populations created from starting
allele frequencies. GENELOSS reports, per locus, the proportion of (in this case
1000) replicate bottlenecks in which a given allele is retained, as well as mean
observed heterozygosity and the mean number of alleles per locus retained
(allelic diversity).
38
Two levels of bottleneck intensity were simulated for each of the two source
populations: intense (2 breeding pairs, that is, eight randomly-chosen alleles -
each generation) and diffuse (50 breeding pairs each generation) (after England
1998). One generation was defined as two years, which is equivalent to the age at
first breeding in this species (Lindenmayer and Lacy 1995, Harley 2005).
Duration of simulated bottlenecks were 1, 5, 10 and 50 generations. One
generation was intended to represent a single founder event (introduction) of
brief duration. Five generations (10 years) would be the maximum bottleneck
duration that could still enable post-bottleneck population growth to produce 12
breeding pairs (which is the average annual number of breeding adults present in
the population during the sampling period; Harley 2005). A bottleneck of 10
generations was chosen arbitrarily as an intermediate figure to the other
simulations, and 50 generations was intended to represent the approximate
amount of time that had elapsed between first European discovery of the species
and the sampling period.
Allelic retention rates were used to determine the probability that source
population alleles could be absent in the Yellingbo sample given a particular
bottleneck scenario by multiplying rates across all retained alleles matching those
in the Yellingbo sample (à la Taylor and Cooper 2000). Retention rates were also
used to calculate allele frequencies representative of each bottleneck scenario,
and the similarity of these to the observed Yellingbo gene pool was examined by
calculation of pairwise FST. Pairwise FST was chosen for comparative purposes as
it uses the differentiation in allelic frequencies in each sample as a measure of
population genetic similarity or difference. Real and simulated population
pairwise FST values were calculated from allele frequencies using modified
Wright's F-statistics according to the following equation
T
eTST H
HHF
−=
after Peakall and Smouse (2006). For consistency, FST values for the real
population pairs were re-computed from genotypes using the same method (in
GENALEX 6; Peakall and Smouse 2006). Pairwise FST values were plotted in a
neighbour-joining tree using MEGA version 2.1 (Kumar et al. 2001) for
convenient visualisation of allele frequency similarities and dissimilarities.
39
Simulated allele frequencies were used to construct 100 genotypes (this figure
represents the average annual population census size at Yellingbo; Harley 2005)
in GEMINI (Valière et al. 2002). These genotypes were included in STRUCTURE
analyses to determine if bottlenecking of any intensity could produce a
population as strongly differentiated from other populations as Yellingbo.
40
Results
Genetic diversity and structure of real populations
Yellingbo exhibited significantly lower expected heterozygosity (all P<0.05)
than any other sampled population, and significantly lower allelic richness (all
P<0.05) than all except Powelltown (0.05<P<0.1). By contrast, the captive
colony showed negligible reduction in diversity compared to Lake Mountain and
Cambarville (Table 1). Initially, genotypes were obtained from a single PCR,
with unique alleles being verified in replicate PCRs. Genotype frequencies at
both Lake Mountain (GL35 and GL44) and Yellingbo (GL4 and GL19B)
deviated significantly from Hardy-Weinberg expectations (heterozygote deficit)
(Table 1). Heterozygote deficits at one or a small number of loci may indicate the
presence of null alleles. However, the trend for heterozygous deficits across most
loci, the fact that the loci involved are not the same in the two populations, and
the lack of evidence for null alleles in parentage analyses (Hansen, Chapter 5)
suggest null alleles are not the cause here. Rather, a Wahlund effect due to strong
demic structure is a more likely explanation given our sampling included all
animals encountered in nest boxes, which typically consist of family groups
(Harley 2005). Furthermore, significant linkage disequilibria were detected for
57 and 27 percent of locus pairs (after Bonferroni correction) at Yellingbo and
Lake Mountain, respectively. Disequilibria were not consistently caused by the
same locus pairs in each population so are unlikely to be reflecting physical
linkage. Strong linkage disequilibrium is also consistent with the presence of
demic sub-structure in our sample. Such effects have been previously observed
when families of related species showing similar social organisation are sampled
from nest-boxes (for example, sugar gliders Petaurus breviceps; Kendall 2008).
This possibility will be further explored in future research.
Genetic differentiation for all sample pairs was highly significant (all FST values
had P ≤ 0.00001: Table 2) with the exception of that for Lake Mountain and
Cambarville (P ≤ 0.01), consistent with their close geographical proximity
(Figure 1). Yellingbo was most differentiated from all other populations, with all
pairwise FST values being greater than 0.23 (Table 2) and highly significant. The
lowest pairwise FST values for the captive colony were with the Lake Mountain
41
and Cambarville populations, in agreement with the fact that many of these
animals are descendents of individuals sourced from sites local to these
populations. The size distribution of alleles will tend to diverge when
populations have been isolated for a long time, and will be reflected by larger RST
values. The larger RST (all P <0.00001) than FST for all Yellingbo comparisons,
as opposed to the more random (and usually lower) RST values for other
population comparisons gives a first indication of potential long-term
evolutionary divergence of Yellingbo from the other populations.
Two methods were used to infer number of genetic clusters from STRUCTURE
results for the combined wild and captive sample. The first is based on the
recommendations of Pritchard et al. (2003) and involves computing the posterior
probability of K, (P(KX)), from multiple replicates of each different value of K.
The estimated number of clusters was nine. The second method of interpretation
after the method of Evanno et al. (2005), who use the second-order rate of
change of the ln P(XK), given by the value ∆K. ∆K is computed from the mean
and standard deviation of the ln P(XK) and the maximum value provides the
best estimate of the number of clusters, which for this data set was two. Either
way, meta-population subdivision was most strongly defined by the exclusion of
Yellingbo from all other populations.
To determine if our wild (excluding Yellingbo) plus captive samples adequately
represent the total potential genetic diversity across the un-sampled range of
Leadbeater's possum, the cumulative number of alleles (for all alleles having a
frequency of 0.05 or greater) was plotted as each individual was added. Five
percent was chosen to represent the threshold for rare alleles (Sjögren and Wyöni
1993, Taylor and Cooper 2000). This was done twice, firstly, by pre-defining
rare alleles (which in this case was 89 out of a total of 200 sampled from the
highlands) and plotting them as they appeared in the sample, and secondly, using
alleles present at greater than 5% after the addition of each individual. All
individuals were plotted in order of population, starting with those from Lake
Mountain and finishing with those from the Captive Colony. The second plot
fluctuates with the addition of every 10 individuals, the greatest fluctuation
occurring between 107 alleles at n = 10 individuals to 64 alleles at n = 11
individuals. These fluctuations occur because a) the addition of more alleles
42
changes the total sample allele frequency distribution with each new individual,
and b) common alleles become diluted by the accumulation of new alleles as
individuals are added. The first plot effectively represents the mean and
asymptotes at n = 20. The subsequent addition of more individuals from the
remainder of the highlands sample (and with it, the addition of new rare alleles)
does not increase the accumulation of common allelic diversity (Figure 2). This
indicates that our sampling has likely detected all except rare alleles and that the
pooled sample captures the majority of meta-population genetic diversity within
the central highlands.
Yellingbo alleles were extremely skewed in their relative size and frequency. In
per locus allelic size frequency plots, there was a bimodal distribution of allele
size classes in at least seven loci (GL35, GL4, GL13, GL39, GL33, GL28 and
DT1), with the pooled and captive source populations tending to contribute to
one mode, and Yellingbo the other (see Appendix 1). This further suggests that
alleles at Yellingbo are not simply a sub-sample of those in potential source
populations, as might be expected if Yellingbo were a bottlenecked founding
population from the latter.
Bottlenecking patterns
The M ratio for the Lake Mountain sample was 0.722 and for Yellingbo was
0.625, confirming that numerous alleles are absent from the Yellingbo sample
relative to the total number we would expect to be present under the two-phase
mutation model where ps (proportion of one-step mutations) = 0.9 and ∆g
(average size of non one-step mutations) = 3.5.
The Wilcoxon test (in BOTTLENECK) revealed significantly higher gene diversity
than expected for the observed allelic diversity at Yellingbo (P = 0.0007,
indicative of a recent bottleneck) but not Lake Mountain (P = 0.7727). Analyses
of bottleneck-induced distortion of allele frequencies indicated an allele
frequency distribution mode-shift (Figure 3a) at Yellingbo, but a normal L-
shaped mode for Lake Mountain, as expected for non-bottlenecked population at
mutation-drift equilibrium (Figure 3b). The strength of bottleneck patterns at
Yellingbo confirms that this population has undergone a recent reduction in size,
43
and conversely, the absence of these patterns at Lake Mountain suggests
otherwise.
Bottleneck simulations
Simulated bottlenecks were highly sensitive to starting allele frequency. This is
not surprising as virtually all bottleneck detection methods acknowledge that
changes in relative allele frequencies are a signal of a genetic bottleneck (Nei et
al. 1975, Frankham et al. 2004). As expected, all bottleneck simulations resulted
in a loss of allelic diversity and heterozygosity, relative to the original source
(Table 3). Initially, allele frequencies from 10 randomly chosen replicate
bottlenecks (per scenario) were examined and compared using the probability of
allelic retention and FST comparisons to the Yellingbo sample. The average
allelic retention rate was subsequently used to summarise the bottlenecking
patterns (probability of retention and FST) per scenario. In no single replicate, nor
the average, were alleles retained at frequencies similar to those observed in the
Yellingbo sample. This was also true when bottlenecking the captive colony
source population. Allele frequencies in all simulated populations regardless of
source or bottleneck type (intense or diffuse) were substantially more similar to
those at Lake Mountain (FST 0.006 to 0.053) and the captive colony (FST = 0.001
to 0.061) than to Yellingbo (FST 0.133 to 0.191) (Figure 4, Appendix 2).
The probability that a founding population could have lost the alleles that are
found to be absent from the Yellingbo sample was effectively zero, depending on
the bottleneck scenario (Table 3). In particular, the probability that alleles could
have been lost from a population founded with captive colony animals in such a
short time was effectively zero. The allele frequency distribution of one
representative simulated bottleneck replicate, which clearly demonstrates the
mode-shift, is shown in Figure 3c.
Consistent with the allele frequency patterns produced by artificial bottlenecking,
replicate simulated bottlenecked populations did not cluster with the Yellingbo
population in any STRUCTURE analysis. Population sub-division in all bottleneck
scenarios was best described by K = 2. This pattern was strong and consistent
over different bottleneck intensities and durations. Each replicate simulation
44
produced very similar results in STRUCTURE, so only the most conservative
outcome, that is, a randomly chosen replicate from the simulation scenario with
average allele frequencies most closely resembling those at Yellingbo (measured
by FST), is presented (Figure 5). It is clear that, using either candidate source
population, be it the sampled central highlands populations or the captive colony,
a bottleneck scenario that could reproduce Yellingbo genetic structure could not
be identified.
45
Discussion
Yellingbo is the only confirmed G. leadbeateri population surviving in the
lowland swamp habitat type from which the species was first described.
Individuals residing there are geographically and demographically separated
from conspecifics in the mountain ash forest of the central highlands of Victoria
(Smales 1994, Harley 2005). Genetic analyses support the hypothesis that
Yellingbo is an isolated population losing genetic diversity as a function of its
small size and isolation. Its allele frequency patterns are consistent with
bottleneck-induced distortion resulting from a loss of rare alleles, and there is
low allelic diversity and heterozygosity, as commonly seen in other bottlenecked
populations, see for example (Taylor et al. 1994, Garza and Williamson 2001,
Hellborg et al. 2002, England et al. 2003, Eldridge et al. 2004, Kraaijeveld-Smit
et al. 2005).
Although a standard suite of tests identified Yellingbo as a bottlenecked
population they could not indicate whether this was due to it being a recent
introduction or a remnant from a more widespread distribution. Simulations were
employed to distinguish these two scenarios. All simulated bottlenecked
populations clustered closely with the real populations from the Central
Highlands, to the exclusion of Yellingbo. Over a range of scenarios, simulated
bottlenecks for the known potential source populations did not approximate
genetic patterns at Yellingbo. This effect was consistently strong, indicating that
this population is not recently descended from any sampled extant Central
Highlands population and certainly did not arise from an introduction event in
the last 100 years (50 generations). Thus, we conclude that the Yellingbo
population has as its source an ancestral gene pool other than that of the
highlands (and its derivative captive colony).
The sample used in this study encompasses populations from the southern
(Powelltown) and northern (Lake Mountain / Cambarville) parts of the core
range, and presumably a significant proportion of the genetic diversity as well.
This was demonstrated in the allele frequency accumulation curve where, at a
sample size of 20 individuals (from a single population), virtually all alleles
occurring at a frequency of 5% or higher had been detected. Thus, we are
46
confident that the addition of more sampling sites to the highlands source gene
pool would not alter the sample allele frequency distribution, such that a
bottleneck of that source could replicate the Yellingbo scenario. Therefore, we
consider it implausible that Yellingbo was founded by any un-sampled extant
highlands population/s.
Our evidence indicates that Yellingbo is not a recent remnant from the Central
Highlands. Instead we propose that the Yellingbo gene pool is a recent remnant
from a broader, now extinct lowland/swamp population. This assertion is buoyed
by speculation in the literature that Yellingbo may be a surviving representative
of now extinct coastal populations of the Western Port region (Smales 2004; see
also Harley 2004 for an overview). This speculation is largely based upon habitat
similarities between the two locations. Part of the Western Port region was
lowland swamp, drained to make way for agriculture in the early 20th century
(Brazenor 1946). Anecdotal historical evidence suggests that, prior to its
reclamation, this swamp may have been Melaleuca and Eucalyptus ovata
dominated, similar to that occurring at Yellingbo (Smales 1994). Swamp habitat
of this type is largely absent from the central highlands.
If Yellingbo is indeed a remnant from an extinct population or meta-population,
its degree and nature of genetic distinctiveness may indicate long-term separation
of G. leadbeateri populations according to habitat type. This postulation has
significant conservation implications, because it suggests that G. leadbeateri
populations from the two habitat types not only constitute separate management
units but may also fit the criteria of Evolutionarily Significant Units (Moritz
1994, 1995). Mitochondrial genetic data are necessary to assess this proposition
in more detail. Nevertheless, geographic isolation and habitat specialization of
the kind proposed here may be sufficient evidence to justify this separation
(Moritz 1995, Frankham et al. 2004). We would therefore advise caution in
mixing animals sourced from different habitat types for breeding or translocation
programs, until it can be ascertained whether they represent entities that differ in
important adaptive characteristics. Our mitochondrial DNA sequence analyses in
progress, including samples from the recently extinct Western Port populations,
may help pinpoint the timing and nature of the Yellingbo population divergence.
Experiments on ecological exchangeability of the form suggested by Rader et al.
47
(2005) would be warranted if they can be conducted without deleterious impacts
on populations. (Rader et al. 2005)
The process of using genetic patterns to infer population ancestry has important
applications in other threatened species with restricted ranges, but also to species
that have been translocated outside their native range. Australia and New
Zealand have historical examples of translocations of this type, where knowledge
of the origin of the introduced animals is useful to guide management decisions.
For example, two Australian marsupial taxa introduced to islands in New
Zealand have since become threatened/extinct in their native range (tammar
wallabies: Taylor and Cooper 2000; brush-tailed rock-wallabies; Eldridge et al.
2001). The tammar wallabies were inferred to be descended from a subspecies
extinct in Australia, and have recently been repatriated on the strength of these
genetic inferences. The brush-tailed rock-wallaby was similarly identified as
having being sourced from an area local to Sydney, where widespread declines
have occurred. In a similar fashion, we have demonstrated that a population of G.
leadbeateri has unique ancestry that may be important for maintaining historical
genetic diversity with ongoing loss of habitat. We have also used this endangered
endemic mammal species to test the utility of microsatellite bottleneck
simulation in elucidating the origin of populations of management significance.
48
Table 1.
Measures of genetic diversity for each sampled population. Sample size (n),
observed (Ho) and expected (He) heterozygosity, allelic diversity (A), percent
unique alleles and loci deviating from Hardy-Weinberg expectations (HW
disquilibrium) at 15 microsatellite loci for all G. leadbeateri samples.
Population n He Ho A % unique
Loci with unique alleles
HW disequilibrium
Toolangi 2 0.72 0.77 2.4 2.8 GL4 - Mt Margaret 3 0.73 0.76 3.3 4.0 GL38 GL7 - Powelltown 4 0.65 0.83 2.9 4.5 GL38 GL5A - Cambarville 7 0.71 0.71 4.9 0 - - Lake Mountain 159 0.79 0.74 11.2 23.2 all except GL4
& GL5A GL35 GL44
Yellingbo 198 0.55 0.53 3.4 5.9 GL38 GL35 GL33
GL4 GL19B
Captive colony 42 0.74 0.69 6.8 1.0 GL24 -
49
Table 2.
Genetic differentiation (pairwise FST and RST) between the five largest
sampled populations of G. leadbeateri.
Cambarville Lake Mountain Powelltown Yellingbo
FST Lake Mountain 0.084 ** Powelltown 0.203 *** 0.136 *** Yellingbo 0.302 *** 0.235 *** 0.358 *** Captive colony 0.131 *** 0.085 *** 0.172 *** 0.309 *** RST
Lake Mountain 0.028 Powelltown 0.101 * 0.091 Yellingbo 0.381 *** 0.328 *** 0.512 *** Captive colony 0.060 * 0.073 *** 0.236 ** 0.434 ***
Significance codes *** P < 0.00001, ** P < 0.01, * P < 0.05
50
Table 3.
Comparisons of genetic diversity between real and simulated populations. A
refers to allelic diversity for real populations and its equivalent, average
allelic retention, for simulations. H is observed heterozygosity for real
populations and observed heterozygosity for simulated populations (output
from GENELOSS). The probability (P) that common alleles in the source
population could be absent from Yellingbo following each bottleneck
scenario is given.
Population H A P
Non-bottlenecked Lake Mountain 0.74 11.2 - Captive colony 0.74 6.8 - Bottlenecked Yellingbo 0.53 3.4 - Simulated introduction CH int-1 0.68 4.6 1.6 × 10-17
CH int-5 0.41 2.3 2.1 × 10-32 CC int-1 0.60 3.7 0.0 CC int-5 0.35 2.1 2.8 x 10-14 Simulated remnant CH dif-10 0.62 4.3 5.5 × 10-19 CH dif-50 0.22 1.7 3.9 × 10-30
CC dif-10 0.64 5.7 0.0 CC dif-50 0.52 3.6 0.0
Source populations are CH (Central Highlands), and CC (captive colony) Bottleneck severity is represented by: int (intense = 2 breeding pairs) and dif (diffuse = 50 breeding pairs) (adapted from England 1998) Number of generations in bottleneck is shown as the suffix.
51
Figure 1.
Map of Australia showing Victoria in detail. The core range (shaded region)
of G. leadbeateri and the locations of extinct populations (represented by
squares) are shown. Black dots represent extant populations. Source of
Australia map outline: www.ga.gov.au. Map modified from Harley 2005
(with permission).
52
Figure 2.
Cumulative number of alleles with frequency >5% in pooled highlands and
captive samples. Each individual sample from each population is plotted,
excluding Yellingbo. The solid line indicates the accumulation of new alleles
present at 5% of higher in the total sample, and the dashed line indicates the
accumulation of alleles at 5% or higher each time an individual is added.
0
20
40
60
80
100
120
0 20 40 60 80 100 120 140 160 180 200Number of individuals
Cum
ulat
ive
num
ber o
f alle
les
53
Figure 3.
Microsatellite allele frequency distributions for (a) Yellingbo, (b) Lake
Mountain and (c) one representative simulated bottlenecked population (CH
int-1).
a.
0
2
4
6
8
10
12
14
0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9
Allele frequency class
Num
ber
of alle
les
b.
0
20
40
60
80
100
120
140
0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9
Allele frequency class
Num
ber
of alle
les
c.
0
10
20
30
40
50
0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9
Allele frequency class
Num
ber
of alle
les
54
Figure 4.
Neighbour-joining (NJ) tree of pairwise FST values (calculated using allele
frequencies) for all real (Yellingbo, Lake Mountain and CAPTIVE) and all
simulated populations (CH - central highlands source, CC - captive colony
source).
55
Figure 5.
STRUCTURE plot of genotypic patterns in all real populations and a
representative simulated bottlenecked population CH int-1 is shown. Bars
indicate the proportion of an individual’s membership, q, to a given genetic
cluster K (where K = 2). The abbreviation CAPTIVE refers to the captive
colony.
56
Appendix 1.
Frequency of allele sizes (in bp) of 15 microsatellite loci for G. leadbeateri.
Grey bars are the pooled central highlands sample, black bars are the
captive colony and white bars are Yellingbo. The allele frequency is given on
the Y axis and allele sizes for each locus are given on the X axis.
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
170 179 181 183 185 187 189 193 195 198
GL38
0.0
0.10.2
0.30.4
0.5
0.60.7
0.8
183 191 193 205 211 213 215 217
GL35
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
180 182 184 188 190 192 194 196 198 200
GL4
57
0.00.10.20.30.40.50.60.70.8
244 246 248 250 252 254 256 260
GL6
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
116 120 122 126 128 130 132 134 136 138 140 142
GL7
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
154 162 166 168 170 172 174 176 178
GL13
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
236 240 242 244 245 246 248 250 252 254 256
GL5A
58
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
201 205 207 209 211 213 215 217 219 221 223
GL39
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
161 163 177 179 183 185 189 191 193 197 199 201 203 205
GL33
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
132 179 182 188 190 192 195 198 200 204 209 213 222 228 243 252
GL44
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
158 160 170 172 174 176 180 182 184 188 190 192 194
GL28
59
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
239 243 247 251 255 259 263 267 271 277
GL19B
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
111 113 115 117 127 129 131 133 135 137
GL24
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
158 160 162 164 166 168 170 172 174
GL42
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
185 211 215 219 223 227 231 235 241
DT1
60
Appendix 2.
Population pairwise FST values for comparisons of each real and simulated
population (computed from allele frequencies). LM refers to Lake Mountain,
YELL is Yellingbo and CC is the captive colony. The other abbreviations are as
for Table 3.
LM YELL CC CH int-
1 CH int-5
CH dif-10
CH dif-50
CC int-1
CC int-5
CC dif-10
YELL 0.136 CC 0.050 0.182 CH int-1 0.006 0.138 0.051 CH int-5 0.019 0.165 0.061 0.016 CH dif-10 0.008 0.133 0.061 0.012 0.025 CH dif-50 0.009 0.143 0.062 0.019 0.040 0.012 CC int-1 0.053 0.191 0.003 0.055 0.062 0.063 0.066 CC int-5 0.050 0.190 0.007 0.051 0.059 0.060 0.063 0.009 CC dif-10 0.052 0.181 0.001 0.052 0.061 0.064 0.062 0.003 0.006 CC dif-50 0.053 0.185 0.002 0.053 0.062 0.063 0.065 0.003 0.006 0.000
61
Chapter Four Population genetic analysis reveals a long-term
decline of a threatened endemic marsupial.
Introduction
The most significant and widespread cause of species decline is the loss of habitat
(Gallant et al. 2007, Eigenbrod et al. 2008). Such loss is exacerbated by fragmentation
of larger areas of habitat into small patches, and the subsequent degradation of these
remnants (Rankmore and Price 2004, Banks et al. 2007). The situation is predicted to
worsen with imminent changes to the climate resulting from global warming
(Lindenmayer 2000, Mitrovski et al. 2007). In particular, many forest-dwelling species
have experienced dramatic declines across their range as a result of human disturbance
(Kerr and Burkey 2002, Rankmore and Price 2004, Goossens et al. 2006). One of these
is Leadbeater's possum Gymnobelideus leadbeateri, a small (120 g) arboreal petaurid
marsupial endemic to Victoria, Australia, patchily distributed within an 80 x 60km
region of montane forest within the central highlands of Victoria (Figure 1).
Leadbeater's possum is listed as endangered under both international (IUCN 2006:
www.iucnredlist.org) and federal legislation (EPBC Act 1999: Department of
Environment and Heritage, Australian Government).
Leadbeater's possum was first discovered near Bass River in the Western Port region of
Victoria in 1867 (McCoy 1867). Four specimens were collected from the area around
the turn of the century and in 1909 and a fifth specimen was purportedly collected from
the far north east of the state at Mt Wills (Fleay 1933, Brazenor 1946, 1962) some
150km north-east of the species’ current core range. After 50 years without a sighting,
the species was declared “certainly, or almost certainly extinct” (Calaby 1960). It was
re-discovered in 1961 near Cambarville in the Victorian Central highlands (Wilkinson
1961). Since that time virtually all records of its presence have been made within the
central highlands (Smith et al. 1985, Lindenmayer et al. 1989).
In the core of its range, Leadbeater’s possum inhabits montane ash forest with large
hollow-bearing Mountain Ash Eucalyptus regnans (typically greater than 200 years old)
and a thick middlestorey of Acacia, an important food resource (Smith 1984a,
Lindenmayer et al. 1991, Lindenmayer 2000). The majority of suitable and /or occupied
62
habitat coincides with timber and pulpwood production activities, as the bioclimatic
conditions that are suitable for Leadbeater’s possum also promote good growth rates for
eucalypts (Ambrose 1982, Lindenmayer 2000). Clearfelling operations have a rotation
time of 50-80 years, which is insufficient time for the development of hollows in
Mountain Ash (Ambrose 1982). Hence, current conservation efforts for Leadbeater’s
possum involve protection of remaining old-growth stands, and maintenance of younger
stands that are allowed to attain hollow-bearing age (Macfarlane and Seebeck 1991).
Multi-aged and old growth stands are comparatively rare within the central highlands,
and hence, the species faces an imminent habitat crisis as mature trees are lost and not
replaced.
During the past 30 years, two populations have been discovered that do not occur in this
typical montane ash habitat. The first was discovered in 1986 at Yellingbo Nature
Conservation Reserve (Smales 1994), only 17km from the nearest record of the species
in montane ash (Harley 2004b) (see Figure 1). The habitat utilised by the species at
Yellingbo is a lowland swampy habitat dominated by Mountain Swamp Gum E.
camphora with Melaleuca and Leptospermum species in the middlestorey (Harley et al.
2005). The long-term conservation value of this population is questionable due to
suspected inbreeding as a function of population's size (<100 individuals) and complete
demographic isolation from the rest of the species. Furthermore, the stochastic
extinction risk posed by wild fire is high due the small size and isolated nature of the
reserve (Harley pers. comm.). The riparian reserve where animals reside is surrounded
by a hostile matrix of partially cleared land on the slopes, some of which are used for
agriculture and livestock grazing (Harley 2005). The second population was discovered
in 1993 in sub-alpine woodland at the popular cross-country ski resort of Lake
Mountain, 80km north-east of Melbourne (Jelinek et al. 1995) (see Figure 1) and
approximately 10km north of Cambarville. Colonies occur across a plateau supporting
the sub-alpine woodland dominated by Snow Gum E. pauciflora, with Leptospermum
grandifolium and Nothofagus cunningham thickets occurring along drainage lines
(Harley 2007). The habitat utilised by Leadbeater's possum at both sites differs to
montane ash forest in lacking large hollow-bearing ash trees and dense stands of Acacia.
