1

Regulation of Mitochondrial Biogenesis

in Human Embryonic Stem Cells

Li-Pin Kao

A thesis submitted for the degree of Doctor of Philosophy at

The University of Queensland in 2015

Australian Institute for Bioengineering & Nanotechnology

2

Abstract

Human embryonic stem cells (hESCs) are established from the inner cell mass of

the pre-implantation blastocyst and are both pluripotent (being able to be differentiated into

all cell types of the body) and immortal (being able to proliferate indefinitely). When grown

in culture, they provide a unique in vitro model system that allows us to study the earliest

steps of human embryogenesis, a developmental process that is otherwise inaccessible to

experimentation.

Mitochondria are not only the essential organelles for generating energy in cells but

also generate reactive oxygen species (ROS) as side-products of aerobic energy

production. The presence of ROS leads to the progressive accumulation of mutations

within mitochondrial DNA (mtDNA), resulting in dysfunctional mitochondria. To counteract

this, it is thought that a selective amplification of healthy mitochondria occurs during

pre-implantation development, aiming at maintaining the mitochondrial fitness in the

germline (the ‗bottleneck‘ theory). Embryonic stem cells harvested from the

pre-implantation blastocyst can be cultured indefinitely in vitro and contain

metabolically-active mitochondria. Therefore, in this study, we wished to investigate how

the mtDNA copy number is regulated in cultured pluripotent stem cells.

Initially, the mitochondrial-encoded as well as the mitochondrial biogenesis-related

gene expression were analysed in spontaneously differentiating hESCs and during different

lineage-specific differentiation of hESCs in a time-dependent manner. The

spontaneously-differentiated hESCs possess more copies of mitochondrial genome in

mitochondria and early-differentiated hESCs display more mature mitochondrial

morphology and a higher mitochondrial membrane potential as compared to

3

undifferentiated hESCs. After 7 days of spontaneous differentiation of hESCs, the transcript

levels of D-loop and PGC1α, the master regulatory gene of the mitochondrial biogenesis,

were upregulated. We also demonstrated that the early ectoderm and cardiomyocyte

differentiation is accompanied by an upregulation of PGC1α. While this shows that

mitochondrial gene expression and biogenesis changes upon differentiation it remained to

be determined what role mitochondria play in pluripotent stem cells and their differentiated

derivatives.

To address this question, we investigated the effect of interference with

mitochondrial DNA replication (using EtBr) or mitochondrial protein synthesis (using

chloramphenicol) in fibroblasts. Compared with untreated primary human foreskin

fibroblasts, the mitochondrial impaired rho-minus fibroblasts showed a lower rate of

proliferation and a decreased level of mitochondrial gene expression, as well as lower

mitochondrial membrane potential and greater rate of lactate production. Moreover, the

mitochondrial-encoded and mitochondrial biogenesis-related genes were upregulated after

the treatments had been removed. While fibroblasts were able to tolerate mitochondrial

depletion or inhibition of mitochondrial protein synthesis repeated attempts to generate

mitochondria depleted, let alone mitochondria null, hESC failed, suggesting that despite the

notion that hESCs are mainly glycolytic mitochondria are required for pluripotent stem cell

proliferation and survival.

These observations next led us to investigate whether the mtDNA copy number

affects the hESC‘s survival. To this end, we chose to perturb the expression of

mitochondrial transcription factor A (TFAM), a member of the high-mobility group (HMG)

family of proteins, which is known to have a role in controlling the mtDNA copy number in

other cell types. Overexpression of TFAM in hESCs led to an increase in the mtDNA copy

4

number but did not affect hESC morphology, whereas knockdown of TFAM expression

resulted in dramatically cell death in H9 and Mel 1 hESCs. The data indicate that in contrast

to other cell types TFAM does not appear to play a central role in mitochondrial biogenesis

in hESC and that PGC1α may be more important in this respect.

To investigate the mechanism of mitochondrial turnover in hESC, we investigated

mitophagy in pluripotent and differentiating hESC. Following a short-term treatment of

hESCs, with rapamycin (mTOR inhibition), CCCP (depolarisation of the mitochondrial

membrane), or ethidium bromide (mtDNA damage). Autophagosome numbers were

increased. Furthermore, after longer-term, EtBr triggered mitophagy events in every single

cell in a hESC culture. Interestingly we found that during early hESC differentiation, the

mitophagic activity transiently increased, perhaps indicating that mitochondrial turnover

may be involved in mitochondrial quality control during very early differentiation of hESCs.

While there remain many questions to be answered regarding the role and regulation of

mitochondria in hESC and hESC differentiation this thesis provides several novel insights

into these processes.

hESCs represent a unique system to study the molecular mechanisms that control

mitochondrial quality and quantity and investigating these processes in the most primitive

human stem cells is highly relevant to understanding the effects of environmental toxins on

early human development and regenerative medicine approaches for in particular

mitochondrial diseases.

5

Declaration by Author

This thesis is composed of my original work and contains no material previously

published or written by another person except where due reference has been made in the

text. I have clearly stated the contribution by others to jointly-authored works that I have

included in my thesis.

I have clearly stated the contribution of others to my thesis as a whole, including

statistical assistance, survey design, data analysis, significant technical procedures,

professional editorial advice and any other original research work used or reported in my

thesis. The content of my thesis is the result of work I have carried out since the

commencement of my research higher degree candidature and does not include a

substantial part of work that has been submitted to qualify for the award of any other degree

or diploma in any university or other tertiary institution. I have clearly stated which parts of

my thesis, if any, have been submitted to qualify for another award.

I acknowledge that an electronic copy of my thesis must be lodged with the University

Library and, subjected to the General Award Rules of The University of Queensland,

immediately made available for research and study in accordance with the Copyright Act

1968.

I acknowledge that the copyright of all material contained in my thesis resides with the

copyright holder(s) of that material. Where appropriate I have obtained copyright

permission from the copyright holder to reproduce material in this thesis.

6

Publications during candidature

1. Kao LP., Ovchinnikov DA., and Wolvetang EJ. Regulations of Mitochondrial

Biogenesis in Chloramphenicol- and Ethidium Bromide-Treated Primary Human

Fibroblasts. Toxicol Appl Pharmacol. 2012 May 15:261(1):42-49.

2. Chious SS., Wang SS., Wu DC., Lin YC., Kao LP., Kuo KK., Wu CC., Chai CY., Lin CL.,

Lee CY., Liao YM., Wuputra K., Yang YH., Wang SW., Ku CC., Nakamura Y., Saito S.,

Hasegawa H., Yamaguchi N., Miyoshi H., Lin CS., Eckner R., Yokoyama KK (2013)

Control of oxidative stress and generation of induced pluripotent stem cell-like cells by

Jun Dimerization protein 2. Cancer 5(3):959-984.

3. Wu JM., Chen CT., Coumar MS., Lin WH., Chen ZJ., Hsu JT., Peng YH., Shiao HY., Lin

WH., Chu CY., Wu JS., Lin CT., Chen CP., Hsueh CC., Chang KY., Kao LP., Huang

CY., Chao YS., Wu SY., Hsieh HP., Chi YH. (2013) Auora kinase inhibitors reveal

mechanisms of HURP in nucleation of centrosomal and kinetochore microtubules. Proc.

Natl. Acad. Sci. USA. 110 (19): E1779-1787.

4. Chen BZ., Yu SL., Singh S., Kao LP., Tsai ZY., Yang PC., Chen BH., Li SS. (2011)

Identification of microRNAs expressed highly in pancreatic islet-like cell clusters

differentiation from human embryonic stem cells. Cell Biol Int 35(1):29-37.

5. Wang KH., Kao AP., Singh S., Yu SL., Kao LP., Tsai ZY., Lin SD., Li SS (2010)

Comparative expression profiles of mRNAs and microRNAs among human

mesenchymal stem cells derived from breast, face, and abdominal adipose tissues.

Kaohsiung J Med Sci 26(3):113-122.

6. Tsai ZY., Singh S., Yu SL., Kao LP., Chen BZ., Ho BC., Yang PC., Li SS

(2010)Identification of microRNAs regulated by activin A in human embryonic stem cells.

J Cell Biochem 109(1):93-102.

7

7. Li SS., Yu SL, Kao LP, Tsai ZY., Singh S., Chen BZ., Ho BC., Liu YH., Yang PC. (2009)

Target identification of microRNAs expressed highly in human embryonic stem cells.

Journal of Cellular Biochemistry. 106(6): 1020-1030.

8. Kao LP, Yu SL, Singh S, Wang KH, Kao AP, Li SS (2008) Comparative profiling of

mRNA and microRNA expression in human mesenchymal stem cells derived from adult

adipose and lipoma tissues. The Open Stem Cell Journal. 1:1-9.

Publications included in this thesis

1) Kao LP., Ovchinnikov DA., and Wolvetang EJ. Regulations of Mitochondrial Biogenesis

in Chloramphenicol- and Ethidium Bromide-Treated Primary Human Fibroblasts.

Toxicol Appl Pharmacol. 2012 May 15:261(1):42-49. PMID: 22712077 –incorporated in

Objective 2- Kao was responsible for 50% of experiments design, analysis and

interpretation of data, drafting and writing; Ovchinnikov was responsible for 5% of

editing and interpretation of data; Wolvetang was responsible for 45% of conception,

experimental design, analysis and interpretation of data, drafting and writing.

2) Tra T., Gong L., Kao LP, Li XL., Grandela C., Devenish RJ., Wolvetang E., Prescott M.

(2011) Autophagy in human embryonic stem cells. PLoS One. 6(11):e27485. -Kao was

responsible for 5% of experimental performances. Wolvetang was responsible for 70%

of drafting and writing

3) Briggs JA., Sun J., Shepherd J., Ovchinnikov DA., Chung TL., Nayler SP., Kao LP.,

Morrow CA., Thakar NY., Soo SY., Peura T., Grimmond S., Wolvetang EJ (2013)

Integration-free induced pluripotent stem cells model genetic and neural development

features of down syndrome etiology. Stem Cells.31 (3):467-478-Kao was responsible

8

for 5% of drafting and writing. Wolvetang was responsible for 70% of drafting and

writing.

Oral and Poster presentations based on this thesis

1. Li-Pin Kao, D.A. Ovchinnikov, M. Prescott, T. Tra, J.P. Turner., J.J. Cooper-White., E.J.

Wolvetang (2013). Regulation of mitochondrial biogenesis in human embryonic stem

cells. The fifth international system biology and bioinformatics (SSBC), Russia. Oral

presentation.-Second best oral presenter and poster presentation-received paper

submission invitation.

2. Li-Pin Kao, M. Prescott, T. Tra, J.P. Turner., J.J. Cooper-White., E.J. Wolvetang (2012).

Mitochondria turnover in human embryonic stem cells and can be modulated by

environmental factors. The annual international conference on stem cell research (SCR),

Malaysia. Oral presentation and poster presentation -received paper submission

invitation.

3. Li-Pin Kao, Mark Prescott, Thien Tra, Rachel Horne and Ernst Wolvetang (2009)

Mitophagy in human embryonic stem cells. The seventh international society for stem

cell research (ASSCR), Australia. Poster presentation.

4. Li-Pin Kao, Mark Prescott, Thien Tra, Rachel Horne and Ernst Wolvetang (2009)

Mitophagy in human embryonic stem cells. The seventh international society for stem

cell research (ISSCR) USA. Poster presentation.

5. Li-Pin Kao, Mark Prescott, Thien Tra, Rachel Horne and Ernst Wolvetang (2009)

Mitophagy in human embryonic stem cells. 2009 MMRI Stem Cell and Regenerative

Medicine Symposium, Australia. Poster presentation.

9

Contributions by others to the thesis

1) A/Prof. Ernst Wolvetang and Dr. Dmitry Ovchinnikov contributed significantly to the

concept and design of projects, as well as data analysis and interpretation, revision of

work, editing of manuscripts and the thesis as a whole.

2) Briggs JA., Sun J., Shepherd J., Ovchinnikov DA., Chung TL., Nayler SP., Kao LP.,

Morrow CA., Thakar NY., Soo SY., Peura T., Grimmond S., Wolvetang EJ (2013)

Integration-free induced pluripotent stem cells model genetic and neural development

features of down syndrome etiology. Stem Cells.31 (3):467-478. - Drs. Briggs and Sun

contributed to the hiPSCs and protocol and cDNAs of ectoderm (neural) differentiation

to this thesis.

3) Hudson J, Titmarsh D, Hidalgo A, Wolvetang E, Cooper-White J. Primitive cardiac cells

from human embryonic stem cells (2012) Stem Cells

Dev.:0;21(9):1513-23.(PMID:21933026)- Dr. Hudson contributed to the protocol and

cDNAs of mesendoderm and cardiomyocyte differentiation to this thesis.

4) Dr. Samah Alharbi contributed to the protocol, cDNAs generation and

immunocytochemistry of definitive endoderm differentiation to this thesis.

5) Dr. Jennifer Turner assisted with other part of mitochondrial metabolism analysis

laboratory work on human embryonic stem cells including optimisation and validation of

lactate, glucose and oxygen measurement methods.

