recruitment of podocytes from glomerular parietal...

Recruitment of Podocytes from Glomerular ParietalEpithelial Cells

Daniel Appel,* David B. Kershaw,† Bart Smeets,*‡ Gang Yuan,* Astrid Fuss,* Bjorn Frye,*Marlies Elger,§ Wilhelm Kriz,§ Jurgen Floege,* and Marcus J. Moeller*

*Division of Nephrology and Immunology, Rheinisch Westfalische Technische Hochschule (RWTH) University ofAachen, Aachen, Germany; †Division of Nephrology, Department of Pediatrics, University of Michigan, Ann Arbor,Michigan; ‡Department of Pathology, Radboud University Nijmegen Medical Center, Nijmegen, Netherlands; and§Institute for Anatomy and Cell Biology, University of Heidelberg/Mannheim, Mannheim, Germany

ABSTRACTLoss of a critical number of podocytes from the glomerular tuft leads to glomerulosclerosis. Even inhealth, some podocytes are lost into the urine. Because podocytes themselves cannot regenerate, wepostulated that glomerular parietal epithelial cells (PECs), which proliferate throughout life and adjoinpodocytes, may migrate to the glomerular tuft and differentiate into podocytes. Here, we describetransitional cells at the glomerular vascular stalk that exhibit features of both PECs and podocytes.Metabolic labeling in juvenile rats suggested that PECs migrate to become podocytes. To prove this, wegenerated triple-transgenic mice that allowed specific and irreversible labeling of PECs upon adminis-tration of doxycycline. PECs were followed in juvenile mice beginning from either postnatal day 5 or afternephrogenesis had ceased at postnatal day 10. In both cases, the number of genetically labeled cellsincreased over time. All genetically labeled cells coexpressed podocyte marker proteins. In conclusion,we demonstrate for the first time recruitment of podocytes from PECs in juvenile mice. Unraveling themechanisms of PEC recruitment onto the glomerular tuft may lead to novel therapeutic approaches torenal injury.

J Am Soc Nephrol 20: 333–343, 2009. doi: 10.1681/ASN.2008070795

Chronic kidney disease, resulting in renal failureand the need for lifelong renal replacement therapy,has become a significant problem worldwide. In theUnited States, approximately 7% of the total Medi-care budget is spent on the treatment of ESRD, andprojections suggest that the amount spent will in-crease by another 50% by 2020.1

Most renal pathologies that ultimately lead toESRD originate within the glomerulus. It has nowbeen established that a depletion of podocytes, thevisceral epithelium of the capillary convolute (Fig-ure 1), is central in this process. As soon as damageto the glomerular podocytes exceeds a certainthreshold (approximately 30%), glomerulosclero-sis ensues.2 Indeed, in patients with a surgical re-duction of �75% of renal mass, a relative lack ofpodocytes (podocytopenia) and subsequent FSGSin the originally healthy remnant kidney can lead to

renal failure.3 Glomerulosclerosis is also the com-mon final pathway of all glomerular diseases lead-ing to ESRD.4 In glomerular diseases such as dia-betic nephropathy, glomerulonephritides, orpreeclampsia, significant numbers of podocytes arelost as a result of apoptosis, necrosis or excretion ofliving cells into the urine. Even in normal individ-uals, low numbers of living podocytes are continu-

Received July 29, 2008. Accepted October 5, 2008.

Published online ahead of print. Publication date available atwww.jasn.org.

D.A. and D.K. contributed equally to this work.

Correspondence: Dr. Marcus J. Moeller, Department of Nephrol-ogy and Clinical Immunology, RWTH University Hospital Aachen,Pauwelsstrasse 30, 52074 Aachen, Germany. Phone: ��49-241-8089530; Fax: ��49-241-8082446; E-mail: [email protected]

Copyright � 2009 by the American Society of Nephrology

BASIC RESEARCH www.jasn.org

J Am Soc Nephrol 20: 333–343, 2009 ISSN : 1046-6673/2002-333 333

ously shed into the urine.5–7 These numbers are too high to becompatible with renal survival for 80 yr, suggesting the exis-tence of a regenerative mechanism. Also, the reversal of earlyglomerular damage in animal models and humans8 –10 arguesfor the existence of such a mechanism; however, podocytes arepostmitotic cells that cannot undergo complete cell divisionsand are therefore unable to regenerate themselves.8 –10 A po-tential mechanism for podocyte replacement from bone mar-row– derived stem cells has been described in the Alport mousemodel as well as in kidney transplants.11–13 Nevertheless, moststudies concluded that regeneration occurs predominantlyfrom an as-yet-unknown source of resident renal cells.12,14 –16

In this study, we tested the hypothesis that glomerular pa-rietal epithelial cells (PECs) lining the inner aspect of Bow-man’s capsule migrate onto the glomerular tuft and differenti-ate into podocytes. Several arguments support this hypothesis.PECs are present in all species whose kidneys contain glomer-uli. They are located within the same compartment and are indirect continuity with podocytes at the glomerular vascularstalk, so PECs do not have to cross an anatomic barrier such asthe glomerular basement membrane, as was suggested for bonemarrow– derived stem cells.11–13 PECs proliferate lifelong at arelatively low frequency,17 express several stem cell markerproteins, and could be transdifferentiated in vitro into othercell types such as adipocytes or neuronal cells, suggesting that

these cells retain multipotency.9,18,19 In rodents, PECs do notexpress any known specific marker protein, which has so farprecluded a detailed analysis of the function of these cells.

In this work, we provide the first evidence that PECs possessthe capability to migrate onto the glomerular tuft via the vas-cular stalk, where they differentiate into podocytes. This estab-lishes that PECs represent an intrinsic cell population fromwhich podocytes can be recruited.

RESULTS

Transitional Cells at the PEC/Podocyte InterfaceTo test our hypothesis that PECs migrate onto the glomerulartuft, we analyzed the vascular stalk of healthy Sprague-Dawleyrats by transmission electron microscopy. At this site, cells withfeatures of PECs as well as podocytes could be observed (Figure2). The phenotype of such transitional cells varied from cellswith a flat and condensed oval nucleus and a flat cytoplasm(Figure 2, A� and D [1]) toward cells with an upright cell bodysitting on the basement membrane without foot processes anda large lobulated nucleus (Figure 2, B and D [2]). The lastfeature was the formation of foot processes. Within a singlecell, cellular processes with and without foot processes—in-cluding a slit diaphragm— could be observed simultaneously(Figure 2C). The transition from a multilayered electron-lu-cent parietal basement membrane to a glomerular homoge-neous electron-dense basement membrane was abrupt andwas always associated with transitional cells (Figure 2, C and D,arrowhead).