For species that are threatened and / or declining, extinction risk is expected to increase
with loss of genetic diversity (Frankham 2005). For highly range-restricted species such
as Leadbeater’s possum, which are subject to ongoing threatening processes such as
63
habitat destruction, loss of genetic diversity may severely compromise population
resilience. Population viability analyses (PVA; Lindenmayer and Lacy 1995,
Lindenmayer and Possingham 1996) have identified two key knowledge gaps that
currently restrict our ability to accurately assess extinction risk for Leadbeater’s
possum: 1) its ability to recolonise logged and regenerated forest, and 2) its dispersal
capability. Although radio-tracking and recapture data has recently been collected to
investigate dispersal of the species in lowland swamp forest (Harley 2005), dispersal
information from the central highlands is still lacking. At a broader spatial scale, the
present study aims to quantify population genetic variation using a panel of highly
resolving microsatellite markers in order to infer gene flow between extant populations.
We also use mitochondrial control region sequence data to infer historic gene flow and
past population structure. Using this information, we identify populations of concern or
requiring special management.
64
Methods
Collection and preparation of genetic material
Leadbeater's possum blood and ear biopsy samples were available from animals
captured between 1991 and 2004 at six locations within the Central Highlands of
Victoria: Cambarville (n=7), Lake Mountain (n=3), Mt Margaret (n=3), Powelltown
(n=4), Toolangi (n=2) and Yellingbo (n=11) (Figure 1; Lindenmayer and Meggs 1996).
As part of an intensive ecological study of Leadbeater’s possum in lowland swamp
forest at Yellingbo conducted between 1996 and 2001, ear biopsies were collected from
possums (n=187) inhabiting nest boxes (Harley 2005). This species is extremely
difficult to capture in the wild and animals do not readily enter traps. Therefore, while
highly desirable, additional samples from under-represented localities (for example,
Powelltown) were not obtainable.
In 2003, 30 nest boxes were installed to survey for Leadbeater’s possum in sub-alpine
woodland across the breadth of the Lake Mountain plateau (Harley 2007). Periodic
monitoring of the boxes since that time has confirmed that 28 of the 30 nest boxes have
been utilised by Leadbeater’s possum colonies (Harley, pers. comm.). During three
visits to Lake Mountain during 2006 and 2007, possums occupying the nest boxes were
temporarily removed for examination. All animals encountered (n=159) were sexed,
aged and weighed, and a small ear biopsy was taken for DNA analysis. Animals were
aged on the basis of pelage characteristics and weight, that is, juveniles had long, fluffy
fur on the rump and weighed under 100g, adults typically weighed over 120g and had
short dense fur on their rump and subadults had intermediate fur lengths and weighed
between 100 and 119g (Harley and Lill 2007).
In addition to the field sampling, hair and / or tissue samples were obtained from seven
Leadbeater's possum specimens held in the collection of the Museum of Victoria. These
include the two Bass type specimens C4380 and C4379 (Wilkinson 1961, Brazenor
1962) (Figure 1), which were provided as plucked hair samples, and two other historic
specimens C4378 (Tynong North, near Bass) and C1965 (Bass) (Wilkinson 1961), for
which hair and a tissue sample from the footpad were obtained. The other three
(contemporary) museum specimens, provided as plucked hair samples, were collected
65
from extant populations after 1961 (Warburton C4321, Marysville/Cambarville C8175
and Yellingbo C28009).
Whole genomic DNA was extracted from tissue samples following a standard salting
out protocol (Sunnucks and Hales 1996), and from blood samples using a DNeasyTM
Tissue Kit (Qiagen GmbH, Germany) according to the manufacturer’s protocol.
Extractions from multiple (usually a small tuft) plucked hair samples followed the
protocol of Larwill et al. (2003). All ancient DNA extractions and PCR preparations
were done in a UV-irradiated laminar flow hood (fan off) using dedicated equipment
(kept stored under UV light) and separate extraction / PCR reagents, to reduce the
potential for contamination from other DNA sources in the laboratory or aerial-borne
PCR contaminants. PCR negative controls were rigorously used throughout the
amplification process.
Microsatellite genotyping
All live animal samples were genotyped using 14 polymorphic microsatellite markers
developed for G. leadbeateri (GL4, GL5A, GL6, GL7, GL13, GL19B, GL24, GL28,
GL33, GL35, GL38, GL39, GL42, GL44; Hansen et al. 2005) and one from another
petaurid, the striped possum, Dactylopsila trivirgata (DT1; Hansen et al. 2003). Primer
sequences and PCR conditions for amplification of microsatellite markers are described
in Hansen et al. (2003, 2005) except for DT1, which was amplified using touchdown
cycling from 62 to 55oC. All museum hair samples were genotyped according to the
multi-tubes approach of Taberlet et al. (1999): a minimum of eight replicate PCRs were
performed per sample per locus.
PCR amplification of museum footpad DNA trialled two methods. The first was the
multiplex method of Piggott et al. (2004), with the addition of 1M betaine in each PCR
reaction mixture. The second method was single 20µL PCR reactions using 8µL
template DNA and 75mM Tris-HCl, 20mM ((NH4)2SO4), 0.01% Tween 20, 2.5mM
MgCL2, 0.2mM each of dTTP, dCTP and dGTP, and 0.02mM of dATP, 1M betaine,
0.5% bovine serum albumin (BSA; Panvera, Madison), 0.5U Taq DNA polymerase
(MBI Fermentas) and 0.05µL [α33P]-dATP (10mCi/mL; Perkin Elmer). Cycling
conditions followed those outlined in Piggott et al. (2004), with the annealing
temperature the same for each locus. (Piggott et al. 2004)
66
Extracts from all museum specimens amplified only sporadically at only seven loci
(GL7, GL13, GL24, GL26, GL28, 5A and GL44). Locus GL5A was re-designed to
produce a smaller fragment size. The new primers (5’-3’ forward: TGT ATC CTC TTC
CCC CAG TAA C; reverse: AGA GTT CTC TCA TCC ACA AGA GG) produced a 158-178bp
fragment, which proved more suitable for amplification of museum extracts, suggesting
the DNA was degraded.
Mitochondrial SSCP and sequencing
Mitochondrial DNA amplification was undertaken using the universal marsupial control
region (D-Loop) primers L16517M and H605M (Fumagalli et al. 1997). For the
purpose of distinguishing haplotypes via SSCP (single-stranded conformation
polymorphism), 10pmol of each primer was used in a 10µL PCR reaction containing
75mM Tris-HCl, 20mM (NH4)2SO4), 0.01% Tween 20, 2.5mM MgCL2, 0.2mM each of
dNTP, 0.1% BSA (Panvera, Madison), 0.5U Taq DNA polymerase (MBI Fermentas)
and 0.05µL [α33P]-dATP (10mCi/mL; Perkin Elmer). Cycling conditions follow those
of Fumagalli et al. (1997). PCR products were combined with 10µL of formamide
loading buffer and analysed using SSCP gel electrophoresis (Sunnucks et al. 2000).
Multiple samples representing each haplotype were commercially sequenced using an
ABI sequencer (Macrogen, Seoul, Korea).
The extracts from museum specimens failed to amplify using the standard marsupial
mitochondrial primers. PCR amplification and sequencing was achieved by designing
five new primers (two pairs and one for use in conjunction with H605M) from
previously obtained Leadbeater's possum D-loop sequence to amplify the same region
in smaller fragments (Appendix 1). The PCR volume was increased to 20µL containing
10pmol of each primer, 0.5% BSA and 1U Taq polymerase. All other reagent
concentrations remained unchanged. All museum extracts were amplified and
sequenced more than once (on average three times) and the multiple sequences for each
specimen were checked for exact matches.
Microsatellite DNA analysis
The four largest samples (Yellingbo, Lake Mountain, Cambarville and Powelltown)
were used in population genetic analyses. Standard diversity indices (observed and
expected heterozygosity and allelic diversity) were calculated in GENEPOP Version 3.4
67
(Raymond and Rousset 1995). Allelic richness, which effectively standardises allelic
diversity by the smallest sample size, was calculated by rarefaction in FSTAT 2.9.3
(Goudet 2001). FSTAT provides statistical tests for comparisons of gene diversity and
allelic richness among groups of populations (requiring at least two groups per
population or sample). To quantify the differences between Yellingbo and Lake
Mountain, 10 and four groupings, respectively, (chosen arbitrarily to approximately
represent the numbers of clusters identified in STRUCTURE; see below) were tested for
significance against 10 000 random permutations. For comparisons with / between
Cambarville and Powelltown, a Wilcoxon test for matched pairs was used.
Pairwise population FST values were calculated in Arlequin 3.11 (Excoffier et al. 2005)
and tested against a null distribution obtained by 50 000 permutations of genotypes
between populations. A principle coordinates analysis (PCA) using a standardised
covariance distance matrix was performed in GenAlEX 6 (Peakall and Smouse 2006).
GenAlEX was also used to perform Mantel tests on pairwise FST and geographic
distance matrices for tests of isolation-by-distance. Genotypes from all extant
populations were analysed in STRUCTURE 2.0 (Pritchard et al. 2000), a model-based
Bayesian clustering method that probabilistically assigns individuals to populations or
groups. The simulation was run with an initial burn-in and thinning interval of 200 000
followed by 500 000 iterations, for five replicates of each K from 1 to 16.
Mitochondrial DNA analysis
DNA sequences were aligned in BioEdit (Hall 1999) and screened for variable and
parsimoniously informative sites in MEGA4 (Tamura et al. 2007). Alignments included
the marsupial conserved sequence blocks (CSB) II and III, which are shared with
eutherian mammals (Janke et al. 1994), to ensure that sequences represent
mitochondrial control region and not pseudogenes (nuclear homologues). Haplotype
networks using all sequences were constructed in NETWORK 4.5.0.0 (Bandelt et al.
1999). MEGA4 was also used to construct a phylogenetic neighbour-joining tree with 1
000 bootstrap replicates to test for support of any clades identified in the network.
Pairwise differences between sequences were used to compute molecular diversity,
AMOVA and population pairwise FST values in Arlequin. Congruence in patterns of
population differentiation inferred separately from mitochondrial and microsatellite data
was assessed by Mantel testing (in GenAlEx) of pairwise population FST matrices
68
derived from each. PCA was performed on variable sites only in GenAlEx using a
standardised covariance distance matrix.
Equilibrium and neutrality tests of sudden population expansion were performed in
Arlequin for the two largest populations, Lake Mountain and Yellingbo. The observed
mismatch distribution provides an estimate of θ0 and θ1 (initial population size N0 and
population size after expansion N1, scaled by mutation rate), and τ, the time since
population expansion. This was tested against the expected mismatch distribution using
the sums of squared deviations SSD between the observed and expected, divided by the
number of parametric bootstrap replicate simulations (in this case 10 000). Tajima’s D
statistic and Fu’s FS test the null hypothesis of selective neutrality and population
equilibrium, which is rejected at P < 0.05.
Maximum likelihood estimates of the parameters of population growth (g) and
population size scaled by mutation rate (θ) were computed in FLUCTUATE (Kuhner et al.
1995) to infer past population dynamics. Six replicate runs of 10 short chains and five
long chains (10 000 and 100 000 steps, respectively) were done for Lake Mountain. Too
few variable sites and a star-like phylogeny (see Network results) precluded estimation
of θ and g for Yellingbo or Bass, even when they were combined into a single
population or when only the growth parameter g was allowed to vary as recommended
when haplotypes represent a star-like phylogeny (Kuhner et al. 1995).
Effective population sizes (Ne) were estimated using both marker sets. A point
estimation method using linkage disequilibrium in microsatellite data was computed in
NeEstimator 1.3 (Peel et al. 2004) using genotypes from all individuals at Lake
Mountain and Yellingbo. Relative Ne was estimated from mtDNA sequence data using
the mean number of pairwise differences method to compute theta (pi) in Arlequin. The
relative differences in Ne between each population using the two data sets was used in
combination with estimates of θ and g to assess recent changes in population size in the
context of current predicted species-wide declines.
69
Results
Microsatellite DNA analyses
Allelic diversity, observed and expected heterozygosity and allelic richness were
significantly lower at Yellingbo than at Lake Mountain (all P < 0.002) (Table 1).
Yellingbo also had significantly lower gene diversity and allelic richness than
Cambarville (P<0.02). Gene diversity and allelic richness were also lower at Yellingbo
than at Powelltown, but the difference was not significant, possibly due to the small
sample from the latter.
Genotype frequencies at both Lake Mountain (GL35) and Yellingbo (GL4 and GL19B)
deviated significantly from Hardy-Weinberg expectations (heterozygote deficit) after
Bonferroni correction (α/c = 0.05/no.loci; Quinn and Keough 2002). Null alleles are
unlikely to have an impact on HW disequilibrium for two reasons. First, the loci
involved are not the same in the two populations. Second, all 373 samples amplified for
every locus. This indicated that no null homozygotes were present in the sample and
therefore suggest that null alleles are sufficiently rare as to have minimal impact on
HWE. Rather, a Wahlund effect due to strong demic structure is a more likely
explanation for disequilibria, given our sampling included all animals encountered in
nest boxes, which typically consist of family groups (Harley 2005). Significant linkage
disequilibria were detected for 57 and 27 percent of locus pairs (Hansen and Taylor
2008) at Yellingbo and Lake Mountain, respectively. Strong linkage disequilibrium is
consistent with the presence of demic sub-structure in our sample. Such effects have
been previously been detected for denning groups of the Sugar glider Petaurus
breviceps (Kendal 2008). This possibility will be further explored in future research.
The number of genetic clusters inferred by STRUCTURE was interpretable in several
different ways, each biologically meaningful. The first is after the method of Evanno et
al. (2005), who use the second-order rate of change of the ln P(XK), given by the value
∆K. ∆K is computed from the mean and standard deviation of the ln P(XK) and the
maximum value provides the best estimate of the number of clusters, which for this data
set was two. This method best describes the split between Yellingbo and other
populations.
70
Based on the recommendations of Pritchard et al. (2000), the ‘correct’ estimate of K
(that is, when the Pr(K) “more-or-less plateaus”) is the smallest value that gives the
largest ln P(XK), in this case seven. Pritchard and colleagues (2000) also suggest
computing the posterior probability of K, (P(KX)), from multiple replicates of each
different value of K. Using this methodology the number of clusters was 13.
For all three methods, meta-population subdivision was most strongly defined by the
exclusion of Yellingbo from all other populations. For the second and third methods,
Yellingbo was sub-divided into two exclusive groups that contributed two of the 7 / 13
clusters, respectively. Lake Mountain was also sub-divided in much the same manner.
This sub-structure was best represented by K = 4 and 11, although population
membership to some clusters was not inclusive, and was partially shared with
individuals from Mt Margaret, Cambarville and Toolangi (Table 3).
Using either K=7 (Figure 2) or K=13, Powelltown clustered separately from other
populations. This clustering of Powelltown is consistent with its geographic separation
in the southern part of the sampled highlands. The four northern-highlands populations
of Toolangi, Mt Margaret, Lake Mountain and Cambarville showed considerable levels
both of admixture and shared cluster membership (Figure 2). The distribution of clusters
in this region was not congruent with sampling site.
Genetic variation was best described by differences between individuals. Molecular
variance among individuals (77%) was much higher than among populations (23%).
This was reflected in a global fixation index (0.23) differing little to population-specific
fixation indices (between 0.22 and 0.24 for all extant populations). Despite this,
population differentiation was still significant: pairwise FST values varied from 0.08
between Cambarville and Lake Mountain, to 0.36 between Yellingbo and Powelltown
(all P ≤ 0.003). Yellingbo was most strongly differentiated from all other populations
(Figure 3), with all pairwise FST values being greater than 0.30 for all but the Yellingbo
/ Lake Mountain comparison (Table 2).
Analyses of molecular variance and population differentiation produced incongruent
results, so we re-computed pairwise FST values to factor in population sub-structure, and
to allow for the possibility that the individual (or groups of individuals) is/are the unit of
spatial genetic variance rather than the population. The Yellingbo and Lake Mountain
71
samples were split into multiple groupings and pairwise population FST values
calculated treating the groupings as separate populations. Groupings were arbitrarily
chosen on the basis of geographic location of nest boxes and were two at Yellingbo: a
northern and southern, and four at Lake Mountain: a north-western, far-eastern,
southern and central grouping. Not only was population differentiation between
Powelltown, Cambarville and the Yellingbo / Lake Mountain groupings large, but there
was also within-population differentiation at Yellingbo and Lake Mountain. The
northern and southern demes at Yellingbo were significantly differentiated (FST = 0.23,
P < 0.00001). In addition, the far-eastern (LME) and north-western (LMNW) demes at
Lake Mountain were significantly differentiated from neighbouring group/s, despite
indications of potential dispersal events between demes (on the basis of the STRUCTURE
analyses).
Coupled with this differentiation was a significant isolation-by-distance effect (R2 =
0.52, P = 0.001). Pairwise FST values for most comparisons with Powelltown were
outliers, as were those for both Yellingbo demes, and LME and LMNW. The
Powelltown comparisons tended to show lesser differentiation over a larger distance,
whereas the Yellingbo/Lake Mountain groupings showed the opposite.
No reliable or consistent genotypes (that is, matching genotypes in more than three
replicate PCRs, at more than two loci for every sample) were obtained from museum
specimens despite repeat extractions from fresh material. Therefore, no comparative
microsatellite analyses involving museum specimens could be undertaken.
Mitochondrial DNA analyses
All samples from the smallest populations (n<20) were run on SSCP and commercially
sequenced. For Lake Mountain, a minimum of 50% of the samples representing putative
unique haplotypes, identified using SSCP, were commercially sequenced. As only two
haplotypes were identified at Yellingbo, all samples representing the rarer putative
haplotype were sequenced, and 27 samples representing the common haplotype were
sequenced. In total, 50 (Lake Mountain) and 34 (Yellingbo) samples were sequenced
and 21 (LM) and 62 (Y) were inferred from SSCP scoring matches.
A total haplotype sequence length of 653bp was aligned for all samples from extant
populations and from museum specimens C4380, C4379, C1965 and C8175 (192
72
samples in total). However, because three museum specimens (C4378, C4321 and
C28009) did not sequence successfully beyond 559 bp, all sequences were truncated to
559 bp for phylogenetic analysis. This truncated sequence contained a total of 37
variable sites, which included 26 parsimoniously informative sites and three single base
pair deletions / gaps (present in 190, 40 and 187 sequences). The CSB II and III were
located in all sequences and aligned with the same CSB in Didelphis virginiana
(GenBank accession number Z29573.1). CSB III had a 100% match with the same
region in G. leadbeateri and CSB II had a 74% match.
In total, 24 unique haplotypes were identified among all populations / localities
analysed: 20 from the six extant populations, two from contemporary museum and two
from historic specimens (Table 4). The largest number of haplotypes was found at Lake
Mountain (n=12), identified from 71 sequences. In contrast, 97 individual sequences
obtained from the Yellingbo sample produced only two haplotypes. The two Yellingbo
haplotypes were only separated by a single base pair deletion. This difference was
verified by replicate sequencing of every sample representing the rarer haplotype. Only
three haplotypes were shared between populations: one between Yellingbo and Bass
(museum specimens C4380 and C28009 and 92 Yellingbo samples), one between Lake
Mountain and Mt Margaret, and one between Lake Mountain and Cambarville. All
other haplotypes were unique to their population of origin or sampling locality (Figure
4). With the exception of Yellingbo, the number of haplotypes observed in a population
generally increased with sample size.
The phylogenetic network indicated the presence of one distinct clade (with 87%
bootstrap support) containing all Yellingbo samples and the Bass Valley specimens
(C4390, C4379 and C1965). This phylogeny was star-like indicating non-equilibrium
past population histories. There was 99% bootstrap support for a single, distinct
haplotype from Lake Mountain representing a distinct lineage from a group containing
all other haplotypes. Contrary to our expectations (based on information regarding
collection sites of specimens representing extinct populations) the Tynong specimen
C4378 did not cluster with the Yellingbo / Bass clade but rather grouped with central
highlands samples. No other population-specific patterns were detected in the network.
Closely-related and missing haplotypes were interspersed among central highlands
populations rather than being confined exclusively to one or the other (Figure 4). The
network could not be rooted for the purpose of assessing reciprocal monophyly due to
73
the absence of a suitable outgroup (that is, sequence from another marsupial that could
be aligned with the G. leadbeateri control region sequence).
Mitochondrial molecular variance among populations was 60%, with the remaining
40% assigned to within-population differences, based on pairwise differences between
sequences. The global fixation index was 0.60 (P~0.0), indicating significant population
differentiation. Given (1) the distribution of haplotypes (not necessarily concordant with
sampling locality); (2) the significant contribution of within-population variance in the
microsatellite data and (3) the clustering of Yellingbo and Bass haplotypes (Figure 4),
we re-analysed molecular variance in the mitochondrial data as follows. Haplotypes
from Yellingbo and the Bass region were combined into one grouping, and all other
central highlands samples into another. This resulted in a major re-partitioning of the
variance, with the among-groups component being the highest at 47%, and the
remainder being partitioned largely within populations (37%) and less so among
populations (16%). All variance components were highly significant when tested
against 50 000 random permutations (P < 0.00001). The global fixation index tested by
permuting populations among groups (FCT) was 0.47 (P = 0.099), indicating that the
two groupings explained only marginally more of the genetic variance than that
explained within populations. Removal of the Tynong specimen from the Bass sample
altered neither the variance nor the global fixation index. Regardless, it was removed
from subsequent analyses of pairwise population FST and tests for sudden population
expansion owing to its clear phylogenetic exclusion from the Yellingbo / Bass clade.
Pairwise population microsatellite FST was highest between Yellingbo and each other
population, including Bass (>0.60), whereas much lower values resulted for
comparisons between Lake Mountain and other populations (Table 3; Figure 5). Mantel
testing of microsatellite pairwise FST and mitochondrial pairwise FST matrices produced
a strong correlation (R2 = 0.90, P = 0.044, based upon 999 permutations). A single
outlier was present, between Cambarville and Powelltown, indicating lower mtDNA
population differentiation than expected given microsatellite differentiation.
Consistent with the pattern of microsatellite diversity the two largest central highlands
samples from Lake Mountain and Cambarville had the highest mtDNA nucleotide
diversity and largest mean number of pair-wise sequence differences (Table 5).
Conversely, Yellingbo had the lowest nucleotide diversity and smallest mean number of
74
pairwise differences despite the large sample size (excluding Toolangi, where the two
individuals sampled had the same haplotype) and was nearly two orders of magnitude
lower than the Lake Mountain sample.
Estimates of the parameters τ, θ0 and θ1 (Table 5) indicated a significant difference
between the mismatch distributions expected under the null hypothesis of sudden
population expansion, and those observed at Lake Mountain, Cambarville and
Powelltown, but not at Yellingbo. Neither Fu’s FS nor Tajima’s D rejected the null
hypothesis of selective neutrality in any population when tested against 10 000
simulated samples. These computations were repeated using three groupings of samples,
1) Yellingbo / Bass (based on clustering of these haplotypes), 2) central highlands north
(Mt Margaret / Lake Mountain / Cambarville, based on patterns of microsatellite
variation) and 3) central highlands south (Powelltown, based on its geographic
separation from the northern central highlands populations), to test for “regional” past
population dynamics. The central highlands north and south groups had significantly
different observed mismatch distributions, but not Fu’s FS nor Tajima’s D (Table 5).
Tests of past population dynamics in FLUCTUATE suggested that Lake Mountain, was in
fact a declining population. All replicates produced a maximum likelihood growth rate
of around -3. The average maximum likelihood estimate of the parameters g and theta
was -77.73 ± 23.43 and 0.0075 ± 0.0008, respectively, and corresponded to an
approximate change in population size over 2 000 generations of one order of
magnitude at a mutation rate of 1.0e-05. Sunnucks et al. (2006) used the mean growth
parameter g plus 3SD < 0 as an indication of significant population decline (after Lessa
et al. 2003). For Lake Mountain, this equated to -148.01. This analysis was repeated on
the central highlands north grouping and found the average maximum likelihood
estimate of the parameters g and theta was -13.42 ± 5.35 and 0.0197 ± 0.0028,
respectively. The mean growth parameter plus 3SD equated to -29.46 also indicating a
significant (meta-population) decline.
(Lessa et al. 2003, Sunnucks et al. 2006)
Effective population sizes were between six and nine times as large at Lake Mountain
than at Yellingbo when estimated from microsatellite data in NeEstimator (Table 5),
and between one and two orders of magnitude larger when estimated from haplotype
sequence data using theta (pi) in Arlequin (Table 5).
75
Discussion
Using genetic analysis of individual animals sampled from nest boxes and from the
wild, we have gathered a substantial sample from wild populations of Leadbeater’s
possum. This has provided us with a unique opportunity to examine some genetic
attributes of the species. Our data corroborate the forecasts of PVA modelling which
suggests there will be substantial future declines of the species, with a result of the
widespread loss of large hollow-bearing trees which are key nesting sites (Lindenmayer
et al. 1997).
Based on extensive long-term monitoring data (Lindenmayer et al. 2003a), the current
population size of Leadbeater’s possum may be as low as 2500. The sample obtained
for this study thus represents ~14% of the estimated population. While our genetic
samples are skewed in geographic distribution and population representation, they are
nevertheless a significant portion of the (extant) species and thus also presumably a
significant portion of the genetic diversity.
Current genetic structure of wild populations
Leadbeater’s possum is remarkably genetically diverse in the core of its range. This is
despite extensive alterations to the montane ash forest at a landscape scale from logging
and wildfire, both of which have been identified as having significant negative impacts
on Leadbeater's possum population persistence (Lindenmayer and Possingham 1996,
Lindenmayer 2000). Both expected heterozygosity and allelic richness (diversity) based
on microsatellite data were higher in all highlands populations sampled than at
Yellingbo, which supports the only extant lowland population.
Lake Mountain, Cambarville, and Mt Margaret in the northern part of the species range
appear to form a continuous genetic unit whose sub-units have experienced regular
genetic exchange. Gene flow is probably still occurring across a relatively large area
(approximately 20 square kilometres) reflecting relatively continuous habitat in the
region. Powelltown, on the other hand, appears to be genetically distinct from other
sampled highlands populations, suggesting either isolation-by-distance (IBD) or
relatively recent disruption to gene flow between these regions.
76
There was generally a high correlation between population genetic differentiation using
both molecular markers, with the exception of Powelltown, which showed less
mitochondrial than microsatellite divergence compared with other populations. This
suggests that the genetic differentiation of Powelltown from northern populations may
be a recent phenomenon, and that habitat fragmentation is having an additive affect to
patterns of isolation-by-distance. Powelltown is disconnected from the northern
distribution of the species by mixed species forest and extensive cleared valley floors
(that both constitute unsuitable habitat), and relatively recent wildfires in young
regrowth forest (Smith and Woodgate 1985) that would have rendered large areas of the
forest unsuitable for occupancy. Therefore, we suggest that recent disruptions to gene
flow are the cause of Powelltown’s differentiation.
Keyghobadi (2007) has commented that time lags may exist between fragmentation and
its subsequent effect on gene flow. It is therefore plausible that changes due to timber
production, land clearance and wildfire are ongoing contributors to the genetic effects of
fragmentation between regions within the highlands. The flow-on genetic effects of
fragmentation may therefore continue to accrue even if there is immediate cessation of
timber production. Furthermore, the extended periods required for recruitment of new
trees to hollow-bearing maturity (Ambrose 1982, Lindenmayer et al. 1993) will inflate
fragmentation effects due to punctuation of suitable habitat with the loss of den sites.
Additional sampling in between the northern and southern units, and sampling in the
eastern part of the highlands is necessary to assess the extent of fragmentation across the
entire species range.
Historical population genetic structure
There were many haplotypes shared among central highlands populations, but few were
unique to their sampling locality. This indicates that populations have not been isolated
for any substantial time period in the past, and probably formed part of a larger
panmictic group. This group may have been centred on the current core range, or may
have extended north-east to regions where sub-fossils have been found (Wakefield
1967, Hall 1974, Menkhorst 1995, Harley 2004b).