Statement of parts of the thesis submitted to qualify for the

award of another degree

None

10

Acknowledgements

I would like to express my gratitude to Assoc. Prof. Ernst Wolvetang, my primary

supervisor for his guidance and support during this period. Ernst, thank you so much for

waiting for my manuscript and delays patiently, and it's so great of you to act as a good

supervisor with positive as well as encouraging attitude towards my work. Thanks for

accompanying me to get through the tough time and to achieve this project, and to my two

associate supervisors, Dr. Dmitry Ovchinnikov and Dr Tung-Liang Chung for being willing

to be my co-supervisor during my PhD and conducting follow-up of this thesis. If either I

hadn't met you during the period of my studying or you hadn't been involved in my advisory

committee, I couldn't have made it through. Of course, there would have been a different

result if we had never met each other. I couldn't express how much I appreciate your

continuous help, support and encouragement, with which I could defeat the difficulties I

encountered while I was developing this thesis. Again, thanks for your dedication to the

stem cell research.

I also want to express my gratitude to the two members of my thesis committee, both

of them are listed in my PhD program: Prof. Justin Cooper-White, thanks for spending your

time and supporting my proposals in each milestone review meeting; and Assoc. Prof.

Christine Wells, thank you for always giving me advice. I also want to show my appreciation

to the members in the entire Cooper-White and Wells groups, past and present, for their

continuous support, encouragement and helping me with my project ideas.

Furthermore, my sincere expressions of thanks are extended to Ms. Victoria Turner

and Mrs. Michelle Brush from the Brisbane core facility of the Australian Stem Cell Centre

for their continuous provision of human embryonic stem cell lines. I would also like to

express my appreciation to Dr. Geoff Osborne and Mr. John Wilson from the FACS facility

11

of the Queensland Brain Institute and the Centre for Microscopy and Microanalysis, Dr.

Elena Taran from the Australian National Fabrication Facility, and members of the Centre

for Microscopy and Microanalysis for their technical support and friendship. Without their

wholehearted devotion and support, this thesis would not have been completed.

This study was made possible because of the support from a scholarship and topup

provided by the Australian Postgraduate Award and the Australian Institute Bioengineering

and Nanotechnology. My appreciation also extends to the staff and postgraduate students

of the AIBN, University of Queensland, for their help and friendship. To all my past and

present supervisors (Prof. Mao SJ, Li SS, Yokoyama KK, and Prof. Chi YH) presence in my

career in the U.S.A, Taiwan and Japan, I am deeply appreciated your support, discussion

and review of my entire thesis when I encountered a bottleneck during my PhD study.

Special thanks should also go to my friends in Australia who gave me the benefit of

their tremendous suggestions. I particularly thank them for being with me and listening to

my research problems even though for most of them, my research topic is not even close to

theirs. With their understanding and assistance, the journey of getting the PhD was no

longer tedious. Each of them deserves credit for the quality and style of this paper. In

addition, I owe a debt of gratitude to members in the Wilson family and their two lovely dogs,

Gucci and Thor. They are the best companions to talk to, to be my ears, and to look in my

eyes as if they truly feel what I have been through during my pursuing PhD in Australia. I

have spent so much quality time running and walking around St Lucia campus with them. I

hope I can run and walk with them again in Australia. Furthermore, I am very grateful to

family members (LKK, Diana YHH, and Leo LYK) for their presence in comfort me. Finally,

to my Marley, thanks for all the joy and happiness you brought into my life and I wish you

have a good time in heaven.

12

Keywords

human embryonic stem cells, human foreskin fibroblast cells, mitochondrial biogenesis,

mitochondrial rho minus cells, mitophagy, transcription factors

Australian and New Zealand Standard Research Classifications

(ANZSRC)

ANZSRC code: 060103, Cell development, Proliferation and Death 50%

ANZSRC code: 060199, Biochemistry and Cell Biology not elsewhere classified, 50%

Fields of Research (FoR) Classification

FoR code:0601, Biochemistry and Cell Biology, 50%

FoR code:1004, Medical Biotechnology 50%

13

Table of Contents

Page

Abstract 2

Declaration by Author 5

Publications 6

Acknolwedgments 10

Keywords 12

Research Classifications 12

List of Tables 14

List of Figures 15

List of Videos 17

Chapter 1. Introduction 18

Chapter 2. Review of Literature 23

Chapter 3. Methods and Procedures 87

Chapter 4. Results 113

Chapter 5: Discussion 135

Chapter 6 Final Conclusion 158

References 160

Tables 189

Figures and Videos 203

Appendix Tables 235

Supplementary Figures 255

14

List of Tables

Page

Table 2.1 Diseases that are associated with perturbations to the mitochondrial fusion/fission machinery

40

Table 2.2 Methods for analysis of mtDNA 46

Table 2.3 Mouse gene knockouts of nuclear-encoded regulators of transcription implicated in mitochondrial biogenesis

54

Table 4.1 Comparison of TRA-1-60 and mitochondrial staining in undifferentiated and differentiated hESCs

189

Table 4.2 Changes in gene expression associated with ectoderm-specific differentiation of hESCs

190

Table 4.3 Changes in gene expression associated with endoderm-specific differentiation of hESCs

192

Table 4.4 Changes in gene expression associated with mesendoderm-specific differentiation of hESCs

193

Table 4.5 Changes in gene expression associated with cardiomyocyte-specific differentiation of hESCs

194

Table 4.6 Gene expression changes of mitochondria-encoded genes, transcription factors, and mtDNA copy number in control, ethidium bromide- or chloramphenicol-treated cells after treatment for 6 weeks and release from treatment for 2 weeks

195

Table 4.7 Relative amounts of glucose, lactate, GSH, and GSSG, and intracellular ATP, ADP concentrations in control, ethidium bromide– or chloramphenicol-treated cells after treatment for 6 weeks and release from treatment for 2 weeks

196

Table 4.8 Comparison of the mitochondrial membrane potential in control, ethidium bromide– or chloramphenicol-treated cells after treatment for 6 weeks and release from treatment for 2 weeks

198

Table 4.9 Target sequence of shRNAs against human TFAM 199

Table 4.10 Levels of TFAM expression in hESC lines (gain-of-function) 200

Table 4.11 Levels of TFAM expression in hESC lines (loss-of-function) 201

Table 4.12 Quantification of autophagosomes and mitophagy events per hES cells

202

15

List of Figures

Page

Figure 2.1 hESC isolation and culture procedures 25

Figure 2.2 ES cells can give rise to cell types from the three primitive germ

layers

32

Figure 2.3 Structure of mitochondrion 33

Figure 2.4 Schematic representation of the human mitochondrial genome 35

Figure 2.5 Stylized representation of the electron transport chain (ETC), which

is the final stage of cellular respiration where oxidative

phosphorylation (OXPHOS) takes place

37

Figure 2.6 Schematic of general mitochondrial replication 48

Figure 2.7 Transcriptional activation from the D-loop promoter region of mtDNA 53

Figure 2.8 TFAM alignment with different species 55

Figure 2.9 Changes in mtDNA copy number per cell during implantation stages 65

Figure 2.10 The possible origin of pathogenic mtDNA deletions 66

Figure 2.11 Stages of autophagosome formation in selective and non-selective

pathways

75

Figure 2.12 The mTOR signaling pathway 79

Figure 4.1 Schematic of lineage-specific differentiation in hESCs 203

Figure 4.2 Comparison of TRA-1-60 and mitochondrial staining in

undifferentiated and differentiated hESCs

204

Figure 4.3 Characterization of mitochondria in undifferentiated and

differentiated hESCs

206

Figure 4.4 Mitochondrial biogenesis profiles during ectoderm differentiation 208

Figure 4.5 Mitochondrial biogenesis profiles during endoderm differentiation 209

Figure 4.6 Mitochondrial biogenesis profiles during mesendoderm differentiation 210

Figure 4.7 Mitochondrial biogenesis profiles during cardiomyocytes

differentiation

211

16

Figure 4.8 Morphology and karyotypes of rho minus cells 212

Figure 4.9 Relative expression of mitochondrial-encoded, and mitochondrial

biogenesis-related genes after treatment for 6 weeks (6w) and

release from treatment for 2 weeks (6+2w)

213

Figure 4.10 Metabolic effect of ethidium bromide and chloramphenicol treatment

on human fibroblasts after treatment for 6 weeks and release from

treatment for 2 weeks

215

Figure 4.11 Mitochondrial membrane potential in ethidium bromide- or

chloramphenicol-treated cells after treatment for 6 weeks and

release from treatment for 2 weeks

217

Figure 4.12 Assessment of mitochondrial ultrastructure by transmission electron

microscopy after treatment for 6 weeks and release from treatment

for 2 weeks

219

Figure 4.13 Levels of TFAM expression in hESC lines (gain-of-function) 220

Figure 4.14 Constitutive knockdown of TFAM levels in hESCs 222

Figure 4.15 Levels of TFAM expression in hESC lines (loss-of function) 223

Figure 4.16 Morphological phenotypes associated with TFAM loss- and gain-of

function in hESC lines

225

Figure 4.17 Characterization of the hESC-LC3-GFP reporter cell line 226

Figure 4.18 Mitochondrial toxin and differentiation-induced mitophagy in

hES3-LC3-GFP cells

227

Figure 4.19 Quantification of mitophagy in hES3-LC3-GFP cells using

live-imaging flow-cytometry

229

Figure 4.20 Quantification of autophagosomes and mitophagosomes in hESCs 232

17

List of Videos

Page

Video 4.1 Live-imaging of mitophagy in hES3-LC3-GFP 233

Video 4.2 Live-imaging of mitophagy in hES3-LC3-GFP with 200nM rapamycin 233

Video 4.3 Live-imaging of mitophagy in hES3-LC3-GFP with 50µM CCCP 233

Video 4.4 Live-imaging of mitophagy in hES3-LC3-GFP with 100ng/ml EtBr 233

Video 4.5 Live-imaging of mitophagy in spontaneously differentiated hES3-LC3-GFP without basic fibroblast growth factor for 7 days

234

Video 4.6 Live-imaging of mitophagy in hES3-LC3-GFP with 100ng/ml EtBr for 16 hours

234

Video 4.7 Live-imaging of mitophagy in hES3-LC3-GFP with 100ng/ml EtBr for one week

234

Video 4.8 Live-imaging of mitophagy in hES3-LC3-GFP for one week 234

18

Chapter 1: Introduction

Embryonic stem cells (ESCs) are derived from the inner-cell-mass (ICM) of

blastocysts. ESC and induced pluripotent stem cell (iPSC) lines are immortal, meaning that

they have unlimited proliferation potential. They are also pluripotent; that is, they can

differentiate into lineages derived from all 3 major germ layers of the embryo. Consequently,

these cells have been widely investigated in the development of regenerative medicine

therapies. Human ESCs have been regarded as important research tools for the

investigation into early development of the human embryo. Mitochondria are the

powerhouses capable of providing the majority of energy within the cell and performing

important metabolic functions such as the Krebs cycle. The well-known endosymbiotic

theory (Martin, Hoffmeister et al. 2001) has suggested that the mitochondrion was originally

derived from a prokaryotic cell that invaded a larger, nucleated host cell. Mitochondria

indeed contain their own mitochondrial DNA (mtDNA) in a circular form, similar to the

bacterial genome. Mitochondrial genomes encode several essential genes of the

eukaryotic respiratory machinery. However, most of the components of the respiratory

machinery and factors controlling mitochondrial biogenesis are encoded in the nucleus.

The cooperation and communication between mitochondria and nuclei are conducted by

retrograde signals, such as energy supply and redox signaling and this currently

poorly-understood communication is essential for balancing energy production and

demand in the cell.

Mutations or deletions in the mitochondrial genome or nuclear-encoded

mitochondrial biogenesis-related genes usually result in a spectrum of mitochondrial

dysfunctions. This can affect a wide variety of tissues, including the brain, heart, liver,

skeletal muscles, kidney and the endocrine and respiratory systems. Differences in the

19

organs affected may lead to different symptoms, such as myopathies, developmental

delays and respiratory complications. Human cells lacking mtDNA known as rho zero (ρ˚)

cells, provide an opportunity to examine cellular processes in the absence of functional

mitochondria; that is to mimic the cells from patients with mitochondrial depletion syndrome

(MDS).

Mitochondria are entirely derived from the oocyte and very little mitochondrial

biogenesis is thought to occur until the implantation of blastocyst into uterus. Implantation

results in dramatic environmental alterations, such as increased oxygen and nutrient supply.

Interestingly, this is also the stage at which the differentiation of the inner cell mass into the

various tissues and cell types of the body starts to occur. The development of an organism

demands energy. Mitochondrial dysfunction (stemming from low mtDNA content, for

example, or from mutations within the mtDNA) within an oocyte may contribute to the failure

of in vitro fertilization and may affect hESC maintenance and differentiation (Reynier,

May-Panloup et al. 2001). The role of mitochondria in human embryonic stem cells (hESCs)

and the mechanism, by which mitochondrial health is maintained in these immortal cells,

remain unclear.

Mitochondrial turnover eliminates defective mitochondria to maintain cellular

homeostasis (Diaz and Moraes 2008). Mitochondrial turnover occurs through a specific

form of autophagy, an evolutionarily-conserved process in eukaryotic cells that results in

the breakdown of some of cytoplasmic proteins and organelles within the lysosome in

response to stress conditions. A key signaling pathway in the regulation of autophagy is the

mammalian Target of Rapamycin (mTOR) kinase, which senses signals causes by the

nutrient levels. mTOR regulates protein synthesis in the cell, the status of energy and

oxygen supply, cell proliferation and cell growth. This mTOR signaling is essential for

20

survival, differentiation, development and homeostasis in all organisms. Autophagy is

essential during degradation and development of maternal RNAs, proteins and organelles

in order to activate zygotic transcription and translation at different developmental stages.