To verify whether transitional cells bear an intermediatephenotype between PECs and podocytes, we determined theexpression of marker proteins by triple immunofluorescentlabeling and confocal microscopy (Figure 3). Frozen sectionsof 10-day-old mice were stained with an antibody specific forclaudin-1, a marker for PECs within the renal cortex that lo-calizes to intercellular light junctions.20 Apart from the Bow-man’s capsule, claudin-1–positive cells were regularly presentalong the vascular stalk at the base of the glomerular tuft, wheretransitional cells were observed (see previous paragraph; Fig-ure 3, arrows). In a co-staining experiment for the podocytemarker proteins nestin, dipeptidyl peptidase IV, and amino-peptidase A,21–24 the cells at the vascular stalk coexpressed PECmarkers as well as the podocyte marker proteins.

Lineage Tracing of PECs Using Metabolic LabelingTo test our hypothesis that PECs contribute to podocyte turn-over, we performed metabolic labeling in adolescent femaleSprague-Dawley rats using bromodeoxyuridine (BrdU) for14 d. We then analyzed BrdU labeling of glomerular cells bytriple-immunofluorescent staining immediately after the la-beling period (t � 0) and 6, 12, and 14 wk later (Figure 4).Immediately after the labeling, 7.1 � 1.2% of the PECs wereBrdU positive in adolescent rats (versus 1% labeling in adultrats; data not shown), indicating increased PEC proliferation

Figure 1. Renal glomerulus. The glomerular epithelium consistsof PECs (red) and podocytes (Pod; blue), which reside on thecapillary convolute. Both epithelia adjoin directly at the vascularpole (VP; arrow). At the tubular pole (TP), the parietal epitheliumis connected to the epithelium of the proximal tubule. In malemice, this transition from PECs to proximal tubular cells oftenoccurs within the glomerulus. The glomerular basement mem-brane (black) forms a continuous barrier between the glomerularepithelium and the endocapillary compartment that containsmesangial cells (shaded) and endothelial cells of the glomerularcapillaries (*). Primary urine is filtered across the three-layeredfiltration barrier (endothelial cells, glomerular basement mem-brane, and Pod) into Bowman’s space (BS).


334 Journal of the American Society of Nephrology J Am Soc Nephrol 20: 333–343, 2009

in adolescence. BrdU labeling of PECs was independent of theiranatomic location relative to the vascular stalk. Only 0.53 �0.28% of all Wilms’ tumor (WT-1)-positive podocytes had incor-porated BrdU immediately after BrdU labeling (Figure 4F), con-firming that podocytes essentially do not proliferate.

Metabolic labeling persisted in PECs throughout the obser-vation period of 14 wk (Figure 4E). After 12 and 14 wk, BrdU-positive podocytes increased to 1.1 � 0.33 and 1.3 � 0.32%,respectively (Figure 4F). These results support the existence ofa regenerative mechanism for podocytes. To resolve this issuefurther we performed, genetic cell tracing experiments.

A Fragment of the PODXL1 Promoter DrivesExpression in PECs but not in PodocytesTo resolve whether PECs migrate onto the glomerular tuft anddifferentiate into podocytes, we had to identify a PEC-specificpromoter to allow genetic tagging of PECs. Three kb of thehuman podocalyxin (hPODXL1) 5� flanking region and 0.3 kbof the rabbit Podxl1 5� untranslated region (GenBank acces-sion no. EU360962) were used to drive expression of rabbitpodocalyxin in transgenic mice (pPEC-cPodxl1; Figure 5).This transgenic mouse was originally designed to reproducethe expression pattern of the endogenous podocalyxin genewithin podocytes. Unexpected, transgene expression was de-tected exclusively within PECs but not in podocytes in six ofnine founder lines using a monoclonal anti-serum specific fortransgenic rabbit podocalyxin24 (Figure 5, B and C).

Nephrogenesis persists in newborn mice, so all develop-mental stages can be observed within the kidney cortex. Trans-gene expression was detected exclusively in mature PECs be-ginning at the capillary loop stage but not in earlier stages ofglomerular development or anywhere else within the kidney(Figure 5, D and E).

Figure 2. Transitional cells at the rat parietal cell–Pod interface.(A) At the VP, epithelial cells with features of parietal cells and Podcan be regularly observed. (A�) Early transitional stage (character-istics: glomerular basement membrane, cytoplasmic vesicles;higher magnification of box in A); e.a., efferent arteriole. (B) Latetransitional stage (characteristics: upright cell body, large lobu-lated nucleus); cap., capillary lumen. (C) Partial formation of footprocesses within a “late” transitional cell (*) at the vascular stalk.The intercellular junction between the last parietal cell (PEC) andthe transitional cell is marked by a filled arrowhead. The transitionfrom a parietal cell basement membrane to a glomerular base-ment membrane also occurs at this site. The transitional cellprojects extensions onto the base of Bowman’s capsule as well asonto a capillary (cap.) without forming foot processes (open ar-rowheads). A third projection extends onto the vascular stalk andforms typical foot processes with a slit diaphragm (arrow). (D)Grazing section along the vascular stalk. Sequential stages oftransitional cells at the parietal/Pod interface (1, early stage; 2,later stage). The intercellular junction toward the last PEC (*) ismarked by arrowheads, the transition from a parietal to a glomer-ular basement membrane is marked by open arrows (A through C,transmission electron micrographs of adult Sprague-Dawley rats).

Figure 3. Transitional cells coexpress PEC and Pod marker pro-teins. (A through C) Normal mouse frozen kidney sections from10-d-old mice were co-stained with an antiserum specific forclaudin-1 (PECs, red) and the Pod markers (green) nestin (A),dipeptidyl peptidase 4 (DPPIV; B), and aminopeptidase A (APA;C). At the VP, claudin-1–positive cells could regularly be ob-served. These cells at the vascular stalk coexpressed Pod markerproteins (arrows, nuclei are stained blue; immunofluorescent la-belings of 2-�m sections analyzed by confocal microscopy).

BASIC RESEARCHwww.jasn.org

J Am Soc Nephrol 20: 333–343, 2009 Recruitment of Podocytes from Parietal Cells 335

A Novel Transgenic Mouse Line for Inducible GeneticTagging of PECsBecause of the exceptional specificity of the identified promoterfor PECs, we generated a second transgenic mouse to allow induc-ible genetic tagging of PECs at any desired time point. For thispurpose, we placed the enhanced reverse tetracycline transactiva-tor (rtTA-M2)25 under the control of the PEC-specific promoterdescribed in the previous two paragraphs (pPEC-rtTA). Sixfounders were bred to homozygous LC1/R26R reporter mice forfurther analysis. Upon administration of doxycycline for 14 d, theLC1 transgene reversibly expressed Cre recombinase under thecontrol of an inducible promoter (tetracycline-responsive ele-ment)26 only in PECs. Once Cre excision occurred within theubiquitously active ROSA26 locus,27 �-galactosidase (�-gal) isconstitutively and irreversibly expressed within the cells and all itsprogeny (“genetic tagging”; Figure 6A).