There were many "missing" haplotypes identified in the network, indicating that either
they have not been sampled or they have been lost due to extinction of maternal
lineages. We consider it unlikely that missing haplotypes were simply unsampled, given
77
that we detected only 12 haplotypes from 71 individuals at Lake Mountain. Moreover,
tests of sudden population expansion failed to find any positive changes to population
size. Coalescent analyses at Lake Mountain (the only sample locality suitable for such
an analysis) produced a significantly negative value for the growth parameter g
indicating that the population is experiencing ongoing declines. This is despite the high
genetic diversity and relatively large numbers of animals sampled there.
In addition to the decline detected at Lake Mountain, coalescent analysis of the north
central highlands grouping that encompasses Lake Mountain, Cambarville and Mt
Margaret also produced significantly negative values of growth. This suggests that the
decline is neither restricted to Lake Mountain, nor a peculiarity of the habitat there.
Given the documented declines in survey counts of animals in ash forest (Lindenmayer
et al. 2003a), the apparent reduction in the species’ range since the last glaciation (Hope
1974, Lindenmayer 1989) and the strong signals of decline in the genetic data from the
northern part of the central highlands, we therefore suggest that population declines
detected here may represent a general trend across a broader area of the species’ current
range.
The clustering of Bass region and Yellingbo haplotypes indicates that these two lowland
areas were probably once part of a larger genetic unit that was separated from montane
ash populations in the central highlands. The species disappeared from Western Port at
the start of the 20th century, and well before any serious attempt to study the species was
made (Brazenor 1946, Menkhorst 1995, Harley 2004b). Anecdotal observations of
habitat in the Bass Valley (Nicholls 1911) suggest that the region where Leadbeater’s
possum was first discovered may have floristically and structurally resembled that at
Yellingbo (Harley 2004b). Swampy habitats that covered a substantial portion of
Western Port were drained and much of the region cleared of scrub cover, almost
certainly contributing to the extinction of Leadbeater’s possum (Nicholls 1911, Spencer
1921, Wilkinson 1961, Menkhorst 1995). Cockatoo Creek (along which the population
at Yellingbo occurs) may have been connected to Western Port prior to urban and
agricultural development of the area. We therefore conclude that populations in the Bass
and Yellingbo districts were historically connected, and that Leadbeater’s possum either
used corridors of suitable habitat to move between the two districts or else was
continuously distributed throughout the intervening area.
78
The historic specimen from Tynong North did not cluster with Yellingbo and Bass, as
would be expected on the basis of geography. This specimen was collected only 30km
south of the nearest contemporary central highlands record (Loyn and McNabb 1982),
both within the Western Port catchment. Its genetic affinity with other central highlands
specimens infers a recent connection between the two. An ecological reconstruction of
the Koo-Wee-Rup Swamp has demonstrated the presence of an “inner” permanently
inundated reed and rush swamp and an “outer” paperbark scrub swamp subject to
regular flooding (Yugovic and Mitchell 2006). The inner swamp lies directly between
the Tynong specimen and the more southerly Bass specimens, and was probably
impassable for Leadbeater's possum. The lack of clustering may therefore represent
physical separation of the two localities. Alternatively, this specimen may represent a
retained ancestral haplotype prior to the divergence of Yellingbo / Bass.
The presence of non-equilibrium past population dynamics at Yellingbo and Bass was
inferred in the test for sudden population expansion. This suggests that this region has
either experienced recent population growth or some other non-negative population size
change. We have previously identified patterns of a genetic bottleneck at Yellingbo,
probably occurring prior to European colonisation (Hansen and Taylor 2008),
supporting the latter proposition. Furthermore, the two haplotypes were separated only
by a single base pair deletion, suggesting a severe bottleneck down to a single haplotype
and the appearance of a second haplotype by mutation. Therefore, while this bottleneck
could have occurred anytime between the last Pleistocene glacial maximum (up to 25
000 years before present) and the arrival of Europeans, it more likely to have occurred
nearer the Pleistocene given the long time taken for mutations to accumulate (Moritz et
al. 1987).
The mitochondrial control region evolves rapidly and at a highly variable rate. As a
result, caution is advised in attempting to use a mitochondrial molecular clock approach
for dating in the absence of fewer than four independent time points (Moritz et al.
1987). Attempts to do so may result in divergence time estimates that are uninformative,
due to the large confidence intervals surrounding those estimates (for example,
Mountain Pygmy Possums Burramys parvus - Mitrovski et al. 2007). Virtually no
sequence similarities were found in the control region of the nearest relative of
Leadbeater’s possum, the Common Striped possum Dactylopsila trivirgata (GenBank
accession number NC_008134), and only conserved sequence blocks II and III were
79
partially shared with the American Opossum Didelphis virginiana. Thus, we were
unable to obtain a suitable calibration to date divergence times for Leadbeater's possum
D-loop sequence, which would have allowed us to test if the bottleneck signature at
Yellingbo is a result of a split between highlands and swamp populations.
Leadbeater's possum is represented in the fossil record by sub-fossils from southern
New South Wales dated from the Pleistocene, and later from the Buchan district in
eastern Victoria (dated between the late Pleistocene and 2500 years before
present)(Wakefield 1967, Lindenmayer 1989). Two hundred and seventy-seven
individual Leadbeater's possum fossils, dated at 15 000 ybp, were detected in the
Buchan sample but only a single Leadbeater's possum fossil was found that dated at
2500 ybp (Wakefield 1967). This change in fossil representation indicates a possible
range contraction since the last Pleistocene glaciation (most likely climate-induced),
which could have lead to the species current restricted range in south-eastern Australia.
Thus, we suggest that the divergence time of Yellingbo / Bass may be sometime around
or after the appearance of sub-fossils in the Buchan area on the basis of a climate-
induced range contraction (Wakefield 1967).
Yellingbo as a source for translocation
The population at Yellingbo is easily accessible via nest boxes, and is consistently close
to carrying capacity. These attributes make it a highly desirable source of animals for a
captive breeding program. Given the declines detected within the central highlands,
there may be increased pressure to translocate possums from Yellingbo for the purposes
of reversing local extinctions at central highlands sites. However, our data highlight two
ways in which the Yellingbo population is unsuitable for these purposes. First,
Yellingbo is ecologically dissimilar to other extant populations, occurring in lowland
swamp rather than wet montane forest (Harley 2004b, Harley et al. 2005). This
dissimilarity, and the strong genetic differentiation of Yellingbo from all other
populations is an important distinction because it indicates that longer-term factors other
than recent land clearance, have contributed to Yellingbo’s isolation from montane sites
supporting the species. If Yellingbo is a locally-adapted isolate, it may be inappropriate
to mix animals with those from the central highlands of Victoria. Such a course of
action may result in loss of local adaptation and / or outbreeding depression, by mixing
of genomes adapted to different environments (Marshall and Spalton 2000).
80
The second characteristic that may make the Yellingbo population less suitable as a
source of individuals for translocation to establish new populations concerns its inbred
status. Inbreeding depression may result in reduced reproductive fitness and survival,
impacting on population resilience. It is for these reasons that Eldridge and colleagues
(1999) have cautioned against the reliance on Australia's offshore islands as reservoirs
for Australia’s biodiversity. The average inbreeding coefficient Fe for non-endemic
island populations is 0.29 (Frankham 1998), a value being approached by the inbreeding
coefficient of 0.23 for Yellingbo Leadbeater’s possums (using the equation Fe = 1 - HIS /
HM (Eldridge et al. 1999), where HIS and HM are the heterozygosities for island and
mainland populations, respectively). Thus, although Yellingbo is not experiencing the
extreme inbreeding seen in some island populations (eg. 0.91 for the Barrow Island
black-footed rock-wallaby; Eldridge et al. 1999), its significantly reduced diversity may
make it inferior to central highlands populations as founders for captive breeding and
translocation.
To date, no traits consistent with inbreeding depression (e.g. reduced fecundity or
survivorship, skewed sex ratios) have been documented at Yellingbo despite extensive
population monitoring since 1996 (Harley 2005). This population may be similar to
populations of the Californian endemic vaquita (Munguia-Vega et al. 2007) where
existing polymorphism may have been maintained for many generations despite
isolation. The low but unique genetic diversity at Yellingbo may have been maintained
despite signs of bottlenecking and apparent long-term isolation. Therefore, as the
population at Yellingbo does not show signs of inbreeding depression, and harbours a
unique subset of genetic diversity that is absent from the rest of the species’ range
(Hansen and Taylor 2008), its protection should be viewed as a high conservation
priority. Moreover, for the reasons outlined earlier (outbreeding depression), lowland
swamp and montane populations of Leadbeater’s possum should not be mixed. Instead,
we believe if translocation from Yellingbo were to occur, that founders should be
translocated only to other swamp habitats.
Implications of the genetic data for future species conservation
The pattern of the genetic data collected here suggests that, in parts of its range
including the intensely studied area around Cambarville, Leadbeater's possum has been
declining for a long time, probably in the order of thousands of years. Thus, it does not
appear to be solely the result of habitat modifications that have taken place since the
81
arrival of Europeans to Australia. This finding is concordant with results of bioclimatic
analyses of predicted distribution, which simulated a considerable range contraction
associated with global warming (Lindenmayer et al. 1991), as well as information from
current and ongoing monitoring programs, which have detected a recent decline in
abundance across much of the core range (Lindenmayer et al. pers. comm.). Thus,
contemporary declines (due to loss of hollow-bearing trees) are occurring in addition to
ongoing longer-term declines (probably due to shifts in climate).
Population viability analyses conducted over a decade ago predicted a high risk of a
meta-population crash within 50 years (Lindenmayer and Lacy 1995, Lindenmayer
2000). At a finer scale, simulations revealed that only populations over a threshold size
(200 individuals - approximately the size of the Lake Mountain population) had a 90%
chance or higher of persistence over a 100 year period.
On the basis of the high level of genetic diversity and the signs of successful breeding
(80 offspring, both weaned (n=71) and pouch young (n=9) were encountered in colonies
over three visits in a 12 month period), large populations like Lake Mountain should be
relatively stable. Instead Lake Mountain showed a strong signal of decline over a long
time period, indicating that meta-population extinction risk might be higher than
currently predicted. State government plans to establish a reserve system will be
important for reducing this risk (Macfarlane and Seebeck 1991, Macfarlane et al. 1995),
but management actions that incorporate conservation of existing genetic diversity will
also be necessary to safeguard against continued loss of maternal lineages. This includes
targetted management of areas identified as distinct genetic units (in this case,
Powelltown and the Lake Mountain / Cambarville complex) (Moritz 1995).
Maintenance of habitat connectivity between populations or sub-populations is clearly
an important factor in facilitating gene flow. The population at Yellingbo should be
managed separately, as it potentially fits the criteria of an Evolutionarily Significant
Unit (Moritz 1995) in being a historically-isolated, and sole representative of an
otherwise extinct genetic unit. I find it nevertheless retains a significant portion of
genetic diversity, which should be accounted for in future reserve design and
conservation funding prioritisation.
I conclude by noting that potential lags in accumulation of genetic signals (Keyghobadi
2007) mean that the effects of ongoing alteration to montane ash forests may be leading
82
to further fragmentation of the forest than the current field data suggest. There may be
continued isolation of populations within the central highlands, especially those towards
the edge of the core range. Not only is it important to take action immediately to
conserve genetic diversity in this species, but it will be equally as important to monitor
changes in this diversity over time, especially if a severe bottleneck occurs due to loss
of nest trees (Lindenmayer et al. 1990). In this sense, these data provide an important
baseline for such monitoring, and will allow realistic estimates of effective population
sizes for incorporation into future PVA models. The importance of both short- and
medium-term genetic marker sets in model validation and assessment of population
processes in endangered species is also recognised.
83
Table 1.
Measures of genetic diversity for the four largest extant populations. n is total
number of individuals sampled. He and Ho are expected and observed
heterozygosity, A is average number of alleles per locus and AR is allelic richness.
Population n He Ho A AR Powelltown 4 0.65 0.83 2.9 2.39 Cambarville 7 0.71 0.71 4.9 2.69 Lake Mountain 159 0.79 0.74 11.2 3.00 Yellingbo 198 0.55 0.53 3.4 2.12
84
Table 2.
STRUCTURE population cluster membership where K = 7. Numbers give the
percentage cluster membership in each population. Values less than 1% are
expressed as zero.
Cluster 1 Cluster 2 Cluster 3 Cluster 4 Cluster 5 Cluster 6 Cluster 7 Mt Margaret 31 18 4 0 18 0 35 Powelltown 0 99 0 0 0 0 0 Toolangi 5 7 2 0 2 0 84 Cambarville 1 2 3 0 0 0 93 Lake Mountain 44 1 19 0 9 0 26 Yellingbo 0 0 0 73 0 26 0
85
Table 3.
Pairwise population differentiation FST between the four largest extant populations
of Leadbeater's possum based on 15 microsatellite loci and on mitochondrial
control region sequence data.
Powelltown Cambarville Lake Mountain Yellingbo
Microsatellite FST Cambarville 0.203 ** Lake Mountain 0.136 *** 0.084 ***Yellingbo 0.359 *** 0.302 *** 0.235 ***Mitochondrial FST
Cambarville 0.226 * Lake Mountain 0.226 ** 0.116 *Yellingbo 0.972 *** 0.908 *** 0.631 ***Bass region 0.766 * 0.418 ** 0.364 ** 0.795 ***
Significance codes *** P < 0.00001, ** P < 0.01, * P < 0.05
86
Table 4.
Mitochondrial haplotype and nucleotide diversity for all locations sampled,
including one extinct locality (Bass region). n samples is the number of individual
sequences obtained for that population / locality. Numerals in parentheses are the
number of museum specimens contributing to a sample.
Population n
samples n
haps Prop. haps
unique Mean no.
pairwise diff. Nucleotide diversity
Cambarville 8 (1) 4 0.75 6.04 ± 3.22 0.0108 Lake Mountain 71 12 0.75 6.76 ± 3.22 0.0121 Mt Margaret 3 2 0.33 1.33 ± 1.10 0.0024 Toolangi 2 1 1.0 0.00 ± 0.00 0.0000 Powelltown 6 2 1.0 2.33 ± 1.48 0.0042 Yellingbo 97 (1) 2 0.5 0.12 ± 0.19 0.0002 Warburton (1) 1 1.0 na na Bass region (4) 4 0.75 3.5 ± 2.2 0.0063 TOTAL 192 24
87
Table 5.
Relative measures of sudden population expansion τ and its 95% confidence
intervals, θ0 (0.0 in all cases) and θ1, and selective neutrality (Tajima's D and Fu's
Fs) The sum of squared deviations SSD between the observed and expected
mismatch distribution is the test statistic of parameters τ, θ0 and θ1. CH north
groups Lake Mountain, Cambarville and Mt Margaret into one unit. Effective
population sizes are estimated from mitochondrial haplotypes, theta(pi), and from
microsatellite genotypes (NE).
Population / grouping
τ τ (95% CI) θ1 SSD D FS theta (pi)
NE (microsats)
Lake Mountain 9.4 3.9-13.8 12.23 0.05* 1.14 3.19 6.73 56.8 (52.7-61.4) Yellingbo 3.0 0.3-3.0 0.12 <0.01 0.00 -0.43 0.10 7.4 (6.7-8.2) Yellingbo / Bass 3.0 0.5-3.0 0.16 <0.01 0.00 -1.78 0.14 - CH north 8.7 4.2-12.1 14.03 0.04* 0.85 1.63 6.72 - CH south (Powelltown)
3.0 0.4-3.0 0.29 0.16* -1.37 3.36 2.33 -
* P < 0.05
88
Figure 1.
Map of Victoria (inset A) and south-eastern Australia (inset B) showing the core
range (shaded region) of Leadbeater's possum. The locations of extant (filled
circles) and extinct localities (filled squares) are shown. In inset B, sub-fossil sites
are represented by triangles. Western Port and Central Highlands labels refer to
'extinct' and 'extant' regions, respectively. Source of Australia map outline:
www.ga.gov.au.
89
Figure 2.
STRUCTURE plot of inferred cluster membership where K=7 for every adult
individual in each extant population. Vertical bars represent individuals. Values
on the Y axis are Q which is the proportion of each individual’s membership to a
cluster K. Population symbols as follows: M = Mt Margaret; P = Powelltown, T =
Toolangi and CM = Cambarville.
90
Figure 3.
Principle coordinates analysis based on 15 microsatellite locus genotypes from the
four largest populations. Powelltown (open diamonds), Cambarville (filled
squares), Lake Mountain (crosses), Yellingbo north sub-group (open triangles) and
Yellingbo south sub-group (closed triangles). Coordinate 1 explains 49% of the
variation and coordinate 2 explains 20%.
Coordinate 1
Coo
rdin
ate
2
91
Figure 4.
Mitochondrial haplotype networks for eight sampling localities based upon a
559bp region of D-loop sequence from 180 individuals. Circle size is proportional
to number of individuals sharing a haplotype. Grey nodes represent haplotypes
missing from any locality, and small black nodes represent mutations. Circle size
corresponds to the number of samples sharing a haplotype and shading is used to
indicate which haplotypes were present in a given population.
92
93
Figure 5.
Principle coordinates analysis of haplotype sequences from all sampling localities,
Powelltown (open diamonds), Cambarville (filled squares), Lake Mountain
(crosses), Yellingbo (open triangles), Mt Margaret (filled diamonds), Toolangi
(filled circle), Bass region (filled triangles) and Warburton (open circle).
Coordinate 1 explains 42% of the variation and coordinate 2 explains 26%.
Coordinate 1
Coo
rdin
ate
2
94
Appendix 1.
Details of G. leadbeateri D-loop mitochondrial primers.
Primer name Sequence (5’-3’) complementary
primer Fragment size*
Location (in D-loop) **
L16216GL ATTCGTAGAGGCATATGTGATG forward 465bp 16184 H196GL GCTTTTTGGGGTGGGAAAG reverse 16704 L16204GL CCTAAACATGCTATTCGTAGAGGC forward 406bp 16175 H120GL AATCATTTAATCAAGGGGGAAAG reverse 16634 L16613GL TTGTTGCTCACGCTAAAC H651B *** 388bp 16617
* This is the approximate size of fragment calculated from alignments of G. leadbeateri sequences. The fragment size of L16613GL is from PCR with H651B. ** Location in D-loop refers to the approximate location on the light strand of the control region of Didelphis virginiana. Primers L16204GL and L16613GL partially overlap with CSB II. *** For details of H651B refer to (Fumagalli et al. 1997)
95
Chapter Five Genetic analysis of social structure, mating system
and dispersal in Leadbeater's possum
Introduction
An understanding of intrinsic and / or cryptic population processes may be critical to the
management of threatened or range-restricted species. In particular, the social dynamics
of a species may play a significant role in genetic structuring of populations (Dobson et
al. 1998) especially in the face of environmental perturbations (Banks et al. 2007). The
mating system and relatedness structure of individuals in social neighbourhoods are
important determinants of the level of patch inbreeding and genetic heterogeneity
among kin groups (Pope 1992, Banks et al. 2005). Large-scale or patchy disturbance
may have profoundly different effects on population structure depending on social
behaviours. If reproductive success is behaviourally determined by being restricted to
very few individuals, then depletion of numbers may result in a much larger and
possibly critical reductions in effective population sizes by physically restricting
breeding recruitment.
In the case of Leadbeater's possum Gymnobelideus leadbeateri, an arboreal marsupial
restricted to a small region of Victoria's montane ash highlands, knowledge of dispersal
and social behaviours will be important to management of wild populations (Macfarlane
and Seebeck 1991). The species relies heavily on old-growth hollow-bearing ash trees
for residency and breeding (Smith and Lindenmayer 1988). Where natural denning sites
are few, the species readily occupies artificial nesting hollows (nest boxes), although
this is not the case where suitable tree hollows are present (Harley 2004a). Therefore,
availability of nesting hollows (natural or artificial) potentially dictates (a) the species'
distribution and (b) breeding recruitment. If the level of intra-population gene flow is
sensitive to nest hollow distribution, then the placement / occurrence of these in the
landscape will significantly affect population genetic structure. If low reproductive
output occurs as a result of intrinsic factors such as dominance hierarchies and
reproductive suppression, and dispersal between kin groupings (which remain to be
defined for this species) is low, then small population persistence may be compromised
by the effects of inbreeding and genetic drift.
96
Leadbeater's possum are considered monogamous (Smith 1980, Smith 1984b, Harley
2005, Harley and Lill 2007). The observation of only a single reproductively active pair
of adults in a colony is central to inferences of monogamy in this species (Smith 1980,
Harley 2005, Harley and Lill 2007). Breeding colonies are defined as groups of
(presumably) related individuals denning together. A colony was found in earlier studies
to be typically composed of a single dominant breeding pair with one or more of their
juvenile or sub-adult offspring, although it is not clear what the latter conclusion is
based on (Smith 1980). Additional adults (usually males) were often encountered and
were assumed to be the matured offspring of the breeding pair in the colony as few
showed signs of reproductive activity. Inferences about social structure and dominance
hierarchies of this species are heavily reliant upon external reproductive indicators and
age structure of colony members. These inferences are based upon captive animals and
have not been empirically tested in any wild population.
Arboreal mammals are notoriously difficult to sample in the wild, and threatened
species, even more so. Information for managing populations will often rely on survey
data alone, and only occasionally on data from captures. Leadbeater's possum is a case
in point. The species is extremely difficult to survey in the wild (Smith 1980,
Lindenmayer and Meggs 1996, Harley 2004a) and animals rarely enter traps, meaning
that the only reliable way to capture individuals is by installing artificial nesting hollows
and monitoring their use over time (Harley 2004a). As animals tend only to use nest
boxes when there is a paucity of natural den sites (Harley 2004a), this approach will
necessarily be limited to habitats lacking large hollow-bearing trees. This means that a
population largely residing in nest boxes will provide the best opportunity for collection
of any detailed social and genetic data on Leadbeater's possum. The degree to which
data collected from nest box studies can be extrapolated to naturally-denning
populations remains to be empirically tested for this species, although it is highly
probable that such testing will never be possible owing to the extremely low success
rate of trapping (Smith 1984b, Lindenmayer and Meggs 1996).
Previous work on genetic structure has identified long-term divergence between the
lowland swamp population at Yellingbo, and the montane populations within the
highlands (Hansen and Taylor 2008, Chapter Four). If the ecology and socio-biology at
both sites is similar, then it is unlikely that evolutionary divergence or marked habitat
differentiation affects population substructure. Therefore, any differences detected
97
between the habitat types are more likely to be due to differences in nesting
opportunities. This possibility is explored in this study.
This study makes use of two populations that largely reside in nest boxes, the only two
such populations. The first is at Yellingbo, which occurs in lowland swamp and has
previously been subjected to intensive ecological study (Thomas 1989, Harley 2005).
The second is in sub-alpine woodland at Lake Mountain within the central highlands,
where nest boxes have only recently been erected (Jelinek et al. 1995). Habitat at both
sites is atypical for the species in lacking two key components identified as being
important predictors of Leadbeater's possum presence (1) large hollow-bearing ash trees
(Smith and Lindenmayer 1988) and (2) a thick understorey of Acacia, the possum’s
preferred food resource in montane ash habitats (Smith 1984a).
The limited information available from radio-tracking studies at Cambarville highlights
the importance of a better understanding of general life-history parameters like the
mating system (Lindenmayer and Meggs 1996), and in particular, dispersal patterns and
re-colonisation ability. In this study, I make use of microsatellite genetic analysis to
elucidate patterns in social structure and the mating system of Leadbeater's possums
inhabiting nest boxes at Yellingbo and Lake Mountain. Firstly, a fine-scale analysis of
population sub-structure was conducted using Bayesian clustering method implemented
in the program STRUCTURE, which probabilistically assigns individuals to genetic
groups on the basis of genotypic similarity. On the basis of the spatial distribution of
related individuals, probable dispersal events between colonies were identified. A
detailed analysis of the mating system was conducted and used to test the assumptions
of monogamy. This information was also used to assess the ecological / field inferences
of breeding, parentage and relatedness among adult colony members. Lastly, this
information was synthesized to provide recommendations about management of
breeding populations in the Central Highlands of Victoria.
98
Methods
Field Work
Site descriptions
Both the population at Yellingbo Nature Conservation Reserve (hereafter referred to as
Yellingbo) and at Lake Mountain both have numerous accessible breeding colonies
(Figure 1) due to the presence of artificial nesting sites (nest boxes), which allow
sampling and monitoring access to colonies residing within them.
The population at Yellingbo occurs in lowland swamp dominated by Swamp Gum
Eucalyptus ovata, with a dense middlestorey of tea-tree (Leptospermum spp.) or
paperbark (Melaleuca spp.) (Harley 2005). Yellingbo is approximately 50 km east of
Melbourne, on the fringe of, but separate from the rest of the central highlands of
Victoria (see Chapter 4). Due to the lack of connecting vegetation on intervening land,
the population in the reserve is long-term genetically isolated from other known extant
populations (Chapter 4). For a more detailed site description refer to Harley et al. (2005)
and Smales (1994). One hundred and fifty nest boxes are located throughout the
floodplain reserve, providing multiple residencies for each breeding colony (Harley
2004a).
The population at Lake Mountain in the northern part of the montane highlands,
approximately 150km north-east of Melbourne, was discovered only relatively recently
during a fauna survey (Jelinek et al. 1995). The Lake Mountain plateau is sub-alpine
woodland dominated by Snow Gum E. pauciflora, with the occurrence of occasional
dense tea-tree (Leptospermum) and Nothophagus thickets in wet gullies. Thirty nest
boxes installed on the Lake Mountain plateau in 2003 are spaced relatively evenly
across the plateau at distances intended to provide a single box per presumed colony
territory (Harley, unpub. data).
Animal sampling and determination of age and breeding condition
Individual possums were sampled at Yellingbo as part of a detailed ecological study
there between 1995 and 2002 (Harley 2006). However, the only animal information
available for this study was the date and weight when genetically sampled. The date, sex
and weight of each animal at first encounter were only recently obtained. The long-term
99
capture histories of each animal are not in an accessible format, and thus could not be
used in this study to 1/ cross reference genetic inferences of dispersal with known
dispersal events, or 2/ check parentage results with known movements of candidate
parents between colonies, or deaths / disappearances of potential candidate parents.
Animals at Lake Mountain were sampled during three visits from 2006 to 2007. At both
sites, animals were removed from nest boxes and aged, sexed and weighed. A small ear
notch was taken for DNA analysis from new animals encountered in nest boxes during
routine inspections. At Yellingbo new captures were tattooed for subsequent
identification, while at Lake Mountain recaptures were identified by the presence of a
single ear notch in the right ear. Animals were aged on the basis of weight as
determined from animals bred in captivity (Smith 1980) and the presence/absence of
long, fluffy fur on the back and rump (Harley 2005). Juveniles typically weigh less than
100g and sub-adults between 100 and 119g. Adults usually weigh over 120g and have
short, dense fur on the rump (Harley 2005).
Breeding condition was determined by the presence of fur staining at the base of the tail
(due to mutual tail licking) and staining of the pouch / scrotal fur. In females with no
pouch young, a loose pouch and elongated teat/s were used to infer past or present
breeding. These characteristics were determined during Smith’s (1980) study on both
captive and wild breeding colonies at Cambarville and are also described in detail, with
photographs, in Harley’s (2005) study. A detailed explanation of life history strategies
and field inferences used to assess breeding can be found in Chapter 1, pages 14-16.