Upon differentiation of hESCs, the mtDNA copy number increases to meet the energy

requirements of different cell types generated. Both ‗healthy‘ and ‗mutated‘ mitochondria

could be amplified upon differentiation. There exists a selective mechanism, called

mitophagy, by which autophagosomes uptake mitochondria. Mitophagic events are a

highly-selective process controlled by oxidative stress and mTOR and is accompanied by

loss of membrane potential and ensuing mitochondrial degradation.

The purpose of the current thesis aimed to examine the role of mitochondria in

hESCs during maintenance and differentiation. Four initial objectives were formulated to

guide the investigation:

Objective 1: To review the gene expression patterns of mitochondria-encoded and

mitochondrial biogenesis-related genes during spontaneous and directed

lineage-specific differentiation.

The gene expression patterns of mitochondria-encoded and mitochondrial

biogenesis-related genes during the differentiation of human pluripotent stem cells are not

known. Mitochondria are the major source of energy for eukaryotic cells. To meet rising

energy demands, cells often expand the pool of mitochondria, a process termed

mitochondrial biogenesis, which involves the replication of mitochondrial DNA (mtDNA) and

the synthesis, import, and assembly of essential mitochondrial proteins (Hock and Kralli

2009). Levels of mtDNA can affect oocyte maturation and subsequent developmental

processes (Van Blerkom 2004). During cellular differentiation, mitochondria also

differentiate in a process that involves structural and functional changes. For example,

21

mitochondria within spontaneously differentiating cells increase their membrane potential

(St John, Ramalho-Santos et al. 2005). This section describes the treatment conditions

used to promote differentiation and documents the expression of mitochondrial-encoded

and mitochondrial biogenesis-related genes during spontaneous, lineage-specific-, or

tissue-specific-differentiation of hESCs.

Objective 2: To investigate the effects of mitochondrial depletion on human

fibroblasts and hESCs.

Environmental toxins might cause mitochondrial dysfunction, which generates

retrograde signaling from the mitochondria to the nucleus. While this signaling pathway has

been well described in yeast, the manner in which mammalian cells respond to

mitochondrial DNA (mtDNA) depletion or the inhibition of mitochondrial protein synthesis

remains largely unclear. To investigate this response, mitochondria-depleted (rho-minus)

human fibroblasts were generated with agents that damage mitochondria: ethidium

bromide, which interferes with mitochondrial DNA replication, or chloramphenicol, which

interferes with mitochondrial protein synthesis. Gene expression, mitochondrial membrane

potential, morphology, and metabolic parameters were assessed during and after

treatment.

Objective 3: To characterize the effects of TFAM overexpression and knockdown on

the control of mitochondrial biogenesis during the proliferation of hESCs.

TFAM regulates the stability (Fisher and Clayton 1988) and copy number (Scarpulla

2008) of mtDNA, and mice lacking Tfam do not survive past embryonic day (E) 8.5

(Larsson, Wang et al. 1998). We hypothesized that TFAM also controls the mtDNA copy

22

number in hESCs. Therefore, we investigated whether manipulation of TFAM expression

affected the proliferation or survival of hESCs. First approach was to assess how

constitutive overexpress or knockdown of TFAM affected the survival of stem cells. The

second approach was to switch from a constitutive expression system to an inducible

expression system in order to obtain a better understanding of the relationship between

TFAM expression and stem cell survival.

Objective 4: To compare mitochondrial turnover (mitophagy) following exposure to

mitochondrial toxins and during the differentiation of hESCs.

Mitochondrial turnover is essential for maintaining optimal cellular function within the

human body. Several diseases have been identified that result from the improper turnover

of mitochondria. LC3 initially forms a complex that resembles a pre-autophagosomal

structure, serving as a nucleation site on damaged mitochondria that sends an ―eat-me‖

signal. The pre-autophagosomal structure eventually forms a cup-shaped isolation

membrane that sequesters and delivers damaged mitochondria to autophagosomes (i.e.

mitophagosomes) and then to autolysosomes. In this study, we investigated the mitophagic

process during differentiation and after exposure to agents that interfere with mitochondrial

function. Firstly, we established the GFP-LC3 system as a means to quantitatively measure

mitophagy. Next, the system was used to understand the dynamics of mitophagy during

differentiation of hESCs or when cells were challenged with toxins that affect mitochondrial

function. Furthermore, various mitochondrial toxins were used to study mitophagy during

stem cell differentiation.

23

Chapter 2: Reivew of Literature

2.1 Human Pluripotent Stem Cells

Stem cells are endowed with a unique capacity for self-renewal (Weissman 2000). In

mammalian development, fertilized oocytes are able to differentiate into all types of cells and

are thus classified as totipotent. ‗Totipotent‘ is derived from the Latin totus, which means

‗entire‘. A totipotent stem cell has the ability to generate all cell types found in the embryo

and in extra-embryonic tissues. Fertilized oocytes divide and progress into 8-cell embryos

and then blastocysts. Blastocysts are composed of an outer layer of cells, called

trophoblasts, and inner cells, which form the inner cell mass (ICM). The ICM can develop

into all cell types of the adult body and is therefore called ‗pluripotent‘, a term derived from

the Latin plures, meaning ‗several‘ or ‗many‘. Pluripotent stem cells, such as mouse

embryonic stem cells (mESCs), human embryonic stem cells (hESCs), and induced

pluripotent stem cells (iPSCs), can differentiate into ectoderm, mesoderm, endoderm, and

germ cells (Lemoli, Bertolini et al. 2005).

Once blastocyst-derived cells have fully differentiated into tissues or organs, stem

cells that reside in various tissues and organs remain in order to generate new tissue or

repair damaged tissue. These stem cells, known as multipotent stem cells or adult stem

cells (ASCs), include mesenchymal stem (or stromal) cells (MSCs) and hematopoietic stem

cells (HSCs). Their differentiation ability is limited compared to that of totipotent and

pluripotent cells. For example, hematopoietic stem cells, which are found in bone marrow,

can differentiate into erythrocytes and white blood cells (including macrophages). These

types of cells are important for homeostasis because they enable the steady self-renewal of

tissue.

24

There are different types of pluripotent stem cells: embryonic stem cells (ESCs),

induced pluripotent stem cells (iPSCs), embryonic germ cells (EGCs), and embryonic

carcinoma cells (ECCs). ESCs are isolated from the ICM of the blastocyst (Figure 2.1)

(Thomson, Itskovitz-Eldor 1998), whereas iPSCs are artificially generated by

reprogramming somatic cells using a defined set of transcription factors. iPSCs are similar

to hESCs in morphology, gene expression, and differentiation ability (Chen, Gulbranson et

al. 2011). Human embryonic germ cells (hEGCs) are derived from the primordial germ cells

(PGCs) and are pluripotent stem cells (Thomson and Odorico 2000). Embryonic carcinoma

cells (ECCs) are stem cells derived from teratocarcinomas, which are tumors that arise from

embryonic tissues such as those from the testis or ovary, or from cultures of explanted cells

(Przyborski, Christie et al. 2004). ECCs are considered the malignant counterparts of

hESCs.

2.2 Embryonic Stem Cells (ESCs) and induced pluripotent stem cells (iPSCs)

Evans and Kaufman (1981) were the first to derive ESCs from an early mouse

embryo (Evans and Kaufman 1981). In 1998, Thomson and colleagues reported the first

successful derivation of hESC lines (Norman, Fischer et al. 2010); these lines are still

widely used. They are capable of proliferating extensively in their undifferentiated state in

vitro and have the ability to differentiate into all three germ layers (Shamblott, Axelman et al.

1998, Thomson and Odorico 2000). The embryo-derived hESCs were established from

blastocysts discarded during in vitro fertilization (IVF) procedures.

iPSCs are an artificially generated type of pluripotent stem cell. iPSCs are

reprogrammed from adult somatic cells to acquire stem cell-like properties through the

forced expression of a combination of transcription factors, such as Oct4, Sox2, Nanog,

25

c-myc, KLF4, and Lin28. Takahashi and Yamanaka introduced four pluripotent genes-Oct4,

Sox2, c-myc, and Kruppel-like family transcription factor 4 (Klf4)—that could reprogram

mouse fibroblasts into mouse-induced pluripotent stem cells (miESCs) or human fibroblasts

into human-induced pluripotent stem cells (hiPSCs) (Takahashi and Yamanaka 2006).

Thomson and colleagues used Oct4 and Sox2 in combination with Nanog and Lin-28

homolog (Lin28), instead of c-myc and Klf4, to reprogram human fibroblasts into hiPSCs

(Yu, Vodyanik et al. 2007). These iPSCs express stem cell markers and can differentiate

into three germ layers in a teratoma in vivo.

iPSCs have the advantage that they do not require the destruction of an embryo.

Moreover, given their origin, they provide a perfect match to the cell donor (are fully

isogenic) and thus would likely avoid rejection by the donor‘s immune system.

Figure 2.1 hESC isolation and culture procedures. hESCs are derived from the inner cell

mass of the blastocyst (left). For long-term culture, hESCs are grown on inactivated mouse

embryonic fibroblasts used as a feeder layer (Hoffman and Carpenter 2005).

26

2.3 Characterization of Undifferentiated hESCs

Undifferentiated hESCs express high levels of cell surface antigens that can be used

as stem cell-specific pluripotency markers. These antigens include: (1) glycolipids, such as

the stage-specific embryonic antigens SSEA-3 and SSEA-4 (Kannagi, Cochran et al. 1983);

(2) glycoproteins, such as TRA-1-60 and TRA-1-81 (Badcock, Pigott et al. 1999); and (3)

alkaline phosphatase (Thomson, Itskovitz-Eldor et al. 1998, Reubinoff, Pera et al. 2000,

Henderson, Draper et al. 2002). Pluripotency markers include the transcription factors

Octamer-4, POU domain, class 5, transcription factor 1 (OCT4 or POU5F1) (Goto, Adjaye

et al. 1999, Hansis, grifo et al. 2000, Mitsui, Tokuzawa et al. 2003, Sperger, Chen et al.

2003, Hart, hartley et al. 2004, Zangrossi, Marabese et al. 2007);sex-determining region

Y-box 2 (SOX2) (Avilion, Nicolis et al. 2003); and Nanog homeobox (NANOG) (Ivanova,

Dimos et al. 2002, Pan and Thomson 2007).These molecular markers provide a means of

identifying pluripotent stem cells, and a decrease in their expression can be used to monitor

the onset of differentiation. The molecular mechanisms underlying the self-renewal of

hESCs have not been fully elucidated.

2.4 Gene Expression Analysis of hESCs

Investigating gene expression in various stem cell lines could give important insights

into how stem cells control pluripotency and differentiation. A number of studies have

measured hESC gene expression to investigate related molecular mechanisms and have

reported differential gene expression in different hESC lines. Rao and Stic (2004) reported

a 75% similarity in the microarray profiles of two lines; in a another study, 48% of the

expressed genes were restricted to one or two lines (Abeyta, Clark et al. 2004). However,

variations in gene expression have been observed in hESC lines derived within the same

laboratory (Ginis, Luo et al. 2004) and even in the same hESC lines (38%) after three

27

passages in different media (Rao, Calhoun et al. 2004). Gene expression also changes

during spontaneous differentiation (Aghajanova, Skottman et al. 2006). For example, the

expression of leukemia inhibitory factor (LIF) and its receptors is low in undifferentiated

hESCs, but increases during differentiation. Differential DNA methylation of

pluripotency-associated promoters such as NANOG and OCT4/POU5F1 has been

observed in pluripotent and differentiated cells. Understanding gene expression in hESCs

will help shed light on the molecular basis of normal differentiation and the abnormal

processes that underlie human developmental disorders.

Several external signals that maintain stem cell pluripotency have been

characterized. External signals are also thought to play important roles in the regulation of

ESC self-renewal and differentiation. For example, the pluripotency of hESCs is maintained

by several signaling pathways (Ohtsuka and Dalton 2008):

The Fibroblast Growth Factor (FGF) Signaling Pathway

Exogenous bFGF is an essential factor in a defined hESC culture medium used for

the maintenance of undifferentiated hESCs and hiPSCs in vitro. Withdrawal of bFGF

induces the downregulation of pluripotency markers and the differentiation of hESCs.

This suggests that FGF signaling plays an important role in self-renewal and

pluripotency regulation in human ES cells and iPSCs (Xu, Peck et al. 2005, Eisenberg,

Knauer et al. 2009).

The Transforming Growth Factor-β (TGF-β)/Activin/Nodal-SMAD2/3 Signaling Pathway

The TGF-β/Activin/Nodal branch is highly active in undifferentiated hESCs. The

pathway supports the self-renewal of undifferentiated hESCs by activating SMAD2/3

and inducing the expression of the pluripotency markers Oct4 and Nanog (James,

28

Levine et al. 2005, Vallier, Alexander et al. 2005). The TGF-β/Activin/Nodal-SMAD2/3

signaling pathway is important in maintaining the self-renewal and pluripotency of

hESCs (Valdimarsdottir and mummery 2005).