Cre recombination was induced in triple-transgenic pPEC-rtTA/LC1/R26R mice at the age of 6 wk by administration ofdoxycycline for 14 d (Figure 6, B and C). As judged by enzymaticand immunofluorescent �-gal staining, Cre recombination oc-curred exclusively within PECs in four transgenic lines. Whenanalyzing the ratio of �-gal–positive to –negative PECs (defined asa cell along Bowman’s capsule with a visible nucleus), 72% of allPECs were genetically tagged by Cre recombination. Genetic la-beling then persisted in PECs throughout life (1-yr observationperiod; data not shown), supporting the notion that this cell pop-ulation regenerates itself. Aberrant Cre recombination in podo-

cytes or other cells in the glomerular tuftwas negligible (less than one cell per 100glomeruli). Similar to pPEC-cPodxl1–transgenic mice, the triple-transgenic linesexhibited sporadic Cre recombination intubular cells, most notably of collectingducts (Figure 6B), the thin part of the loopof Henle, and epithelial cells of the pyra-mid, but not in the urothelial epithelium(see below). In the absence of doxycycline,Cre recombination did not occur even intriple-transgenic pPEC-rtTA/LC1/R26Rmice (n � 10; data not shown) older than1 yr. In summary, the pPEC-rtTA/LC1/R26R mice provide a novel tool to intro-duce a specific and irreversible genetic la-bel into PECs in vivo and thereby allow forthe tracing of these cells for any desiredperiod of time.

Genetic Tagging of PECs inAdolescent MiceFor testing whether PECs contribute to thegeneration of podocytes, newborn triple-transgenic mice were genetically labeled bydoxycycline administration on postnatalday 5. On postnatal day 7, Cre recombina-tion was evident specifically in PECs by

their expression of �-gal (Figure 6, D and D�). At this time point,1.6 labeled cells per 100 glomeruli were detected within the glo-merular tuft. Subsequently, a constant increase in genetically la-beled glomerular cells was observed over time. On postnatal day12, 21 � 10 labeled cells were observed per 100 glomeruli. �-Gal–positive cells increased approximately 10-fold at weeks 6 and 12,respectively (Figure 7). We observed a similar increase of labeledglomerular cells in triple-transgenic mice that received doxycy-cline 10 d after birth, when nephrogenesis has ceased (Figure 7C).We also noted an increase in genetically labeled tubular epithelialcells.

To test whether genetically labeled cells were fully differen-tiated podocytes, we analyzed the kidneys of the 6- and 12-wk-old mice by double-immunofluorescent staining and confocalmicroscopy. Genetically labeled �-gal–positive cells always co-expressed the podocyte marker proteins nephrin, synaptopo-din, and WT-1 but not the endothelial marker von Willebrandfactor (Figure 8). Of note, genetically labeled transitional cellsat the PEC/podocyte interface expressed intermediate levels ofthe podocyte marker nephrin (Figure 8A, arrowheads).

In conclusion, these data show that �-gal–labeled PECs arerecruited onto the glomerular tuft during adolescence and thatthese cells fully differentiate into podocytes.

Extrarenal Activity of the PEC-Specific PromoterThe extrarenal activity of the PEC-specific promoter was ana-lyzed by a chemiluminescent assay of total tissue lysates and

Figure 4. Metabolic labeling of rat PECs. After weaning, 75-g female Sprague-Dawleyrats were labeled with BrdU over 14 d and followed up to 14 wk. (A through D)Representative triple-immunofluorescent staining for the nuclear Pod marker proteinWT-1 (red; A), BrdU (green; B), and DNA (blue; C) 12 wk after BrdU labeling. (D) Mergedimage (phase contrast image not shown). Arrowhead, BrdU-labeled PEC along the inneraspect of Bowman’s capsule; arrow, BrdU-labeled WT-1–positive Pod nucleus on theglomerular tuft. (E) BrdU labeling persisted in glomerular cells (mainly mesangial andendothelial cells) without a significant increase over time (Œ). Shortly after weaning, 7% ofall PECs were metabolically labeled with BrdU. Over time, BrdU labeling of PECs in-creased significantly, most likely as a consequence of ongoing proliferation and self-regeneration of this cell population (*P � 0.02, one-sided ANOVA test). (F) BrdU-positivePod were detected significantly more often at 12 or 14 wk after metabolic labeling (*P �0.03, **P � 0.01, one-sided ANOVA test; n � 3 animals per time point, 300 glomeruli peranimal). During the observation period, adolescent rats more than quadrupled their bodyweights (gray line). No significant increase in Pod numbers (WT-1–positive cells) relativeto all glomerular cells was observed.



verified by histology (Table 1, Figure 9). �-Gal expression wasnoted within the basal layers of the seminiferous epithelium ofthe testis, the pancreatic ducts, spleen, and thymus follicles(likely MHCII-negative follicular dendritic cells; Figure 9, Bthrough E). Cre recombination was never observed after doxy-cycline administration within the bone marrow of triple-trans-genic mice even when analyzed up to 8 mo (Figure 9E).

DISCUSSION

In this study, we provide the first evidence that podocytes arerecruited from PECs under physiologic conditions. This con-cept is based on four major findings.

Our first major finding was that transitional cells withmorphologic and immunohistochemical features of bothPECs and podocytes could be detected at the glomerularvascular stalk. One feature of transitional cells was the pres-ence of a glomerular basement–type membrane, which was

always associated with them but not with PECs. Furtherfeatures included heterogeneous vacuoles, an upright cellbody, and the transition to a large lobulated nucleus. Cells

Figure 5. Identification of a PEC-specific promoter. (A) Map ofthe pPEC-cPodxl1 transgene. A 3-kb hybrid of the human andrabbit podocalyxin (hPODXL1) promoter (parietal cell promoter,pPEC) was used to drive expression of rabbit podocalyxin(cPodxl1) in transgenic mice. BGHpA, bovine growth hormonepolyadenylation signal. (B through D) Transgene expressionwithin the renal cortex. (B) In adult pPEC-cPodxl1–transgenicmice, rabbit podocalyxin was expressed exclusively in PECs of therenal cortex (arrowheads). (C) Transgene expression was re-stricted to PECs (arrowheads) and did not extend into the S1segment of proximal tubular cells, which in male mice extendsinto Bowman’s capsule (arrows). No labeling of Pod was observed(immunohistologic staining using anti-rabbit podocalyxin mousemAb 4B3). (D and E) In newborn pPEC-cPodxl1 mice, the parietalpromoter was active exclusively in mature PECs of the capillaryloop stage or mature glomeruli (arrowheads). No transgene ex-pression was observed in earlier developmental stages (e.g., S-shaped bodies [arrow]).