Genotyping and Additional Genetic Marker Development
Whole genomic DNA was extracted and sampled genotyped using 15 loci (Hansen et al.
2005) following the method in Hansen and Taylor (2008).
The total exclusionary power of the 15 loci for the first parent (that is, when neither
parent was known) was 0.9999 for Lake Mountain compared with only 0.9345 at
Yellingbo. This meant that in the latter population the true parent was indistinguishable
in many cases. Therefore, further marker optimisation and development was
undertaken.
100
Two additional loci were further developed from earlier cloning work (Hansen et al.
2005). One of these loci required PCR optimisation with the original primers to increase
amplification performance (GL27B; Hansen et al. 2005). The second, GL1, was
designed from a repeat-bearing clone that only had 20 bases of 5' flanking sequence
between the end of the plasmid (pUC19) and the beginning of the repeat region. GL27B
was amplified at 56oC for 40 cycles using 10pmol of each primer. GL1 was amplified
under the same conditions as other loci (Hansen et al. 2005), with the exception of
touchdown cycling from 62 to 55oC.
Enrichment cloning following the FIASCO protocol of Zane et al. (2002) and was
undertaken to increase the number of loci available for parentage analysis. Between 20
and 200ng of whole genomic DNA was digested with MseI, and ligated with MseI
adapter oligos (5' TACTCAGGACTCAT 3' and 5' GACGATGAGTCCTGAG 3'). Microsatellite
PCR enrichment was achieved using biotinylated oligo probes (GA and CA) and
enriched PCR product isolated using Streptavidin-coated MagneSphere Paramagnetic
Particles (Promega). PCR enrichment produced 112 putative positive clones. Fifty-
seven clones were screened following the method in Hansen et al. (2005) and
commercially sequenced with the universal primers M13 (-20)
(GTAAAACGACGGCCAGT) and M13 pUC (-40) (CAGGAAACAGCTATGAC) on an ABI
sequencer (Macrogen, Korea). Thirty-three microsatellite-bearing sequences were
obtained, most containing either GA or CA repeats, and primers were designed and
tested for all of them. However of these, only three were polymorphic when screened on
20 samples from Yellingbo. Details of the five new loci are given in Appendix 1.
Statistical Analyses
Spatial genetic analyses
To investigate patterns of genetic variation within Yellingbo and Lake Mountain, and to
elucidate general spatial arrangements of groupings of related individuals (on the
presumption that breeding colony members are related), a fine-scale analysis of
population sub-structure was conducted. This was done using the Bayesian clustering
program STRUCTURE (Pritchard et al. 2000), which assigns individuals to clusters
identified on the basis of genotype affinities in conformance with Hardy-Weinberg
expectations.
101
Two methods were used to interpret the number of clusters K in STRUCTURE. The
first, using the author's recommendations (Pritchard et al. 2000) was to compute the
posterior probability of K, (P(KX)) from multiple replicates of each different value of
K. The second method was after Evanno et al. (2005), who use the second-order rate of
change of the ln P(XK), given by the value ∆K. ∆K is computed from the mean and
standard deviation of the ln P(XK) and the maximum value provides the best estimate
of the number of clusters. Clusters identified in STRUCTURE were used to assign
whole colonies to genetic groups or “neighbourhoods” (where possible and biologically
sensible). On some occasions this analysis identified individuals that were members of a
different cluster to their co-colony members, and were thus regarded as putative
migrants.
Where more than one colony contributed to a neighbourhood, a point geographically
equidistant from each nest box was calculated from GPS coordinate data to give the
position of the neighbourhood relative to others within the population. Pairwise FST
values were computed among neighbourhoods / colonies in Arlequin 3.11 (Excoffier et
al. 2005) and tested against a null distribution obtained by 50 000 permutations of
genotypes among colonies. Pairwise FST values were compared against geographic
location in a Mantel test for isolation-by-distance patterns in GenAlEX 6 (Peakall and
Smouse 2006). Standard analyses of molecular variance (AMOVA) computed using
allele frequencies, were performed for genetic groupings (within individuals and within
neighbourhoods / colonies) in Arlequin.
Spatial autocorrelation analyses were performed for each population for each sex
separately using GenAlEX to explore the pattern of spatial genetic similarity and
compare these among populations. Estimates of first generation migration were
computed using a likelihood Bayesian approach in GENECLASS 2 (Piry et al. 2004). The
ratio of the likelihood an individual’s genotype from its sampled colony (L_home)
divided by the maximum likelihood of the sample (L_max) was estimated using the
criteria of Rannala and Mountain (1997), and the probability of the likelihood ratio was
tested against 10 000 simulated individuals. The maximum likelihood method in ML-
relate (Kalinowski et al. 2006) was used to investigate the level of relatedness among all
individuals and used to check the relatedness between multiple adults in each colony, as
well as to independently assess the relatedness of dispersers to animals in their home
(sampled) colony and their source colony.
102
Arlequin was used to calculate the absolute number of migrants M exchanged between
the sub-sections at Yellingbo, based on previous identification of a unique haplotype in
one section (the north) but not the other (Chapter Four). Slatkin's linearised FST, which
is expressed in terms of coalescence times and is inversely proportional to M, was also
calculated in Arlequin.
Genetic disequilibria
Previous work on these populations has identified strong Hardy-Weinberg and linkage
disequilibrium in both (Hansen and Taylor 2008, Chapter Four). These were inferred to
be due to the presence of population genetic sub-structure in the form of both family
(given samples are taken from nest boxes) and geographic structure. To investigate
these disequilibria more closely, the data from Yellingbo were re-analysed
incorporating genotypes from the extra five loci, in addition to more detailed analysis of
the 15 locus genotype database from Lake Mountain. The results obtained from the
STRUCTURE analyses were used to identify sub-groupings of animals in Hardy-
Weinberg equilibrium and to relate those to their geographic location within the
population. Thus, genetic disequilibria were either shown to be real, or were
substantially reduced with population sub-division. To ensure that groupings of related
individuals were not strongly influencing patterns of disequilibria, these analyses were
repeated with juveniles and subadults removed.
Parentage Analyses
Inference of parental / offspring relationships from field data
In all cases at Yellingbo, juveniles under 50g but not physically attached to a teat at the
time of sampling were assumed to be suckled by the breeding female present in the
colony. This is based upon extensive field observations made at Yellingbo by recapture
and inspection of females with pouch young (Harley 2005) and was therefore used to
assign a putative mother for parentage analyses. This provided the opportunity to assess
the reliability (and assumptions) of field indicators of breeding. Juveniles weighing
more than 50g were assumed to be permanently out of the pouch and weaned. The
presence of a single reproductively active female in all colonies at Yellingbo and most
colonies at Lake Mountain meant that for nearly all offspring, identifying the putative
mother was relatively straightforward. In the rare situation where more than one
103
breeding female was present (a single nest box at Lake Mountain), both females were
considered equally as likely to be the putative mother and were analysed accordingly.
As no juveniles under 50g were encountered during nest box inspections at Lake
Mountain, the breeding female in the colony was always assumed to be the putative
mother. The breeding male in each box was assigned as the putative father in all cases.
When there was more than one breeding male present in the colony, then it was
assumed that both were equally likely to be a putative father.
Parentage testing
Parentage analyses were conducted using the software package CERVUS 2.0 (Marshall et
al. 1998). CERVUS simulates a random pool of candidate parents based upon allele
frequencies sampled from a population, and uses a likelihood-based approach to test
putative parents against the simulated parental pool. Number of alleles, observed and
expected heterozygosity, deviations from Hardy-Weinberg expectations, null allele
frequency estimates and per locus exclusionary power were computed prior to
simulations. Parentage assignment power was tested in 10 000 simulations, assuming
100 candidate parents, proportion of population sampled as 0.75 and with a genotyping
error rate initially at 0.010 (default program settings), then again at 0.002 (chosen to
reflect the approximate genotyping error rate, which was estimated from a second re-
amplification of approximately a third of the samples).
All adults in the population at the time a juvenile was sampled were included as
candidate parents. All juveniles sampled in a single year were analysed together as a
"cohort", despite the best definition of a cohort being all juveniles born within a four
month period (based on litter sizes: Smith 1980). This "lumping" of juveniles into year
cohorts was done because the exact start and end dates of a four monthly cohort could
not be accurately defined. This was due to the unavailability of detailed information on
first capture date and weight at the time of analysis. The same strategy was employed
for offspring from Lake Mountain, as the small number of field visits meant that a
different cohort was present each time. This was determined on the basis of some
juveniles being recaptured as adults on subsequent visits. At both Yellingbo and Lake
Mountain, offspring from previous years were included in testing as candidate parents.
For each population, two sets of CERVUS analyses were performed. The first was an
initial parentage screening assuming no prior knowledge of either parent (blind test).
104
This was done primarily to search for the genetically most-likely mother, with an
emphasis placed upon testing the putative mother. Candidate mothers identified in the
blind test were used to guide subsequent choice of the "known" candidate mother in the
paternity testing.
The second analysis was performed including with each offspring the "known" mother,
as defined above, and testing all candidate fathers (not just the putative) against the
mother-offspring dyad. Where a putative mother and the genetically most-likely mother
in the blind test differed, analyses for that juvenile were repeated for each candidate
mother.
ML-relate was used as a complementary assessment to CERVUS of kin relationships
between all individuals in each population. ML-relate differs slightly to CERVUS in
finding the maximum likelihood estimates of relatedness, in the presence of null alleles
(which CERVUS version 2.0 does not), to test putative relationships (PO parent-
offspring, FS full-sibs, HS half-sibs and U unrelated). Generally, relatedness values
over 0.5 were found to correspond to assigned putative parents (see results section).
Yellingbo exclusion criteria
Significantly lower genetic diversity at Yellingbo (Hansen and Taylor, 2008) required a
slightly different approach to excluding putative parents than at Lake Mountain. The
lower resolving power at Yellingbo meant that on many occasions, the true parent was
impossible to distinguish from multiple candidate parents. In the blind test, the
successful discrimination of true parents from false parents using dyadic (mother-
offspring or father-offspring) mismatches was uncommon. Therefore, many exclusions
were made on the basis of another candidate parent having a significantly higher dyadic
LOD score.
In the paternity test, putative fathers were excluded on the basis of two or more dyadic
or triadic (mother-offspring-father) mismatches. In cases where more than one
candidate male had no mismatches, exclusions were made on the basis of a significantly
lower LOD score in combination with an assessment of relatedness between the
candidate parents and the offspring using results from ML-relate.
105
There were two exceptions to these general rules. In the case of a putative father having
a single dyadic mismatch, and the most likely candidate (genetically assigned) father
having no mismatch and a significantly higher LOD score, the putative father was
excluded. These exclusions were also assessed by parent-offspring relatedness in ML-
relate. In the relatively uncommon case of each putative parent having only a single
dyadic mismatch in addition to one or more triad mismatches, the parentage case was
considered not resolved and was removed from subsequent inferences of the mating
system.
Lake Mountain exclusion criteria
The criterion for excluding a putative parent in the blind test at Lake Mountain was two
or more dyadic mismatches. This also applied in the second test of paternity. If a
putative mother was not excluded on the basis of two or more dyadic mismatches, she
was tested in a triad with all candidate fathers. As with Yellingbo, two or more dyadic
or triadic mismatches were considered acceptable bounds for exclusion of a candidate
father. LOD scores were less helpful in resolving paternity as virtually all genetic
assignments, including false parents, were statistically significant even when there were
two or more mismatches. However, the antithesis of this was that exclusion of a false
parent was frequently accompanied by many (four or more) dyadic and triadic
mismatches. A single pouch young large enough to be sampled whilst attached to the
teat (at Lake Mountain) provided a convenient calibration for testing the assignment of
putative mothers.
For both populations, where single or dual dyad or triad mismatch resulted in exclusion
of either putative parent, PCR replicates were performed to check the reliability of the
genotypes of the excluded putative parents, the offspring and the assigned parent/s.
106
Results
Field Work
Sample collection
One hundred and eighty-seven animals were sampled at Yellingbo over four sampling
years, 1997, 1998, 1999 and 2001. Of the animals encountered in nest boxes, 87 were
aged as adults and 102 as juveniles, representing approximately three cohorts a year or
16 cohorts overall. One hundred and fifty-six animals were sampled from nest boxes at
Lake Mountain. Seventy-four animals were aged as adults and 82 as juveniles or
subadults, representing at least three cohorts of offspring.
Patterns in colony composition / cases of multiple adults in a single colony
The animals sampled represented 21 colonies at Yellingbo and 26 colonies at Lake
Mountain. Most were breeding colonies, containing reproductively active adults and
offspring: 18 at Yellingbo and 25 at Lake Mountain. At Lake Mountain, there were two
colonies where one breeding adult was not sampled, and there was a third colony where
no breeding female was present. At Yellingbo, there were four single animal encounters
in a nest box in addition to the 21 colonies sampled. There were no single animal
encounters at Lake Mountain.
At Yellingbo, all colonies made use of multiple nest boxes. The average distance
between the primary nest box of each adjacent colony was 165 ± 44m (Harley 2005).
Detailed information on nest box use and colony structure is available in Harley and Lill
(2007) and Harley (2005). At Lake Mountain, each nest box was only ever used by a
single colony. The average distance between adjacent colonies was 575 ± 93m (n =
106).
Seven (of 18) and eight (of 25) breeding colonies at Yellingbo and Lake Mountain,
respectively, had more than one adult of each sex present at the same time. Of those at
Yellingbo, three contained more than one adult female, one contained more than one
adult male, and three contained more than one adult of each sex. Of the eight at Lake
Mountain, four contained more than one adult male, three contained more than one
adult female, and one contained two adult males and two adult females. The majority of
107
these additional adults (in both populations) probably represent an earlier cohort of
offspring, as few showed signs of reproductive activity.
Statistical Analyses
Spatial genetic analysis
At Lake Mountain where there were 26 colonies, STRUCTURE analysis indicated the
number of clusters to be fourteen (P = 0.999) (Figure 2a). This corresponded to groups
consisting of either a single colony or groups of between two and four adjacent
colonies, which I have termed here ‘neighbourhoods’. The 14 neighbourhoods identified
were separated from their nearest neighbourhood by an average distance of 767m. A
mantel test of isolation-by-distance found a stronger correlation between neighbourhood
pairwise FST and geographic distance (R2 = 0.166, P = 0.008) than between colony
pairwise FST and geographic distance (R2 = 0.116, P = 0.001). Some multi-colony
neighbourhoods appear to have arisen by colonisation of one nest box with dispersers
from nearby boxes (two cases). Others appear to contain established colonies (with a
single breeding pair), among which regular gene flow occurs (six cases), for example,
E13, E14, E15 and N26 (which are separated by an average distance of 791m).
The majority of molecular variance was partitioned within neighbourhoods (82%) and
within colonies (79%). A much smaller proportion of genetic variance was attributable
to differences between colonies (21%) or neighbourhoods (18%). The intra-individual
covariance component of genetic diversity (which takes into account the differences
between genes found within individuals) was largest (within individuals within colonies
93%, and within neighbourhoods 92%).
At Yellingbo, where there were 21 colonies, patterns in spatial genetic clustering were
more difficult to establish, and neighbourhoods were more difficult to define, due to the
appearance of mixing of related animals among colonies. The clustering patterns
identified using STRUCTURE were interpreted twice. Using the posterior probability of
K, the best number of clusters was 10 (Figure 2b). Some clusters corresponded well
with single or multiple colony groups, and thus qualified as neighbourhoods according
to the definition used for Lake Mountain. For example, distinct clusters were
represented by individuals in boxes B2 / B4 and F1 in the north, J1 / J2 / J4 / J5A / K1
and L9 in the centre, and M6 / O2A / O6 / Q3 and O3A in the south. These groups
108
constitute six of the 10 ten clusters identified in STRUCTURE (Figure 2b). However, the
other clusters overlapped substantially in their colony composition, and patterns were
difficult to distinguish. I therefore computed pairwise FST between colonies rather than
neighbourhoods and tested them against geographic distances, which revealed a strong
isolation-by-distance effect (R2 = 0.216, P = 0.001). Partitioning of genetic variance was
similar as for Lake Mountain, with the majority occurring within colonies (78%).
Separate computation of the intra-individual covariance component (92%) was
concordant with the pattern at Lake Mountain.
The second method of interpreting the STRUCTURE results (Evanno et al. 2005)
produced a cluster estimate of two, splitting the population into a northern and southern
section. The approximate location of the split is illustrated in Figure 1b with a red line.
Patterns in spatial relatedness and dispersal
There was significant isolation-by-distance at both locations (Yellingbo: R2 = 0.15, P =
0.001; Lake Mountain: R2 = 0.08, P = 0.001) when individual pairwise genetic distances
were tested against geographic distances between individuals. Furthermore, sex-specific
patterns of spatial autocorrelation differed between each population. At Yellingbo, both
adult males and females were significantly related up to 900 metres (Figure 3a).
However, at Lake Mountain, male relatedness was significant up to 700 metres but
females only up to 500 metres (Figure 3b).
Using GENECLASS, first generation migration by 14 adults was detected between
colonies (at P < 0.05) at Lake Mountain (Table 1). Eight of these had dispersed between
neighbourhoods, and the other six between colonies within neighbourhoods. Males
made up the majority of dispersers, 10 males dispersing an average inter-colony
distance of 1130 ± 990m (range 229 - 2431m) and four females dispersing an average
inter-colony distance of 783 ± 921m (range 255 - 2158m).
At Yellingbo, GENECLASS analysis detected 50 first generation migrants (at P < 0.05).
Thirty-three of these were adults at the time of genetic sampling, eight female and 25
male (Table 1). The remaining 17 putative first generation migrants corresponded to
animals first genetically sampled as juveniles (males: n = 5; females: n = 4) or sub-
adults (males: n = 1; females: n = 7). Four of the juveniles were under 50g when
genetically sampled (one male and three females), meaning they were not yet weaned.
109
Any immature identified as a disperser that bred (see parentage analysis below) was
included in inter-colony distance calculations (one male juvenile and four female sub-
adults). The average inter-colony distance dispersed by males was 654 ± 573m (range
141 - 2824m, n = 26) and by females was 634 ± 515m (range 123 - 1795m, n = 12).
There were three dispersal events between the northern and southern section of the
reserve at Yellingbo, one by an adult male, one an adult female and one a juvenile. Both
the adults dispersed from colony M6 (northern-most colony in the southern section).
The female dispersed to nest box J1 (in the upper-middle of the reserve) but does not
appear to have bred there. The male dispersed to nest box L5 (in the middle of the
reserve) and subsequently bred there (producing at least two offspring to the same
female). One of his male offspring dispersed from L5 back to M6 and sired a minimum
of three offspring there with the same female (herself a migrant from nest box O6 in the
south of the southern section). Analysis of the absolute number of migrants M
exchanged between the northern and southern sections was 1.7. The Arlequin estimate
of pairwise FST between the two regions was 0.23 (P < 0.00001). Slatkin's linearised FST
was 0.294, reflecting the low inferred migration rate.
Dispersal and recruitment appears to account for the colonisation of one nest box at
Yellingbo and at least two nest boxes at Lake Mountain. At Yellingbo, nest box Q3
appeared to have been colonised by a dispersing male from colony O6 (694m away),
although the accuracy of this genetic inference cannot be verified at this time. At Lake
Mountain, box N29 was colonised by a female from N30 (262m away), who paired with
a male from somewhere in the area of C23 (>2.5km away) or an unsampled colony
between and west of, S3, C23 and N28/N29/N30 (inferred on the basis of the
distribution of clusters). Nest box C7 appears to have been colonised after E16 (distance
between 517m), probably by offspring of the breeding pair in E16.
Genetic disequilibrium and the potential for null alleles
Significant Hardy-Weinberg and linkage disequilibria (57% of locus pairs at Yellingbo,
27% at Lake Mountain) have previously been reported at both Lake Mountain and
Yellingbo (Hansen and Taylor 2008, Chapter 4). Significant homozygote deficits, which
contributed to the strong signal of HW disequilibrium, were detected at locus GL35
(Lake Mountain) and loci GL4 and GL19B at Yellingbo, following Bonferroni
correction.
110
To explore the possibility that Hardy-Weinberg and linkage disequilibria were the result
of population sub-structure, genotype frequencies and allele correlations were re-
analysed separately for each of the northern and southern sections at Yellingbo. Linkage
disequilibrium was reduced to 8% and 11% of locus pairs in the north and south,
respectively. Only a single pair (GL19B and GL42) was shared between north and
south. Hardy-Weinberg disequilibrium remained at locus GL19B in the northern section
but none was detected in the southern section.
This analysis was also done at Lake Mountain, although the choice of "sub-populations"
was somewhat more arbitrary. Nest boxes were allocated to four groups, southern,
central / eastern / western, north-western and far-eastern (see also Chapter 4). Linkage
disequilibrium was reduced to between 0% (far-eastern group) and 9% (central / eastern
/ western) of locus pairs. Four locus pairs were shared between regions, GL6 / GL19B,
GL1 / GL28 and GL19B / GL42 between the southern and central regions, and GL35 /
DT1 between the southern and north-western regions. This grouping of colonies into
four regions was also tentatively supported by the presence of unique haplotypes in two
regions (north-western and far-eastern) (Chapter 4).
Null alleles are commonly reported as a cause for genetic disequilibrium, and may
interfere with the accuracy of parentage assignments. The data were explored in some
detail to determine if null alleles were a potential cause of homozygous excess. None of
the 357 animals failed to amplify for any locus, precluding the presence of null
homozygotes. This would suggest that null alleles may be sufficiently rare as to have
little impact on Hardy-Weinberg equilibrium, suggesting that null homozygotes are
rarer than 1 in 357 (that is, p2 < 0.003), which means that p (null allele frequency) must
be less than 0.053.
ML-relate was used to compute null allele frequency estimates of GL35 (Lake
Mountain), GL4 and GL19B (both Yellingbo). The null allele frequency estimate of
GL35 is 0.203, GL4 is 0.098 and GL19B is 0.038. It is possible that a null allele at
either GL4 or GL19B may not have been detected in its homozygous state at Yellingbo
(GL4 0.098×0.098 and GL19B 0.038×0.038 corresponds to four and fewer than one
individual, respectively, failing to amplify at this locus), but the likelihood of a null
allele at a frequency of 0.203 (GL35) never appearing in a homozygous state must be
111
extremely low (0.203×0.203 corresponds to approximately seven individuals).
However, there were 10 cases of a single mismatch that may have been caused by the
presence of a single null allele at GL35. This confirms that the presence of single
mismatches in some parentage cases may not necessarily be due to undetected
genotyping errors.
The removal of known offspring (juveniles and subadults) did not significantly alter the
overall patterns of disequilibria. A different suite of loci were found to deviate from
Hardy-Weinberg expectations and showed significant linkage disequilibrium. However,
substantial reductions in disequilibria still resulted when adults were grouped according
to their spatial distribution, further supporting the notion that this effect was not the
result of null alleles or genotyping errors.
112
Parentage Analyses
CERVUS analysis and the power of assignments
Allelic diversity and expected heterozygosity were lower at Yellingbo than at Lake
Mountain, averaged over all loci (Table 2). Appendix 2 gives the per locus estimates of
number of alleles, observed and expected heterozygosity, exclusionary power,
polymorphic information content and null allele frequency estimates for each
population.
The exclusionary power of the CERVUS algorithm at Yellingbo increased from 0.935 to
0.976 with the addition of the five new loci. This had less effect on statistical power of
LOD scores than did decreasing the genotyping error rate in simulations. Decreasing the
genotyping error rate resulted in more assignments being supported at a higher level of
confidence, but did not alter the nature of those assignments.
Assignment success in the blind test was generally poor, especially at Yellingbo. The
proportion of offspring assigned the putative mother in the blind test was 0.56 at
Yellingbo, and at Lake Mountain was 0.63. Using only the original 15 loci (those shared
with the Lake Mountain database) for the Yellingbo sample, this success was even
lower (0.19). The assignment of previous year's offspring as the most likely candidate
parent was the primary cause for this relatively low success. It was therefore important
to individually check every CERVUS assignment in both the blind test and the paternity
test (by searching for triad mismatches between all non-excluded candidate parents) and
not rely solely on ∆ LOD scores.
Yellingbo
Paternity assignment success
Of the 102 juveniles sampled at Yellingbo, 94 (91.2%) were assigned as the offspring of
the putative mother and 70 (68.6%) as the offspring of both putative parents (Table 3).
Of the 24 offspring where the putative father was not assigned as the most likely male
parent, in 18 cases (17.6%) he was excluded on the basis of two or more mismatches
and in six cases (5.9%) the true father could not be determined (Table 4). A detailed list
of every offspring, its putative and genetically assigned parents, LOD scores and ML-
113
relate r values between offspring and their assigned fathers, and details of mismatches is
given in Appendix 3.
There were only three (out of 96) cases where the putative mother was excluded as a
candidate mother in the blind test and the paternity test. The first was excluded on the
basis of six dyadic mismatches. The second was excluded on the basis of a single dyadic
mismatch and three triadic mismatches with the putative father. The third was excluded
on the basis of two triadic mismatches with candidate father plus a significantly lower
LOD score (assigned mother had no triadic mismatches with the candidate father).
Case studies from paternity analyses
There were two cases where the putative father was excluded and the assigned father
was from a different colony (Table 4). The first case represents a departure from
monogamy and is discussed in this context later (under Tests for departures from
monogamy - see below). The second was a male that bred in colony L9 from late 1997
to mid 1998, and then appears to have departed that colony (on the basis of the genetic
results) and moved north to G3 (692m) where he sired a single offspring at the end of
1999. Results from ML-relate suggest that his relationship to the first offspring (colony
L9) is either full-sib or parent-offspring, and that the second (colony G3) is either a half-
sib or full-sib.
There were four cases where the putative father was excluded and the assigned father
was another colony member - that is, a male other than the breeding male in the nest
box at the time of sampling (Table 4). Three of these cases were all from the same
colony, but in all four cases the assigned father had a statistically higher LOD score
(95% confidence) than the putative, although the putative was not excluded on basis of
dyad mismatches. At this time it is not known if each male was reproductively active
according to the field data, when his offspring was born (information unavailable).
Relatedness between candidate parents
The average relatedness between putative parental pairs was high (r = 0.31 ± 0.24) and
exceeded the threshold for full siblings (0.25, Kalinowski et al. 2006). Relatedness
between genetically assigned parents was slightly lower (r = 0.28 ± 0.23), but still
above the full sibling threshold. This confirms that there is inbreeding at Yellingbo, as
indicated by the lower expected heterozygosity (HE = 0.55) compared to Lake Mountain
114
(HE = 0.79). However, when colonies are analysed as separate “populations” in
Arlequin, there is an observed heterozygote excess (HO = 0.59 ± 0.06, c.f. HE = 0.50 ±
0.07) and negative values for FIS (between -0.08 and -0.38 per colony, average is -0.20)
in every colony, suggesting non-random mating.
There were 11 cases of juvenile males from a previous cohort being assigned as the
most likely father of offspring (in a different colony to their natal one). The first five of
these paternities were assigned to one male, who was one of three inferred dispersers
between the northern and southern sections of the reserve. These five were the only
supported cases (that is, no mismatches, statistically higher LOD scores and high
relatedness values). The assigned father was first encountered in February 1997 at 33g
(less than four months old) and first bred in November 1998. He was therefore
approximately two years old when he first bred. This is within the range (males:
26±9mo, females: 29±10mo) of the approximate age at first breeding estimated from
successful parentage assignments (Table 2).