The Phosphoinositide-3-Kinase (PI3K) Signaling Pathway

The PI3K protein is highly expressed in undifferentiated cells and is downregulated

in differentiated ESCs (Di Cristofano, Pesce et al. 1998, Takahashi, Murakami et al. 2005,

Armstrong, Hughes et al. 2006). Blocking the PI3K signaling pathway with the PI3K

inhibitor LY294002 results in the loss of pluripotency markers and initiates cellular

differentiation (Paling, Wheadon et al. 2004). In addition, activation of the PI3K signaling

pathway induces the PI3K-dependent phosphorylation of PKB/Akt and GSK-3α/β proteins.

2.5 Propagation of Undifferentiated hESCs

Initially, hESCs were grown on irradiated mouse feeders or human foreskin

fibroblasts (Inzunza, Gertow et al. 2005). However, exposure to animal-derived culture

constituents is a drawback of the feeder-dependent systems (Sidhu, Walke et al. 2008).

Given that hESCs and hiPSCs are attractive candidates for future human cell

transplantation, it is important to optimize good manufacturing practice (GMP)-compliant

systems for the derivation, scale-up, and banking of cells and their corresponding quality

assurance controls (Unger, Skottman et al. 2008, Ausubel, Lopez et al. 2011). Therefore

feeder-free systems are increasingly used in combination with xeno-free defined culture

medium and GMP-compliant coating substrates specially designed for hESC growth (Yoon,

Chang et al. 2010), including laminin and fibronectin.

29

2.6 Pluripotent Stem Cell Differentiation

In vitro and in vivo, hES and iPS cells can differentiate into cell types from the three

primitive germ layers: ectoderm, mesoderm, and endoderm (Thomson, Itskovitz-Eldor et al.

1998, Reubinoff, Pera et al. 2000, Thomson and Odorico 2000) (Figure 2.2). The

differentiation capacity of these cells is typically tested by assessing their spontaneous

differentiation in cell culture (i.e. in vitro formation of embryonic bodies or EBs). Upon the

removal of growth factor (e.g. bFGF) or feeder layers and/or transfer to suspension

conditions, hESCs undergo spontaneous unguided differentiation into various cells

representative of the different germ layers. In two-dimensional (2D) spontaneously

differentiated hESCs, the different morphologies appeared to be epithelial cells, neural cells

with axons and dendrites, and cells with mesenchymal characteristics (Odorico, Kaufman

et al. 2001). In suspension, the hESCs form multicellular aggregates of differentiated and

undifferentiated cells called embryoid bodies (EBs), which resemble early post-implantation

embryos and frequently progress through a series of differentiation stages (Itskovitz-Eldor,

Schuldiner et al. 2000). Typically, EBs are allowed to grow for several days or weeks, with

samples taken at intervals for analysis via flow cytometry or immunocytochemical staining.

In vitro and in vivo assessments of differentiation involve determining whether the derived

cells have acquired a variety of ectoderm-, mesoderm-, and endoderm-like properties (and

loss of markers for pluripotency). In vivo assessment of pluripotency is performed by

xenografting hESCs and iPSCs into severe combined immune-deficient (SCID) mice and

observing the formation of teratomas with derivatives of all three germ layers, which

indicates that the injected stem cells have the ability to differentiation along three lineages

(Thomson, Itskovitz-Eldor et al. 1998, Reubinoff, Pera et al. 2000).

30

2.7 Directed Differentiation

To direct the differentiation of ESCs towards a particular cell type, such as a neuronal

cell type or a cardiomyocyte cell type, hESCs in monolayer culture are exposed to certain

growth factors or stimuli and extracellular matrix components, either directly or indirectly

through feeder cells (Schuldiner, Yanuka et al. 2000).

Retinoic acid (RA) induces human embryonic stem cells to differentiate into the

ectodermic lineage (Guan, Chang et al. 2001). RA and its receptors play important roles in

the development of the central nervous system by initiating the cellular differentiation of

neuronal precursors (Niederreither and Dolle 2008). Several papers have reported that RA

induces neuronal differentiation in neuroblastoma cell lines (SH-SY5Y human

dopaminergic neuroblastoma cells) (Constantinescu, Constantinescu et al. 2007, Lopes,

Schroder et al. 2010) and human promyelocytic leukemia HL-60 cells (Racanicchi,

Montanucci et al. 2008). Further, RA also induces embryonic stem cells to differentiate into

neuronal cells (Guan, Chang et al. 2001, Parsons, Teng et al. 2011, Liu, Liu et al. 2012),

including neurons and glial cells. In order to improve the efficiency and reproducibility of

neuronal differentiation, several studies have attempted to add small molecules. For

example, Idelson M et al. have demonstrated that nicotinamide promotes the differentiation

of hESCs into neural cells and subsequently into retinal pigment epithelium (RPE) cells

(Idelson, Alper et al. 2009). Moreover, Lu SJ et al. have described a robust system that

efficiently generates large numbers of hemangioblasts from multiple hESC lines and

produces functional homogeneous RBCs with oxygen-carrying capacity on a large scale

(Lu, Feng et al. 2010). The markers of early ectodermdifferentiation are paired box gene 6

(PAX6), SRY (sex determining region Y)-box 1 (SOX1), nesting, and glial fibrillary acidic

31

protein (GFAP). Briggs JA et al. have demonstrated successful neuronal differentiation via

a sophisticated protocol (Briggs, Sun et al. 2013).

Mesoderm differentiation has been extensively studied, particularly the families of

protein growth factors that control the early stages of mesoderm formation in

cardiomyocytes (Mummery, Zhang et al. 2012). Hudson J et al. have used small molecules

to target the wingless/INT (Wnt) signaling pathway in order to induce the differentiation of

hESCs into beating cardiomyocytes (Hudson, Titmarsh et al. 2012). Biomarkers for early

mesoderm-differentiation include T-box factor Brachyury (BRY or T), the homeodomain

protein MIXL1, and myosin (Hudson, Titmarsh et al. 2012).

Endoderm differentiation forms several tissues, including the liver, lung, thyroid, and

foregut endoderm. The families of protein growth factors that control the early stage of

endoderm differentiation into the anterior-ventral domain of the foregut endoderm are

targeted by signaling through Nodal, a member of the transforming growth factor-B (TGF-B)

superfamily and the SMAD signaling pathway (Kim, Yoon et al. 2011). The biomarkers of

early endoderm differentiation are insulin-like growth factor 2 (IGF2) and gata binding factor

(GATA4); SRY (sex determining region Y)-box 17 (SOX17) is also an indicator of the

definitive foregut endoderm (Kanai-Azuma, Kanai et al. 2002, Nakanishi, Kurisaki et al.

2009). Little is known about the expression of mitochondrial biogenesis-related genes

during hESC lineage-specific differentiation.

32

Figure 2.2 Undifferentiated hES cells (A) can give rise to cell types from the three primitive

germ layers: (B) neuronal cells in ectoderm-lineage differentiation, (C) pancreatic cells in

endoderm-lineage differentiation, and (D) cardiomyocytes in mesoderm-lineage

differentiation. This figure is adapted from Hoffman and Carpenter 2005, Wobus and

Boheler 2005).

33

2.8 Mitochondrial Biology: Introduction

The mitochondrion is a dual-membrane organelle which is found in all eukaryotic

cells except erythrocytes and lense tissue. The mitochondrion is composed of the outer

mitochondrial membrane, the intermembrane space (the space between the outer and

inner membranes), the inner mitochondrial membrane, the cristae space (formed by

in-folding of the inner membrane), and the matrix (the space within the inner membrane)

(Figure 2.3).

Figure 2.3 Structure of a mitochondrion. This figure is modified from (Frey and Mannella

2000).

The human mitochondrial genome consists of a 16.5-kb double-stranded circular

DNA molecule that contains both non-coding and coding regions. The largest non-coding

sequence in mammalian mtDNA is the displacement-loop (D-loop), which contains

promoters and origins of replication. The coding regions contain 37 genes, including 2

ribosomal RNA (rRNA) genes, 22 transfer RNA (tRNA) genes, and 13 genes that encode

34

subunits of the respiratory complexes (I, III, IV, and V) (Figure 2.4) (Chan 2006). Alkaline

gradient centrifugation separates mtDNA into a heavy strand (H-strand) and a light strand

(L-strand) based on differential contents of guanosine (G) and cytosine (C). The H-strand

encodes 2 rRNAs, 12 polypeptides, and 14 tRNAs, while the L-strand encodes one

polypeptide (ND6) and 8 tRNAs. The genetic code of mitochondria is similar to the

universal genetic code, with three exceptions: 1) the TGA codon codes for tryptophan in

mtDNA instead of stop in nuclear DNA, 2) AGA and AGG code for stop in mtDNA instead of

arginine in nuclear DNA, and 3) ATA codes for methionine in mtDNA instead of isoleucine

in nuclear DNA (Anderson, Bankier et al. 1981). It is thought that mitochondria originally

derived from endosymbiotic prokaryotes because they share many features. For example,

the circular mitochondrial genome is very similar to the genomes of bacteria (Martin,

Hoffmeister et al. 2001).

35

Figure 2.4 Schematic representation of the human mitochondrial genome. mtDNA is a

double-stranded circular molecule of approximately 16.5 kb, consisting of a heavy (H)

strand and a light (L) strand. mtDNA consists of non-coding and coding regions. The

non-coding D-loop (displacement loop) region contains the origin of heavy strand

replication (OH), and the transcription promoters for both strands (HSP and LSP). The

origin of light strand replication (OL) is found approximately two-thirds of the way around the

genome (at 16024–16569 and 1–576). The coding region encodes 13 protein subunits of

the electron transport chain (ETC), 12 on the heavy strand and 1 on the light strand (ND6),

along with 22 tRNAs and 2 rRNAs that are necessary for mtDNA transcription and protein

synthesis. Proteins encoded by mtDNA, indicated in yellow, include ND1, 2, 3, 4, 4L, 5, and

6 (NADH dehydrogenase; Complex I); CYTB (cytochrome b; Complex III); COX1, 2, and 3

(cytochrome c oxidase; Complex IV); and ATP6 and 8 (ATP synthase; Complex V).

36

Mitochondrial respiratory activity occurs via the electron transport chain (ETC). The

ETC is composed of five complexes: Complex I (NADH dehydrogenase, also called ND),

Complex II (succinate dehydrogenase), Complex III (cytochrome reductase), Complex IV

(cytochrome C oxidase, also called COX), and Complex V (ATP synthase). Energy

obtained from the transfer of electrons through these complexes is used to pump protons

from the mitochondrial matrix into the intermembrane space. The sum of the pH gradient

and the membrane potential (Δψ), which arises from the net movement of positive charge

across the inner membrane, is known as the proton motive force (PMF; ΔP= ΔµH+ + Δψ),

which accumulates across the mitochondrial inner membrane. The proton motive force

allows ATP synthase (Complex V) to transfer protons back into the matrix to generate ATP

from ADP and inorganic phosphate (Pi). As electrons flow through the complexes, they

eventually reach Complex IV, where they are used to generate water from hydrogen ions

and molecular oxygen (Figure 2.5) (Wallace and Fan 2010).

37

Figure 2.5 Stylized representation of the electron transport chain (ETC), the final stage of

cellular respiration, where oxidative phosphorylation (OXPHOS) takes place. The ETC

consists of five protein complexes that contain polypeptides encoded by the nuclear and

mitochondrial genomes (except for Complex II). The flow of electrons through the first four

complexes releases protons (H+) from the mitochondrion and establishes the mitochondrial

membrane potential. The transfer of these protons back into the mitochondrion through

Complex V generates ATP. This figure is modified from (Zeviani and Di Donato 2004).

Abbreviations: CoQ, coenzyme Q; Cyt C, cytochrome C; ANT, adenosine nucleoside

transporter; ADP, adenosine diphosphate; ATP, adenosine triphosphate.

38

2.9 Mitochondria Are Dynamic Organelles

A mitochondrion is not a discrete, autonomous organelle; rather, it is part of a

dynamic network akin to the endoplasmic reticulum. Mitochondria are highly dynamic

organelles that are constantly engaged in fusion and fission in the cell, as demonstrated, for

instance, in mouse embryonic fibroblasts (Chen, Detmer et al. 2003). In dividing cells, the

mass of this mitochondrial network steadily increases throughout the cell cycle; it normally

divides more or less equally between daughter cells. During fusion and fission, the

synthesis of the vast majority of mitochondrial components is required, including lipids and

proteins that are imported into pre-existing organelles, thereby enlarging the structure.

Mitochondria have maintained a fission system in order to split the enlarged organelle mass.

Once a sufficient volume of organelle has been generated and the cell is ready to divide,

the mitochondria segregate between the cells of the next generation. The relative rates of

fusion and fission determine the morphology of the mitochondrial network at any given

time.

Multiple proteins are involved in mitochondrial fusion and fission. Several important

players are involved in the mitochondrial fusion mechanism in mammalian cells, such as

mitofusin 1 (MFN1), mitofusin 2 (MFN2), and optic atrophy 1 (OPA1) (Westermann 2010).