Figure 6. Genetic tagging of PECs in a triple-transgenic doxy-cycline-inducible rtTA mouse line. (A) pPEC-MCS, the rabbitpodocalyxin cDNA, was replaced by a multiple cloning site(MCS; available restriction sites indicated). The enhanced tet-racycline reverse transactivator (rtTA-M2) was cloned intoNhe1/Xho1 (red). pPEC-rtTA–transgenic mice were generatedby pronuclear injection and mated to LC1 mice expressing Crerecombinase and luciferase under the control of tetracycline-responsive elements (TRE), which can be activated by rtTA-M2in the presence of doxycycline and R26R: This reporter lineirreversibly expresses �-gal (LacZ) under the control of theubiquitous ROSA26 locus only after Cre excision of an inter-posed floxed neomycin cassette (neo; acting as a stop signal)has occurred. (B) Genetic labeling of PECs using doxycycline in6-wk-old triple-transgenic pPEC-rtTA mice (pPEC-rtTA/LC1/R26R; 9 wk of age). Sporadic labeling was observed in sometubular cells of the renal cortex (arrows). (C) After induction,Cre recombination occurred in 72% of all PECs (arrowheads,labeled PEC; arrow, unlabeled PEC). (D and D�) Cre recombi-nation was induced in triple-transgenic mice 5 d after birth (d5),when nephrogenesis still persists. Two days after doxycyclineadministration (d7), specific genetic labeling of PECs was ver-ified by immunofluorescent staining (arrowheads). In 1 to 2% ofall glomeruli, labeled cells on the glomerular tuft were ob-served (arrow with tails, confocal triple-immunofluorescent la-beling; red, �-gal [genetic marker for PECs]; green, E-cadherin(proximal tubular cell marker); blue, DNA).



with similar features were first described within the glomer-uli of sheep and were subsequently detected in many spe-cies.28 Given their location close to the vascular pole, thesecells were termed “peripolar cells.” Because of the multiple

vacuoles, which were also observed inthis study, it was initially speculatedthat these cells secrete hormones orother mediators29; however, untilnow, no specific hormone could be de-tected and the function of these cellsremained elusive. Our data suggestthat peripolar cells are PECs in theprocess of differentiating into podo-cytes. Our findings are also in agree-ment with Bariety et al.,30 who showedthat cells expressing podocyte markersextend along the vascular stalk ontoBowman’s capsule at the vascular polein the majority of glomeruli of normalhuman kidneys. In this work, we ob-served that cells expressing the PECmarker claudin-1 extend along thevascular stalk onto the glomerular tuftand coexpress podocyte marker pro-teins. The region of overlap defines thearea of PEC to podocyte differentia-tion.

Second, in metabolic pulse-chase ex-periments in juvenile rats, we observed atwo- to three-fold increase in BrdU-la-beled podocytes after BrdU administra-tion. Because direct labeling of podo-

cytes could no longer contribute to the increase, such anincrease could be explained by nuclear divisions of BrdU-la-beled podocytes. Although there is no evidence to support theoccurrence of significant cellular divisions (cytokinesis) of

Figure 7. Recruitment of PECs onto the glomerular tuft in adolescent pPEC-rtTA/LC1/R26R mice. (A) After genetic tagging of PECs 5 d after birth, �-gal–positive cells(arrows) can be detected on glomerular tufts on day 12. (B) Six weeks after birth,genetically tagged cells are present within most glomeruli (arrows) of the outer cortexas well as close to the medulla. Genetic labeling persists in PECs (arrowheads). (C)Statistical analysis of �-gal–positive cells per 100 glomeruli over time in triple-transgenic PEC-TETon mice induced 5 (d5) or 10 d after birth (d10). A similar increaseof �-gal–positive cells over time was observed in both groups (**P � 0.01 ANOVA; n �5 for each time point). (D through F) Genetic labeling persists in PECs (arrowheads)12 d (D) and 6 and 12 wk (E and F) after doxycycline administration. �-Gal–positivecells were identified close to the VP (arrow with tails) as well as projecting into theperiphery of the glomerulus (arrow). (F) Occasionally, glomeruli with up to 20 �-gal–positive cells were observed at 12 wk of age (arrowheads, labeled PECs; A, B, and Dthrough F, X-gal/eosin staining on 6-�m cryosections).

Figure 8. �-Gal–positive cells on the glomerular tuftare fully differentiated Pod. (A) Double-immunofluores-cent staining for �-gal (red) and the Pod marker proteinnephrin (green) in 6-wk-old triple-transgenic PEC-TETon mice induced with doxycycline at the age of 5 d.PECs expressed constitutively �-gal (open arrow-heads). �-Gal–positive cells on the vascular tuft wereexclusively Pod as demonstrated by nephrin coexpres-sion (green, arrows). Transitional cells, located close tothe vascular stalk, were genetically labeled (�-gal pos-itive) and expressed low to intermediate levels of thePod marker protein nephrin (filled arrowheads). (B) Noco-localization of �-gal–positive cells (red, arrow) withthe endothelial cell marker vWF (green, arrowheads)was observed in the mice described. Interstitial capil-laries are marked in B (vWF) (open arrowhead). (C)�-Gal–positive Pod derived from PECs coexpress WT-1(arrow, open arrowheads, �-gal positive/WT-1 nega-tive PEC nuclei). Panel shows an enzymatic �-gal stain-ing (in blue)/immunohistochemical 3-amino-9-ethyl-carbazole (AEC) anti–WT-1 (in red) double stainings.



podocytes in vivo,9 at least nuclear divisions have been ob-served in podocytes under very particular conditions suchas infusion of high dosages of fibroblast growth factor 231;however, no bi-nucleated podocytes were observed in ourstudy.

More likely, the two- to three-fold increase representspodocyte replacement by BrdU-labeled hematopoietic cells11–13

or cells of an intrarenal origin, such as PEC. In the latter case, onecan calculate that at a labeling efficiency of 11% of all PECs at 14wk, between 7.0 � 0.2 and 12.0 � 0.3% of all podocytes wouldhave been derived from BrdU-positive PECs, concurring with ourresults obtained from the genetic tagging experiments.

