1

Preparation and in vitro characterization of Lactobacillus

plantarum and Lactobacillus fermentum beads using low

methoxyl pectin

Qingshen Sun

*1, Yanyan Zhang

1, Xiuyan Ma

1, Dequan Han

1, Yue Shi

1, Quan Sun

1,

Xiaoxiong Ma1, Chunhai Yang

1, Bo Pan

1

1Laboratory of Microbiology, College of Life Science, Heilongjiang University, Harbin

150080, China

Corresponding author: Qingshen Sun

Abstract

Lactobacillus plantarum (LP) and Lactobacillus fermentum (LF) were encapsulated into low

methoxyl pectin (LMP) beads by CaCl2 external ionization. The encapsulating efficiency

(EE), in vitro release and stability studies were performed by plate counting. The results

showed that more than 99.99% EE were obtained. The contents of LF and LP were 10 11

cfu/g

beads (dry base). Stability study showed that encapsulation improved the stability under

ambient temperature compared with the unencapsulated microbes. It provides the foundation

for the further development and application of composite Lactobacillus beads in modulation

of intestinal and systematic function.

Keywords: Low methoxyl pectin Bead; Lactobacillus plantarum; Lactobacillus fermentum

INTRODUCTION

SCIREA Journal of Food

http://www.scirea.org/journal/Food

April 26, 2017

Volume 2, Issue 1, February 2017

2

Probiotics is a kind of live microorganisms which can exert the health effects when there are

enough number reaching colon or the lower parts of small intestine [1-4], and have been

studied extensively for their use as new therapy to the treatment of many diseases, including

the cardiovascular disease, obesity and its related syndrome. Studies also found that the

intestinal flora were most abundant in the colon, therefore, it is conceivable that the changes

of colon flora composition for weight loss may have a more direct effect. However, because

of the instable nature of some probiotics during passage into gastrointestinal (GI) system

where extreme pH and bile salt exist, many measures have been taken, of which

microencapsulation technique showed great promise [5-15]. However, because of the

intestinal soluble features of some materials such as alginate [16, 17], more efforts have been

directed to find more sable materials for probiotics encapsulation.

Pectin is plant-derived component which has been used in many areas based on its different

characters [18-22]. According to the methoxyl contents, pectin can be divided into high

methoxyl pectin (HMP) and low methoxyl pectin (LMP). In recent years, LMP has been

studied in drug delivery system as it can form beads under calcium chloride treatment [22-27],

which are widely used as colon delivery carrier [28-30]. In this study, the LMP was used for

encapsulating LF and LP individually or in combination. The in vitro tests were performed to

verify the possibility of using this kind of material as carrier for colon-targeted probiotic

delivery system.

MATERIALS AND METHODS

Strain

Lactobacillus fermentum subsp. bulgaricus (LF, CGMCC1.1880) was purchased from China

General Microbiological Culture Collection Center (CGMCC). Lactobacillus plantarum (LP)

was isolated from Northeast sauerkraut in our lab.

Preparation of cells for encapsulation

The frozen cultures of Lactobacillus fermentum subsp. bulgaricus (LF) and Lactobacillus

plantarum (LP) were transferred independently into MRS broth at 4% (v/v) under aerobic

environment. Then the cultures were harvested after centrifugation at 4000rm (6C type low

speed centrifugator, Labnet, internation. inc) for 15 min. The pellets were subcultured 3

passages and collected at 4000rpm for 15 min.

3

Low methoxyl pectin (food grade, Anhui Yu Ning Biotechnology Co. Ltd.) beads containing

LP and LF alone or in combination at 1:1 (v/v) were prepared by external ionotropic gelation

[20]. In brief, 2% pectin aqueous solution containing LP and LF alone or in combination was

extruded into 300mM anhydrous calcium chloride (food grade, Anhui Yu Ning

Biotechnology Co. Ltd.) solution using 10 mL injector with 7# needle under stirring. After

extrusion, the solution was stirred for another 20 minutes. After that, the beads were collected

by filtration and freeze-dried after mixing with cryoprotectant. The formula for

cryoprotectant was composed of 10.43 g skim milk (Inner Mongolia Yili Industrial Group

Limited by Share Ltd), 8.91g sucrose and 0.23g MnSO4 in 100mL formulation base, which

were mixed well and boiled at 100 ℃ for 10 min, then cooled down to 4 ℃. The beads

were mixed with cryoprotectant at 4:1 (w/v) [31]. Then the mixture was prefrozen at -20 ℃

for 3 h, then freeze dried for 12 hours. The freeze drying products were collected after dried.