These three proteins are large GTPases that localize to different sites in mitochondria

(Detmer and Chan 2007, Liesa, Palacin et al. 2009). MFN1 and MFN2 insert into the outer

membrane and form homo- and hetero-oligomers; OPA1 is found at the intermembrane

space partially anchored to the inner membrane (liesa, Palacin et al. 2009, Westermann

2010). The presence of mitofusins on adjacent mitochondria is required during fusion

because they form complexes in-trans that tether the mitochondria together (Meeusen,

McCaffery et al. 2004). Inhibition of mitofusins results in mitochondrial fragmentation and

39

poor mitochondrial function (Chen, Detmer et al. 2003, Rakovic, Grunewald et al. 2011).

Inhibition of OPA1 leads to mitochondrial fragmentation and severe aberrations in the

structure of the cristae owing to a loss of mitochondrial fusion (Olichon, Baricault et al. 2003,

Griparic, van der Wel et al. 2004, Chen and Chan 2005). However, the specific functions of

these proteins in membrane fusion remain to be determined (Youle and Karbowski 2005).

In vitro, mitochondrial fusion of both the outer and inner membranes requires GTP

hydrolysis; the mitochondrial membrane potential is also required for inner membrane

fusion (Meeusen, McCaffery et al. 2004).

In mammalian cells, mitochondrial fission is regulated by fission 1 (mitochondrial

outer membrane) homologue (FIS1) and dynamin-related protein 1 (DRP1). FIS1 is

localized uniformly on the mitochondrial outer membrane. During mitochondrial fission,

DRP1 is recruited from the cytosol to the outer membrane. The majority of DRP1 is located

in the cytosol, but a subpool is localized to punctate spots on microtubules. A subset of

these puncta mark future sites of fission (Smirnova, Griparic et al. 2001, Youle and

Karbowski 2005), and DRP1 plays a role in membrane constriction during fission. Inhibition

of FIS1 and DRP1 inhibits fission, resulting in the elongation of mitochondrial tubules

(Zeviani and Di Donato 2004). However, inhibition of FIS1 does not disrupt the mitochondrial

localization of DRP1 (Zeviani and Di Donato 2004). DRP1 plays a role in membrane

constriction during mitochondrial fission. However, the precise mechanism of fission

remains to be determined.

Mitochondrial fission and fusion events are important processes not only in the

normal functioning of the cell but also in pathophysiological situations in different cells and

tissues (Table 2.1). For example, mitochondrial fission mediated by DRP1 is a necessary

step for cell death in apoptosis (Frank, Gaume et al. 2001).

40

Table 2.1 Diseases associated with perturbations in the mitochondrial fusion/fission

machinery. This table is modified from (Detmer and Chan 2007). Abbreviations: CMT2A,

Charcot-Marie-Tooth type 2A; MFN2, mitofusin-2; OPA1, optic atropohy-1; DRP1,

dynamin-related protein-1.

Diseases Mitochondrial

function Gene Description

CMT2A Fusion MFN2 Autosomal dominant peripheral neuropathy

ADOA Fusion OPA1 Autosomal dominant optic atrophy (ADOA)

Unnamed Fission DRP1 Neonatal lethality

2.10 Mitochondrial Defects

Mitochondrial diseases often result from mtDNA mutations and represent common

inherited conditions. One of every 7,634 newborns is affected by mitochondrial dysfunction

(Debray, Lambert et al. 2007). Mitochondrial diseases are a heterogeneous group of

disorders in which mitochondrial dysfunction can affect tissues with varying severity. The

effects are often more prominent in neurons of the brain and in skeletal muscles, which

require more energy than other tissues.

Within mtDNA, several types of mutations have been identified, including 1) point

mutations, 2) large-scale rearrangements, and 3) depletion of mtDNA resulting from a

reduction in the mtDNA copy number (Zeviani and Antozzi 1997, Zeviani and Di Donato

2004). Depletion of mtDNA is an autosomal recessive trait that can cause severe illnesses,

such as neurodegenerative disorders (Zeviani and Antozzi 1997, Zeviani and Di Donato

41

2004, St John and Lovell-Badge 2007). Profound reductions in mtDNA are responsible for

a series of syndromes that are collectively referred to as mtDNA-depletion syndromes

(Deodato F 2009). Patients with these syndromes present with myopathy,

encephalomyopathy, and mitochondrial neurogastrointestinal encephalomyopathy

syndromes (Deodato F 2009). Pathologies associated with these syndromes vary widely

and can manifest in utero or later in life. To study the consequences of mtDNA dysfunction,

animal and cellular models with mitochondrial mutations, deletions, or depletion have been

generated.

2.11 Mitochondrial Dysfunction in Animal and Cellular Models

The symptoms of mitochondrial dysfunction caused by mutations or deletions in the

mitochondrial genome or by mitochondrial depletion can be observed in whole animals and

cellular models. Several studies have described mice with abnormal mitochondria resulting

from mutations or deletions in the mitochondrial genome. These mutations cause

conditions that phenocopy Pearson and Kearns-Sayre syndromes (Wallace 1999, Inoue,

Nakada et al. 2000). The mice exhibit numerous symptoms indicative of mitochondrial

dysfunction, with clinical phenotypes associated with human diseases (Inoue, Nakada et al.

2000, Sligh, Levy et al. 2000), including: (1) abnormalities of the optic nerve in the retina, (2)

decreases in cytochrome c-oxidase (COX) activity, (3) ragged-red fibers in muscle, (4) a

high lactic acid concentration, and (5) death from kidney failure (acidosis). Furthermore, the

progeny of the mice exhibit several features: (1) inherited mtDNA mutations, homoplasmic

or heteroplasmic, (2) a severely affected survival rate, with many dying in utero or in the

first few days after birth, (3) growth retardation, (4) abnormal mitochondrial morphology in

skeletal and cardiac muscle, and (5) progressive myopathy, myofibril disruption and loss,

42

and dilated cardiomyopathy. Tissues derived from normal hESCs or tissues repaired using

a gene therapy approach carry normal mtDNA. Inducing hESCs with normal mtDNA to

differentiate into specific cell types might help in the treatment of mitochondrial dysfunction

generated by mutations, deletions, and depletion of the mitochondrial genome. Therefore,

hESCs could be a useful model for understanding the etiology of mitochondrial-related

diseases.

To demonstrate the importance of mitochondrial morphology and function in

cell-specific functions, mitochondria-depleted cells called rho-zero cells (ρ˚), which are

depleted of mtDNA, were generated in vitro through the application of different drugs, such

as ethidium bromide, antibiotics, or the nucleoside analogue reverse transcriptase inhibitor

(NARTI, an anti-HIV drug). ρ˚ cells exhibit several common features: (1) they become

autotrophic, relying on pyrimidine (uridine) and pyruvate supplementation for cell growth

(Armand, Channon et al. 2004, Miceli and Jazwinski 2005); (2) they have a low mtDNA

copy number and low expression of mitochondrial-encoded genes, but not of

nuclear-encoded genes; (3) they have low mitochondrial respiratory chain complex

activities, with the exception of complex II; (4) they have low ATP concentrations,

respiration rates (oxygen consumption), and mitochondrial membrane potential; (5) they

shift from aerobic to anaerobic metabolism if given supplemental pyruvate; and (6) they

have an immature mitochondrial structure with reduced numbers of cristae membranes,

circular morphology, and loss of tubular structure.

Upon a reduction in oxygen consumption, several studies have found that

antioxidants can reverse the increased ROS production in ρ˚ cells. In addition, ρ˚ cells have

decreased levels of cell proliferation, mitotic cyclin gene expression, cyclin-dependent

kinase inhibitors, retinoblastoma 1 phosphorylation, and telomerase activity (Park, Choi et

43

al. 2004, Schroeder, Gremmel et al. 2008). In ρ˚ cells, upregulation of mitochondrial

biogenesis-related genes, relative to expression in control cells, has been observed

(Miranda, Foncea et al. 1999, Joseph, Rungi et al. 2004).

Interestingly, it has been suggested that ρ˚ cells have increased resistance to

apoptosis. However, they exhibit a normal distribution of cytochrome c within mitochondria

during staurosporine-induced apoptosis (in spite of low mtDNA levels and respiratory

function deficiencies). Consistently, caspase 3 activation and DNA fragmentation are not

affected in ρ˚ cells. However, the localization of NF-κB is altered (i.e. more NF-κB in the

nucleus than in the cytoplasm), which might be related to the observed resistance to

apoptosis. Moreover, in ρ˚ cells, a greater amount of mass is associated with lysosome and

peroxidation production (King and Attardi 1989, Appleby, Porteous et al. 1999, Miranda,

Foncea et al. 1999). Remarkably, the differentiation of SH-SY5Y neuroblastoma cells into

neuron-like cells is not affected by defective mitochondria, as indicated by the presence of

long neurites and secretory granules, which are typical of differentiating neuroblastoma

cells (Miller, Trimmer et al. 1996).

2.12 Assessing mtDNA Integrity, Copy Number, and Mitochondrial Biogenesis

Mitochondria have their own protein-coding DNA but also import a large number of

nuclear-encoded proteins. Therefore, mitochondrial biogenesis requires precise

coordination between the nuclear and mitochondrial genomes. Because of the complex

and dynamic nature of mitochondria, the analysis of mitochondrial biogenesis within a

population of cells is difficult and requires measurements of multiple parameters, such as:

(1) the volume and number of mitochondria via microscopy, (2) mtDNA copy number, (3)

44

levels of mtDNA-encoded transcripts, (4) levels of mitochondrial biogenesis-related

transcription factors (e.g. TFAM, NRF1, POLG, and PGC1α) via qPCR, (5) levels of

biogenesis molecular markers via western blotting, and 6) mitochondrial rates of translation

by in vivo labeling (Medeiros 2008). Details of these techniques are provided below.

First, mitochondrial morphology can be visualized and measured by fixing,

dehydrating, sectioning, and staining cells and tissue sections for analysis with

transmission electron microscopy (TEM). The method is time-consuming, but generates

reliable, quantitative data. TEM analysis also requires expensive equipment and the

assistance of an experienced TEM operator.

Second, mitochondrial mass can be visualized and measured using fluorescent dyes.

Analysis of stained samples using microscopy or flow cytometry yields quantitative results.

Several fluorescent dyes are available for measuring the mitochondrial mass or Δψ

(mitochondrial potential). Mitochondrial mass is typically measured using MitoTracker

(Molecular Probes, Invitrogen) or 10-n-nonyl-acridine orange. The latter binds cardiolipin,

which is predominantly found in the inner mitochondrial membrane.

Third, common PCR and qPCR techniques can be used to assess the levels of

mtDNA, mtDNA-encoded transcripts, and mitogenesis-associated transcription factors (e.g.

TFAM, NRF1, and PGC1α). Because mitochondria have their own genomes, the amount of

mtDNA is roughly proportional to the number of mitochondria, although each mitochondrion

has multiple copies of mtDNA. mtDNA has traditionally been quantified using Southern blot

analysis (Tang, Halberg et al. 2012), but the use of qPCR techniques is becoming more

common. qPCR methods typically compare levels of mtDNA and nuclear DNA to determine

the mtDNA copy number (i.e. the number of mitochondrial genomes per cell) (Hoschele,

Wiertz et al. 2008). The measurements typically use a variety of primer sets, such as those

45

for NADH dehydrogenase subunit I (ND1), along with primers specific for nuclear-encoded

housekeeping genes, which are used for normalization purposes. In addition, the D-loop is

critical for the replication and transcription of mtDNA (Takamatsu, Umeda et al. 2002).

Expression of D-loop elements can be used to determine the mtDNA copy number.

However, when quantifying levels of mtDNA, it is important to use target sequences that

are not commonly deleted in disease or by aging.

The quality of mtDNA is typically determined via DNA sequencing or microarray

analysis (Maitra, Cohen et al. 2004) (Table 2.2). These techniques are expensive and must

be repeated multiple times because of the heteroplasmy of mtDNA. mtDNA sequencing

can be used to detect polymorphic sites and to determine maternal relationships between

individuals. Molecular techniques such as these have led to the creation of the Human

Mitochondrial Genome Database (MtDB), which contains many human mtDNA sequences,

a list of known mutation hotspots, and a catalogue of polymorphic sites (Ingman and

Gyllensten 2006).

Fourth, antibodies directed against proteins encoded by the mitochondrial genome

or proteins critical for mitogenesis (e.g. TFAM, NRF1, POLG, and PPARGC1A) can be

used (Williams, Scholte et al. 2001). Many of these antibodies are commercially available

(Invitrogen, Sigma-Aldrich, MitoSciences, and Santa Cruz Biotechnology). Mitochondria

can be measured by assessing complex (I, II, IV, and V) activities, fission/fusion rates, and

oxygen consumption. GFP, targeted by a leading signaling peptide to mitochondria, is used

to measure fission/fusion rates. During oxidative phosphorylation, the transfer of electrons

to oxygen and the oxidation of substrates is used to generate ATP. Thus, oxygen

consumption can be one of the most informative and direct measures of mitochondrial

function.

46

Table 2.2 Methods for the analysis of mtDNA mutations or mtDNA copy number

Method for the analysis of mtDNA

mutations Sample type Reference

Oligonucleotide array Total DNA (Maitra, Cohen et al. 2004,

Maitra, Arking et al. 2005)

Sequence analysis of PCR-amplified

products Total DNA

(Polyak, Li et al. 1998, Fliss,

Usadel et al. 2000, Maitra,

Cohen et al. 2004)

qPCR (mitochondrial-encoded gene,

ND1, COX2) cDNA

(Cunningham, Rodgers et al.