Our third major finding was the identification of a novelpromoter with PEC specificity in the glomerulus, whichprovided the foundation to trace the fate of PECs in vivo.That the novel PEC-specific promoter identified in thisstudy was derived from a relatively podocyte-specific gene(podocalyxin) further supports a close relationship betweenthese two cell populations. So far, it is unknown why thepromoter was active exclusively in PECs and not in podo-cytes. In development, endogenous podocalyxin is also ex-pressed by PECs within the kidney, albeit at a low level.32

For the purposes of our studies, however, this issue is oflittle relevance, because genetic labeling using Cre recombi-nation follows an “all or nothing law,” whereby only cellsthat express sufficient levels of Cre recombinase undergorecombination. These cells (e.g., PECs) will then expressmaximum levels of the reporter gene �-gal. Consequently,even if there were low-level expression of the construct inpodocytes, this would not be detected with our system be-cause the threshold for Cre recombination is obviously notreached in podocytes or any other glomerular cell. Becauseno genetically marked cells were observed within the kidneyin triple-transgenic mice that had not received doxycycline,the use of the doxycycline-inducible system effectively pre-cluded aberrant Cre recombination during the chasing pe-riod. Also, Cre recombination did not occur in bone mar-row cells. This finding is important given the observation ofbone marrow– derived cells in podocyte locations in dis-eased rodent and human kidneys.11–13 Such cells, therefore,cannot account for the findings of this study. In summary,the pPEC-rtTA/LC1/R26R mice provide a novel tool to in-troduce a specific and irreversible genetic label into PECs invivo and thereby allow for the tracing of these cells for anydesired period of time. Any increase in labeled podocytesafter completion of the genetic labeling with doxycyclinecould have originated only from PECs migrating onto theglomerular tuft.

The fourth major finding of this study was that in cell-trac-ing experiments, podocytes were recruited from PECs. Re-cruitment of podocytes was high during postnatal glomerulo-genesis as well as in juvenile mice, when glomerulogenesis wascompleted and a rapid, approximately 10-fold increase in sizeof the kidney occurred. Our data thereby provide the experi-mental proof for a hypothesis that in parallel was proposed on

the basis of findings in human PEC.33 Thus, in the study ofRonconi et al.,33 it was shown that PECs express stem cellmarker proteins and gradually lose the expression of these pro-teins as they approach the glomerular tuft. Furthermore, PECsthat express stem cell markers retained multipotency andcould engraft and differentiate into podocytes in the glomeruliof developing fetal kidneys. Our observation also provides anexplanation for the findings of Bariety et al.30 and Gibson etal.,30,34 who observed that Bowman’s capsule can be lined by“parietal podocytes” in atubular glomeruli of damaged humantransplant kidneys. Interestingly, parietal podocytes coex-pressed PEC and podocyte marker proteins (e.g., Pax2, WT-1),suggesting that these cells resembled transitional cells at thevascular stalk. Our findings, therefore, suggest that parietalpodocytes in atubular glomeruli are the result of a prematurePEC differentiation triggered by an as-yet-unknown signal.

Our data do not exclude that other mechanisms of podo-cyte regeneration exist, such as their replacement by bonemarrow30,34derived cells11–13; however, our data are moresuitable to explain the development of the glomerular tiplesion, which by some authors is considered to represent anearly stage in the evolution of FSGS.35 Thus, our findingssuggest that within the glomerulus a gradient exists,whereby podocytes at the glomerular tip would representthe “oldest” podocytes, which in turn might be most sus-ceptible to damage.

In summary, using various lines of evidence, we demon-strate that podocytes can be recruited from PECs. Our find-ings explain how the growing glomerulus is covered withpodocytes despite their inability to undergo cell division.Finally, the observation of podocyte recruitment from PECslays the basis for searching for pharmacologic strategiesaimed at accelerating podocyte and thereby glomerular re-generation. This will represent a completely novel approachto treating chronic kidney disease.

CONCISE METHODS

Plasmid Construction and Generation of TransgenicMiceThe human promoter/enhancer of hPODXL1 (-3 kb until 97 bp 5� of

the ATG) was amplified by PCR (Accuprime; Invitrogen, Karlsruhe,

Germany) from a BAC clone RP11-180C16 (accession no.

AC008264.10, Homo sapiens chromosome 7) using forward primer

5�-AGTAACTAGTCTTCATAGTATTGGCTTCTGT3-� and reverse

primer 5�-AGTAAGATCTTGTGGGTGGCTCCGGAGGC-3�. The

resulting promoter fragment was cloned in reverse orientation into

pGlowTOPO (Invitrogen) using Spe1/BglII (clone A). Rabbit podo-

calyxin cDNA, including 326 bp of cPodxl1 5�untranslated region,

was released using EcoRI (fragment size 2 kb) from a full-length

hPODXL1 clone,24 filled in with Klenow (Promega, Madison, WI)

and cloned into clone A using XbaI blunt ended with Klenow (pGlow-

Topo-cPodxl1). The human promoter region phPODXL1 was re-

versed in orientation by digesting clone A with Bgl II and SpeI, filled



with Klenow and ligated into PGlowTopo-cPodxl1, digested with Bg-

lII and Spe1, filled with Klenow (pPEC-cPodxl1). The entire promoter

region was sequenced (GenBank accession no. EU360962).

The cPodxl1 cDNA was replaced by a multiple cloning site by PCR

mutagenesis using Accuprime and the primers PECMCS.fwd 5�P-

ATGGCTAGCCTCGAGATCTGGACAACCTGACCAAGGACG-3�

and PECMCS.rev 5�P-GGTGGTCGCGACTAGTCCTCGCTCCGG-

GGGCCTGGA-3� using pPEC-cPodxl1 as template. The template

was removed by digestion with DpnI, and the resulting 8-kb product

was recircularized using T4 ligase (pPEC-MCS; Fermentas, St. Leon-

Rot, Germany). PUHrt62–1, containing the improved reverse tetra-

cycline–inducible transactivator (rtTA-M2),25 was digested with

Xba1/BamH1 and cloned into pPEC-MCS digested with Spe1/BglII

(pPEC-rtTA-M2). The enhanced transcription factor rtTA-M2 is

characterized by lower background activity and a higher sensitivity

to doxycycline. The promoter and coding region, including the

polyadenylation signal of this clone, was entirely sequenced. For

pronuclear injection of pPEC-cPodxl1 and pPEC-rtTA-M2, the

prokaryotic sequence was removed using SspI and NsiI. Pro-

nuclear injection was performed according to standard procedures

into a 129/SvEv � C57BL/6J genetic background at the Interfakul-

taere Biomedizinische Forschungseinrichtung (IBF) of the Heidel-

berg University (Heidelberg, Germany). All three transgenes were

heterozygous within the experimental animals. For achieving this,

the PEC-rtTA line was mated to homozygous LC1/R26R mice,

yielding 50% triple-transgenic offspring.

All animal studies were approved by the University of Michigan

Committee on Use and Care of Animals and by the LANUV Cologne

9.32.2.10.35.07.041 and Stuttgart 35-9185.81/G-32/03. All experi-

mental groups contained a similar distribution of males and females

unless stated otherwise. Animals received regular feeding and water

ad libitum and were kept under specific pathogen–free conditions in a

12-h light cycle (22°C, 50% humidity).