The other six cases (out of the 11) were not strongly supported as true fathers. Four
could be excluded outright on the basis of information on encounter histories. In each
case, the assigned father was first encountered as a sub-adult after the offspring in
question was encountered. The remaining two cases were obscure. The offspring in
question were litter mates, either half-sibs or full-sibs (r=0.56), which would ordinarily
suggest that they should have the same parents. They were both assigned different
fathers (both father sexually mature by the time they were first encountered). However,
the father of these candidate fathers (which would be the grandfather of the litter mates)
was a genetically assigned as a candidate father of the litter mates but having a
significantly lower LOD score than his sons. It is therefore more likely that he is the
true father and his relatedness to his sons has masked this assignment.
The above six cases highlight the difficulty in assigning paternity in a population with
low genetic variation and relatively high levels of relatedness among individuals. The
average relatedness between putative parents was r = 0.31 ± 0.24, and between assigned
parents was r = 0.28 ± 0.23. Any of these cases could represent potential extra-pair
matings but without more discriminating power in the genetic data set or more detailed
information from recapture data, they cannot be resolved.
115
The case of movement of breeding individuals and successful dispersal events
There were two cases where the genetic data suggest a male changed colony whilst still
breeding, and sired offspring in both locations. Both changes appeared to represent
permanent moves and were to colonies in the neighbouring area (one 230m and the
other 690m). In neither case was another breeding male recorded in the colony at the
same time. There were no similar cases recorded at Lake Mountain.
Dispersal was found to result in a successful breeding event in approximately 50% of
cases. Of the 50 male and female dispersers detected by GENECLASS, 12 males were
identified as fathers and 10 females were identified as mothers in the parentage analyses
(Table 1). None of the juveniles detected as first generation dispersers, bred whilst still
“immature”, and were all over two years old when they bred.
Lake Mountain
Paternity assignment success
Of the 79 juveniles and sub-adults encountered co-habiting with a breeding pair at the
time of sampling, 76 (96.2%) were assigned as the offspring of the putative mother and
60 (76.0%) as the offspring of both putative parents (Table 3). These were very similar
rates to those obtained for Yellingbo. Of the 16 offspring where the putative father was
not assigned as the most likely father, in all cases he was excluded on the basis of two
or more mismatches (Table 4). Appendix 3 details assignments for every offspring.
There were only three occasions where a putative mother was not assigned as the most
likely mother. In one of these cases the mother was not resolved owing to a two dyadic
mismatch with one of three offspring in the colony (E16). In the other two cases, the
most likely mother was not sampled.
Of the 76 cases where the putative mother was not excluded, there were 16 cases where
the putative father was excluded. Owing to the higher resolving power of the genetic
data I could determine that the true male had not been sampled on 11 occasions (as
opposed to only two at Yellingbo) (Table 4). In the remaining five cases where the
putative father was excluded the true father was not known, although it is highly
probable that he was also not sampled. These five cases involved offspring from three
colonies. One colony (E13) contained two offspring and represents a potential case of
116
extra-pair paternity, discussed in more detail below. Two offspring from colony E15
were the first young sampled there (and therefore the oldest on the basis of weights: 103
and 74g) and clearly have a different father (but the same mother) to later offspring.
This suggests a change in breeding partners by the mother. The remaining offspring, in
colony C11, has a high relatedness with the putative father (r = 0.64). However, the
putative father has a single dyadic mismatch and five triadic mismatches with the
putative mother. He may be an offspring from a previous cohort (although he is not
related to the putative mother r = 0.0), suggesting the true father was elsewhere at the
time of sampling.
Dispersal resulting in breeding
Of the 14 males and females detected as first generation migrants, five males were
identified as fathers in the paternity analysis, and two females were identified as
mothers. A third female was detected as a disperser and was carrying a tiny pouch
young at the time of sampling. She appeared, on the basis of her pouch (still unstained
and quite tight, normally taken to indicate nulliparous females) to be a first time breeder
and was excluded as a candidate mother of the offspring in her colony in the blind test.
All eight dispersers bred in the colony they emigrated to (although this is not known for
certain in the case of the first time female breeder, as no sample was collected from the
pouch young).
Relatedness between candidate parents
The average relatedness between putative parental pairs was much lower at Lake
Mountain than at Yellingbo (r = 0.11 ± 0.14) and was lower still between genetically
assigned parents (r = 0.08 ± 0.11). Of the eight colonies containing multiple adult males
and / or females at Lake Mountain, four appeared to contain an earlier cohort of
offspring, usually identified as offspring of the breeding pair in the box by the ML-
relate method (data not shown). One box contained three adult females. One of these
was (presumably) the dominant breeding female as she was carrying a pouch young at
the time of sampling and was the genetically assigned mother of the young in the
colony. The other two females appeared to be offspring from an earlier cohort, both
having no signs of reproductive activity, and both being related to the other colony
members (r > 0.35). The last three colonies all contained an extra adult male who was
unrelated to the other animals in the box at the time of sampling. In one of these cases,
the extra male was identified as a disperser from a distant colony.
117
Tests for departures from monogamy - Yellingbo and Lake Mountain
There were indications of extra-pair paternity in two cases (both at Yellingbo) where
more than one male sired offspring from different litters to a single breeding female in a
colony. Both the putative and the most likely candidate fathers had no mismatches
(dyad or triad), but the putative father had a significantly lower LOD score than the
most likely candidate father (offspring 1 ∆LOD = 2.72 and offspring 2 ∆LOD = 0.47, at
a confidence of 80%). In both cases the breeding male was present in the box with the
female at the time of sampling. In the first case the most likely father was another adult
male present in the box and in the second, the most likely father was a breeding male in
an adjacent colony (310 metres away).
There were two cases representing a potential switch between breeding males by the
breeding female. There was one case each at Lake Mountain and Yellingbo where a
putative father was excluded for one offspring but not for another of similar weight (and
therefore, likely to be litter mates). At Lake Mountain, three cohorts of offspring were
encountered in colony E13. The putative mother was assigned maternity of all, but the
putative father was excluded as the most likely father of the first and last cohort (on the
basis of five and three dyadic mismatches), although he was assigned as the father of the
second cohort. Paternity of the first and last cohorts potentially represents an extra-pair
mating by the female, although the absence of an assigned father (who may not have
been sampled) in these cases means this cannot be confirmed.
There was a potential example of mate switching by a female at Yellingbo involving
one pair of offspring (colony M6, both offspring weighing 32g) that are litter mates.
This is the single case example of an offspring (Y032) dispersing between the northern
and southern sections of the reserve, and he went onto reproduce in his father's natal
colony. In this example, his father (Y031) is assigned as the most likely male parent of
one litter mate, and the son (Y032) is the most likely father of the other. However given
that the son fathered the other five juveniles in that colony (to the putative mother), this
assignment seems questionable.
118
Patterns of breeding in colonies containing multiple adults - Yellingbo and Lake
Mountain
Seven (of 18) and eight (of 25) breeding colonies at Yellingbo and Lake Mountain,
respectively, had more than one adult of each sex present at the same time. In most
cases, one adult bred and the other/s did not. At Yellingbo, there was one colony
containing more than one female and one colony containing more than one adult of both
sexes. On both colonies, both / all females bred, usually in different boxes at different
times. There was one colonies that had multiple females and males. In this case, one
female was the mother of all but a single offspring, and two of the males bred four years
apart with two different females (one the female breeding in the colony and the other a
matured offspring from a nearby colony). There were no cases at Lake Mountain where
more than one adult male in a colony was breeding at the same time.
119
Discussion
For threatened and range-restricted species such as Leadbeater's possum, cryptic
barriers to gene flow and mating opportunities will dictate the ability of a population to
persist in the face of habitat loss and fragmentation. This is particularly important for
Leadbeater's possum because the species is rare and populations are threatened with
further loss of habitat due to the ongoing collapse of old-growth ash trees containing
natural nesting hollows (Lindenmayer 2000). I found that Leadbeater’s possum colonies
form distinct genetic clusters, which experience limited genetic exchange with their
neighbours, such that neighbourhoods / colonies are relatively homogeneous patches
(Diniz-Filho and Telles 2002). Cryptic barriers to gene flow exist that strongly influence
these discrete groupings of related individuals. The social dynamics within kin groups
and reproductive dominance hierarchies are the most likely cause of this crypsis.
Discrete clustering of kin groups mimics a meta-population style of structure, and may
reflect the general structure of populations of colonies across the wider montane
landscape. Given that in an unfragmented landscape, Leadbeater's possum exists as a
meta-population of genetically discrete neighbourhoods or colonies, the effects of
fragmentation may disrupt colony formation and breeding success compared with a
uniformly-distributed randomly-mating population.
Spatial patterns in genetic variation
At Lake Mountain, clusters or "neighbourhoods" of colonies appeared to describe
spatial genetic variation better than colonies alone. In some cases neighbourhoods
comprised a single colony and in others several different colonies, some of which
exchanged migrants. The genetic variance component attributed to intra-neighbourhood
differences (82%) was similar to intra-colony differences (79%). Furthermore,
differences within individuals within neighbourhoods / colonies were even higher (92%
and 93%, respectively). This partitioning of genetic variance and the general structuring
of single or multiple colonies into neighbourhoods is similar to polygynous black-tailed
prairie dogs, which occur in wards of one or more coteries having an intra-coterie
variance component of 80-85% (Dobson et al. 1998). One or several wards occur in
largely isolated sub-populations that tend to be patchily distributed across the short-
grass prairie landscape. In both species, social / kin groupings are observed to exert a
strong influence on population sub-structure regardless of life history strategies.
120
Social behaviours that affect breeding may have a substantial influence on gene
dynamics within populations (Pope 1992, Dobson et al. 1998) . More than one adult
Leadbeater’s possum female of breeding age can be present in a colony, but only one
female ever appears to breed at any one time (Smith 1980, Harley 2005, this study).
This is thought to be a form of reproductive repression by the breeding female, and may
be indicative of a strong matrilineal dominance hierarchy. In concordance with these
observations, I found that dispersal does not appear to be hindered by any features of the
landscape, but limitations still exist that restrict migration and subsequent breeding.
Given the discrete structuring of colonies and neighbourhoods, it is therefore possible
that meta-population diversity is maintained by imposition of strict social dynamics
(leading to non-random mating within groups of colonies). A similar pattern of genetic
variation has been identified in red howler monkeys (Pope 1992), and emphasises the
importance of intrinsic factors (social barriers) in mediating intra-population gene flow.
Sex-biased patterns in dispersal
Dispersal distances inferred by the genetic data (based upon inter-colony movements)
exceeded published estimates based upon radio tracking and recapture data. At
Yellingbo, 48 dispersal events were detected (Harley 2005), closely matched by the
inferred dispersal events using the genetic data. The dispersal distances reported in the
field study were similar in both sexes (males: 495 ± 348m, n = 33; females: 407 ±
298m, n = 23), although males tended to undertake the majority of dispersal events
(Harley 2005). This was attributed to male-biased primary sex ratios and higher
mortality in females at weaning. At Cambarville, where the study population resided in
natural nesting hollows, dispersal did not appear to exceed 400m (Smith 1984b).
My study found the average dispersal distances of males at Lake Mountain was 1130 ±
990m (range 229 - 2431m, n = 10) and of females was 783 ± 921m (range 255 - 2158m,
n = 4). At Yellingbo, the average distance for males was 654 ± 573m (range 141 -
2824m, n = 26) and for females was 634 ± 515m (range 123 - 1795m, n = 12).
Interestingly, these estimates were not reflected in the spatial autocorrelation analyses.
This is discussed in more detail below. Consistent with earlier field studies, the genetic
data indicate more frequent male-biased dispersal events occurring over greater
distances than female dispersal events.
121
The shorter dispersal distances at Yellingbo compared to Lake Mountain, probably
resulting from the higher densities of colonies, means that recruits do not need to travel
as far to exit their natal territory. However, this also means that finding breeding
vacancies will be more difficult and fewer animals probably get an opportunity to fill a
breeding position. This is reflected by the relatively lower effective population sizes at
Yellingbo, which were between six and nine times less than at Lake Mountain (Chapter
4). This supports earlier observations that the population at Yellingbo is likely to be
close to carrying capacity and recruits must wait for the death or displacement of a
dominant breeding animal to gain access to breeding opportunities (Harley 2005). At
Lake Mountain, there are probably still many empty territories available in which
dispersers can establish new colonies, without coming into direct competition with a
resident dominant pair.
The maximum inferred dispersal distances did not differ much between Lake Mountain
and Yellingbo (males around 2.5km and females around 2km), despite the restrictions
placed upon dispersal beyond the reserve boundaries at Yellingbo. However, both
estimates substantially exceed those previously reported, which is 1460m (Harley
2005). At Yellingbo, a single movement between Cockatoo Creek and a nearby smaller
stem (Woori Yallock Creek) was detected during the field study and was thought to be
highly unusual, both in its magnitude (1100m) and apparent occurrence across open
messmate Eucalyptus obliqua woodland (Harley 2002). This was confirmed as a
dispersal event via genetic analysis and the disperser’s natal colony was identified as
one in the centre of the reserve. In his study at Cambarville, Smith (1980) did not assign
any value to maximum dispersal distances, probably owing to the extreme difficulty in
following tagged animals through ash forest. Therefore, this study has provided
important information about dispersal distances that is difficult to obtain in field studies,
and finds that they are clearly much further than previously thought.
There is a risk that dispersal distances may be over-estimated relying on data collected
from colonies using nest boxes, as colonies at Lake Mountain only use a single nest
box. The effective territory size of each colony at Lake Mountain may be quite different
to the area described by distances between adjacent nest boxes (575 ± 93m), and the
location of other den sites is not known. Territory size at Cambarville was between 1.3
and 1.9ha (Smith 1984b). This suggests that colonies are more dispersed at Lake
Mountain, but that they may also have larger territories. This could be an artefact of nest
122
boxes or may reflect resource quality differences between sites. In the absence of a
comparative genetic study on a population using natural nesting hollows, the degree to
which the use of nest boxes affects dispersal distances cannot be determined.
Nevertheless, the estimates of dispersal obtained here suggest that animals are capable
of moving larger distances if necessary.
Sex-biased patterns in spatial relatedness
Both males and females were significantly positively related over very different
distances at Lake Mountain compared with Yellingbo. At Lake Mountain, the average
inter-colony dispersal distance of males and females (~1130 and 730m) exceeded the
distance over which animals were positively related (700 and 500m). At Yellingbo, the
opposite occurred whereby the average dispersal distances were slightly lower than
positive spatial relatedness (~650 c.f. 900m). The estimates at Yellingbo were similar to
field obtained estimates in that males and females disperse approximately the same
distance. However, this was not the case at Lake Mountain, where males dispersed
greater distances than females. Furthermore, the spatial autocorrelation analyses
indicated that females are structured over shorter distances than males, as well as
substantially under-estimating dispersal distances. This suggests that using spatial
autocorrelation alone to infer dispersal may be erroneous. It also suggests that some
ecological aspect/s of Lake Mountain differ substantially from Yellingbo, possibly the
nest box placement but potentially the lack of continuous suitable habitat for dispersal
and recruitment at Yellingbo. Therefore, if animals were able to move beyond the
boundaries of the reserve at Yellingbo to breed, the effective population size might be
larger and the reproductive output higher.
There are three site characteristics that might cause this difference between dispersal
estimates obtained for each population. One, the area available to colonies to establish
their territories is much larger at Lake Mountain, (the sub-alpine plateau is
approximately 950Ha (S. Smith pers comm.) compared with the riparian reserve at
Yellingbo, which is 640Ha). Two, colonies are more spread out at Lake Mountain,
possibly because of nest box placement. Three, the isolated nature of the population at
Yellingbo means that average relatedness among individuals is much higher than at
Lake Mountain. Provision of extra habitat at Yellingbo by revegetating adjoining
habitats for example, might alleviate the high relatedness between individuals through
simple population expansion. The second factor (dispersion of colonies at Lake
123
Mountain) suggests that the placement of nest boxes may have a significant impact on
patterns of relatedness among colonies. This should be investigated further as current
management programs for Leadbeater's possum involve installation of nest boxes at
sites where hollow-bearing trees are lacking (Harley pers. comm.). The third factor is an
artefact of isolation and highlights the inbreeding risks faced by this population.
The risk of inbreeding has been previously highlighted for Yellingbo on the basis of the
low observed heterozygosity and allelic diversity (Yellingbo 3.4 c.f. Lake Mountain
11.2) (Hansen and Taylor 2008, Chapter Four). This study has found relatedness
between genetically assigned breeding pairs (0.28 ± 0.23) at Yellingbo to exceed the
threshold for full siblings (0.25). Furthermore, there were 13 breeding pairs who had a
relatedness of 0.5 or higher. This high relatedness between breeding pairs is clearly not
peculiar to colonies in nest boxes or to the species in general, as relatedness between
breeding pairs at Lake Mountain was much lower (0.08 ± 0.11). Therefore, this is the
first substantive evidence for inbreeding at Yellingbo, and occurs despite the signs of
inbreeding avoidance (suggested by the observed heterozygote excess and negative FIS
in each colony). Lake Mountain also exhibits the same patterns of heterozygosity and
negative FIS in colonies and in neighbourhoods. This demonstrates that social dynamics
are strictly regulated for the maintenance of outbreeding and reduction of instances of
breeding with relatives. Nevertheless, the strict regulation of breeding at Yellingbo is
failing to minimise inbreeding, which is an evitable consequence of isolation.
Admixture disequilibria and the Wahlund principle
The presence of discrete clusters / neighbourhoods produced very strong patterns of
genetic disequilibria at both sites. These patterns were not attributable to high frequency
null alleles (although there were a few cases where null alleles may have been present,
resulting in ambiguous parental assignments). Disequilibria were also unlikely to be
attributable to physical linkage between loci, since the same pairs of loci were not
involved in disequilibria at multiple sites. Instead, I concluded that both linkage
disequilibria and homozygous excess, the latter being a Wahlund effect, were due to
underlying population sub-structure at each site.
Significant population differentiation may occur as a result of barriers or restrictions to
gene flow (Frankham et al. 2004). At Yellingbo, one of the only two haplotypes
identified occurs only in a small number of individuals in the northern half of the
124
reserve (Chapter Four). This suggests little historic genetic exchange between the two
regions within the reserve. Furthermore, when treated as separate populations, the two
regions are approximately in Hardy-Weinberg equilibrium.
STRUCTURE analyses inferred the presence of this north / south differentiation. Analysis
of number of migrants in Arlequin indicates that the northern and southern demes
exchange few migrants and pairwise FST between the two demes is substantial (> 0.25).
However, both STRUCTURE and GENECLASS have indicated recent gene flow between
nest box M6 in the south and L5 in the north (666m apart).
The two dispersal events (that resulted in F1 offspring) between colonies L5 and M6
implies an effective dispersal rate over the period of the study between northern and
southern sections as two animals over five years or 0.8 individuals per generation. The
rule of thumb for maintenance of outbreeding is one migrant per generation (Bouchy et
al. 2005). Therefore, either the migration rate detected in this study is below the
minimum required to homogenise the two sections over long time periods, or the two
sections represent historically isolated populations that have recently come into contact,
a situation known as Wahlund breaking. If the latter is true, a reduction in average
homozygosity in the fused sub-population would be expected (Hartl and Clark 1997). A
simple test of heterozygosity excess relative to that expected at mutation-drift
equilibrium was performed in BOTTLENECK (Cornuet and Luikart 1996), and found no
significant excess in either the northern or southern sub-populations. Given the very low
probability of sampling a population right at the moment of isolate breaking, and the
history of land clearance in the area (probably being well over 100 years) meaning that
this population has been restricted to the riparian reserve for a long time, it is unlikely
this represents a case of Wahlund breaking. Instead, migration resulting in successful
reproduction between the two sections probably occurs very rarely and that cryptic
inhibitions exist that prevent regular gene flow. This crypsis is most likely caused by the
strict social dynamics in colonies.
The mating system and the reliability of ecological inferences of breeding
There was little evidence for departures from monogamy. In less than 5% of cases were
there signs of extra-pair matings. There were potentially more cases, but the inability to
distinguish between false mismatches (due to null alleles, genotyping error or mutation)
and un-sampled candidate parents meant that these cases were not resolved. However,
125
the mating system at Yellingbo does not differ to that at Lake Mountain. Thus, neither
isolation of the Yellingbo population, nor the paucity of empty territories for dispersing
recruits appear to affect the mating system.
At Yellingbo, there were eight dominant pairs with long histories of breeding
association, inferred from recapture data (Harley 2005). Of these, at least four were
thought to have bred for five or more years (Harley and Lill 2007). On the basis of the
genetic data, five of the eight pairs, all in different colonies, parented offspring for a
minimum of two years (calculated using the age of first capture of each offspring) and a
maximum of three years. The best evidence for extra-pair paternity was during the
breeding association of one of these pairs. Two of the eight pairs produced offspring
together for less than 12 months and the eighth pair never reproduced together.
Therefore, breeding associations for up to three years are supported, but no evidence
was found for longer associations.
At Yellingbo, putative maternity was supported in all cases where offspring were
deemed to be still suckling (that is, <50g). Furthermore, there were only three cases (out
of 33) involving older offspring (>50g) where the putative mother was excluded as the
most likely parent. The use of these same indicators to infer maternity at Lake Mountain
is therefore retrospectively justified and those indicators can be reliably used to assign
maternity in virtually all situations where a juvenile is found co-habiting with the
breeding female.
Field studies have identified various examples of additional adults (to the breeding pair)
in breeding colonies (Smith 1980, Harley 2005). In most cases at Lake Mountain where
there was more than one adult male in a colony, all but one of the extra males were
unrelated to any other member of the colony. This is similar to the inferences -
presumably based on re-capture history - made by Smith (1980), in the frequent cases
he encountered more than one adult male was in a colony. Where more than one adult
female was present at Lake Mountain, approximately half of the time she was an
offspring from a previous cohort and the other times was unrelated (and a probable
immigrant).
126
The role of nesting sites in structuring populations
The pattern of spatial genetic structure differences between Lake Mountain and
Yellingbo, such that kin groups occurred in more discrete clusters at the former and
positive relatedness was over shorter distances. These differences suggest that the
spacing of artificial nesting hollows may have a significant effect on population sub-
structure and that clustering of animals into kin groups will coincide with den
availability. Lindenmayer (2000) showed that factors influencing distribution of
Leadbeater's possum at one scale inform processes at another (from the local patch scale
through to the ash-type montane landscape scale). Den availability appears to underpin
population genetic structure at all scales, from local colonies to meta-populations.
In a natural system of tree hollows, it is reasonable to expect that kin groups may be
more scattered and neighbourhood boundaries to be more strongly defined. It is unlikely
that this will ever be testable in a population using tree hollows, as Leadbeater's possum
are extremely difficult to capture (Smith 1980, Lindenmayer and Meggs 1996, Harley
2004a). Nest boxes typically provide the only reliable access to animals for the purposes
of genetic sampling and investigation of colony composition. Therefore, our
conclusions about meta-population genetic structure will be necessarily extrapolated
from data collected through nest box studies. However, this in itself provides useful
information about the role of nesting opportunities in structuring populations of this
species.
Management implications
Radio tracking studies conducted on Leadbeater's possum in montane ash forest
highlighted the importance of a clear understanding of life-history strategies
(Lindenmayer and Meggs 1996). In that study, the spatial distribution of colonies was
considered critical for management of the species in ash forest, because, at the time of
the study, timber harvesting activities were prohibited within 50m of sightings of the
species (Macfarlane and Seebeck 1991). It was noted at the time that up to 100m might
be more realistic. My study has confirmed that average movements are in the order of
hundreds of metres or more, and that movements over 2km can be expected to occur.
However, genetic variability tends to be concentrated into discrete patches, which are
distributed across the landscape as a mosaic of kin groups dictated by den availability.
The implications of this meta-population style of structure is that population
“boundaries” will be difficult to delineate, and what may at first appearance constitute
127
continuous permeable habitat may in fact be punctuated with cryptic barriers to
dispersal and recolonisation. This will have consequences for managing the effects of
habitat fragmentation by physical barriers like roads, fire breaks and logging coupes.
The use of two populations reliant on nest boxes highlights the critical importance of
den site availability and their role in meta-population structure, distribution and
likelihood of persistence.
128
Table 1.
Details of first generation dispersal at Lake Mountain (a) and Yellingbo (b). -LOG
(Lhome / Lmax) gives the ratio of the likelihood of a putative disperser originating
from the colony they were sampled in (home) divided by the maximum likelihood
of the sample. p is the observed probability of that likelihood ratio. The distance
moved refers to the distance between home and source colonies. Average r to
source / home is the average relatedness (calculated in ML-relate) of the putative
disperser to all members of a source / home colony. Breeder in home colony is
determined on the basis of the parentage analyses.
(a) LAKE MOUNTAIN
MALEShome colony
source colony
-LOG (Lhome /Lmax)
pdistance
moved (m)average r to source
SD r to source
average r to home
SD r to home
weight at genetic
sampling
breeder in home colony?
LM66 C10 C11 10.939 0.001 310.5 0.526 0.023 0.207 0.2342 133 YLM85 C6 N26 5.19 0.0 2430.7 0.202 0.334 0.223 0.4356 142 NLM48 E13 C11 0.412 0.041 559.0 0.353 0.307 0.214 0.2125 153 YLM132 E13 E15 8.307 0.0 549.9 0.147 0.104 0.038 0.0424 134 NLM45 E14 E13 5.848 0.001 332.3 0.333 0.133 0.393 0.2469 148 YLM57 E17 S1 17.781 0.0 2102.3 0.146 0.123 0.000 0.0000 131 NLM92 N26 C6 6.492 0.0 2430.7 0.216 0.320 0.133 0.2060 142 YLM97 S1 E17 3.313 0.0 2102.3 0.104 0.186 0.033 0.0581 143 NLM31 S3 S2 2.144 0.001 228.5 0.462 0.145 0.409 0.2542 145 YLM42 S5 S4 16.643 0.0 255.0 0.504 0.116 0.167 - 136 N
MEAN 1130.1 0.299 0.179 0.182 0.188FEMALESLM50 C11 C9 2.492 0.008 455.7 0.138 0.075 0.213 0.3012 150 YLM143 N29 N30 10.203 0.0 262.2 0.607 0.074 0.375 0.2500 128 YLM100 S2 E17 6.662 0.0 2157.6 0.094 0.167 0.070 0.1012 133 YLM41 S5 S4 14.338 0.0 255.0 0.449 0.121 0.167 - 132 N
MEAN 782.6 0.322 0.109 0.206 0.217OVERALL MEAN 1030.8 0.306 0.159 0.189 0.195
129
(b) YELLINGBO
MALEShome colony
source colony
-LOG (Lhome /Lmax)
pdistance
moved (m)average r to source
SD r to source
average r to home
SD r to home
weight at genetic
sampling
breeder in home colony?