For storage, these products were subdivided into three parts, one was stored in desiccator at

room temperature; the other parts were stored at 4 ℃ and -20 ℃.

The supernatants were collected and used for enumeration of the LP and LF by plate counting

as follows. The morphology of the beads was characterized by optical microscopy.

Encapsulation efficiency (EE)

The EE was calculated by plate counting using MRS agar. The MRS agar medium was

prepared according to manufacturer`s guide and autoclaved at 121 ℃ for 20 min using

LDZX-50KB type vertical pressure steam sterilizer (Shanghai Shen An medical instrument

factory). After cool down to 50 ℃, the medium was poured onto 10 cm plates and

continually cool down. Then the collected flora was diluted serially and spread onto the

plates. After anaerobically culture for 40-44h, the LP and LF were counted and then

calculated as cfu/mL (for supernatants) or cfu/g (for beads). For enumeration of the LP and

LF in supernatants, the supernatant was diluted directly and spread on pates.

The EE was calculated according to Reddy et al [32] based on plate counting technique with

some modifications.

EE=log (A-B)/ log A*100%

Where A and B represent the total number of Lactobacillus added (CFU/ mL) and those in

supernatants.

The total number of lactobacillus was counted by plate counting also. In brief, the LP and LF

4

cultures were spread onto MRS plates after collection and dilution into suitable

concentrations.

In vitro release

Simulated gastric fluid (SGF) was prepared according to the U.S. Pharmacopeia [33], with

some minor modifications. In brief, 100mL SGF containing 1.00 g pepsin (Tissue Culture

Grade，AMERCO), the pH was adjusted to 2.0 with 10 N HCl. Simulated bile fluid (SBF): 1%

SBF was prepared by adding 1g No. 7 bile salt into 99 mL sterile water. Simulated intestinal

fluid (SIF): 1g pancreatin (Tissue Culture Grade, AMERCO) was dissolved into 100mL 0.2M

PBS (pH 6.8) before use.

In vitro release tests were performed by putting the beads in SGF for 2h, SBF 20min, SIF 2h,

continually [34]. After each process, the beads were collected and disintegrated using 50mM

Ethylene diamine tetra-acetic acid (EDTA) solution as above, then washed with autoclaved

saline. The collected flora was spread on 10 cm MRS plates for enumeration in duplicate.

Stability study

The freeze drying beads were stored at -20℃, 4℃ and ambient temperature in desiccator,

respectively, samples were tested weekly in triplicate by plate counting as above.

Determination of microbe number in beads

Strain specific primer design Bacterial DNA was extracted using Ezup pillar bacterial

genome DNA extraction kit. The LF and LP were amplified using 16S rDNA sequences, then

subjected to sequence analysis. The individual specific sites were selected for primer design

using Primer 5.0 primer design software from NCBI website.

RT-PCR The quantification of the LP and LF was based on the pure culture standards. A

tenfold dilution series of the strain in MRS was prepared corresponding to 104 to 10

8

CFU/mL LP and LF, respectively. These dilutions were used for RT-PCR analysis.

Real-time PCR was performed by Bio-Rad apparatus. 0.1g Lyophilized composite

Lactobacillus beads were taken out and subjected to 50 mmol/L EDTA solution for thorough

breakdown. RT-PCR quantitative analysis of the LP and LF was performed using

double-stranded chimeric SYBR dye method.

