protein synthesis
DESCRIPTION
Protein Synthesis. What is a nucleotide?? What are the base pairing rules in DNA?? In RNA?? What is the structure of the DNA?. Knowledge Check. Protein synthesis is the process by which genes within DNA are decoded into instructions for protein production in the cells. - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/1.jpg)
![Page 2: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/2.jpg)
What is a nucleotide??
What are the base pairing rules in DNA??
In RNA??
What is the structure of the DNA?
![Page 3: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/3.jpg)
Protein synthesis is the process by which genes within DNA are decoded into instructions for protein production in the cells.
This process takes place in three steps:
-Step 1→ Transcription -Step 2→ Translation -Step 3 → Amino Acid Formation
![Page 4: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/4.jpg)
![Page 5: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/5.jpg)
Is a nucleic acid Consist of a long chain of nucleotides Three types of RNA:
-mRNA: serves as messengers from DNA to the rest of the cell
-rRNA: makes up the ribosomes, clamps on to mRNA and uses its information to
assemble amino acids
-tRNA: transports amino acids to the ribosomes to be assembled into proteins.
![Page 6: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/6.jpg)
Sugar in RNA →ribose Sugar in DNA→ deoxyribose RNA → single-stranded DNA → double stranded RNA contains uracil DNA contains thymine
![Page 7: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/7.jpg)
In the nucleus, enzymes make an RNA copy of a portion of DNA
Requires an enzyme called RNA polymerase
During transcription, RNA polymerase binds to DNA and separates the DNA strands.
RNA polymerase then uses one strand of DNA as a template strand to form RNA
![Page 8: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/8.jpg)
DNA unwinds, becomes single stranded. Serves as template for synthesizing mRNA
mRNA molecules move to nucleus where specific codes are transcripted and carried into cytoplasm
A(from DNA)U(RNA)C (from DNA) GT(from DNA)A
![Page 9: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/9.jpg)
Results of Transcription-one single-stranded RNA molecule
is formed-mRNA is produced
http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter3/animation__mrna_synthesis__transcription___quiz_1_.html
![Page 10: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/10.jpg)
![Page 11: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/11.jpg)
AATGCCATTAATCGCCGGATGACT
![Page 12: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/12.jpg)
What is the structure of RNA?
What are the results of transcription?
What is the enzyme that is required for transcription?
![Page 13: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/13.jpg)
language of the mRNA is translated into the language of proteins
Takes place in the ribosomes tRNA transfers amino acids to the site
of the growing protein chain (polypeptide).
3 steps initiation, elongation, termination
![Page 14: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/14.jpg)
Translation begins at the start codon AUG Each tRNA molecule recognizes a specific,
three base-pair mRNA code or codon Anti-codon:
A sequence of three adjacent nucleotides located on one end of transfer RNA
Translation Video
![Page 15: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/15.jpg)
When trying to find the amino acid sequence it is important to remember that you are only reading from the mRNA codons NOT the tRNA anti-codons
![Page 16: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/16.jpg)
Stop codons are present. UAA, UGA, UAG is the stop codon that signals for the termination of the protein synthesis process. DOES NOT CODE FOR AN AMINO ACID
![Page 17: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/17.jpg)
![Page 18: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/18.jpg)
![Page 19: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/19.jpg)
The nucleotide sequence transcribed from DNA to RNA acts as a genetic message
protein synthesis video
![Page 20: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/20.jpg)
![Page 21: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/21.jpg)
What is a code?-A system of words, letters, figures, or
other symbols used to represent others
Living organisms have their own code called the genetic code
![Page 22: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/22.jpg)
the language of the mRNA instructions
![Page 23: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/23.jpg)
it is read three letters at a time
Ex: UCGCACGGU ↓
UCG-CAC-GGU ↓
Serine-Histidine-Glycine
Codons represent the different amino acids
Genetic Code Video
![Page 24: Protein Synthesis](https://reader036.vdocument.in/reader036/viewer/2022062722/56813a73550346895da26b27/html5/thumbnails/24.jpg)