Y044 B4 B2 10.028 0.0 257.0 0.519 0.156 - - 115 NY047 C7 B4 1.478 0.001 1113.2 0.231 0.326 0.258 0.273 105 YY169 C7 F1 4.752 0.0 157.9 0.571 0.104 0.229 0.317 120 YY071 D4 B2 6.812 0.0 1317.2 0.458 0.202 - - 122 NY007 E3A F1 8.098 0.0 292.0 0.685 0.072 0.144 0.185 109 NY011 G3 F1 4.073 0.0 876.5 0.656 0.061 0.400 0.224 128 YY126 H4 J2 4.994 0.0 757.0 0.225 0.168 0.173 - 122 NY085 J1 J2 0.852 0.024 229.7 0.452 0.220 0.464 0.262 130 YY060 J2 C7 0.546 0.034 1446.8 0.162 0.109 0.162 0.153 132 YY170 J5A L9 5.666 0.0 231.7 0.190 0.190 0.045 - 125 NY008 L1 L9 0.024 0.027 727.1 0.209 0.212 0.438 0.112 128 YY031 L5 M6 5.352 0.0 665.5 0.559 0.108 0.240 0.232 139 YY150 L5 J5A 1.686 0.004 652.2 0.334 0.220 0.188 0.287 124 YY108 L5 L9 3.332 0.0 426.6 0.260 0.177 0.150 0.256 124 NY006 L9 J2 3.595 0.0 485.9 0.533 0.186 0.236 0.256 135 YY062 L9 J1 3.332 0.0 308.3 0.333 0.209 0.206 0.186 123 ?Y068 L9 L8 3.567 0.0 193.3 0.283 0.211 0.101 0.168 126 NY072 L9 B4 1.524 0.012 2823.9 0.192 0.055 0.081 0.106 138 NY078 L9 J2 1.699 0.009 485.9 0.429 0.167 0.260 0.190 50 NY089 L9 L8 5.501 0.0 193.3 0.326 0.195 0.068 0.166 135 NY070 O2A Q3 4.438 0.0 367.1 0.741 0.073 0.487 0.060 151 NY137 O3A O2A 1.196 0.002 141.1 0.576 0.063 0.429 0.152 144 YY040 O6 M6 4.222 0.0 390.0 0.537 0.142 0.447 0.106 133 NY118 Q3 O6 0.905 0.0 693.6 0.605 0.109 0.648 0.090 140 YY059 Y5 I1 10.194 0.0 1097.242 0.538 0.054 - - 121 ?Y032jv L5 M6 0.258 0.027 665.5 0.446 0.112 0.309 0.232 92 YY186jv E3A L9 0.507 0.026 1289.1 0.390 0.206 0.455 0.284 36 NY091jv G3 L9 4.728 0 691.6 0.419 0.235 0.293 0.305 64 NY099sb J1 Y5 0.84 0.015 1295.6 0.575 0.422 0.193 120 NY015jv L5 J4 1.074 0.006 375.1 0.292 0.180 0.147 73 NY048jv O3A L5 1.396 0.001 1122.2 0.180 0.100 0.386 0.148 66 N
MEAN 702.2 0.416 0.153 0.282 0.196FEMALESY045 B4 H4 6.24 0.0 1795.1 0.404 0.291 0.000 - 116 NY080 G3 L8 4.519 0.0 832.5 0.419 0.154 0.304 0.277 123 YY151sb H4 L9 3.773 0.0 1096.3 0.201 0.164 0.173 - 102 NY172sb I1 J2 3.045 0.0 122.8 0.361 0.247 0.268 - 120 NY175 I1 L9 2.752 0.0 597.5 0.280 0.185 0.268 - 129 YY188 J1 M6 20.173 0.0 1356.4 0.455 0.245 0.000 0.000 120 NY010 J2 J1 1.334 0.007 229.7 0.550 0.265 0.456 0.181 147 NY061sb J2 I1 5.697 0.0 122.8 0.522 0.008 0.308 0.163 118 YY104sb J4 L5 4.042 0.0 375.105 0.176 0.164 - - 101 NY054 J5A J2 0.894 0.044 265.8 0.372 0.110 0.396 0.182 145 YY012sb K1 J2 2.847 0.0 558.3 0.448 0.170 - - 117 ?Y076 L1 J5A 0.802 0.003 944.1 0.359 0.222 0.450 0.125 120 YY013sb O3A O6 1.231 0.001 190.2 0.462 0.121 0.432 0.154 108 YY041sb O6/6 M6 1.783 0.003 390.0 0.379 0.194 0.479 0.152 114 YY074 O6 O2A 4.118 0.0 331.0 0.594 0.103 0.445 0.109 133 YY110jv J5A L9 3.816 0 231.7 0.296 0.145 0.110 0.096 23 YY046jv O2A O3A 2.045 0.001 141.1 0.322 0.219 0.329 0.112 31 YY049jv O6 O3A 4.099 0 190.2 0.255 0.168 0.275 0.092 96 NY185jv Q5 O3A 10.055 0 626.448 0.380 0.164 - - 44 NMEAN MEAN 547.2 0.381 0.176 0.293 0.137
OVERALL MEAN 643.3 0.403 0.162 0.286 0.177
130
Table 2.
Comparative genetic diversity measures for Yellingbo and Lake Mountain. nA is
the average number of alleles, HO observed and HE expected heterozygosities, PIC
average polymorphic information content. Null refers to null allele frequency
estimates.
Population nA HO HE PIC Null Approx.* age at first breeding
Yellingbo 3.7 0.52 0.55 0.49 0.035 males 26.2 ± 8.5mo females 29.3 ± 9.5mo
Lake Mountain 11.5 0.74 0.79 0.76 0.043 - * calculated as difference in months between approximate age at first capture date (estimated from weights using 30-60g = 4-6mo, and 100-120g = 12-16mo) and date of first encounter of offspring. Calculated from 24 males and 21 females that were clearly assigned as the most likely parents.
131
Table 3.
Parental assignment success for all juveniles and sub-adults from each population.
'BOTH assigned' and 'assigned' refer to assignment of the putative mother and/or
father as most likely parents. NS is not sampled. NR is not resolved. BOTH NS
refers to not sampling either parent.
Population BOTH
assigned Putative mother not resolved Putative
mother NS
Putative mother excl.
BOTH NS
Total number young
Only putative mother assigned *
putative father assigned
putative father NR
putative father excl
putative father excl
putative father NR
Yellingbo 102 70 24 0 4 0 1 1 2 Lake Mountain 79 60 16 1 0 0 2 0 0
* Putative mother was assigned but the putative father was either excluded, not resolved or not sampled (details given in Table 3.) ** number in parentheses indicates the number of cases where the assigned father was from a different next box
132
Table 4.
Result of paternity testing from Yellingbo and Lake Mountain, where the putative
mother is the most likely female parent.
Where putative father excluded
the assigned father is:
Total number
of cases
Putative father
assigned Unknown Not
sampled Different nest box
Same nest box
Most likely
father not resolved
Yellingbo 94 70 10 2 2 4 6 Lake Mountain 76 60 5 11 - - 0
133
Figure 1.
Map of Lake Mountain (a) and Yellingbo (b) showing relative position of each
colony. Colonies not sampled (i.e. containing no animals) were N27, E19 and C12
at Lake Mountain. The red line in Figure 1b shows the approximate location of the
genetic split between northern and southern colonies.
134
(a) Lake Mountain
135
(b) Yellingbo
136
Figure 2.
STRUCTURE plots of all animals sampled at (a) Lake Mountain and (b) Yellingbo. Each bar represents a single individual. The
colony / nest box to which each animal belongs is labelled below plot. The proportion q, of each individual's membership to cluster
K is given on the Y-axis.
(a) Lake Mountain
137
(b) Yellingbo
138
Figure 3
Spatial autocorrelograms of male and female relatedness at Yellingbo (a) and Lake
Mountain (b). The grey lines are the 5 and 95% confidence intervals. The error
bars are and the confidence intervals are interpreted separately. Positive spatial
relatedness is significant when the observed autocorrelation coefficient outside the
confidence intervals for a given distance class or when the errors bars do not
intersect the x-axis at y=zero.
(a)
-0.30
-0.20
-0.10
0.00
0.10
0.20
0.30
0.40
0.50
0.60
0.70
200 600 1000 1400 1800 2200 2600 3000 3400
Distance class (m)
auto
corre
latio
n co
effic
ient
males
-0.30
-0.20
-0.10
0.00
0.10
0.20
0.30
0.40
0.50
0.60
0.70
200 600 1000 1400 1800 2200 2600 3000 3400
Distance class (m)
auto
corre
latio
n co
effic
ient
females
139
(b)
-0.60
-0.40
-0.20
0.00
0.20
0.40
0.60
0.80
200 600 1000 1400 1800 2200 2600 3000 3400 3800 4200 4600
Distance class (m)
auto
corre
latio
n co
effic
ient
males
-0.60
-0.40
-0.20
0.00
0.20
0.40
0.60
0.80
200 600 1000 1400 1800 2200 2600 3000 3400 3800 4200 4600
Distance class (m)
auto
corre
latio
n co
effic
ient
females
140
Appendix 1.
Details of five new G. leadbeateri loci developed and optimised for parentage
analysis at Yellingbo.
Locus
name
Sequence 5’→3’ Repeat Allele size
range (bp)
No.
alleles
TA (oC) GenBank
Accession no.
HE/HO
GL27B tagccggttacctggttcag (CA)34 117-141 6 56 AY884086 0.54/0.49 gagaactcactgcgggagag GL1 gagggagccctctaggtgac (GA)17 (CA)19 200-230 3 55→47 - 0.64/0.68 aggaacacagggcgggagag GL83 agatgatcttttggtgatgg 189-205 6 - 0.60/0.46 aatctctctgctttgctcac
(GA...)* (GA)25
62→55 or 55→47
GL95 ttcttcaggcaggttattgactc 174-188 3 55→47 - 0.54/0.56 gagtcctgagtaaccctaattgc
(GA)7 AA (GA)25
GL110 acacaaacctcactctcattc (CA)17 142-170 5 54 - 0.59/0.53 tcttcctgcagtgtgaaatg
* Details of repeat are: GAx4 GGGAx2 AGAAGA GGGA GA GGGAx3 GAx6 CA
141
Appendix 2.
Per locus genetic diversity measures, determined in CERVUS, of Yellingbo and
Lake Mountain.
Locus nA HO HE PIC Excl (1) HW Null
Yellingbo GL38 4 0.37 0.49 0.43 0.12 ** 0.170 GL35 3 0.60 0.55 0.47 0.15 NS -0.054 GL4 4 0.48 0.63 0.56 0.20 ** 0.139 GL6 2 0.39 0.36 0.30 0.07 NS -0.037 GL7 3 0.56 0.55 0.49 0.15 NS -0.022 GL13 4 0.58 0.60 0.51 0.18 NS 0.020 GL5A 3 0.54 0.58 0.48 0.17 NS 0.040 GL39 2 0.29 0.30 0.25 0.04 NS 0.000 GL33 3 0.56 0.53 0.46 0.14 NS -0.057 GL44 5 0.55 0.65 0.58 0.22 ** 0.090 GL28 2 0.40 0.49 0.37 0.12 NS 0.103 GL19B 6 0.71 0.79 0.75 0.40 ** 0.053 GL24 2 0.44 0.49 0.37 0.12 NS 0.057 GL42 4 0.61 0.64 0.56 0.21 NS 0.024 DT1 4 0.54 0.54 0.49 0.15 NS -0.017 GL1 3 0.49 0.54 0.47 0.14 NS 0.054 GL27B 5 0.68 0.64 0.60 0.23 NS -0.045 GL83 6 0.46 0.60 0.55 0.19 ** 0.144 GL95 3 0.56 0.54 0.47 0.14 NS -0.019 GL110 5 0.53 0.59 0.55 0.20 NS 0.058 Average 3.7 0.52 0.55 0.49 0.17 0.035 Lake Mountain GL38 14 0.83 0.86 0.84 0.56 NS 0.017 GL35 7 0.29 0.61 0.53 0.20 ** 0.358 GL4 9 0.78 0.84 0.81 0.50 NS 0.034 GL6 8 0.78 0.74 0.70 0.33 NS -0.026 GL7 8 0.54 0.62 0.55 0.21 ** 0.077 GL13 8 0.77 0.79 0.75 0.41 NS 0.006 GL5A 8 0.76 0.83 0.80 0.48 NS 0.041 GL39 10 0.83 0.86 0.84 0.55 NS 0.013 GL33 12 0.73 0.75 0.73 0.38 NS 0.019 GL44 27 0.93 0.92 0.91 0.72 NS -0.006 GL28 13 0.82 0.84 0.82 0.52 NS 0.014 GL19B 18 0.86 0.92 0.91 0.71 NA 0.029 GL24 7 0.81 0.77 0.74 0.38 NS -0.029 GL42 9 0.64 0.70 0.67 0.32 NS 0.054 DT1 14 0.80 0.86 0.85 0.56 NS 0.037 Average 11.5 0.74 0.79 0.76 0.45 0.043
142
Appendix 3.
Details of parental assignments at Yellingbo and Lake Mountain. Column 1 gives
each juvenile's ID, column 2 the nest box they were originally sampled in, their the
date of first sampling (column 3), their weight in grams at first sampling (column
4). Column 5 gives the putative mother on the basis of ecological inferences,
column 6 the genetically assigned mother, columns 7 and 8 the putative and
genetically assigned fathers, respectively. Exclusions (N), inclusions (Y) and
ambiguities / not resolved cases (NR) for putative parents are given in column 9.
Columns 10 and 11 give the CERVUS LOD score and ∆LOD for the genetically
assigned parents. A bold ∆LOD indicates a non-significant score. Column 12
provides the relatedness r between the offspring and the genetically assigned
father. Column 13 has comments about locus mismatches and other related
information about putative and genetically assigned parents. NS = not sampled.
NR = not resolved. Bold characters indicate non-exclusion of putative parents on
the basis of only a single locus mismatch or potential null alleles.
Yellingbo
JUVENILE BOXFIRST CAPTURE
DATE WEIGHTPUTATIVE MOTHER
GENETIC ASSIGNED MOTHER
PUTATIVE FATHER
GENETIC ASSIGNED
FATHER
ASSIGNED PARENTS
POSSIBLE?
ASSIGNED PARENTS
LOD
DELTA LOD
>80%
ML-RELATE ASSIGNED
FATHER COMMENTS / REASON PUTATIVE NOT POSS?Y146 B2 8-Jan-96 24 Y113 Y113 Y116 Y116 Y 9.46 3.60 0.500Y163 B2 3-Oct-96 23 Y113 Y113 Y116 Y116 Y 11.80 10.75 0.590Y111 B2 8-Apr-97 26 Y113 Y113 Y116 Y116 Y 5.95 3.16 0.561Y123 B2 8-Apr-97 25 Y113 Y113 Y116 Y116 Y 5.95 1.81 0.500Y157 B2 28-Jan-98 61 Y113 Y113 Y116 Y116 Y 7.39 0.93 0.500Y144 B2 8-Dec-98 18 Y113 Y113 Y116 Y116 Y 9.27 0.05 0.671Y174 B2 14-Mar-99 23 Y113 Y113 Y116 Y116 Y 9.13 5.89 0.602Y183 B2 14-Mar-99 23 Y113 Y113 Y116 Y116 Y 9.60 6.68 0.602Y129 C7 3-Aug-97 20 Y014 Y014 Y047 Y047 Y 10.94 9.82 0.519Y141 C7 3-Aug-97 22 Y014 Y014 Y047 Y047 Y 8.96 8.32 0.500Y075 C7 28-Jan-98 34 Y014 Y014 Y047 Y047 Y 11.37 6.66 0.564Y130 C7 28-Jan-98 38 Y014 Y014 Y047 Y047 Y 9.14 5.89 0.500Y132 C7 28-Jul-98 38 Y014 Y014 Y047 Y047 Y 7.84 3.14 0.500Y028 C7 19-Nov-99 78 Y014 Y014 Y169 Y169 Y 11.07 3.85 0.500Y087 C7 19-Nov-99 66 Y014 Y014 Y169 Y169 Y 12.11 6.97 0.665Y063 C8 2-May-01 88 Y014 Y014 Y169 Y169 Y 12.97 7.63 0.826Y134 E3A 8-Sep-98 35 Y175 Y175 Y152 Y142 Y 7.90 5.20 0.500 Y175 1 mism; 2 triad mismatches, GL35 & GL83Y186 E3A 8-Sep-98 36 Y175 Y175 Y152 Y142 Y 9.31 2.79 0.645 Y152 LOD=2.03, 175 & 152 1 triad mism GL35Y019 E3A 8-Sep-98 35 Y175 Y175 Y152 Y142 Y 9.37 1.38 0.500 Y152 LOD=0.91, 175 & 152 1 triad mism, GL35Y149 F1 10-Dec-97 101 Y120? Y120 Y125? Y125? Y 6.89 2.19 0.500 1 triad mism, GL5AY037 F1 5-Nov-99 33 Y120? Y120 Y125? Y125 Y 0.595Y023 F1 5-Nov-99 97 Y120? Y120 Y125? Y125? Y 9.42 1.77 0.796 Y149? juv assigned as father; 1 triad mism, GL5AY053 F1 6-Apr-01 86 Y120? Y120 Y125? Y125 Y 12.02 8.08 0.735Y067 F1 6-Apr-01 82 Y120? Y120 Y125? Y125? Y 7.94 2.19 0.687 1 triad mism, GL5A 120 & 125 FS POY091 G3 8-Nov-99 64 Y110? Y110 Y164 Y057 L9 Y 9.24 1.41 0.856 Y164 LOD=7.83 no mismY035 G3 6-Apr-01 93 Y080? Y080 Y011 Y149? juv NR 5.34 0.68 0.662 Y011 LOD=3.29, 1 triad mism GL27B; Y149 last encounter 1997Y088 G3 6-Apr-01 58 Y080 Y080 Y011 Y011 Y 6.55 6.30 0.500 80 & 11 1 triad mismY039 G3 6-Apr-01 101 Y080? Y080 Y011 Y011? Y 4.12 1.22 0.500 Y011 1 mism GL95 HS FS POY189 J1 30-Mar-96 102 no data ? no data ? no matchY099 J1 2-Dec-95 47 Y188? Y012 K1 NS Y059 Y5 NR 0.575 Y188 6 mism; 12 and 59 not encountered until 2encounter histories of pY112 J1 29-Sep-97 39 Y017 Y017 Y190 Y190 Y 8.40 3.35 0.500Y168 J1 28-Jan-98 34 Y017 Y017 Y190 Y085 Y 6.59 1.48 0.778 Y190 negative LOD 85 & 6 HS FS PO 0.59Y140 J1 8-Dec-98 73 Y017? Y017 Y190 Y006 L9 Y 6.75 0.47 0.611 Y190 negative LOD encounter histories makY173 J1 27-Apr-99 70 Y017? Y017 Y190 Y190 Y 9.77 5.12 0.549Y079 J1 5-Nov-99 82 Y017? Y017 Y190 Y190 Y 8.26 4.39 0.686Y095 J1 5-Nov-99 88 Y017? Y017 Y190 Y190 Y 7.30 2.14 0.584Y005 J2 25-Jan-97 98 Y061? Y061 Y060 or 98 NS? /Y059 N 5.43 3.50 0.736 Y059 2 mism; Y060 3 mism; 8 & 3 triad mism encounter history of Y0Y164 J2 3-Dec-97 74 Y119? Y119 Y060 or 98 Y060? Y 12.60 10.25 0.500 Y119 1 mism; Y098 3 mism; 119 60 NR - 1 & 7 triad mismY147 J2 19-Nov-98 88 Y119? Y119 Y060 or 98 Y098 Y 6.69 1.23 0.628Y025 J2 6-May-01 64 Y119? Y119 60or162or147 Y021 NR 8.50 0.66 0.573 Y190 prob. sire no mism LOD=7.15; ass. no mism; Y060 3 mism, 4 & 2 Y042 J2A 6-May-01 61 Y119? Y119 Y060 or 162 Y079 J1 NR 8.28 1.37 0.635 Y190 prob. sire no mism LOD=6.91, ass. no mism; 3 & 3 triad mism, Y0Y021 J5A/VTJ14 21-Feb-96 30 NS Y076 Y190 Y062 NR 5.58 0.49 0.716 Y076 first encounter 104g oct95, notched at 120g jun97; Y190 LOD=3.4Y110 J5A 29-Jul-97 23 Y054 Y054? Y021 juv Y057? N 7.38 4.23 0.549 Y054 1 mism, 54 & 57 2 triad mism; Y021 3 mism, 8 triad mism Y138 J5A 25-Jan-98 40 Y054 Y054 Y021 juv NS?/Y135 N 2.06 0.94 0.179 Y135 2 mism; Y021 2 mism, 54 & 21 8 triad mism; Y135? juv L8 2 triadY177 J5A 11-Nov-98 40 Y002 Y002 Y021 juv Y021? Y 8.78 0.31 0.500 2 & 21 1 triad mism, DT1 21 HS FS POY161 J5A 26-Feb-99 31 Y002 Y002 Y021 juv Y021? Y 7.87 6.54 0.500 1 triad mism, DT1 21 HS FS POY092 J5A 30-Nov-99 <40 Y002 Y002 Y021 juv Y021 Y 10.63 0.08 0.500Y034 J5A 5-Apr-01 95 Y002? Y002 Y021 juv Y021? Y 10.85 6.18 0.546 1 triad mism, DT1 21 HS FS POY020 L1 25-Sep-96 18 Y076 Y076 Y008 Y008 Y 6.44 1.34 0.505Y128 L1 13-Jun-97 18 Y076 Y076 Y008 Y008 Y 7.36 7.36 0.500
144
Yellingbo continued
JUVENILE BOXFIRST CAPTURE
DATE WEIGHTPUTATIVE MOTHER
GENETIC ASSIGNED MOTHER
PUTATIVE FATHER
GENETIC ASSIGNED
FATHER
ASSIGNED PARENTS
POSSIBLE?
ASSIGNED PARENTS
LOD
DELTA LOD
>80%
ML-RELATE ASSIGNED
FATHER COMMENTS / REASON PUTATIVE NOT POSS?Y032 L5 16-Feb-97 33 Y001 Y001 Y031 Y031 Y 12.85 4.08 0.572Y121 L5 30-Jul-97 <50g Y001 Y001 Y031 Y031? Y 7.03 2.93 0.500 1 triad mism, GL110 31 HS FS POY145 L5 30-Jul-97 27 Y001 Y001 Y031 Y031 Y 6.87 4.90 0.500Y015 L5 29-Oct-99 73 Y001 or 24 Y024 Y150 Y150 Y 11.09 11.09 0.500 3 & 0 triad mism, GL7 GL1 GL110, Y001 2 mismY127 L8 5-Dec-97 38 Y182 Y182 Y122 Y122 Y 8.52 5.63 0.509Y135 L8 5-Dec-97 38 Y182 Y182 Y122 Y122 Y 9.90 4.80 0.500Y176 L8 5-Dec-97 89 Y182? Y182 Y122? Y122 Y 6.09 0.44 0.500Y156 L8 18-Mar-98 26 Y182 Y182 Y122 Y122 Y 6.48 0.05 0.500Y167 L8 30-Jul-98 32 Y182 Y182 Y122 Y122 Y 10.04 3.14 0.500Y027 L8 20-Nov-99 105 no data Y182 no data Y007 N 5.95 0.11 0.438 Y122 LOD=5.84, Y007 first encountered 2001Y051 L8 20-Nov-99 57 Y182 Y182 Y122 Y007 N 6.93 1.49 0.500 Y122 LOD=4.75, Y007 first encountered as sub in 2001Y002 L9 29-Sep-96 28 no data Y036 no data Y125? N 4.39 2.16 0.414 Y125 1 mism 36 & 125 2 triad mismY009 L9 6-Jul-96 46 Y036? Y036 NS or Y057 NS? /Y064 N 2.11 0.52 0.481 36 & 64 1 triad m; Y057 1 mismY065 L9 12-Jun-97 25 Y036 Y036 Y057 Y169? N 3.45 0.93 0.500 169 1 mism, 36 & 169 2 triad mism GL39 GL24, encounter history of Y16Y090 L9 4-Dec-97 PY Y036? Y036 Y009 or 57? Y057 Y 7.85 4.19 0.696Y136 L9 4-Dec-97 38 Y036 Y036 Y057 Y057 Y 7.19 5.59 0.500Y159 L9 4-Dec-97 35 Y036 Y036 Y057 Y057 Y 8.58 3.98 0.524Y153 L9 12-Jun-97 25 no data Y036 no data ?Y187 L9 31-Jul-98 35 Y036 Y036 Y057 Y057 Y 6.84 3.76 0.591Y078 L9 4-Apr-01 50 Y082? Y082 6 73 64? 105? Y085 J1 N 7.05 0.02 0.714 78 & 82 r=0.5 Y082 & Y085 prob HS (rY003 M6 21-Apr-97 30 Y096 Y096 Y022 Y022? NR/N 6.74 0.96 0.500 Y096 1 mism; Y022 2 mism; 2 triad mism Y096 & Y022 PO - def. nY050 M6 21-Apr-97 36 Y096 Y096 Y022 Y022 NR/N 0.655 Y096 & Y022 PO - def. nY160 M6 10-Nov-98 32 Y041 Y041 Y032 Y032 L5 Y 7.20 1.79 0.500 Y041 1 mism, 1 triad mism GL38; Y031 negative LODY166 M6 10-Nov-98 32 Y041 Y041 Y032 Y031 L5 NR 10.68 1.01 0.500 Y032 LOD=9.67, no mism either 31 or 32
Y081 M6 23-Nov-99 115 Y041 Y041 Y032 Y032 L5 Y 8.49 1.00 0.500 Y031 negative LOD 31 & 81 r=0.4729
Y093 M6 23-Nov-99 83 Y041? Y041 Y032 Y032 L5 Y 10.18 2.80 0.500 Y041 1 mism GL110, Y031 LOD=7.39 & 2 triad mism r=0.503Y103 M6 23-Nov-99 73 Y041? Y041 Y032 Y032 L5 Y 7.44 1.72 0.500 Y041 1 mism GL83 103 & 31 r=0.5173Y030 M6 19-Apr-01 61 Y041? Y041 Y032 or 40 Y032 L5 Y 8.21 5.83 0.500 Y031 LOD=2.38 2 triad mism 30 & 31 r=0.5073Y086 O2A 15-May-98 16 Y033 Y033 Y155 Y155 Y 7.17 0.65 0.723 Y033 1 mism Y155 FSY094 O2A 15-May-98 15 Y033 Y033 Y155 Y155 Y 7.33 0.09 0.650Y038 O2A 15-Sep-98 PY Y074? Y074 Y155 NS? ?/Y117 N 0.500 2 triad mism, GL13 GL110, Y155 I mism r=0.8315Y046 O2A 16-Mar-99 31 Y074 Y074 Y155 Y115 NR 5.70 3.72 0.623 Y115 1 mism, 74 & 115 3 triad mis; 9 triad mismY115 encounter historyY114 O3A 14-Feb-97 42 Y029 Y029 NS Y107 4.96 2.02 0.500 29 & 107 1 triad misY124 O3A 14-Feb-97 42 Y029 Y029 NS Y137 8.60 2.34 0.500Y115 O3A 30-Nov-97 72 Y029 Y029 Y137 or 155? Y137 Y 6.51 2.69 0.559 137 1 mismatchY131 O3A 21-Jan-98 88 Y029 Y029 ?[1 Rt] Y155 NR 9.10 0.15 0.500Y178 O3A 10-May-98 87 Y029? Y029 Y137? Y137 Y 7.48 0.57 0.500Y048 O3A 10-Apr-01 66 181/46? Y181? 137 58 16?107? Y058 Y 5.50 4.33 0.500 181 & 58 1 triad mis; Y181 1 mism Y137 1 mis; 6 & ? & ? triad mismY049 O6 15-Feb-97 48 2R NS no match Y004 or 4R NS ? -Y117 O6 28-Sep-97 20 Y074 Y074 Y004 Y004 Y 20.42 11.07 0.711Y154 O6 20-Mar-98 39 Y074 Y074 Y004 Y004 Y 16.10 7.03 0.644 4 & 155 r=0.5Y179 O6 20-Mar-98 40 Y074 Y074 Y004 Y004 Y 15.69 4.59 0.634Y133 O6 15-Sep-98 45 Y024 Y024 Y004 or 117? Y004 Y 12.28 2.87 0.589Y139 O6 15-Sep-98 40 Y024 Y024 Y004 or 117? Y004 Y 15.91 7.02 0.647Y158 O6 8-Mar-99 29 Y013? Y013 4 or 117 179? Y004 Y 18.40 2.13 0.593Y043 O6 8-Mar-99 29 Y013? Y013 4 or 117 179? Y004 Y 15.77 3.43 0.642Y056 O6 21-Nov-99 30 Y013 Y013 Y004 Y004 Y 17.49 5.92 0.664Y083 O6 21-Nov-99 90 Y013? Y013 Y004 Y155? N 10.98 0.48 0.568 Y013 1 mism, Y004 2 mism 5 triad mism, Y069 O6 10-Apr-01 73 Y013? Y013? Y004 Y155? NR 9.24 1.50 0.500 Y077 ass. but not bred yet at that date so NO; 3 triad mism, Y013 & Y00Y165 Q3 19-May-98 23 Y148 Y148 Y118 Y118 Y 17.01 3.63 0.744 further comments Y069: Y013 & Y077 FS PO, Y004 & Y155 POY100 Q3 28-Oct-99 46 Y148 Y148 Y118 Y118 Y 0.566Y185 Q5 11-Feb-99 44 Y084 Y084 Y115? Y115 Y 10.19 7.30 0.672 Y084 1 mismatch
145
Lake Mountain
JUVENILE BOX AGE DATE WEIGHTPUTATIVE MOTHER
GEN ASSIGNED MOTHER
PUTATIVE FATHER
GEN ASSIGNED
FATHER
ASSIGNED PARENTS
POSSIBLE?