The specific primers of LP and LF were designed as follows:

LF: PrimerF CAACAAGGGAAAAACGGCGA

5

PrimerR GGAATCAGGTAGGGCGTCTG

LP: PrimerF AAGATAAGCGGCCAGTGCTT

PrimerR CACCGCCACCAAAATTACCG

Amplification was carried out in a 20 uL final volume containing 1 uL bacterial DNA as

templates. 2.0 uL 10×PCR buffer, 1.6 uL 2.5mM dNTPs, 1.2 uL 2.5mM Mg2+, 0.2 uL Taq

DNase, 1.0 uL former primer, 1.0 uL reverse primer and 12 uL ddH2O. The thermocycler

programs had denaturation at 94℃ for 5 min, then 35 cycles with the following steps:

denaturation at 94℃ for 1 min, annealing at 53℃ for 30 s (for LP) or 55℃ for 30 s (for LF),

and elongation at 72℃ for 10 min. For each step, the temperature transition rate was 20 ℃.

Fluorescence signal was detected at the end of the annealing step in every cycle.

Statistical analysis

The results were expressed as mean ±std. All the data were analyzed using Origin 8.0

software. Comparisons were analyzed by one-way analysis of ANOVA.

RESULTS AND DISCUSSION

In vitro characterization of the beads

The study is aimed at the characterization of LMP beads loading LP and LF alone or in

combination in vitro/in vivo. Figure 1 showed the morphology of the beads which were round

and smooth in solutions with excellent disperse character. The average sizes were

2.00±0.02mm. After freeze drying, the beads were light yellow. Our results showed the

spherical morphology with the size which are suitable for animal experiments. The size

distribution may be determined by several factors, such as the internal diameter of syringe

needle, the pectin concentration, the stirring rate. In this study, the optimized protocol

documented by Jung et al was used [35]. There was 3 to 4 log cfu decrease of the LP and LF

in supernatants from beads prepared with LMP encapsulation, indicating that EE was higher

than 99.9%.

Table 1 showed the survivability after in vitro release profile in different simulated fluids. All

the unencapsulated strains showed significantly decrease in activities after subjected to SGF,

with 3.83, 3.95, 3.74 log CFU reduction for LF+LP, LF and LP, respectively. After subjected

to SBF treatment, there is another 1 log CFU reduction, but all were relatively stable in SIF.

6

In comparison, the LF+LP, LF and LP beads showed only 1.10, 1.10, and 0.87 log CFU

reduction after SGF treatment. Another 0.78, 0.69, 1.04 log CFU reduction appeared after

SBF treatment. Similar to unencapsulated strains, all were stable in SIF, indicating that it can

reach small intestine or colon only if the higher survival rate can be obtained upon passage

through gastric acid or bile salt.

Stability analysis

Stability of the probiotics during storage is another important consideration as this affect the

applicability of the products. Generally, temperature, light, oxygen and water can directly

affect the stability of the encapsulated probiotics [36]. For the beads after freeze drying, the

results have been obtained for the beads prepared in different time, which showed that more

stability was found for those stored at -20 and 4℃. Encapsulation with LMP did not change

the stability of the microbes (Fig. 2).

Quantification of the strains in beads

The strain-specific real-time PCR was conducted to quantify the number of the LP and LF in

beads. The PCR products of LF and LP were imaged by agar gel electrophoresis (Fig. 3) ,

then sequenced and checked for the accuracy of the segments using web tool of the National

Center of Biotechnology Information (NCBI) Blast software (data not shown).

The qPCR standard curve was plotted by diluting the LF and LP cultures from 104

CFU to

108 CFU/g, Amplification efficiency were 95% for both strains (Fig. 4). Using the individual

standard regression equation, the number of LP and LF in beads were absolutely calculated as

1011

cfu/g bead (dry base). Fig. 5 showed the absolutely quantification curves of the LP and

LF in beads. The accurate number of each probiotics in beads is important as this will enable

us to design the composition of compound probiotics beads.

In summary, the external gelation by calcium chloride is ideal for encapsulation of LP and LF

into LMP. The compound beads showed good stability in different storage conditions.

ACKNOWLEDGMENTS

We gratefully acknowledge the support of the Heilongjiang province natural science

foundation of China (C2016049), and support program from Biomass and Mineral Resources

Efficient Use Collaborative Innovation Center R & D incubation and transformation.