GenotypingNine founder mice were identified by PCR from tail biopsies, which were

incubated in 190 �l of Viagen DirectPCR lysis reagent (Viagen cat. no.

102-T; Viagen, Los Angeles, CA) and 10 �l of Proteinase K (Sigma cat. no.

6556; Sigma Aldrich, St. Louis, MO) stock concentration of 4 mg/ml at

55°C overnight and heat inactivated at 85°C for 45 min. The following

primers were used: Cre forward GCATAACCAGTGAAACAGCATT-

GCTG and reverse GGACATGTTCAGGGATCGCCAGGCG; LacZ for-

ward TTCACTGGCCGTCGTTTTACAACGTCGTGA and reverse AT-

GTGAGCGAGTAACAACCCGTCGGATTCT; LC1 forward TTACA-

GATGCACATATCGAGG and reverse TAACCCAGTAGATCCA-

GAGG; TetOn forward AATCGAGATGCTGGACAGGCATCATAC-

CCA and reverse GGCATAGAATCGGTGGTAGGTGTCTCTCTT; and

ROSA26 forward GCGAAGAGTTTGTCCTCAACC, ROSA26_1 re-

verse GGAGCGGGAGAAATGGATATG, and ROSA26_2 reverse

AAAGTCGCTCTGAGTTGTTAT.

Transgene expression was evaluated in pPEC-Podxl1 mice by im-

munohistology according to standard techniques36 using an anti-

serum specific for rabbit podocalyxin (4B3).24 Six of nine founder

lines expressed transgenic rabbit podocalyxin. Nine founder animals

transgenic for pPEC-rtTA were obtained.

Doxycycline TreatmentDouble- or triple-transgenic animals received doxycycline hydro-

chloride via the drinking water for a total of 14 d (5% sucrose and 0.5

mg/ml doxycycline, protected from light), which was exchanged every

2 d. For induction of 5- or 10-d-old animals, 50 ng/g body wt doxy-

cycline dissolved in 0.45% NaCl solution was injected intraperitone-

ally over a total of 3 d.

Perfusion Fixation and Electron MicroscopyMice were anesthetized (Avertin, Sigma Aldrich, St. Louis, MO) and

ice-cold perfusion solution (3% paraformaldehyde, 0.2% glutaralde-

hyde, 2.5 mM EGTA, and 4 mM MgCl2 in 0.5 � PBS [pH 7.6]) was

perfused into the left ventricle for 3 min followed by 20% sucrose for

1 min. Organs and tissues were immediately recovered and snap-

frozen in Tissue-Tek (Miles Inc., Iowa City, IA) or embedded in par-

affin. Transmission electron microscopy was performed as described

previously.37

�-Gal Assays�-Gal activity was measured in unfixed snap-frozen tissues using a

commercial chemiluminescent assay, Galacto-Star (Tropix, Bedford,

Table 1. Transcriptional activity of the identified PEC promotera

Parameter

Tissue

Blood BoneMarrow

CNS Eye FattyTissue

Gut

Kidney LiverFront Hind Stomach SmallIntestine

LargeIntestine

Chemiluminescenceb Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. Neg. �� Neg.

Histologyc Neg. Neg. ND ND ND Neg. Neg. Neg. ND Parietal cells, thin part ofloop of Henle, mosaic:collecting duct,epithelial cells of thepyramid

Neg.

aND, not done; Neg., no expression of �-gal detected; (�), weak luminescence; ��, significant luminescence; ��, strong luminescense.bThe pattern of Cre recombination was evaluated in tissues of triple-transgenic pPEC-rtTA/LC1/R26R mice induced with doxycycline at the age of 6 wk using asensitive chemiluminescent assay.c�-Gal expression was confirmed by enzymatic stainings with X-Gal on cryosections.



MA), as described previously.38 For enzymatic X-Gal staining, 6-�m

cryosections were cut and incubated overnight at 35°C in a humid-

ified atmosphere in staining solution (1 mg/ml X-Gal, 5 mM po-

tassium ferricyanide, 5 mM potassium ferrocyanide, and 2 mM

MgCl2 in PBS [pH 7.8]). On the next day, samples were counter-

stained with eosin, washed in tap water, and mounted (Immu-

Mount; Thermo Scientific, Waltham, MA).

ImmunofluorescenceImmunofluorescence was performed as described previously39,40 on

2- and 4-�m cryosections blocked with 10% donkey serum in PBS

(017-000-121; Jackson Immunoresearch Laboratories, West Grove,

PA) and incubated with the following antibodies: Chicken anti–�-gal

polyclonal antibody (1:100, ab9361, lot no. 301516; Abcam, Cam-

bridge, UK), mouse anti-nephrin polyclonal antibody (1:100; a gift of

Lawrence B. Holzman, Ann Arbor, MI), mouse anti-synaptopodin

polyclonal antibody (1:100, 65294; Progen, Heidelberg, Germany),

rabbit anti– claudin-1 (DAKO, Glostrup, Denmark), rabbit anti–von

Willebrand factor (A0082; DAKO), chicken anti-nestin (DAKO), rat

anti–aminopeptidase A (ASD41), rat anti-DPPIV (ASD36),23 goat

anti-rabbit Dylight 549 (1:100, 35557; Pierce Biotechnology, Rock-

ford, IL), Alexa Fluor 488 – conjugated goat anti-rat (1:200, A11006;

Molecular Probes, Eugene, OR), Cy3-conjugated donkey anti-

chicken IgG and Cy2-conjugated rabbit anti-mouse IgG (1:100, 703-

225-155 and 715-225-151, respectively; Jackson Immunoresearch

Laboratories). Nuclei were stained with TO-PRO-3 (624/661; 1:200,

T3605; Molecular Probes). All secondary antibodies, except the anti-

mouse antibody, were immunoabsorbed with 4% normal mouse se-

rum. Irrelevant rabbit IgG was used as control. For immunohisto-

chemical stainings, the X-gal–stained cryosections were boiled in

citrate buffer, blocked against avidin and bi-

otin, and stained with the anti–WT-1 anti-

serum (1:400; Santa Cruz Biotechnology,

Santa Cruz, CA). Secondary anti-rabbit (BA-

1000; Vector Laboratories, Burlingame, CA)

was visualized using 3-amino-9-ethyl-carba-

zole (AEC). Sections were evaluated with an

Olympus BX 41 microscope (Hamburg, Ger-

many) and Zeiss LSM 510 Meta laser in-

verted confocal microscope, (Goettingen,

Germany). Images were collected with

AnalySIS (Soft Imaging System, Munster,

Germany) and prepared for presentation

with Adobe Photoshop and Illustrator soft-

ware (Adobe Systems, Mountain View, CA).

Metabolic LabelingFemale Sprague-Dawley rats weighing 75 g

were purchased from Charles River (Charles

River Laboratories, Inc., Wilmington, MA).