ASSIGNED PARENTS
LOD
DELTA LOD
>80%
ML-RELATE ASSIGNED
FATHER MISMATCHES - PUTATIVE PARENTS MISMATCHES - ASSIGNED LM065 C10 juv 27/3/06 71 LM67 LM67 LM66 NS - 0.00 LM66 7 mismatchesLM068 C10 juv 27/3/06 72 LM67 LM67 LM66 NS - 0.10 LM66 6 mismatchesLM088 C10 juv 24/3/07 71 LM67 LM67 LM66 LM66 Y 10.41 6.25 0.50LM089 C10 juv 24/3/07 84 LM67 LM67 LM66 LM66 Y 10.52 4.85 0.42 LM66 1 mismatch - GL35LM051 C11 juv 24/3/06 102 LM50 LM50 LM49 LM49 Y/N 12.08 6.42 0.64 LM50 1 mismatch - GL5A; 5 triad mismatch - GL4 GL6 GL39 GL28 GLM008 C23 juv 22/3/06 61 LM10 LM10 LM7 LM7 Y 13.13 13.13 0.50LM009 C23 juv 22/3/06 66 LM10 LM10 LM7 LM7 Y 13.97 12.66 0.50LM086 C6 juv 12/11/06 95 LM83 LM83 LM84 LM84 Y 14.31 14.31 0.55LM087 C6 juv 12/11/06 90 LM83 LM83 LM84 LM84 Y 11.66 9.56 0.52LM001 C7 sub 22/3/06 135 LM2 LM2 LM5 LM5 Y 15.95 5.51 0.64LM003 C7 juv 22/3/06 68 LM2 LM2 LM5 LM5 Y 11.97 7.99 0.50LM004 C7 juv 22/3/06 68 LM2 LM2? LM5 LM5 Y 13.22 4.76 0.50 LM2 1 mismatch - GL7, 2 & 4 r=0.4111LM006 C7 juv 22/3/06 119 LM2 LM2 LM5 LM5 Y 13.61 7.39 0.50LM060 C8 juv 26/3/06 77 LM61 LM61 LM62 LM62 Y 13.36 8.11 0.50LM063 C8 juv 26/3/06 83 LM61 LM61 LM62 LM62 Y 14.09 10.97 0.50LM064 C8 juv 26/3/06 120 LM61 LM61 LM62 LM62 Y 14.30 12.25 0.54LM079 C9 juv 12/11/06 64 NS LM61 LM82 LM82 N 0.55 LM61 1 mismatch - GL39LM080 C9 juv 12/11/06 55 NS UN? LM82 LM82 N 0.63 LM61 3 mismatches - GL4 GL39 GL44LM081 C9 juv 12/11/06 109 NS UN? LM82 LM82 N 0.66 LM50 3 mismatches - GL5A GL39 GL44LM047 E13 juv 24/3/06 62 LM134 LM134 LM48 NS? N LM90 4 mismatches; 47 & 48 r=0.0708 LM48 5 mismatchesLM131 E13 sub 27/3/07 119 LM134 LM134 48 or 132 LM48 Y 10.96 5.23 0.50LM133 E13 sub 27/3/07 125 LM134 LM134? 48 or 132 LM48 Y 8.54 2.85 0.42 LM134 & LM48 1 mismatch each - GL7LM135 E13 juv 27/3/07 84 LM134 LM134 48 or 132 LM48 N 4.45 4.38 0.27 LM48 3 mismatches GL44 GL6 DT1; 11 triad mismatchesLM044 E14 juv 24/3/06 96 LM43 LM43 LM45 LM45 Y 9.30 8.30 0.57LM046 E14 juv 24/3/06 91 LM43 LM43 LM45 LM45 Y 8.35 5.68 0.50LM012 E15 juv 22/3/06 103 LM13 LM13 LM11? NS? N LM13 1 mismatch - GL35; LM11 neg. LOD r=0.1759LM014 E15 juv 22/3/06 74 LM13 LM13 LM11? M14 Y 12.79 11.95 0.46 LM13 1 mismatch - GL35; LM11 neg. LODLM015 E15 juv 22/3/06 51 LM13 LM13 LM11? LM11 Y 12.05 5.95 0.51 LM11 & LM13 1 mismatch each - GL5A & GL35LM101 E15 juv 25/3/07 106 LM13 LM13 11 or 14? LM11 Y 8.84 3.81 0.50 LM13 1 mismatch - GL35LM103 E15 juv 25/3/07 68 LM13 LM13 11 or 14? LM11 Y 10.31 3.36 0.51 LM13 1 mismatch - GL35LM105 E15 juv 25/3/07 99 LM13 13 or 12 11 or 14? LM11 Y 9.99 2.81 0.50 LM13 1 mismatch - GL35LM053 E16 sub 25/3/06 122 LM52 LM52 LM56 LM56 Y 13.55 5.22 0.50 LM52 1 mismatch - GL35LM054 E16 juv 25/3/06 62 LM52 LM52 LM56 LM56 Y 13.93 9.80 0.54LM055 E16 juv 25/3/06 80 LM52 ? LM56 LM56 NR 12.90 8.63 0.55 LM52 2 mismatches - GL35 GL7LM069 E18 juv 27/3/06 108 LM70 LM70 LM74 LM74 Y 14.24 5.28 0.61LM071 E18 juv 27/3/06 85 LM70 LM70? LM74 LM74 Y 11.76 4.04 0.51 LM70 1 mismatch - GL7LM073 E18 juv 27/3/06 107 LM70 LM70 LM74 LM74 Y 11.50 2.20 0.50LM109 E18 juv 25/3/07 72 LM70 LM70 LM74 LM74 Y 12.27 4.66 0.60LM110 E18 juv 25/3/07 74 LM70 LM70? LM74 LM74 Y 11.33 1.92 0.50 LM70 & LM74 1 mismatch each - GL35LM111 E18 juv 25/3/07 86 LM70 LM70? LM74 LM74 Y 13.05 5.42 0.57 LM70 & LM74 1 mismatch each - GL35
146
Lake Mountain continued
JUVENILE BOX AGE DATE WEIGHTPUTATIVE MOTHER
GEN ASSIGNED MOTHER
PUTATIVE FATHER
GEN ASSIGNED
FATHER
ASSIGNED PARENTS
POSSIBLE?
ASSIGNED PARENTS
LOD
DELTA LOD
>80%
ML-RELATE ASSIGNED
FATHER MISMATCHES - PUTATIVE PARENTS MISMATCHES - ASSIGNED PARENTSLM058 E17 juv 25/3/06 68 NS LM134 or M11 LM57 NS? (LMM17) - 0.18 LM57 > 7 mismatches M17 6 mism. 134 & M11 4 mism.LM059 E17 juv 25/3/06 117 NS LM10 LM57 NS? (LM5) - 0.08 LM57 > 7 mismatches LM5 6 mism. LM10 4 mism.LM091 N26 sub 24/3/07 140 LM94 LM94 LM92 NS? N 0.07 LM92 9 mismatches LM90 & LM9LM093 N26 sub 24/3/07 132 LM94 LM94 LM92 NS? N 0.04 LM92 >8 mismatchesLM094PY N26 PY 24/3/07 - LM94 LM94 LM92 LM92 Y 10.59 1.47 0.50LM137 N28 juv 27/3/07 97 LM136 LM136 LM139 LM66 N 4.68 0.44 0.21 LM139 negative LOD r=0.0363 LM66 3 mism. GL38 GL5A DT1LM138 N28 juv 27/3/07 56 LM136 LM136 LM139 LM139 Y 13.39 10.51 0.58LM142 N29 sub 27/3/07 99 LM143 LM143 140 or 141 LM140 Y 13.81 7.80 0.50LM144 N29 juv 27/3/07 96 LM143 LM143 140 or 141 LM140 Y 12.11 7.55 0.50LM149 N30 juv 27/3/07 73 LM147 LM147 LM148 LM148 Y 10.40 2.13 0.59 LM147 1 mismatch - GL35 null allele mLM150 N30 sub 27/3/07 117 LM147 LM147 LM148 LM148 Y 11.59 10.90 0.59 LM147 1 mismatch - GL35 null allele mLM151 N30 juv 27/3/07 98 LM147 LM147 LM148 LM148 Y 10.86 8.48 0.50LM018 S1 juv 23/3/06 129 LM16 LM16 LM97? NS N LM97 9 mismatchesLM019 S1 juv 23/3/06 82 LM16 LM16 LM97? NS N LM97 9 mismatchesLM020 S1 juv 23/3/06 91 LM16 LM16 LM97? NS N LM97 9 mismatchesLM096 S1 sub 25/3/07 119 LM16? LM16? 97 or 20 LM18? N 6.62 3.00 0.48 LM16 1 mismatch - GL6; LM97 / 20 > 9mLM18 1 mism GL6, 6 triad mism.LM023 S2 juv 23/3/06 71 LM22 LM22 LM21 LM21 Y 8.57 5.17 0.53 LM22 1 mismatch - GL35LM025 S2 juv 23/3/06 96 LM22 LM22 LM21 LM21 Y 9.11 3.91 0.50 LM22 1 mismatch - GL35LM026 S2 juv 23/3/06 115 LM22 LM22 LM21 LM21 Y 11.42 8.55 0.50LM098 S2 juv 25/3/07 93 LM22? LM22 LM21 LM21 Y 8.03 3.38 0.50LM099 S2 juv 25/3/07 110 LM22? LM22 LM21 LM21 Y 10.21 1.66 0.50LM027 S3 juv 23/3/06 122 LM29 LM29 LM31 LM31 Y 11.38 4.46 0.59 31 & 21 r=0.5LM028 S3 sub 23/3/06 137 LM29 LM29 LM31 LM31 Y 13.50 7.03 0.55LM030 S3 juv 23/3/06 124 LM29 LM29 LM31 LM31 Y 12.19 6.92 0.59LM032 S3 juv 23/3/06 83 LM29 LM29 LM31 LM31 Y 16.03 14.29 0.55LM033 S3 juv 23/3/06 90 LM29 LM29 LM31 LM31 Y 13.14 9.68 0.50 LM31 1 mismatch - GL35LM034 S4 juv 23/3/06 100 LM36 LM36 LM37 LM37 Y 14.74 8.78 0.68LM035 S4 juv 23/3/06 61 LM36 LM36 LM37 LM37 Y 13.65 10.02 0.67LM038 S4 juv 23/3/06 57 LM36 LM36 LM37 LM37 Y 12.84 2.80 0.75LM039 S4 juv 23/3/06 118 LM36 LM36 LM37 LM37 Y 14.68 5.27 0.76LM040 S4 juv 23/3/06 65 LM36 LM36 LM37 LM37 Y 14.97 8.92 0.72LM076 W20 juv 12/11/06 54 LM75 LM75 LM78 LM78 Y 15.04 13.40 0.65LM077 W20 juv 12/11/06 117 LM75 LM75 LM78 LM78 Y 10.42 6.62 0.50LM113 W21 juv 26/3/07 95 LM114 LM114 LM115 LM115 Y 10.40 5.41 0.50LM116 W21 sub 26/3/07 136 LM114 LM114 LM115 LM115 Y 13.78 8.73 0.50LM117 W21 sub 26/3/07 114 LM114 LM114 LM115 LM115 Y 10.30 6.11 0.50LM118 W21 sub 26/3/07 98 LM114 LM114 LM115 LM115 Y 8.43 6.27 0.57 LM115 1 mismatch - GL35 null allele mLM119 W21 sub 26/3/07 120 LM114 LM114 LM115 LM115 Y 9.67 8.52 0.50 LM115 1 mismatch - GL35 null allele mLM121 W22 juv 26/3/07 88 LM120 LM120 LM125 LM125 Y 8.07 4.62 0.49 LM125 1 mismatch - GL39LM124 W22 juv 26/3/07 111 LM120 LM120 LM125 LM125 Y 11.82 9.36 0.66 LM125 1 mismatch - GL39LM128 W24 juv 26/3/07 92 LM129 LM129 NS 127 or NS N 6.36 5.85 0.45 LM129 1 mismatch - GL39 LM127 2 mism. GL38 GL19BLM130 W24 juv 26/3/07 91 LM129 LM129 NS 127 or NS N 5.64 5.55 0.42 LM129 1 mismatch - GL39 LM127 3 mism. GL7 GL39 GL19B
Chapter Six The conservation implications of fine scale and meta-
population scale genetic structure of populations of Leadbeater's
possum.
In preparation for inclusion in the updated Leadbeater's Possum Flora and Fauna
Guarantee Action Statement
Background
The Flora and Fauna Guarantee Act 1988 provides a legislative process for the listing
and protection of threatened species in the state of Victoria. An action statement is
prepared for each listed species, and draws on all available sources of current
information to provide management guidelines and identify future research priorities.
The Flora and Fauna Guarantee Action Statement for Leadbeater's Possum (Macfarlane
et al. 1995) identified a number of key knowledge gaps and management actions that
required immediate attention. The main management action recommended was the
development of a reserve system and the zoning of ash-type forest into three different
categories for the preservation and recruitment of hollow-bearing trees, whilst
maintaining timber production in some habitats. The key knowledge gaps identified
were information on dispersal and re-colonisation ability, and an assessment of wildfire
risk to population persistence.
The information presented here provides a summary of the findings of an investigation
into historic and current population genetic structure of Leadbeater's Possum. Molecular
marker analyses using microsatellites and mitochondrial control region were used to
address several broad aims; (1) to elucidate inter- and intra-population genetic structure
and thus make inferences about connectivity and gene flow, (2) to investigate life
history strategies most notably the mating system, and (3) to infer historic population
processes. In this context, historic refers to anytime prior to European colonisation and
indicates that population changes are probably not due to anthropogenic activities.
The major findings of this study are five fold. First, Leadbeater's Possum populations
within the central highlands contain appreciable levels of genetic diversity. Second,
Leadbeater's Possum may be a historically declining species. Third, the species is
strictly socially structured, which drives significant sub-population genetic
148
differentiation. Fourth, the availability of denning sites affects population genetic
structure and the distribution of kin groups in the montane landscape. Fifth, the isolated
population at Yellingbo Nature Conservation Reserve represents a now extinct genetic
unit that previously extended to Western Port and is significantly genetically
differentiated from central highlands populations. Furthermore, Yellingbo appears to
consist of two sub-populations, one in the northern and one in the southern halves of the
reserve, between which homogenising gene flow rarely occurs.
Reasons for Conservation Status
Leadbeater's Possum is thought to be declining concurrent with the loss of hollow-
bearing ash trees (Lindenmayer et al. 2003a, Lindenmayer, pers. comm.). These losses
have been incorporated in population viability analysis (PVA) modelling, which has
predicted a significant reduction in species abundance within 50 years (Lindenmayer
and Lacy 1995, Lindenmayer et al. 1997). Using the genetic information contained
within mitochondrial DNA sequences obtained from animals at Lake Mountain,
extinction of maternal lineages was detected, indicating a long-term population decline
(Table 5, Chapter 4). Given the time frame over which mitochondrial DNA population
divergence occurs in mammals (usually in the order of thousands to hundreds of
thousands of years; Moritz et al. 1987), this decline may have been occurring since the
last Pleistocene glaciation, probably as a result of shifts in climate (see also
Lindenmayer 1996). Importantly, Lake Mountain is a large (>150 individuals)
genetically diverse, freely outbreeding population that has experienced regular
contemporary genetic exchange with nearby montane ash populations. Furthermore, if
Lake Mountain, Cambarville and Mt Margaret are analysed as a single genetic unit
(which is inferred from patterns of nuclear genetic variation; Figure 2, Chapter 4), there
remains a signal of historic population decline (Table 5, Chapter 4). Therefore, it is
plausible that the declines detected in the Lake Mountain region represent a change
across the broader range of the species' distribution. The implications of these findings
are that recent changes to Leadbeater's possum abundance and distribution due to loss of
important habitat elements may have an additive effect to historic declines. Therefore,
PVA predictions of future declines may be too conservative.
Major Conservation Objectives (recommended on the basis of the genetic data)
• management of populations representing distinct genetic units. The few
populations that have been genetically sampled fall into three distinct genetic
149
units: the northern highlands complex represented by Lake Mountain,
Cambarville and Mt Margaret, the south-eastern highlands region represented
here by Powelltown samples, and the population at Yellingbo. In the case of the
Lake Mountain complex and Powelltown, management should be adequately
provided for under the current objectives of maintenance of suitable habitat
(Macfarlane et al. 1995), which are the protection and proliferation of multi-
aged stands of ash.
• continued protection and potential expansion of the population at Yellingbo.
Extension of existing riparian swamp habitat via land acquisition and
revegetation may facilitate a population expansion that would contribute toward
alleviating the effects of genetic drift and isolation.
Management Issues
The genetic data collected here suggest that the majority of genetic variation is
contained within small groupings of individuals, usually colonies but sometimes groups
of colonies (Chapter 5). This means that genetic variability is scattered across meta-
populations in a mosaic of kin groups, whose distribution is dictated by hollow
availability (Figure 2, Chapter 5). The implications of this meta-population structure is
that population “boundaries” will be difficult to delineate, and what may at first appear
to constitute continuous permeable habitat may in fact be punctuated with cryptic
barriers to dispersal and recolonisation (which are not necessarily physical). This will
need to be considered when considering fragmentation effects, not only in terms of
silvicultural practices, but also in terms of roading, fire breaks and other potential
barriers (Macfarlane and Seebeck 1991).
Ecological Issues Specific to the Taxon
Leadbeater's possum is largely monogamous and extra-pair matings occur rarely
(Chapter 5). It has strict social dynamics with mating opportunities usually limited to a
single dominant breeding pair in each colony. Colonies tend to cluster into groups of
partially related individuals (kin groups), maintaining discrete genetic units in areas of
continuous suitable habitat (Figure 2, Chapter 5). These units infrequently exchange
migrants but contain a significant portion of the population’s genetic diversity. The
degree to which nest boxes artificially structure kin groups remains to be tested.
However, the focal point of each colony is the primary den (be it hollow or box), and
the availability of den sites dictates the spatial distribution of kin groups (Chapter 5).
150
Loss of den sites may lead to erosion of kin groups, and loss of local genetic diversity.
Thus, the distribution and availability of den sites underpins meta-population genetic
structure and variability.
151
Evolutionary Issues Specific to the Taxon
Past Population Processes in the Central Highlands
Leadbeater's Possum is the sole extant member of the genus Gymnobelideus, which is
represented by sub-fossil remains in east Gippsland (dated from the late Pleistocene)
and from south-eastern New South Wales (dated from the mid-late Pleistocene)
(Wakefield 1967, Lindenmayer 1989). A sub-fossil representing a closely related, but
extinct genus, was found at Wombeyan Caves in the New South Wales tablelands
(Lindenmayer 1989). The closest living relative to Gymnobelideus is the Common
Striped Possum (Edwards and Westerman 1992, Osborne and Christidis 2001),
Dactylopsila trivirgata, which occurs only at tropical latitudes. The Gymnobelideus
lineage diverged from the Dactylopsiline lineage around 32 million years ago (Edwards
and Westerman 1992). The presence of sub-fossils north and east of the current range of
G. leadbeateri suggests a range shift (or contraction) since that divergence, from more
northerly latitudes to the southerly wet sclerophyll forests.
In this study, mitochondrial DNA control region sequencing was used to assess long-
term changes in population size and distribution. Different sequences are termed
haplotypes and new haplotypes arise by mutations in the sequence (Moritz et al. 1987).
Different haplotypes were identified at Cambarville, Lake Mountain, Mt Margaret,
Powelltown, Warburton, Toolangi and Yellingbo (Figure 4, Chapter 4). Only three of
these were shared between populations, one between Lake Mountain and Cambarville,
one between Lake Mountain and Mt Margaret and one between Lake Mountain and
Warburton. The scattering of different haplotypes among populations in no regional
pattern (that is, similar haplotypes were not necessarily restricted to a single location)
(Figure 4, Chapter 4) indicates no historic population structure.
Detailed analyses of mitochondrial sequences obtained from animals residing in nest
boxes at Lake Mountain gave a signal of historic population decline. This is despite the
large number of breeding colonies (n=26) and the apparent successful breeding there:
80 offspring, both weaned (n=71) and pouch young (n=9) were encountered in colonies
over three visits in a 12 month period (data not shown). This decline is also despite high
microsatellite genetic diversity. Expected heterozygosity (HE) at Lake Mountain was
0.79, which compares favourably with other petaurids in continuous habitat like Sugar
Gliders in Paddy’s Ranges, HE = 0.89 (Kendall 2008) and Greater Gliders in Bungungo
152
SF HE = 0.74 (Taylor et al. 2007), and to the Common Striped Possum, HE = 0.74
(Hansen et al. 2003).
The general patterns in the mitochondrial data suggest that the Leadbeater's Possum
populations analysed may have been declining since the last glaciation. This implies
that its current restricted distribution may be indicative of an ongoing climate-induced
range contraction. This concept is not new but it has lacked any empirical data to
support it, and has been based mostly upon the fossil record (Lindenmayer 1996). The
long-term decline detected at Lake Mountain provides the first evidence of a population
decline occurring prior to European colonisation of Victoria. More genetic data from
other central highlands populations will elucidate the extent of this decline. In
particular, coalescent analyses using other marker types (for example, nuclear sequence
markers) would be warranted to further examine these trends in population size).
Nevertheless, current and more rapid reductions in population size as a result of habitat
loss in addition to historic declines may elevate the extinction risk beyond what is
currently predicted.
The Evolutionary History of the Population at Yellingbo
The population at Yellingbo has experienced a genetic bottleneck and consequently, has
very low genetic variation relative to other extant populations (HE = 0.55). It is also
significantly genetically diverged from the central highlands (Hansen and Taylor 2008,
Chapter 4). Although the exact divergence time is unknown, simulations of genetic
bottlenecking indicate that it has been separated from other extant populations for well
over 50 generations (or 100 years) (Hansen and Taylor 2008). Furthermore,
mitochondrial DNA analyses confirm it to be a remnant of a now extinct gene pool
(Chapter 4), and reveal close affinities with the extinct populations from Western Port
(represented by four specimens held at the Museum of Victoria).
Its long-term genetic divergence, the distinctness of habitat compared with central
highlands populations and the signs of long-term population stability (inferred from
coalescent analyses of mitochondrial data, Table 5, Chapter 4), indicate Yellingbo to be
evolutionarily distinct from the rest of the species. According to the criteria of Moritz
(1995), historically isolated populations that together encompass the evolutionary
diversity of a taxon qualify as Evolutionarily Significant Units. Yellingbo fits these
criteria in being a monophyletic clade containing unique genetic diversity (albeit low
153
diversity). This definition may also extend to the central highlands, although more
genetic data are necessary to assess this proposition. Nevertheless, the population at
Yellingbo clearly represents an important historically isolated genetic unit and needs to
be managed under separate criteria to other populations. The major conservation issue
therefore is not habitat protection per se but long-term evolutionary persistence to
counterbalance the effects of isolation and genetic drift (Hansen and Taylor 2008,
Chapter 5).
Management Action
Intended Management Action
Management strategies outlined in the 1995 action statement may be sufficient to
maintain current genetic diversity within the central highlands, if they are implemented
strictly according to their recommendations. In particular, the focus on maintenance and
proliferation of habitat containing multi-aged stands of regrowth ash, to ensure the
recruitment of younger trees to maturity, should remain the highest priority. The
establishment of three zones with difference land uses was intended to meet this
management strategy. The first zone (Zone 1) prioritises Leadbeater's Possum
conservation and stipulates the retention of mature and mixed-aged ash forest. The
second zone (Zone 1B) is a mixed-use area allowing for timber production whilst
stipulating retention of hollow-bearing trees and Acacia at a pre-defined basal area. The
third zone (Zone 2) prioritises timber production activities but stipulates the retention of
regrowth ash forest. The distribution of multi-aged and regrowth ash forest in Zone 1B
and Zone 2 landscapes will be of critical importance in the future provision of hollow-
bearing trees, if these zonings contain a substantial proportion of the species'.
The population at Yellingbo contains important historic genetic diversity that is
virtually absent from the central highlands. However, it is very low in genetic variation
and has experienced a genetic bottleneck (Hansen and Taylor 2008). These factors make
it vulnerable to the effects of inbreeding depression and loss of evolutionary potential. It
is therefore desirable to establish other breeding populations in similar habitat. The
advantages of translocation of individuals (not dominant breeding animals) to
unoccupied lowland swamp sites would be twofold. One, it will provide a second extant
representative of an ancestral gene pool, which will reduce stochastic extinction risk.
Two, it will increase reproductive turnover by allowing non-breeding adults the
154
opportunity to establish new colonies. The strict social dynamics of the species' and the
tenure of dominant breeding pairs (up to three years and possibly more, Chapter 5)
means that it will be important not to disrupt established breeding colonies.
Planning and Management Units
The 1995 FFG Action Statement outlined plans to establish 25 Leadbeater's Possum
Management Units (LMUs) based upon the extent and spatial distribution of ash-type
forest. The intended aim of this management strategy is to "maintain viable populations
of the species in all LMUs". Whilst this proposal is commendable, its definition of a
management unit is incomplete and ignores the evolutionary basis for defining units of
conservation significance (Moritz 1994). As a result, it lacks consideration of genetic
factors to guide assessment of suitable sites for maintaining long-term evolutionary
persistence, which in turn is necessary for the maintenance of viable populations. The
evidence gathered in this study suggests that, while Leadbeater's Possum is capable of
long distance dispersal (>2km), intrinsic factors of the species’ social system limits gene
flow among kin groups (Figure 2, Chapter 5). This means that genetic diversity is
concentrated into local patches that significantly contribute to meta-population
diversity, but may be missed in reserve design owing to their cryptic nature.
Distribution, density and landscape context of hollow-bearing trees will play an
important role in landscape genetic structure. Ideally, an initial assessment of genetic
diversity at sites earmarked for reservation as LMUs should be made, to sample the
local gene pool and determine its degree of divergence relative to other sampled
populations. This will ultimately ensure that collectively, LMUs do contain "viable"
populations in terms of species' genetic diversity.