7

Figures and Tables

Fig. 1 image of LMP beads. Left: LMP beads before freeze drying; Right: LMP beads with

protectant after freeze drying

8

Fig. 2 Stability studies on the freeze-dried microcapsules storage under 4℃ (A) , 20℃(B) and

-20(C),respectively. All the viable flora number was calculated as the number of lactobacillus on dry

base (CFU/g) for comparison. LP, Lactobacillus plantarum; LF, Lactobacillus fermentum; MC,

microcapsule; UM, unmicrocapsulated

9

Figure 3 The gel electrophoresis image of Lactobacillus fermentum and plantarum PCR products

Fig. 4 qPCR standard curve for quantification of LF and LP, the LP and LF cultures were diluted

serially from 104CFU to 108 CFU/g.

10

A

B

Fig 5 The absolute quantitative graphs of Lactobacillus fermentium (A) and Lactobacillus

plantarum (B) in microcapsules

11

Table 1 In vitro simulated gastric-intestinal tract test of the beads (log CFU)

Note: SGF, simulated gastric fluid; SBF, simulated bile fluid; SIF, simulated intestine fluid.

SGF-SBF-SIF refers to the LB underwent the SGF treatment for 2h, SBF for 20min and SIF

for 3h. Different lowercases and uppercases represent the significant difference at p<0.05 and

p<0.01 level in the same column, respectively. All the flora were counted on dry lactobacillus

base. LP, Lactobacillus plantarum; LF, Lactobacillus fermentum; MC, microcapsule; UM,

unmicrocapsulated

REFERENCES

[1] R.A. Britton, J. Versalovic, Probiotics and gastrointestinal infections, Interdisciplinary

perspectives on infectious diseases 2008 (2008) 290769.

[2] M.L. Jimenez-Pranteda, D. Poncelet, M.E. Nader-Macias, A. Arcos, M. Aguilera, M.

Monteoliva-Sanchez, A. Ramos-Cormenzana, Stability of lactobacilli encapsulated in

various microbial polymers, Journal of bioscience and bioengineering 113(2) (2012)

179-84.

[3] Y.E. Dommels, R.A. Kemperman, Y.E. Zebregs, R.B. Draaisma, A. Jol, D.A. Wolvers,

E.E. Vaughan, R. Albers, Survival of Lactobacillus reuteri DSM 17938 and Lactobacillus

rhamnosus GG in the human gastrointestinal tract with daily consumption of a low-fat

probiotic spread, Applied and environmental microbiology 75(19) (2009) 6198-204.

[4] D. Dianawati, N.P. Shah, Survival, acid and bile tolerance, and surface hydrophobicity of

microencapsulated B. animalis ssp. lactis Bb12 during storage at room temperature, J

Food Sci 76(9) (2011) M592-9.

[5] A.K. Anal, H. Singh, Recent advances in microencapsulation of probiotics for industrial

applications and targeted delivery, Trends in Food Science & Technology 18(5) (2007)

240-251.

[6] M.T. Cook, G. Tzortzis, D. Charalampopoulos, V.V. Khutoryanskiy, Microencapsulation

LF+LP UM LF+LP MC UM LF MC LF UM LP MC LP

Original 10.54±0.07 10.32±0.06 10.52±0.05 10.31±0.07 10.51±0.04 10.21±0.07

SGF 2h 6.71±0.12 9.22±0.10 6.57±0.10 9.21±0.11 6.73±0.08 9.34±0.09

SBF 20min 5.66±0.21 8.54±0.17 5.59±0.11 8.52±0.18 5.80±0.11 8.30±0.13

SIF 3h 5.60±0.18 8.54±0.18 5.52±0.12 8.56±0.16 5.71±0.12 8.55±0.16

12

of probiotics for gastrointestinal delivery, Journal of controlled release : official journal

of the Controlled Release Society 162(1) (2012) 56-67.

[7] M.R. Corbo, A. Bevilacqua, M. Gallo, B. Speranza, M. Sinigaglia, Immobilization and

microencapsulation of Lactobacillus plantarum: Performances and in vivo applications,

Innovative Food Science & Emerging Technologies 18 (2013) 196-201.