2007)

qPCR (mitochondrial-encoded genes and

non-coding region, D-loop) Total DNA

(Kanki, Ohgaki et al. 2004, St

John, Amaral et al. 2006,

Amaral, Ramalhoo-Santos et

al. 2007, Armstrong, Tilgner

et al. 2010)

PCR (ND4, CYTB, and COXI) and

western blot (COXI and COXII)

cDNA and

proteins (Jeng, Yeh et al. 2008)

Southern and northern blot

(mitochondrial-encoded genes)

Total DNA

and total RNA

(Larsson, Oldfors et al. 1994,

Garstka, Schmitt et al. 2003,

Ekstrand, Falkenberg et al.

2004, Maniura-Weber,

Goffart et al. 2004,

Pohjoismaki, Wanrooij et al.

2006).

Southern blot (Alpha-32P-dCTP labeled

random primed probes generated against

a 16-kb mtDNA template)

Total DNA (Rebelo, Williams et al. 2009

47

2.13 Mitochondrial Biogenesis: Introduction

Mitochondrial biogenesis to generate new mitochondria involves all cellular

processes. There are several transcription factor regulators of mitochondrial biogenesis.

During adaptation to changing environmental situations, inputs from all cellular processes

promote mitochondrial biogenesis, including the synthesis, import, and assembly of

essential mitochondrial components, as well as the replication of mtDNA (Hock and Kralli

2009).

2.14 Mitochondrial DNA Replication

Mitochondrial DNA is replicated and transcribed within mitochondria. In these

semi-autonomous organelles, mtDNA replication takes place independently from the cell

cycle and from nuclear DNA replication. Transcription factors involved in mtDNA biogenesis,

encoded by nuclear DNA, regulate mtDNA replication and mtDNA transcription (Moraes

2001).

The process of DNA replication differs in mitochondria and the nucleus. Replication

of mtDNA depends on nuclear DNA-encoded regulatory proteins, particularly

mtDNA-specific polymerase gamma (POLG). POLG consists of two subunits: the catalytic

subunit, responsible for elongation of the daughter DNA strands, and the accessory subunit,

responsible for primer recognition and proofreading activity (Gray and Wong 1992).

Synthesis starts at one of the multiple origins of replication of the heavy strand (OH) in the

D-loop region using a short RNA primer, which is complementary to the light strand DNA

(Xu and Clayton 1995). The leader sequence is then removed from the remainder of the

light strand transcript by the mitochondrial RNA processing endoribonuclease (RNase MRP)

(Figure 2.6) (Shadel and Clayton 1997), allowing it to form a triple-stranded RNA-DNA

48

hybrid. mtDNA synthesis continues until it reaches the origin of replication of the light strand

(OL), which is situated approximately 10 kbp downstream of the OH. At this time, synthesis

of the light strand starts (Garesse and Vallejo 2001). mtDNA replication is carried out by

POLG, which has 3′–5‘ exonuclease and 5′-deoxyribose phosphate lyase activities,

assisted by the helicase TWINKLE, which unwinds the DNA duplex, and by single-strand

binding proteins (mtSSB), which maintain the DNA in a single strand (Moraes 2001,

Falkenberg, Larsson et al. 2007).

Figure 2.6. Schedmatic of mitochondrial replication. The H-strand and L-strand are

depicted with bold and thin black lines, respectively. Firstly, TFAM (yellow box), TFBM

(green box), and mtRNA polymerase (light blue box) bind to the L-strand promoter to

produce an RNA transcript (red arrow). Secondly, the RNA transcript extends across the

conserved sequence blocks (CSBs) and forms an RNA/DNA hybrid (dashed lines) in a

stable loop configuration. This loop configuration subsequently generates RNA primers

(green arrow). The RNase MRP (dark blue circle) then cleaves the RNA primers from the

loop structure. Lastly, the RNA primer (thin line attached to the circle) and DNA polymerase

49

initiate heavy-strand (OH) DNA replication (heavy arrows with attached circle). This figure

was modified from (Shadel and Clayton 1997).

Two types of mtDNA replication models have been proposed: the asynchronous

strand displacement model (Clayton 1982) and the strand-coupled bidirectional replication

model (Holt, Lorimer et al. 2000). In the asynchronous strand displacement

model,replication of mtDNA is unidirectional and asynchronous, with initiation of replication

at two replication origins (OH and OL) (Clayton 1982, Brown, Cecconi et al. 2005).

Transcription starts from a light-strand promoter (LSP), which forms an R-loop, a triplex

structure containing the transcript RNA. The RNA serves as a primer for the initiation of

H-strand synthesis from the replication origin of H-strand, OH, in the D-loop region. The

D-loop is a DNA triplex structure composed of a displacement loop and a stretch of DNA.

Many of the DNA synthesis events prematurely terminate at about 700 bases, resulting in

the formation of a D-loop structure. This 700-base nascent H-strand is termed 7S DNA or

the D-loop strand. If H-strand synthesis does not terminate prematurely, DNA synthesis

undergoes a complete replication cycle. Displacement of the parental H-strand as

single-stranded DNA continues until synthesis reaches the replication origin of L-strand, OL,

located approximately two-thirds of the genome downstream from OH. Once exposed on a

single-stranded H-strand, the OL region assumes a special stem-loop structure, which

initiates the synthesis of an RNA primer for L-strand DNA synthesis (Clayton 1992, Schmitt

and Clayton 1993, Shadel and Clayton 1997, Kang and Hamasaki 2006, Krishnan, Reeve

et al. 2008). The two new DNA molecules are ligated to form the circular double-stranded

mtDNA. Because the lagging L-strand synthesis is delayed, replication proceeds

asymmetrically. This unique property of mtDNA replication has not been observed with

either mammalian nuclear DNA or bacterial DNA.

50

The second model, proposed by Holt and Jacobs, is a bidirectional replication model

of mtDNA replication in which replication initiates at one replication zone and proceeds

symmetrically in both directions. The model is based on the observation of replication

intermediates in 2D gels (Holt, Lorimer et al. 2000, Yang, bowmaker et al. 2002, Bowmaker,

Yang et al. 2003, Krishnan, Reeve et al. 2008). Both mtDNA strands replicate at the same

time from the same replication origin in the D-loop; this might be an alternative replication

mechanism, with the choice of mechanism determined by variations in transcription factor

binding or in the number of dNTPs present within mitochondria in different cell types. In the

studies describing strand-coupled bidirectional replication, no replication intermediates

harboring long single-stranded DNA, indicative of asymmetric replication, were found. In

contrast, Y-fork intermediates, typical of nuclear DNA replication, were observed. On the

basis of these observations, it was concluded that lagging strand synthesis must occur

simultaneously and symmetrically with eading strand synthesis, as is generally seen in

DNA replication. Because mitochondria contain a large amount of RNA, Holt and Jacobs

proposed that the long single-stranded ‗intermediates‘ observed by Clayton and Shadel

(Shadel and Clayton 1997) were due to degradation of mitochondrial RNA during mtDNA

preparation (Yang, Bowmaker et al. 2002). In addition, they proposed that H-strand

synthesis initiated from a broad 5-kb region located downstream of the D-loop region and

not from OH (Bowmaker, Yang et al. 2003, Yasukawa, Yang et al. 2005, Kang and

Hamasaki 2006, Falkenberg, Larsson et al. 2007).

The exact contributions of the two mechanisms of mtDNA replication remain to be

determined. The balance between the two replication mechanisms is thought to influence

the mtDNA copy number under several physiological and developmental conditions (Holt,

Lorimer et al. 2000). The asynchronous mechanism of mtDNA replication occurs in growing

51

cells with a lower mtDNA synthesis rate that maintain a stable mtDNA copy number for the

daughter cells. In cells in which the mtDNA copy number is increasing, the bidirectional

replication mechanism is predominantly observed. The bidirectional replication mechanism

is also more common in cells transiently depleted of mtDNA (Holt, Lorimer et al. 2000,

Moraes 2001). These findings suggest that the first model is responsible for the

maintenance of mtDNA and the second model is used primarily when mtDNA amplification

is required (Holt, Lorimer et al. 2000).

2.15 Mitochondrial Transcription

The transcription of mtDNA depends upon factors encoded within the nucleus.

These include mitochondrial transcription factor A and B (TFAM, TFB1M and TFB2M),

nuclear respiratory factors 1 and 2 (NRF1 and NRF2), and members of the peroxisome

proliferator-activated receptor gamma coactivator 1 family of regulated coactivators

(including PGC1α and PGC1β) (Scarpulla 2008).

A number of factors regulate mitochondrial biogenesis. For example, DNA

polymerase gamma (POLG) is the catalytic subunit of the mtDNA polymerase and is

responsible for mtDNA replication (Graziewicz, Longley et al. 2006). Mitochondrial

transcription factors (e.g. TFAM, TFB1M, and TFB2M) localize to mitochondria, bind

mtDNA, and stimulate the transcription of mtDNA (Kelly and Scarpulla 2004, Gleyzer,

Vercauteren et al. 2005). TFAM, TFB1M, and TFB2M are induced in response to signals

that promote mitochondrial biogenesis (Figure 2.7) (Scarpulla 2008, Hock and Kralli 2009).

TFAM is a key activator of mtDNA transcription during mitochondrial genome replication.

TFAM binds the two major promoters in the mitochondrial genome: the light-strand and

52

heavy-strand promoters (Larsson, Wang et al. 1998, garstka, Schmitt et al. 2003). There

are other regulators of nuclear-encoded transcription factors, such as nuclear respiratory

factors (NRF1 and NRF2). NRF1 and NRF2 (also known as GA-binding protein, GABP) are

transcription factors that act within the nucleus to regulate genes that encode components

of the mitochondrial respiratory system and many genes involved in the replication of

mtDNA (Evans and Scarpulla 1990, Virbasius, Virbasius et al. 1993). PGC1α also affects

mitochondrial biogenesis by regulating the expression of numerous transcription factors

(e.g. the NRFs) that are involved in the transcription and replication of mtDNA (Puigserver,

Rhee et al. 2003).

By examining the regulatory network that controls mitochondrial function and

biogenesis, many relevant transcription factors, coactivators, and signaling pathways have

been identified. As one would expect, perturbation of the mitochondrial biogenesis

machinery dramatically affects cellular physiology and development. Studies have provided

important insights into the dynamic and coordinated control of nuclear and mitochondrial

genes during development (Table 2.3) (Scarpulla 2008). For example, knockout of NRF1 in

mice results in mtDNA depletion, loss of Δψ, and blastocyst growth defects, resulting in

embryonic lethality between E3.5 and E6.5 (Huo and Scarpulla 2001). Knockout of the

catalytic subunit of POLG in mice results in mtDNA depletion, cytochrome oxidase

deficiency, and embryonic lethality between E7.5 and E8.5 (Hance, Ekstrand et al. 2005).

Knockout of TFAM in mice results in mtDNA depletion and severe respiratory chain

deficiency, with embryonic lethality between E8.5 and E11.5 (Larsson, Wang et al. 1998).

A variety of therapeutic interventions (e.g. dietary supplements, exercise therapy,

and chemicals) have been used to induce mitochondrial biogenesis. For example,

resveratrol induces mitochondrial biogenesis and improves aerobic capacity in mice

53

through histone modifications and activation of PGC1α (Lagouge, Argmann et al. 2006).

Moreover, upregulation of the expression of PGC1 family members stimulates

mitochondrial oxidative phosphorylation (OXPHOS). Caffeine and

5-aminoimidazole-4-carboxamide-1-β-D-ribofuranoside (AICAR) enhance PGC1α

expression in the skeletal muscles of rodents in vivo (Irrcher, Ljubicic et al. 2009, McConell,

Ng et al. 2010). Benzafibrate is also a known activator of the PPAR/PGC1α pathway. When

added to cell lines with defective mitochondria, it improves several indicators of

mitochondrial function (e.g. the activity of some mitochondrial enzymes and the levels of

mitochondrial proteins) (Bastin, Aubey et al. 2008).

Figure 2.7 Transcriptional activation from the D-loop promoter region of mtDNA. The

transcription complex is composed of TFAM, TFB (comprising TFB1M and TFB2M), and

mitochondrial RNA polymerase (POLRMT). TFAM unwinds the DNA and forms a complex

with TFB and POLRMT. Together, they initiate transcription from the bidirectional

promoters present within the D-loop (Scarpulla 2008).

54

Table 2.3 Mouse gene knockouts of nuclear-encoded regulators of transcription that have

been implicated in mitochondrial biogenesis (Scarpulla 2008).

Gene

knockout Viability Mitochondrial phenotype Reference

TFAM

(germ line)

Embryonic lethal

between E8.5 and

E11.5

mtDNA depletion, severe

respiratory chain deficiency

(Larsson,

Wang et al.

1998).

Catalytic

subunit of

POLG

Embryonic lethal

between E7.5 and E8.5

mtDNA depletion, cytochrome

oxidase deficiency

(Hance,

Ekstrand et al.

2005)

NRF-1 Embryonic lethal

between E3.5 and E6.5

mtDNA depletion, loss of Δψ,

blastocyst growth defect

(Huo and

Scarpulla

2001)

NRF-2

(GABP) Pre-implantation lethal Not determined

(Ristevski,

O'Leary et al.