The population/s at Powelltown (which requires further genetic assessment to establish
its boundaries) and at Lake Mountain should each constitute one of the 25 LMUs as
they have already been identified as containing unique and significantly different
components of the species' genetic diversity.
Other Desirable Management Actions
The extent to which the current genetic separation of Powelltown from northern central
highlands populations is due to fragmentation is not assessable with the current data set.
Therefore, further genetic sampling of this and other central highlands populations is
necessary to quantify the effects of fragmentation at the montane landscape scale. The
155
collection of additional samples will also improve our baseline genetic database and will
allow for realistic future estimates of effective population sizes. Effective population
sizes should be incorporated into future PVA modelling to give a more accurate
indication of past and predicted population turnover rates.
Despite containing a substantial amount of genetic diversity (HE = 0.74, Hansen and
Taylor 2008), the captive colonies at Melbourne Zoo and Healesville Sanctuary
collapsed. There does not appear to be any genetic basis for this collapse (that is, no
signs of inbreeding), and therefore, establishment of new captive colonies should be
considered as a long term insurance policy against future species declines. Ideally, these
should be seeded with wild stock from both the central highlands and Yellingbo.
However, it is inadvisable to interbreed founders sourced from different habitat types,
until it can be ascertained whether they represent entities that differ in important
adaptive characteristics.
Ideally monitoring data collected by individual researchers should be centralised in
electronic format and made available to other researchers so that maximum information
can be obtained in each study. This should also include the collection and storage of
genetic samples from independent research programs for future research purposes.
156
References
Ambrose GJ (1982) An ecological and behavioural study of vertebrates using hollows in
Eucalypt branchesThesis. La Trobe University. Melbourne
Bandelt H-J, Forster P, Röhl A (1999) Median-joining networks for inferring
intraspecific phylogenies. Molecular Biology and Evolution 16, 37-48.
Banks S, Taylor A (2004) Genetic analysis in fauna conservation: issues and
applications to Australian forests Conservation of Australia's Forest Fauna, pp. 576-
590.
Banks S, Ward S, Lindenmayer D, et al. (2005) The effects of habitat fragmentation on
the social kin structure and mating system of the Agile antechinus, Antechinus agilis.
Molecular Ecology, 14, 1789-1801.
Banks SC, Piggott MP, Stow AJ, Taylor A (2007) Sex and sociality in a disconnected
world: a review of the impacts of habitat fragmentation on animal social interactions.
Canadian Journal of Zoology 85, 1065-1079.
Beaumont MA (1999) Detecting Population Expansion and Decline Using
Microsatellites. Genetics, 153, 2013-2029.
Bouchy P, Theodorou K, Couvet D (2005) Metapopulation viability: influence of
migration. Conservation Genetics, 6, 75-85.
Brazenor CW (1931) Twelve days in north-east Victoria. Victorian Naturalist, 48, 165-
167.
Brazenor CW (1946) Last chapter to come. A history of Victoria’s rarest possum. Wild
Life, 8, 382-384.
Brazenor CW (1962) Rediscovery of a rare Australian possum. Proceedings of the
Zoological Society of London, 139, 429-431.
157
Calaby JH (1960) Australia’s Threatened Mammals. Oryx, 5, 381-386.
Cornuet J, Luikart G (1996) Description and Power Analysis of Two Tests for Detecting
Recent Population Bottlenecks from Allele Frequency Data. Genetics, 144, 2001-2014.
Diniz-Filho JAF, Telles MPD (2002) Spatial Autocorrelation Analysis and the
Identification of Operational Units for Conservation in Continuous Populations.
Conservation Biology, 16, 924-935.
Dobson FS (1998) Social Structure and Gene Dynamics in Mammals. Journal of
Mammalogy, 79, 667-670.
Dobson FS, Chesser RK, Hoogland JL, Sugg DW, Foltz DW (1998) Breeding Groups
and Gene Dynamics in a Socially Structured Population of Prairie Dogs. Journal of
Mammalogy, 79, 671-680.
Edwards D, Westerman M (1992) DNA-DNA Hybridisation and the Position of
Leadbeater's Possum (Gymnobelideus leadbeateri McCoy) in the Family Petauridae
(Marsupialia: Diprotodontia). Australian Journal of Zoology, 40, 563-571.
Eigenbrod F, Hecnar SJ, Fahrig L (2008) Accessible habitat: an improved measure of
the effects of habitat loss and roads on wildlife populations. Landscape Ecology, 23,
159-168.
Eldridge M, Browning T, Close R (2001) Provenance of a New Zealand brush-tailed
rock-wallaby (Petrogale penicillata) population determined by mitochondrial DNA
sequence analysis. Molecular Ecology, 10, 2561-2567.
Eldridge M, Rummery C, Bray C, et al. (2004) Genetic analysis of a population crash in
brush-tailed rock-wallabies (Petrogale penicillata), from Jenolan Caves, south-eastern
Australia. Wildlife Research, 31, 229-240.
Eldridge M, King J, Loupis A, et al. (1999) Unprecedented Low Levels of Genetic
Variation and Inbreeding Depression in an Island Populations of the Black-Footed
Rock-Wallaby. Conservation Biology, 13, 531-541.
158
England P (1998) Conservation Genetics of Population BottlenecksThesis. Macquarie
University. Sydney
England P, Osler G (2001) GENELOSS: a computer program for simulating the effects
of population bottlenecks on genetic diversity. Molecular Ecology, 1, 111-113.
England PR, Osler GHR, Woodworth LM, et al. (2003) Effect of intense versus diffuse
population bottlenecks on microsatellite genetic diversity and evolutionary potential.
Conservation Genetics, 4, 595-604.
Evanno G, Regnaut S, Goudet J (2005) Detecting the number of clusters of individuals
using the software STRUCTURE: a simulation study. Molecular Ecology, 14, 2611-
2620.
Excoffier L, Laval G, Schneider S (2005) Arlequin (version 3.0): An integrated
software package for population genetics data analysis. Evolutionary Bioinformatics
Online, 1, 47-50.
Fleay D (1933) A beautiful phalanger. Victorian Naturalist, 50, 34-41.
Frankham R (1998) Inbreeding and Extinction: Island Populations. Conservation
Biology, 12, 665-675.
Frankham R (2005) Genetics and extinction. Biological Conservation, 126, 131-140.
Frankham R, Ballou J, Briscoe D (2004) A Primer of Conservation Genetics.
Cambridge University Press, UK.
Fumagalli L, Pope LC, Taberlet P, Moritz C (1997) Versatile primers for the
amplification of the mitochondrial DNA control region in marsupials. Molecular
Ecology, 6, 1199-1201.
Gallant AL, Klaver RW, Casper GS, Lannoo MJ (2007) Global Rates of Habitat Loss
and Implications for Amphibian Conservation. Copeia, 4, 967-979.
159
Garza J, Williamson E (2001) Detection of reduction in population size using data from
microsatellite loci. Molecular Ecology, 10, 305-318.
Gibbons P, Lindenmayer D (2002) Tree hollows and wildlife conservation in Australia.
CSIRO publishing, Collingwood.
Goossens B, Chikhi L, Ancrenaz M, et al. (2006) Genetic Signature of Anthropogenic
Population Collapse in Orang-utans. PLoS Biology, 4, 285-291.
Goudet J (2001) FSTAT, a program to estimate and test gene diversities and fixation
indices (version 2.9.3). http://www.unil.ch/izea/softwares/fstat.html
Hall LS (1974) A Recent Bone Deposit at Marble Arch, N.S.W. Proceedings of the 10th
Biennial Conference of the Australian Speleological Federation, pp. 35-46.
Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT. Nucleic Acids Symposia Series, 41, 95-98.
Handley LJL, Perrin N (2007) Advances in our understanding of mammalian sex-biased
dispersal. Molecular Ecology, 16, 1559-1578.
Hansen B, Sunnucks P, Blacket M, Taylor A (2005) A set of microsatellite markers for
an endangered arboreal marsupial, Leadbeater’s possum. Molecular Ecology Notes, 5,
796-799.
Hansen B, French J, Handasyde K, Kendal T, Taylor A (2003) A set of microsatellite
primers for the striped possum, Dactylopsila trivirgata (Petauridae: Marsupialia).
Molecular Ecology Notes, 3, 212-214.
Harley D (2006) The Yellingbo population of Leadbeater's Possum - remnant or
introduced? Victorian Naturalist, 123, 170-173.
Harley D (2007) Snow Possums. Wildlife Australia, 44, 32-35.
160
Harley DKP (2002) The Discovery of Leadbeater's Possum Gymnobelideus leadbeateri
along the Woori Yallock Creek, Yellingbo. Victorian Naturalist, 119, 233-235.
Harley DKP (2004a) Patterns of nest box use by Leadbeater’s possum (Gymnobelideus
leadbeateri): applications to research and conservation. In: The Biology of Australian
Possums and Gliders (eds. Goldingay R, Jackson S), pp. 318–329. Surrey Beatty &
Sons, Chipping Norton.
Harley DKP (2004b) A Review of Recent Records of Leadbeater's Possum
(Gymnobelideus leadbeateri). In: The Biology of Australian Possums and Gliders (eds.
Goldingay R, Jackson S), pp. 330-338. Surrey Beatty & Sons, Chipping Norton.
Harley DKP (2005) The life history and conservation of Leadbeater's Possum
(Gymnobelideus leadbeateri) in lowland swamp forest. Ph.D. Thesis. Monash
University. Melbourne
Harley DKP, Lill A (2007) Reproduction in a population of the endangered
Leadbeater’s possum inhabiting lowland swamp forest. Journal of Zoology, 272, 451-
457.
Harley DKP, Worley MA, Harley TK (2005) The distribution and abundance of
Leadbeater's possum Gymnobelideus leadbeateri in lowland swamp forest at Yellingbo
Nature Conservation Reserve. Australian Mammalogy, 27, 7-15.
Hartl D, Clark AG (1997) Principles of Population Genetics. Sinauer Associates, Ma.
Hellborg L, Walker CW, Rueness EK, et al. (2002) Differentiation and levels of genetic
variation in northern European lynx (Lynx lynx) populations revealed by microsatellites
and mitochondrial DNA analysis. Conservation Genetics, 3, 97-111.
Hope J (1974) The biogeography of mammals of the islands of Bass Strait. In:
Biogeography and ecology in Tasmania (ed. Williams WD), pp. 397-415. Junk, The
Hague.
161
Houlden BA, England PR, Taylor AC, Greville WD, Sherwin WB (1996) Low genetic
variability of the koala Phascolarctos cinereus in south-eastern Australia following a
severe population bottleneck. Molecular Ecology, 5, 269-281.
Janke A, Feldmaier-Fuchs G, Thomas WK, von Haeseler A, Pääbo S (1994) The
Marsupial Mitochondrial Genome and the Evolution of Placental Mammals. Genetics,
137, 243-256.
Jelinek A, Cameron D, Belcher C, Turner L (1995) New Perspectives on the Ecology of
Lake Mountain: The Discovery of Leadbeater's Possum Gymnobelideus leadbeateri
McCoy in Sub-alpine Woodland. Victorian Naturalist, 112, 112-115.
Kalinowski ST, Wagner AP, Taper ML (2006) ML-Relate: a computer program for
maximum likelihood estimation of relatedness and relationship. Molecular Ecology
Notes, 6, 576-579.
Kendal P (2008) Molecular Population Ecology of the Sugar Glider (Petaurus
breviceps) in Fragmented and Unfragmented Habitat. Ph.D. Thesis. Monash University.
Clayton
Kerr JT, Burkey TV (2002) Endemism, diversity, and the threat of tropical moist forest
extinctions. Biodiversity and Conservation, 11, 695-704.
Keyghobadi N (2007) The genetic implications of habitat fragmentation for animals.
Canadian Journal of Zoology, 85, 1049-1064.
Kraaijeveld-Smit F, Beebee T, Griffiths R, Moore R, Schley L (2005) Low gene flow
but high genetic diversity in the threatened Mallorcan midwife toad Alytes muletensis.
Molecular Ecology, 14, 3307-3315.
Kuhner MK, Yamato J, Felsenstein J (1995) Estimating effective population size and
neutral mutation rate from sequence data using Metropolis-Hastings sampling. Genetics,
140, 1421-1430.
162
Kumar S, Tamura K, Jakobsen I, Nei M (2001) MEGA2: molecular evolutionary
genetics analysis software. Bioinformatics, 17, 1244-1245.
Lada H, Mac Nally R, Taylor AC (2008) Distinguishing past from present gene flow
along and across a river: the case of the carnivorous marsupial (Antechinus flavipes) on
southern Australian floodplains. Conservation Genetics, 9, 569-580.
Lambert DM, King T, Shepherd LD, et al. (2005) Serial population bottlenecks and
genetic variation: Translocated populations of the New Zealand Saddleback
(Philesturnus carunculatus rufusater). Conservation Genetics, 6, 1-14.
Larwill S, Myroniuk P, Belvedere M, Westerman M (2003) Evidence of Leadbeater's
Possum Gymnobelideus leadbeateri in the Macedon Region: An Example of the Use of
Molecular Genetics in Fauna Survey. Victorian Naturalist, 120, 132-139.
Lessa EP, Cook JA, Patton KP (2003) Genetic footprints of demographic expansion in
North America, but not Amazonia, during the Late Quaternary. Proceedings of the
National Academy of Science, 100, 10331–10334.
Lindenmayer DB (1989) The ecology and habitat requirements of Leadbeater's Possum.
Ph.D. Thesis. ANU. Canberra
Lindenmayer DB (1996) Wildlife and Woodchips. UNSW Press, Sydney.
Lindenmayer DB (2000) Factors at multiple scales affecting distribution patterns and
their implication for animal conservation - Leadbeater's Possum as a case study.
Biodiversity and Conservation, 9, 15-35.
Lindenmayer DB, Lacy RC (1995) Metapopulation viability of Leadbeater's Possum,
Gymnobelideus leadbeateri, in fragmented old-growth forests. Ecological Applications,
5, 164-182.
Lindenmayer DB, Possingham HP (1995) Modelling the viability of metapopulations of
the endangered Leadbeater's possum in south-eastern Australia. Biodiversity and
Conservation, 4, 984-1018.
163
Lindenmayer DB, Possingham HP (1996) Ranking Conservation and Timber
Management Options for Leadbeater's Possum in Southeastern Australia Using
Population Viability Analysis. Conservation Biology, 10, 235-251.
Lindenmayer DB, Meggs RA (1996) Use of Den Trees by Leadbeater's Possum
(Gymnobelideus leadbeateri). Australian Journal of Zoology, 44, 625-638.
Lindenmayer DB, Cunningham RB, Donnelly CF (1997) Tree decline and collapse in
Australian forests: implications for arboreal marsupials. Ecological Applications, 7,
625-641.
Lindenmayer DB, Smith AP, Craig SA, Lumsden LF (1989) A Survey of the
Distribution of Leadbeater's Possum, Gymnobelideus leadbeateri McCoy in the Central
Highlands of Victoria. Victorian Naturalist, 106, 174-178.
Lindenmayer DB, Cunningham RB, Tanton MT, Smith AP (1990) The Conservation of
Arboreal Marsupials in the Montane Ash Forests of the Central Highlands of Victoria,
South-East Australia: II. The Loss of Trees with Hollows and its Implications for the
Conservation of Leadbeater's Possum, Gymnobelideus leadbeateri McCoy
(Marsupialia: Petauridae). Biological Conservation, 54, 133-145.
Lindenmayer DB, Nix HA, McMahon JP, Hutchinson MF, Tanton MT (1991) The
conservation of Leadbeater's Possum, Gymnobelideus leadbeateri (McCoy): a case
study of the use of bioclimatic modelling. Journal of Biogeography, 18, 371-383.
Lindenmayer DB, Cunningham RB, Donnelly CF, Tanton MT, Nix HA (1993) The
abundance and development of cavities in montane ash-type eucalypt trees in the
montane forests of the central highlands of Victoria, south-eastern Australia. Forest
Ecology and Management, 60, 77-104.
Lindenmayer DB, Cunningham RB, MacGregor C, Incoll RD, Michael D (2003a) A
survey design for monitoring the abundance of arboreal marsupials in the Central
Highlands of Victoria. Biological Conservation, 110, 161-167.
164
Lindenmayer DB, MacGregor CI, Cunningham RB, et al. (2003b) The use of nest boxes
by arboreal marsupials in the forests of the Central Highlands of Victoria. Wildlife
Research, 30, 259-264.
Loyn RH, McNabb EG (1982) Discovery of Leadbeater's Possum in Gembrook State
Forest. Victorian Naturalist, 99, 21-23.
Luikart G, Allendorf F, Cornuet J, Sherwin W (1998) Distortion of Allele Frequency
Distributions Provides a Test for Recent Population Bottlenecks. Journal of Heredity,
89, 238-247.
Macfarlane M, Lowe KL, Smith J (1995) Flora and Fauna Guarantee Action Statement:
Leadbeater's Possum Gymnobelideus leadbeateri. Department of Sustainability and
Environment, Melbourne.
Macfarlane MA, Seebeck JH (1991) Draft Management Strategies for the Conservation
of the Leadbeater's Possum Gymnobelideus leadbeateri, in Victoria. Arthur Rylah
Institute for Environmental Research Technical Report Series No. 111, Department of
Conservation and Environment - Victoria.
Manel S, Schwartz MK, Luikart G, Taberlet P (2003) Landscape genetics: combining
landscape ecology and population genetics. Trends in Ecology and Evolution, 18, 189-
197.
Marshall T, Spalton J (2000) Simultaneous inbreeding and outbreeding depression in
reintroduced Arabian oryx. Animal Conservation, 3, 241-248.
Marshall TC, Slate K, Kruuk L, Pemberton JM (1998) Statistical confidence for
likelihood-based paternity inference in natural populations. Molecular Ecology, 7, 639-
655.
McCoy F (1867) On a new genus of phalanger. Annals and Magazine of Natural
History, 3, 287-288.
Menkhorst PW (1995) Mammals of Victoria. Oxford University Press, Melbourne.
165
Mitrovski P, Heinze DA, Broome L, Hoffman AA, Weeks AR (2007) High levels of
variation despite genetic fragmentation In populations of the endangered mountain
pygmy-possum, Burramys parvus, in alpine Australia. Molecular Ecology, 16, 75-87.
Moritz C (1994) Defining ‘Evolutionarily Significant Units’ for conservation. Trends in
Ecology and Evolution, 9, 373-375.
Moritz C (1995) Uses of molecular phylogenies for conservation. Philosophical
Transactions of the Royal Society of London Series B, 349, 113-118.
Moritz C (2002) Strategies to Protect Biodiversity and the Evolutionary Processes That
Sustain It. Systematic Biology, 51, 238-254.
Moritz C, Dowling TE, Brown WM (1987) Evolution of animal mitochondrial DNA:
relevance for population biology and systematics. Annual Review of Ecology and
Systematics, 18, 269-292.
Munguia-Vega A, Esquer-Garrigos Y, Rojas-Bracho L, et al. (2007) Genetic drift vs.
natural selection in a long-term small isolated population: major histocompatibility
complex class II variation in the Gulf of California endemic porpoise (Phocoena sinus).
Molecular Ecology, 16, 4051-4065.
Nei M, Maruyama T, Chakraborty R (1975) The bottleneck effect and genetic
variability in populations. Evolution, 29, 1-10.
Nicholls EB (1911) A trip to the Bass Valley. Victorian Naturalist, 28, 149-157.
Osborne MJ, Christidis L (2001) Molecular Phylogenetics of Australo–Papuan Possums
and Gliders (Family Petauridae). Molecular Phylogenetics and Evolution, 20, 211-224.
Peakall R, Smouse PE (2006) GENALEX 6: Genetic Analysis in Excel. Population
genetic software for teaching and research. Molecular Ecology Notes, 6, 288-295.
166
Peel D, Ovenden JR, Peel SL (2004) NeEstimator: software for estimating effective
population size, Version 1.3. Queensland Government, Dept. of Primary Industries and
Fisheries.
Piertney SB, MacColl AD, Bacon PJ, Dallas JF (1998) Local genetic structure in red
grouse (Lagopus lagopus scoticus): evidence from microsatellite DNA markers.
Molecular Ecology, 7, 1645-1654.
Piggott MP, Bellemain E, Taberlet P, Taylor AC (2004) A multiplex pre-amplification
method that significantly improves microsatellite amplification and error rates for faecal
DNA in limiting conditions. Conservation Genetics, 5, 417-420.
Piggott MP, Banks SC, Stone N, Banffy C, Taylor AC (2006) Estimating population
size of endangered brush-tailed rockwallaby (Petrogale penicillata) colonies using
faecal DNA. Molecular Ecology, 15, 81-91.
Piry S, Alapetite A, Cornuet J-M, et al. (2004) GeneClass2: A Software for Genetic
Assignment and First-Generation Migrant Detection. Journal of Heredity, 95, 536-539.
Pope TR (1992) The influence of dispersal patterns and mating system on genetic
differentiation within and between populations of the red howler monkey (Alouatta
seniculus). Evolution, 46, 1112-1128.
Pritchard J, Stephens M, Donnelly P (2003) Inference of Population Structure Using
Multilocus Genotype Data. Genetics, 155, 845-859.
Pritchard JK, Stephens M, Donnelly P (2000) Inference of population structure using
multilocus genotype data. Genetics, 155, 945–959.
Quinn GP, Keough MJ (2002) Experimental Design and Data Analysis for Biologists.
Cambridge University Press, Port Melbourne.
Rader RB, Belk MC, Shiozawa DK, Crandall KA (2005) Empirical test for ecological
exchangeability. Animal Conservation, 8, 239-247.
167
Rankmore BR, Price OF (2004) Effects of habitat fragmentation on the vertebrate fauna
of tropical woodlands, Northern Territory. In: Conservation of Australia's Forest Fauna
(ed. Lunney D), pp. 452-472. Royal Zoological Society of New South Wales, Mosman.
Rannala B, Mountain JL (1997) Detecting Immigration by Using Multilocus Genotypes.
Proceedings of the National Academy of Science of the United States of America, 94,
9197.
Raymond M, Rousset F (1995) GENEPOP (version 1.2): population genetics software
for exact tests and ecumenicism. Journal of Heredity, 86, 248-249.
Ross KG (2001) Molecular ecology of social behaviour: analyses of breeding systems
and genetic structure. Molecular Ecology, 10, 265-284.
Saccheri I, Kuussaari M, Kankare M, et al. (1998) Inbreeding and extinction in a
butterfly metapopulation. Nature, 392, 491-494.
Selkoe KA, Toonen RJ (2006) Microsatellites for ecologists: a practical guide to using
and evaluating microsatellite markers. Ecology Letters, 9, 615-629.
Sjögren P, Wyöni P (1993) Conservation Genetics and Detection of Rare Alleles in
Finite Populations. Conservation Biology, 8, 267-270.
Smales IJ (1994) The Discovery of Leadbeater's Possum, Gymnobelideus leadbeateri
McCoy, Resident in a Lowland Swamp Woodland. Victorian Naturalist, 111, 178-182.
Smith A (1980) The diet and ecology of Leadbeater's possum and the Sugar glider.
Ph.D. Thesis. Monash University. Melbourne
Smith A (1984a) Diet of Leadbeaters Possum, Gymnobelideus leadbeateri
(Marsupialia). Australian Wildlife Research, 11, 265-273.
Smith A (1984b) Demographic consequences of reproduction, dispersal and social
interaction in a population of leadbeaters Possum (Gymnobelideus leadbeateri). In:
168
Possum and Gliders (eds. Smith AP, Hume ID), pp. 359-373. Australiam Mammal
Society, Sydney.
Smith A, Woodgate P (1985) Appraisal of fire damage for timber salvage by remote
sensing in Mountain Ash forests. Australian Forestry 48, 252-263.
Smith A, Lindenmayer D (1988) Tree Hollow Requirements of Leadbeater's Possum
and Other Possums and Gliders in Timber Production Ash Forests of the Victorian
Central Highlands. Australian Wildlife Research, 15, 347-362.
Smith A, Lindenmayer D, Suckling G (1985) The Ecology and Management of
Leadbeater’s Possum. Research Report to the World Wildlife Fund Australia,
University of New England.
Spencer B (1921) The necessity for an immediate and coordinated investigation into the
land and fresh-water fauna of Australia and Tasmania. Victorian Naturalist, 37, 120-
122.
Sunnucks P (2000) Efficient genetic markers for population biology. Trends in Ecology
and Evolution, 15, 199-203.
Sunnucks P, Hales D (1996) Numerous transposed sequences of mitochondrial
cytochrome oxidase I-II in aphids of the genus Sitobion (Hemiptera: Aphididae).
Molelcular Biology and Evolution, 13, 510-524.
Sunnucks P, Wilson ACC, Beheregaray LB, et al. (2000) SSCP is not so difficult: the
application and utility of single-stranded conformation polymorphism in evolutionary
biology and molecular ecology. Molecular Ecology, 9, 1699-1710.
Sunnucks P, Blacket MJ, Taylor J, et al. (2006) A tale of two flatties: different
responses of two terrestrial flatworms to past environmental climatic fluctuations at
Tallaganda in montane southeastern Australia. Molecular Ecology, 15, 4513-4531.
Taberlet P, Waits LP, Luikart G (1999) Noninvasive genetic sampling: look before you
leap. Trends in Ecology and Evolution, 14, 323-327.
169
Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution, 24,
1596-1599.
Taylor A, Sherwin W, Wayne R (1994) Genetic variation of microsatellite loci in a
bottlenecked species: the northern hairy-nosed wombat Lasiorhinus krefftii. Molecular
Ecology, 3, 277-290.
Taylor AC (2003) Assessing the consequences of inbreeding for population fitness: past
challenges and future prospects. In: Reproductive Science and Integrated Conservation
eds. Holt WV, Pickard AR, Rodger JC, Wildt DE), pp. 67-81. Cambridge University
Press, Cambridge.
Taylor AC, Cooper DW (2000) Microsatellites identify introduced New Zealand
tammar wallabies (Macropus eugenii) as an ‘extinct’ taxon. Animal Conservation, 2,
41-49.
Taylor AC, Tyndale-Biscoe H, Lindenmayer DB (2007) Unexpected persistence on
habitat islands: genetic signatures reveal dispersal of a eucalypt-dependent marsupial
through a hostile pine matrix. Molecular Ecology, 16, 2655-2666.
Thomas VC (1989) The ecology of Leadbeater’s possum in the Cockatoo Swamp,
Yellingbo State Nature Reserve. Hons. Thesis. La Trobe University. Melbourne
Valière N, Berthier P, Mouchiroud D, Pontier D (2002) GEMINI: software for testing
the effects of genotyping errors and multitubes approach for individual identification.
Molecular Ecology Notes, 2, 83-86.
Wakefield NA (1967) Mammal Bones in the Buchan District. Victorian Naturalist, 84,
211-214.
Walker FM, Taylor AC, Sunnucks P (2006) Does soil type drive social organization in
southern hairy-nosed wombats? Molecular Ecology, 16, 198-208.
170
Wilkinson HE (1961) The Rediscovery of Leadbeater's Possum, Gymnobelideus
leadbeateri McCoy. Victorian Naturalist, 78, 97-102.
Yugovic J, Mitchell S (2006) Ecological review of the Koo-Wee-Rup Swamp and
associated grasslands. Victorian Naturalist, 123, 323-334.
Zane L, Bargelloni L, Patarnello T (2002) Strategies for microsatellite isolation: a
review. Molecular Ecology, 11, 1-16.