BrdU (B-5002; Sigma) labeling was per-

formed as described previously.17 In brief,

rats received a subcutaneous injection of 25

�g of BrdU in 500 �l sterile 0.9% NaCl twice

Figure 9. Activity of the parietal cell promoter. (A) Within the kidney, activity of the PECpromoter was also observed within the thin limb of the loop of Henle (arrows, pPEC-cPodxl1 transgenic mouse; brown, anti-rabbit podocalyxin staining, hematoxylin counterstaining). (B) Mesothelial cells lining the peritoneal cavity on the uterus were geneticallylabeled in a mosaic manner (arrowhead). (C) Cre recombination occurred within theepithelium of the pancreatic ducts (arrowheads) but not within glandular cells or pancre-atic islets (arrow). (D and D�) Activity of the parietal cell promoter within follicles of thespleen (arrow) was visualized by immunohistology in pPEC-cPodxl1–transgenic mice (D,anti-rabbit podocalyxin in brown; D� control using irrelevant primary antibody). (E) Noevidence for Cre recombination was observed within cells of the bone marrow of micemore than 8 mo after induction (B, C, and E, pPEC-rtTA/LC1/R26R mouse, X-gal/eosinstaining on cryosections).

Tissue

LungMuscle

(Skeletal)Myocardium Pancreas

Reproductive OrgansSalivaryGlands

Skin Spleen ThymusFemale Male

Neg. Neg. Neg. �� (�) �� Neg. ��

ND ND Neg. Pancreaticduct

Uterine glandularcells

Basal layers of theseminiferousepithelium

Salivaryducts

Neg. Folliculardendriticcells (?)

Folliculardendriticcells (?)



a day for 14 d. Animals were anesthetized with isoflurane and ket-

amine/rompune and perfusion-fixed through the left ventricle with

3% paraformaldehyde in 0.5% PBS (pH 7.6) for 3 min. Four-mi-

crometer cryosections were boiled in citrate buffer three times for 5

min; blocked with 10% donkey serum; incubated with anti-BrdU an-

tibody (MAB3424, 1:200; Chemicon, Billerica, MA), anti–WT-1 (1:

400; Santa Cruz Biotechnology, Santa Cruz, CA), and Hoechst 33342

(0.1 mg/ml; Sigma), counterstained; and mounted as described al-

ready.

Statistical AnalysisThree hundred glomeruli were evaluated for each experimental ani-

mal on random transverse sections through the middle part of the

kidney. Glomeruli that did not have a glomerular tuft or that were

sectioned close to the edge were disregarded. Transitional cells were

identified on X-gal–stained cryosections as large upright epithelial

cells located along the vascular stalk. PECs were counted only when

their cellular body, including the nucleus, was seen. Data were ana-

lyzed using Prism 4.0 for Macintosh (GraphPad, San Diego, CA) us-

ing the one-sided ANOVA test.

ACKNOWLEDGMENTS

This work was supported by the German Research Foundation

(MO1082/1-1, 1-2, 3-1); the Else-Kroner-Fresenius-Stiftung; the

START Program of the Faculty of Medicine, RWTH-Aachen (to

M.J.M.); and by the NIH (R01-DK058270 to D.B.K.). M.M. is a mem-

ber of the DFG research group “Mechanisms of Chronic Renal Fail-

ure” and of the Transregio/SFB DFG consortium “Mechanisms of

Organ Fibrosis.”

DISCLOSURESNone.

REFERENCES

1. US Renal Data System: USRDS 2007 Annual Report, Bethesda, Na-tional Institutes of Health, National Institute of Diabetes and Digestiveand Kidney Diseases, 2007

2. Wharram BL, Goyal M, Wiggins JE, Sanden SK, Hussain S, Filipiak WE,Saunders TL, Dysko RC, Kohno K, Holzman LB, Wiggins RC: Podocytedepletion causes glomerulosclerosis: Diphtheria toxin-induced podo-cyte depletion in rats expressing human diphtheria toxin receptortransgene. J Am Soc Nephrol 16: 2941–2952, 2005

3. Novick AC, Gephardt G, Guz B, Steinmuller D, Tubbs RR: Long-termfollow-up after partial removal of a solitary kidney. N Engl J Med 325:1058–1062, 1991

4. Kriz W, Gretz N, Lemley KV: Progression of glomerular diseases: Is thepodocyte the culprit? Kidney Int 54: 687–697, 1998

5. Hara M, Yamamoto T, Yanagihara T, Takada T, Itoh M, Adachi Y,Yoshizumi A, Kawasaki K, Kihara I: Urinary excretion of podocalyxinindicates glomerular epithelial cell injuries in glomerulonephritis.Nephron 69: 397–403, 1995

6. Vogelmann SU, Nelson WJ, Myers BD, Lemley KV: Urinary excretion of

viable podocytes in health and renal disease. Am J Physiol RenalPhysiol 285: F40–F48, 2003

7. Yu D, Petermann A, Kunter U, Rong S, Shankland SJ, Floege J: Urinarypodocyte loss is a more specific marker of ongoing glomerular dam-age than proteinuria. J Am Soc Nephrol 16: 1733–1741, 2005

8. Fries JW, Sandstrom DJ, Meyer TW, Rennke HG: Glomerular hyper-trophy and epithelial cell injury modulate progressive glomeruloscle-rosis in the rat. Lab Invest 60: 205–218, 1989

9. Pabst R, Sterzel RB: Cell renewal of glomerular cell types in normalrats: An autoradiographic analysis. Kidney Int 24: 626–631, 1983

10. Marshall CB, Shankland SJ: Cell cycle and glomerular disease: Aminireview. Nephron Exp Nephrol 102: e39–e48, 2006

11. Prodromidi EI, Poulsom R, Jeffery R, Roufosse CA, Pollard PJ, PuseyCD, Cook HT: Bone marrow-derived cells contribute to podocyteregeneration and amelioration of renal disease in a mouse model ofAlport syndrome. Stem Cells 24: 2448–2455, 2006

12. Sugimoto H, Mundel TM, Sund M, Xie L, Cosgrove D, Kalluri R:Bone-marrow-derived stem cells repair basement membrane collagendefects and reverse genetic kidney disease. Proc Natl Acad Sci U S A103: 7321–7326, 2006

13. Becker JU, Hoerning A, Schmid KW, Hoyer PF: Immigrating progen-itor cells contribute to human podocyte turnover. Kidney Int 72:1468–1473, 2007

14. Ito T, Suzuki A, Imai E, Okabe M, Hori M: Bone marrow is a reservoirof repopulating mesangial cells during glomerular remodeling. J AmSoc Nephrol 12: 2625–2635, 2001