2004)

2.16 Mitochondrial Transcription Factor A (TFAM)

Several transcription factors play important roles in mitochondrial biogenesis. One of

them is TFAM, which controls the mtDNA copy number (Ekstrand, Falkenberg et al. 2004)

and stimulates mtDNA transcription in vitro and in vivo (Maniura-Weber, Goffart et al. 2004).

TFAM (also known as mitochondrial transcription factor 1, mtTFA, mtTF1, TCF6, and

TCF6L2) was initially characterized as a monomeric 25-kDa protein comprising a signal

peptide (mitochondrial leading peptide, MLP) and two high-mobility group (HMG) motifs,

which share strong similarities across species (Figure 2.8) (Fisher and Clayton 1988,

Diffley and Stillman 1991, Parisi, Xu et al. 1993, Dairaghi, Shadel et al. 1995, Ohgaki, Kanki

et al. 2007). Abf2p, the yeast homologue, shares similar features but lacks the

55

carboxy-terminal tail, which is essential for transcription activity. If added to the Abf2p

protein, the tail is sufficient to convert the protein into a transcriptional activator (Dairaghi,

Shadel et al. 1995). The Abf2p protein does not have a role in transcription but packages

mtDNA. This has led many to speculate that TFAM might also have DNA-packaging

activities. While there is 81% similarity between the mouse and human TFAM peptide

sequences, human TFAM is a poor activator of mouse mitochondrial transcription in vitro,

despite its strong capacity for non-specific DNA binding (Ekstrand, Falkenberg et al. 2004).

Conversely, mouse TFAM cannot substitute for human TFAM.

Figure 2.8 TFAM alignment across a wide range of species. The image shows the

N-terminal region, HMG boxes 1 and 2, linker region, and the C-terminal tail of TFAM in

human, mouse, rat, and yeast. The amino acid residues conserved in all 4 species are

indicated in red. The amino acid residues conserved in 3 species are indicated in blue. The

dashes indicate sequence gaps due to different amino acid compositions. Abbreviations:

Human, Homo sapiens; Mouse, Mus musculus; Rat, Rattus norvegicus; and Yeast,

Saccharomyces cerevisiae.

Levels of TFAM were altered in a patient suffering from mtDNA depletion and are

greatly decreased in tissue culture cell lines lacking mtDNA (Larsson, Oldfors et al. 1994).

56

The HMG motifs in TFAM recognise specific mtDNA regulatory sequences and bind

upstream of the light- and heavy-strand promoters (OL and OH) of the mitochondrial

genome in a non-specific fashion (Fisher, Lisowsky et al. 1992, Garstka, Schmitt et al.

2003), while facilitating the synthesis of RNA primers that are necessary to initiate mtDNA

replication and transcription (Xu and Clayton 1995).

TFAM has a higher affinity for DNA near the light strand promoter (LSP) than for

DNA near the heavy strand promoter (HSP) and stimulates transcription to a much greater

extent from the LSP than from the HSP in vitro (Fisher and Clayton 1985, Falkenberg,

Gaspari et al. 2002).

Early in vitro transcription studies dissecting the human mitochondrial transcription

machinery showed that, in addition to mitochondrial RNA polymerase, a number of

transcription factors were necessary for specific transcription initiation from mitochondrial

promoters (Fisher and Clayton 1988). Low levels of TFAM are sufficient to recruit other

replication factors (TFBMs and POLRMT) for mtDNA replication in order to increase the

mtDNA copy number (Seidel-Rogol and Shadel 2002, Alam, Kanki et al. 2003). TFAM is

absolutely necessary for mtDNA maintenance during development (Larsson, Wang et al.

1998). Moreover, in addition to its transcription factor activity, TFAM might function to

protect and package mtDNA (Kanki, Ohgaki et al. 2004, Kang, Kim et al. 2007). Its

non-specific DNA binding activity shows that TFAM is involved in the transcriptional

regulation of mtDNA. Studies have shown that the estimated molar ratio between TFAM

and mtDNA in mammals varies from 1 TFAM molecule per 15-20 bp of mitochondrial

genome (Alam, Kanki et al. 2003) to 1 TFAM molecule per 35-50 bp of mitochondrial

genome (Maniura-Weber, Goffart et al. 2004, Cotney, Wang et al. 2007). Additionally,

several studies have shown that mtDNA is organized in a chromatin-like higher-order

57

structure, of which TFAM might be an integral part (Spelbrink, Li et al. 2001, Alam, Kanki et

al. 2003, Garrido, griparic et al. 2003). The studies indicate that TFAM could be a stabilizing

factor in mitochondrial chromatin that plays a role in maintaining chromatin integrity.

2.17 Manipulation of TFAM Expression Levels in Cellular Models

Overexpression of TFAM in a human epithelial carcinoma cell line (HeLa) results in

an increase in mtDNA copy number, whereas knockdown of TFAM results in a gradual

decrease in mtDNA, which corresponds to the gradual decrease in TFAM protein (Kanki,

Ohgaki et al. 2004). Thus, TFAM plays an important role in the replication and transcription

of the mitochondrial genome. Moreover, PGC1α, an upstream regulator of TFAM,

enhances the expression of TFAM and increases levels of mtDNA (Wu, Puigserver et al.

1999). Interestingly, while TFAM is absolutely required for in vitro mitochondrial

transcription, physiologically high levels of TFAM negatively impact mitochondrial

transcription (Parisi, Xu et al. 1993, Falkenberg, Gaspari et al. 2002, Ylikallio, Tyynismaa et

al. 2010).

The amount of TFAM localized to the mitochondria decreases during

spermatogenesis in humans (Larsson, barsh et al. 1997) and mice (Larsson, Garman et al.

1996). This has been proposed as a functional mechanism for specifically reducing mtDNA

copy number in maturing sperm and thereby reducing paternal mtDNA transmission to

future generations. Interestingly, the reduction in mtDNA copy number resulting from

reduced TFAM levels is not mirrored by an increase in mtDNA copy number following

overexpression of TFAM in cultured HEK cells (Maniura-Weber, Goffart et al. 2004). The

majority of TFAM protein is found in the chromatin fraction of PC3 and SKR1 cells.

SiRNA-mediated knockdown of TFAM expression downregulates 596 genes, including

58

baculoviral IAP repeat-containing 5 (BIRC5). Conversely, BIRC5 is upregulated when

TFAM is overexpressed. In contrast, cyclin-dependent kinase inhibitor p21 (CDKN1A) is

upregulated in TFAM-knockdown cells. Chromatin immunoprecipitation was used to

demonstrate that TFAM binds the BIRC5 promoter in the nucleus. Among

TFAM-overexpressing cells,a greater proportion of cells are in the G2/M phase of the cell

cycle; in contrast, among TFAM-knockdown cells, more are in G1 and fewer are in G2/M.

This suggests that TFAM localizes to the nucleus and regulates nuclear genes and cellular

growth in a manner dependent on the level of TFAM expression. The studies demonstrate

that TFAM overexpression has different effects depending on the cell type. Overall, these

results suggest that TFAM is involved in mitochondrial biogenesis.

TFAM-deficient human fibroblasts have low mitochondrial activity (as assessed by

MitoTracker staining), more hydrogen peroxide, more aerobic glycolysis, and greater

L-lactate secretion than control cells (Balliet, Capparelli et al. 2011). Furthermore,

TFAM-deficient fibroblasts promote breast cancer tumor growth in vivo without increasing

tumor angiogenesis. TFAM-deficient fibroblasts increase the mitochondrial activity of

adjacent cancerous epithelial cells. This might mean that the downregulation of TFAM

enhances processes that support tumorigenesis in fibroblasts, including glycolytic

metabolism. In conclusion, the transcription factor TFAM is indispensable for the

maintenance of active mammalian mitochondria. TFAM recognizes sequences upstream of

mitochondrial promoters, and it is absolutely essential for mitochondrial transcription

initiation.

59

2.18 Animal Models of TFAM Knockdown

The necessity of TFAM for the maintenance of mtDNA during embryonic

development has been well documented (Larsson, Wang et al. 1998). Several studies have

described mouse models of TFAM depletion and TFAM knockout. Larsson et al. first

established a TFAM knockout mouse model (Larsson, Wang et al. 1998). The

heterozygous knockout mice exhibited reduced mtDNA copy number in all tissues and

cardiac respiratory chain deficiency, while the homozygous knockout mice did not develop

beyond E10.5 because of severe mtDNA depletion and the absence of electron transport

chain (ETC) function. Homozygous knockout mouse embryos exhibited numerous enlarged

mitochondria with abnormal cristae and severe mtDNA depletion accompanied by the

absence of oxidative phosphorylation. At day E8.5, TFAM-deficient embryos were smaller

than littermate controls; the fomer had delayed neural development, no optic discs, no

recognizable cardiac structures, and indistinct somites (Larsson, Wang et al. 1998). These

data indicate that TFAM is critical for controlling the number of mtDNA copies during

development.

To clarify the role of TFAM during embryonic development, conditional knockout

strategies have been used to eliminate TFAM from specific tissues. When TFAM

expression was specifically disrupted in the heart and muscle of mice, all conditional

tissue-specific TFAM knockouts presented with mitochondrial disease in the affected tissue,

resulting from a loss of mtDNA, loss of mitochondrial transcripts, and severe respiratory

chain deficiency (Wang, Wilhelmsson et al. 1999, Li, Wang et al. 2000, Sorensen, Ekstrand

et al. 2001, Wredenberg, Wibom et al. 2002, hansson, Hance et al. 2004, Silva, Aires et al.

2008). As a result, respiratory chain activity decreased dramatically in heart tissue, which

also exhibited dilated cardiomyopathy and atrioventricular heart conduction blocks (Wang,

60

Silva et al. 2001). Symptoms of heart failure were also identified, such as an increase in

glyceraldehyde 3-phosphate dehydrogenase (GAPDH) expression and a decrease in

calcium ATPase 2. However, there was no indication of fibrosis, necrosis, or infiltration of

inflammatory cells. Apoptosis was detected in hearts with TFAM knockout: levels of TUNEL

staining (DNA fragmentation), active caspases 3/7, Bax, and Bcl-xL were all elevated.

Increased levels of GPX and SOD2 activated the oxidative defense mechanism. These

studies demonstrate that the loss of TFAM results in increased levels of apoptosis (li, Wang

et al. 2000). When TFAM was eliminated from pancreatic beta cells, the mice developed

diabetes approximately 5 weeks later (Silva, Kohler et al. 2000). The characteristics of the

pancreatic beta cells included severe mtDNA depletion, deficient oxidative phosphorylation,

morphologically abnormal mitochondria, and the inability to release insulin when stimulated

by glucose. Another study showed that TFAM bound to damaged DNA and that binding

increased in the presence of p53, suggesting that TFAM has a direct role in the regulation

of apoptosis (Yoshida, Izumi et al. 2002). TFAM has been shown to bind with high affinity to

cisplatin-damaged DNA, suggesting that TFAM acts as a recruitment factor for the repair

mechanism in mitochondria and the nucleus (Yoshida, Izumi et al. 2002).

Mice with tissue-specific knockout of TFAM in forebrain neurons (MILON mice)

survived for a surprisingly long time (Sorensen, Ekstrand et al. 2001). When the mice were

4 months of age, many neurons had severe respiratory chain deficiencies and displayed

increased sensitivity to excitotoxic stress, but the mice still appeared normal. MILON mice

died from massive synchronized neurodegenerative events in the neocortex and

hippocampus at 5-6 months of age without showing any major upregulation of oxidative

defenses. In cortical neurons that lacked TFAM, apoptosis, DNA fragmentation, and the

61

expression of caspase 3 and 7 increased. In addition, the neurons were more vulnerable to

excitotoxic stress.

TFAM has also been specifically knocked out in dopaminergic (DA) neurons,

generating a transgenic mouse termed ―MitoPark‖ (Galter, Pernold et al. 2010). Two other

studies generated mice in which the TFAM gene was specifically inactivated in DA neurons

(Ekstrand, Terzioglu et al. 2007, Ekstrand and Galter 2009). In early adulthood, MitoPark

mice exhibited a progressive Parkinson‘s disease (PD) phenotype, which slowly impaired

motor function. They developed progressive symptoms that replicated many of the clinical

features of PD, such as bradykinesia, rigidity, and abnormal gait. The behavioral

disturbances correlated with a slow degeneration of the nigro-striatal DA pathway. Primarily,

DA neurons in the substantia nigra pars compacta were lost; at later stages, the ventral

tegmental area neurons also succumbed. Many surviving DA neurons displayed abnormal

morphology and contained alpha-synuclein and ubiquitin-immunoreactive inclusions,

similar to Lewy bodies observed in PD. This phenotype was accompanied by reduced

mtDNA expression and respiratory chain defects within midbrain neurons. Intraneuronal

inclusions also developed, and the cells eventually died (Ekstrand, Terzioglu et al. 2007,

Galter, Pernold et al. 2010). These findings suggest that mitochondrial dysfunction plays a

role in PD. Collectively, these studies demonstrate that TFAM is important for mtDNA

maintenance. Novel strategies to treat mitochondrial disorders and neurological diseases

will likely involve the manipulation of TFAM expression (Keeney, Quigley et al. 2009).

These studies also support the experimental rationale for the manipulation of TFAM

expression in this thesis.