[8] G. Della Porta, F. Castaldo, M. Scognamiglio, L. Paciello, P. Parascandola, E. Reverchon,

Bacteria microencapsulation in PLGA microdevices by supercritical emulsion extraction,

The Journal of Supercritical Fluids 63 (2012) 1-7.

[9] T. Heidebach, P. Först, U. Kulozik, Influence of casein-based microencapsulation on

freeze-drying and storage of probiotic cells, Journal of Food Engineering 98(3) (2010)

309-316.

[10] S.-J. Kim, S.Y. Cho, S.H. Kim, O.-J. Song, I.I.S. Shin, D.S. Cha, H.J. Park, Effect of

microencapsulation on viability and other characteristics in Lactobacillus acidophilus

ATCC 43121, LWT - Food Science and Technology 41(3) (2008) 493-500.

[11] F. Liu, Z. Chen, C.-H. Tang, Microencapsulation properties of protein isolates from three

selected Phaseolus legumes in comparison with soy protein isolate, LWT - Food Science

and Technology 55(1) (2014) 74-82.

[12] A. Nag, K.-S. Han, H. Singh, Microencapsulation of probiotic bacteria using pH-induced

gelation of sodium caseinate and gellan gum, International Dairy Journal 21(4) (2011)

247-253.

[13] A.C. Oliveira, T.S. Moretti, C. Boschini, J.C.C. Baliero, L.A.P. Freitas, O. Freitas, C.S.

Favaro-Trindade, Microencapsulation ofB. lactis(BI 01) andL. acidophilus(LAC 4) by

Complex Coacervation Followed by Spouted-Bed Drying, Drying Technology 25(10)

(2007) 1687-1693.

[14] S. Rathore, P.M. Desai, C.V. Liew, L.W. Chan, P.W.S. Heng, Microencapsulation of

microbial cells, Journal of Food Engineering 116(2) (2013) 369-381.

[15] Q. Sun, F. Wang, D. Han, Y. Zhao, Z. Liu, H. Lei, Y. Song, X. Huang, X. Li, A. Ma, G.

Yuan, X. Li, Z. Yang, Preparation and optimization of soy protein isolate-high methoxy

pectin microcapsules loaded withLactobacillus delbrueckii, International Journal of Food

Science & Technology 49(5) (2013) 1287-1293.

[16] R.R. Mokarram, S.A. Mortazavi, M.B.H. Najafi, F. Shahidi, The influence of multi stage

alginate coating on survivability of potential probiotic bacteria in simulated gastric and

intestinal juice, Food Research International 42(8) (2009) 1040-1045.

[17] L.-E. Shi, Z.-H. Li, D.-T. Li, M. Xu, H.-Y. Chen, Z.-L. Zhang, Z.-X. Tang, Encapsulation

13

of probiotic Lactobacillus bulgaricus in alginate–milk microspheres and evaluation of the

survival in simulated gastrointestinal conditions, Journal of Food Engineering 117(1)

(2013) 99-104.

[18] F. Atyabi, S. Majzoob, M. Iman, M. Salehi, F. Dorkoosh, In vitro evaluation and

modification of pectinate gel beads containing trimethyl chitosan, as a multi-particulate

system for delivery of water-soluble macromolecules to colon, Carbohydrate polymers

61(1) (2005) 39-51.

[19] G. Auriemma, T. Mencherini, P. Russo, M. Stigliani, R.P. Aquino, P. Del Gaudio, Prilling

for the development of multi-particulate colon drug delivery systems: pectin vs.

pectin-alginate beads, Carbohydrate polymers 92(1) (2013) 367-73.

[20] Z. Aydin, J. Akbuga, Preparation and evaluation of pectin beads, Int J Pharm 137(1)

(1996) 133-136.

[21] A. Gharsallaoui, R. Saurel, O. Chambin, E. Cases, A. Voilley, P. Cayot, Utilisation of

pectin coating to enhance spray-dry stability of pea protein-stabilised oil-in-water

emulsions, Food Chemistry 122(2) (2010) 447-454.

