Protein Synthesis Protein Synthesis ContinuedContinued

After transcriptionAfter transcription

RNA editingRNA editing

After a strand of RNA is constructed by After a strand of RNA is constructed by transcription, it must be altered before it transcription, it must be altered before it moves to the cytoplasmmoves to the cytoplasm

IntronsIntrons are sections of the RNA that do are sections of the RNA that do not code for a protein and are “cut out” of not code for a protein and are “cut out” of the RNA strand (they stay IN the nucleus)the RNA strand (they stay IN the nucleus)

ExonsExons are then spliced back together are then spliced back together because they code for the protein (they because they code for the protein (they EXIT the nucleus)EXIT the nucleus)

RNA languageRNA language

Remember that RNA codes for a Remember that RNA codes for a specific order of amino acids to specific order of amino acids to make a proteinmake a protein

The RNA strand is read in triplets The RNA strand is read in triplets (threes) called (threes) called codonscodons

RNA strand = UCGCACGGUURNA strand = UCGCACGGUU Read as = UCG / CAC / GGURead as = UCG / CAC / GGU

RNA RNA Proteins Proteins

Each codon “codes” for a specific Each codon “codes” for a specific amino acidamino acid

Using the chart on p. 303 decode Using the chart on p. 303 decode the mRNA sequence from the the mRNA sequence from the previous slide.previous slide.– UCGCACGGUUUCGCACGGUU– Serine – Histidine - GlycineSerine – Histidine - Glycine

““Special Codons”Special Codons”

The amino acid The amino acid methionine “AUG” is methionine “AUG” is the code for start or the code for start or GOGO

Notice on the chart Notice on the chart on p. 303 that on p. 303 that several sequences several sequences code for “STOP”code for “STOP”

These are used to These are used to start or stop protein start or stop protein sythesissythesis

Using the chartUsing the chart

Also notice that more that one codon Also notice that more that one codon will code for the same amino acidwill code for the same amino acid– Ex: Arginine has the codons Ex: Arginine has the codons

CGUCGU CGCCGC CGACGA CGGCGG

This is called the “wobble effect” so if This is called the “wobble effect” so if a mutation occurs it may not effect the a mutation occurs it may not effect the amino acid sequence. amino acid sequence.

Amino Acid Amino Acid SequencingSequencing On page 303, do the “Quick Lab”On page 303, do the “Quick Lab” You may write your answers in You may write your answers in

your notes, however do your OWN your notes, however do your OWN work and I will insure that you work and I will insure that you have the answers before you can have the answers before you can exit the classroom.exit the classroom.

““Say it With DNA” Say it With DNA” ProjectProject Each amino acid has been assigned a Each amino acid has been assigned a

letterletter Create a ONE OF A KIND message using Create a ONE OF A KIND message using

those letters (a sentence with DHS in it those letters (a sentence with DHS in it would be cool)would be cool)

Figure out the DNA strand, RNA Figure out the DNA strand, RNA complementary strand, the codons, and complementary strand, the codons, and the amino acid strand and finally the the amino acid strand and finally the messagemessage

Place the above on your posterPlace the above on your poster Decorate the poster as you wish (Hint: Decorate the poster as you wish (Hint:

double helices make excellent accents) double helices make excellent accents)