15. Imasawa T: Roles of bone marrow cells in glomerular diseases. ClinExp Nephrol 7: 179–185, 2003

16. Lin F, Moran A, Igarashi P: Intrarenal cells, not bone marrow-derivedcells, are the major source for regeneration in postischemic kidney.J Clin Invest 115: 1756–1764, 2005

17. Vogetseder A, Karadeniz A, Kaissling B, Le Hir M: Tubular cell prolif-eration in the healthy rat kidney. Histochem Cell Biol 124: 97–104,2005

18. Sagrinati C, Netti GS, Mazzinghi B, Lazzeri E, Liotta F, Frosali F,Ronconi E, Meini C, Gacci M, Squecco R, Carini M, Gesualdo L,Francini F, Maggi E, Annunziato F, Lasagni L, Serio M, Romagnani S,Romagnani P: Isolation and characterization of multipotent progenitorcells from the Bowman’s capsule of adult human kidneys. J Am SocNephrol 17: 2443–2456, 2006

19. Lazzeri E, Crescioli C, Ronconi E, Mazzinghi B, Sagrinati C, Netti GS,Angelotti ML, Parente E, Ballerini L, Cosmi L, Maggi L, Gesualdo L,Rotondi M, Annunziato F, Maggi E, Lasagni L, Serio M, Romagnani S,Vannelli GB, Romagnani P: Regenerative potential of embryonic renalmultipotent progenitors in acute renal failure. J Am Soc Nephrol 18:3128–3138, 2007

20. Ohse T, Pippin JW, Vaughan MR, Brinkkoetter PT, Krofft RD, Shank-land SJ: Establishment of conditionally immortalized mouse glomer-ular parietal epithelial cells in culture. J Am Soc Nephrol 19: 1879–1890, 2008

21. Zou J, Yaoita E, Watanabe Y, Yoshida Y, Nameta M, Li H, Qu Z,Yamamoto T: Upregulation of nestin, vimentin, and desmin in ratpodocytes in response to injury. Virchows Arch 448: 485–492, 2006

22. Chen J, Boyle S, Zhao M, Su W, Takahashi K, Davis L, Decaestecker M,Takahashi T, Breyer MD, Hao CM: Differential expression of the inter-mediate filament protein nestin during renal development and itslocalization in adult podocytes. J Am Soc Nephrol 17: 1283–1291,2006

23. Mentzel S, Dijkman HB, Van Son JP, Koene RA, Assmann KJ: Organdistribution of aminopeptidase A and dipeptidyl peptidase IV in nor-mal mice. J Histochem Cytochem 44: 445–461, 1996

24. Kershaw DB, Thomas PE, Wharram BL, Goyal M, Wiggins JE, White-side CI, Wiggins RC: Molecular cloning, expression, and characteriza-tion of podocalyxin-like protein 1 from rabbit as a transmembraneprotein of glomerular podocytes and vascular endothelium. J BiolChem 270: 29439–29446, 1995



25. Urlinger S, Baron U, Thellmann M, Hasan MT, Bujard H, Hillen W:Exploring the sequence space for tetracycline-dependent transcrip-tional activators: Novel mutations yield expanded range and sensitiv-ity. Proc Natl Acad Sci U S A 97: 7963–7968, 2000

26. Schonig K, Schwenk F, Rajewsky K, Bujard H: Stringent doxycyclinedependent control of CRE recombinase in vivo. Nucleic Acids Res 30:e134, 2002

27. Soriano P: Generalized lacZ expression with the ROSA26 Cre reporterstrain. Nat Genet 21: 70–71, 1999

28. Yamaguchi H, Kaku H, Onodera T, Kurokawa R, Morisada M: Peripolarcells in guinea pigs under experimental hyperplasia of juxtaglomerularcells induced by long-term, low-dose calcium condition. Exp ToxicolPathol 46: 283–286, 1994

29. Gardiner DS, Downie I, Gibson IW, More IA, Lindop GB: The glomer-ular peripolar cell: A review. Histol Histopathol 6: 567–573, 1991

30. Bariety J, Mandet C, Hill GS, Bruneval P: Parietal podocytes in normalhuman glomeruli. J Am Soc Nephrol 17: 2770–2780, 2006

31. Kriz W, Hahnel B, Rosener S, Elger M: Long-term treatment of rats withFGF-2 results in focal segmental glomerulosclerosis. Kidney Int 48:1435–1450, 1995

32. Bariety J, Bruneval P, Hill G, Irinopoulou T, Mandet C, Meyrier A: Post-transplantation relapse of FSGS is characterized by glomerular epithelialcell transdifferentiation. J Am Soc Nephrol 12: 261–274, 2001

33. Ronconi E, Sagrinati C, Angelotti ML, Lazzeri E, Mazzinghi B, BalleriniL, Parente E, Gacci M, Carini M, Maggi E, Serio M, Vannelli GB,Lasagni L, Romagnani S, Romagnani P: Regeneration of glomerularpodocytes by human renal progenitors. J Am Soc Nephrol 20: 322–332, 2009

34. Gibson IW, Downie TT, More IA, Lindop GB: Atubular glomeruli andglomerular cysts: A possible pathway for nephron loss in the humankidney? J Pathol 179: 421–426, 1996

35. D’Agati VD, Fogo AB, Bruijn JA, Jennette JC: Pathologic classificationof focal segmental glomerulosclerosis: A working proposal. Am JKidney Dis 43: 368–382, 2004

36. Moeller MJ, Soofi A, Sanden S, Floege J, Kriz W, Holzman LB: Anefficient system for tissue-specific overexpression of transgenes inpodocytes in vivo. Am J Physiol Renal Physiol 289: F481–F488, 2005

37. Kriz W, Hahnel B, Hosser H, Ostendorf T, Gaertner S, Kranzlin B, GretzN, Shimizu F, Floege J: Pathways to recovery and loss of nephrons inanti-Thy-1 nephritis. J Am Soc Nephrol 14: 1904–1926, 2003

38. Moeller MJ, Kovari IA, Holzman LB: Evaluation of a new tool for exploringpodocyte biology: Mouse Nphs1 5� flanking region drives LacZ expres-sion in podocytes. J Am Soc Nephrol 11: 2306–2314, 2000

39. Moeller MJ, Soofi A, Braun GS, Li X, Watzl C, Kriz W, Holzman LB:Protocadherin FAT1 binds Ena/VASP proteins and is necessaryfor actin dynamics and cell polarization. EMBO J 23: 3769 –3779,2004

40. Moeller MJ, Soofi A, Hartmann I, Le Hir M, Wiggins R, Kriz W,Holzman LB: Podocytes populate cellular crescents in a murinemodel of inflammatory glomerulonephritis. J Am Soc Nephrol 15:61– 67, 2004

See related editorial, “Parietal Epithelial Cells Regenerate Podocytes,” onpages 231–233.



recruitment of podocytes from glomerular parietal...

Documents