[22] P. Jantrawut, A. Assifaoui, O. Chambin, Influence of low methoxyl pectin gel textures

and in vitro release of rutin from calcium pectinate beads, Carbohydrate polymers 97(2)

(2013) 335-42.

[23] O. Sandoval-Castilla, C. Lobato-Calleros, H.S. García-Galindo, J. Alvarez-Ramírez, E.J.

Vernon-Carter, Textural properties of alginate–pectin beads and survivability of

entrapped Lb. casei in simulated gastrointestinal conditions and in yoghurt, Food

Research International 43(1) (2010) 111-117.

[24] Y. Kim, L. Wicker, Valencia PME isozymes create charge modified pectins with distinct

calcium sensitivity and rheological properties, Food Hydrocolloids 23(3) (2009)

957-963.

[25] P. Sriamornsak, Investigation of pectin as a carrier for oral delivery of proteins using

calcium pectinate gel beads.pdf, Int J Pharm 169 (1998) 213-220.

[26] I. Ventura, J. Jammal, H. Bianco-Peled, Insights into the nanostructure of low-methoxyl

pectin-calcium gels, Carbohydrate polymers 97(2) (2013) 650-8.

[27] Y. Yang, G. Zhang, Y. Hong, Z. Gu, F. Fang, Calcium cation triggers and accelerates the

gelation of high methoxy pectin, Food Hydrocolloids 32(2) (2013) 228-234.

[28] S. Bourgeois, A. Laham, M. Besnard, A. Andremont, E. Fattal, In vitro and in vivo

evaluation of pectin beads for the colon delivery of beta-lactamases, Journal of drug

targeting 13(5) (2005) 277-84.

14

[29] S. Das, A. Chaudhury, K.Y. Ng, Polyethyleneimine-modified pectin beads for

colon-specific drug delivery: in vitro and in vivo implications, Journal of

microencapsulation 28(4) (2011) 268-79.

[30] A. Oehme, A. Valotis, G. Krammer, I. Zimmermann, P. Schreier, Preparation and

characterization of shellac-coated anthocyanin pectin beads as dietary colonic delivery

system, Molecular nutrition & food research 55 Suppl 1 (2011) S75-85.

[31] F. Shamekhi, M. Shuhaimi, A. Ariff, Y.A. Manap, Cell viability of microencapsulated

Bifidobacterium animalis subsp. lactis under freeze-drying, storage and gastrointestinal

tract simulation conditions, Folia microbiologica 58(2) (2013) 91-101.

[32] K.B.P.K. Reddy, A.N. Madhu, S.G. Prapulla, Comparative survival and evaluation of

functional probiotic properties of spray-dried lactic acid bacteria, Int J Dairy Technol

62(2) (2009) 240-248.

[33] K. Miura, H. Yamashiro, K. Uotani, S. Kojima, T. Yutsudo, J. Lu, O. Yoshida, Y. Yamano,

H. Maki, H. Arimoto, Mode of action of Van-M-02, a novel glycopeptide inhibitor of

peptidoglycan synthesis, in vancomycin-resistant bacteria, Antimicrobial agents and

chemotherapy 54(2) (2010) 960-2.

[34] F.P. De Castro-Cislaghi, C.D.R.E. Silva, C.B. Fritzen-Freire, J.G. Lorenz, E.S.

Sant’Anna, Bifidobacterium Bb-12 microencapsulated by spray drying with whey:

Survival under simulated gastrointestinal conditions, tolerance to NaCl, and viability

during storage, Journal of Food Engineering 113(2) (2012) 186-193.

[35] J. Jung, R.D. Arnold, L. Wicker, Pectin and charge modified pectin hydrogel beads as a

colon-targeted drug delivery carrier, Colloids and surfaces. B, Biointerfaces 104 (2013)

116-21.

[36] G.M. Maciel, K.S. Chaves, C.R. Grosso, M.L. Gigante, Microencapsulation of

Lactobacillus acidophilus La-5 by spray-drying using sweet whey and skim milk as

encapsulating materials, Journal of dairy science 97(4) (2014) 1991-8.