Mice that lack TFAM in Schwann cells (TFAM-SCKO mice) are viable, but with age

they develop sensory and motor deficits, resulting from a progressive peripheral

62

neuropathy (Viader, Golden et al. 2011). The mice exhibit early loss of small, unmyelinated

fibers, followed by demyelination and degeneration of large-calibre axons. Within Schwann

cells of TFAM-SCKO mice, the mtDNA content was severely depleted, and respiratory

chain abnormalities were prevalent. However, the proliferation and survival of Schwann

cells were not affected. Moreover, TFAM has been selectively eliminated from neurons and

glia of the enteric nervous system (ENS), leading to an 80% reduction in total mtDNA

content within the ENS, which induced severe respiratory chain deficiencies. Many

enlarged mitochondria with distorted cristae were found specifically within enteric neurons

and glia. Mitochondrial dysfunction in these cells resulted in high levels of apoptosis and

disruption of gastrointestinal motility (Viader, Wright-Jin et al. 2011). The mice (designated

TFAM-ENSKO) were initially viable, but by 4 weeks of age they were significantly smaller

than littermate controls. At 6–8 weeks of age, TFAM-ENSKO mice developed abdominal

distension with mild phenotypic abnormalities. At 10-12 weeks of age, enteric

neurodegeneration in the proximal small intestine (SI) was profound. Massive dilation of the

proximal SI, accompanied by contraction of the distal SI, was also observed. By 12 weeks

of age, the majority of TFAM-ENSKO animals had died. Interestingly, the ENS is not

uniformly affected in TFAM-ENSKO mice: both regional and neuronal subtype-specific

effects are observed. This regional and subtype-specific variability in susceptibility to

mitochondrial defects results in an imbalance of inhibitory and excitatory neurons that likely

accounts for phenotypes associated with TFAM-ENSKO mice. At 12 weeks of age, the

relative abundance of inhibitory input to the proximal SI results in distension, while the

relative loss of inhibitory input to the distal SI leads to constriction. Small molecules (such

as rotenone and antimycin) were used to inhibit the mitochondrial electron transport chain.

Disrupting mitochondrial respiration induced neurite degeneration within 24 h and

63

subsequently induced enteric neuron apoptosis. Together, these results suggest that

mitochondrial defects stimulate axonal degeneration, which precedes the loss of enteric

neurons. Overall, the study suggests that mitochondria are essential for the survival of

axonal neurons and for normal peripheral nerve function; that mitochondria play a role in

Schwann cells, glial cells in the enteric nervous system (ENS); and that mitochondrial

dysfunction within neurons contributes to human peripheral neuropathies.

The multiple links between TFAM expression or activity and mitochondrial

dysfunction suggest that TFAM is an important driving force in neurodegenerative disorders,

including Parkinson‘s disease, as well as in diabetes and mtDNA depletion disorders, such

as infantile mitochondrial myopathy, fatal childhood myopathy, skeletal muscle and

mitochondrial encephalomyopathy, ocular myopathy, exercise intolerance, and muscle

wasting (Larsson, Oldfors et al. 1994, Poulton, Morten et al. 1994, Siciliano, Mancuso et al.

2000, Tessa, Manca et al. 2000, Choi, Kim et al. 2001, Belin, Bjork et al. 2007).

2.19 Role of the Mitochondrion during Pre-implantation Stages: Introduction

The pre-implantation stages of development include the fertilized zygote; the two-,

four-, eight-, and 16-cell morula (pre-embryo); and the blastocyst. The amount of mtDNA

present during these stages depends on the number of mtDNA copies in the oocyte at

fertilization, because mtDNA replication is initiated only post-implantation. As such, the

mtDNA copy number at fertilization is an important determinant of subsequent

developmental success (Spikings, Alderson et al. 2007), and a certain minimum mtDNA

copy number is required for an oocyte to reach implantation (Spikings, Alderson et al. 2007).

In addition, embryonic mtDNA copy numbers decrease between the 2- and 8-cell stages,

suggesting an active mtDNA degradation process. In mature murine and human oocytes,

64

the critical threshold is estimated at 100,000 mtDNA copies (Piko and Taylor 1987, Reynier,

May-Panloup et al. 2001, Santos, El Shourbagy et al. 2006). It has also been shown that

low levels of mtDNA (or mtDNA mutations) in the ovary are associated with ovarian

dysfunction (May-Panloup, Chretien et al. 2005).

2.20 Mitochondrial Bottleneck during Pre-implantation Stages

During the earliest stages of development (between fertilization and implantation),

the mtDNA inherited by an organism appears to pass through a genetic bottleneck. This

implies that there is selective elimination of mitochondrial genomes, which ensures that

only a small number of mtDNA molecules are passed to the next generation.

Very little mitochondrial replication occurs during the pre-implantation stages of

development (Piko and Matsumoto 1976, Ebert, Liem et al. 1988) (Figure 2.9). The mtDNA

copy number within a single primordial germ cell (PGC) is ~1350–3600 at 7.5-13.5 days

post-coitum (Cao, Shitara et al. 2007). To establish the number of mtDNA molecules within

PGCs, Wai et al. (2008) used OCT4-GFP to identify these cells. They measured a low

mtDNA copy number in early PGCs, suggesting that a mitochondrial bottleneck occurs in

the early PGC. Furthermore, the number of mtDNA copies in the female germ line is lower

than in male germ cells, suggesting that the mitochondrial genetic bottleneck is less

important in the male germ line than in the female one. However, mtDNA mutations can

alter sperm motility (Spiropoulous, Tumbull et al. 2002, Cree, Samuels et al. 2008) but do

not affect fertility (Wai, Ao et al. 2010). Moreover, partial knockdown of TFAM in blastocysts

does not affect fertilization or pre-implantation development in mice, but it does alter

post-implantation embryonic viability. In contrast, male fertility is not affected by TFAM

knockdown (Wai, Ao et al. 2010).

65

Figure 2.9 Changes in mtDNA copy number per cell during implantation stages. This figure

is modified from (Wai, Ao et al. 2010).

In theory, all mitochondrial genomes within an organism should be identical.

However, because mutations to mtDNA are inherited from the maternal line, wild-type and

mutant mtDNA can coexist (heteroplasmy) (Figure 2.10). Examination of heteroplasmic

mice and humans has revealed that mtDNA genotypes shift extremely rapidly in offspring

and can even return to homoplasmy within a few generations (at least in some progeny)

(Kaneda, Hayashi et al. 1995, Marchington, Hartshorne et al. 1997, Inoue, Nakada et al.

2000, Fan, Waymire et al. 2008). The number of heteroplasmic mutations varies widely

among offspring, suggesting that mutant mtDNA molecules are eliminated during

development.

66

Figure 2.10 The possible origin of pathogenic mtDNA deletions. This figure is modified from

(Chinnery, DiMauro et al. 2004).

Overall, these studies indicate that a drastic reduction in mtDNA copy number does

not occur in PGCs. Rather, the genetic bottleneck associated with mtDNA seems to result

from the selective replication of a subpopulation of mitochondrial genomes. This is

accompanied by strong selection against mutations within the germ line. This has been

demonstrated in studies of an ND6 frame-shift mutation (Fan, Waymire et al. 2008) and a

large deletion (Sato, Nakada et al. 2007, Cao, Shitara et al. 2009).

It has been proposed that primordial female germ cells contain a small number of

mtDNA molecules to permit rapid genetic drift toward populations of pure mutant or pure

wild-type mtDNA. A process for selecting mitochondrial mutations has been proposed for

mice and humans (Kaneda, Hayashii et al. 1995, Marchington, Hartshorne et al. 1997, Fan,

Waymire et al. 2008, Inoue, Noda et al. 2010). Although the mechanism by which

deleterious mtDNA mutations are recognized and eliminated remains unclear, selection

67

might be based on mitochondrial ‗fitness‘. For example, mitochondria that produce the most

ROS undergo apoptosis or mitochondrial turnover. Understanding the genetic bottleneck

associated with mitochondria will facilitate the development of therapeutic strategies that

block the transmission of mitochondrial disease from mother to progeny and ensure the

safety of hESC-derived therapeutic agents.

2.21 Analysis of Mitochondrial Behavior in Stem Cells

Mitochondrial properties have been used to assess oocyte competence during

oocyte development in various species, including Xenopus laevis, Artemia franciscana,

Equus caballus, Sus scrofa, Mus musculus, and Rattus norvegicus (Vallejo, Lopez et al.

1996, El Shourbagy, Spikings et al. 2006, Facucho-Oliveira, Alderson et al. 2007,

Kameyama, Filion et al. 2007, Mohammadi-Sangcheshmeh, Held et al. 2011). Changes in

mitochondrial morphology from the late morula to the early post-implantation stages of

embryogenesis have been closely examined in monkeys and rats (Shepard, Muffley et al.

2000). During this time, the number of cristae increases, but the cristae appear tubular or

vesicular. New cristae begin to form from blebs of the inner mitochondrial membrane,

resulting in a lamellar appearance. Mitochondrial properties have also been investigated in

a variety of species, using adult monkey stem cells, porcine oocytes, mESCs, hESCs, and

hiPSCs (St John, Ramalho-Santos et al. 2005, Cho, Kwon et al. 2006, St John, Amaral et al.

2006, Spikings, Alderson et al. 2007, Armstrong, Tilgner et al. 2010).

The extent to which the analysis of mitochondria in human pluripotent stem cells

reflects the inner cell mass of the blastocyst remains to be determined, given that hESCs

and iPSCs are usually cultured for long periods of time in vitro before analysis. It is likely

that mitochondrial properties shift in culture as mitochondria adapt to the culture conditions.

68

Indeed, hESCs grown in hMSC-CM (conditioned medium derived from human

mesenchymal stem cells) or mTeSR exhibited lower mitochondrial membrane potential (Δψ)

and lower expression of mtDNA-encoded genes and mitochondrial biogenesis-related

genes then cells grown in hFF-CM (conditioned medium derived from human foreskin

fibroblasts) (Ramos-Mejia, Bueno et al. 2012). Moreover, mtDNA and the bioenergetics

profiles of hESCs and hiPSCs can be altered to provide a growth advantage for culture

passage (Maitra, Arking et al. 2005, Prigione, Lichtner et al. 2011).

Prigione and co-workers (2011) have shown that hiPSC lines exhibit varying levels

of homoplasmic and heteroplasmic mtDNA mutations and display a number of point

mutations, but not large-scale rearrangements (e.g. long insertions or deletions) (Prigione,

Lichtner et al. 2011). These studies suggest that the accumulation of mitochondrial

mutations correlates with the level of mitochondrial damage and could affect the

differentiation ability of neural stem cells and hematopoietic stem cells (Norddahl, Pronk et

al. 2011, Wang, Esbensen et al. 2011).

Overall, undifferentiated hESCs and hiPSCs share similar features (Oh, Kim et al.

2005, St John, Ramalho-Santos et al. 2005, Cho, Kwon et al. 2006, Prigione, Lichtner et al.

2011, Panopoulos, Yanes et al. 2012). These features include: (1) high expression of

pluripotency markers, (2) a low mtDNA copy number and a low level of

mitochondrial-encoded genes, (3) a low level of mitochondrial complex activities and

mitochondrial biogenesis, (4) a spherical and immature mitochondrial structure (i.e. poorly

developed cristae) located around the nucleus, (5) restricted oxidative capacity, including a

lower mitochondrial membrane potential and low levels of oxygen consumption, ROS

production, and intracellular ATP generation, (6) a greater reliance on glycolysis (anerobic

metabolism) than on oxidative phosphorylation (aerobic metabolism) for energy generation,

69

(7) low levels of intracellular peroxide and mitochondrial superoxide, and (8) defensive

systems, including glutathione S transferase (GSTA3), glutathione peroxidise 2 (GPX2),

and heat shock protein 1 (HSPA1B and HSPB)1 (Armstrong, Tilgner et al. 2010).

hESCs and hiPSCs have a similar metabolic status. They are more reliant on

anaerobic metabolism, which breaks down glucose to form two molecules of pyruvic acid

and generates ATP without oxygen in a manner that is less efficient than ATP production

through oxidative phosphorylation. Studies have shown that a stimulator

(D-fructose-6-phosphate, F6P) of anaerobic metabolism improves the reprogramming from

somatic cells (aerobic metabolism) by shifting to hiPSCs, which have an hESC-like

morphology (anaerobic metabolism), when compared to the effects of an anaerobic

metabolism inhibitor (2-deoxy-D-glucose, 2-DG) (Panopoulos, Yanes et al. 2012). However,

other studies have shown that inhibition of mitochondrial complexes (i.e. using a Complex

III inhibitor such as antimycin) in hESCs with low mitochondrial activities does not alter the

expression of pluripotency markers and that mitochondrial morphology is immature (Varum,

Momcilovic et al. 2009). Moreover, inhibition of oxidative phosphorylation in mitochondria

(i.e. with protonophore carbonyl cyanide m-chlorophenylhydrazone, CCCP, which

depolarizes the mitochondrial membrane potential) does not affect pluripotent gene

expression. The cells still use similar energy sources from anaerobic metabolism (i.e. low in

oxygen consumption and ATP production and more glycolytic flux), have a similar

methylation pattern, and are able to differentiate into three different lineages in mESCs and

hESCs (Mandal, Lindgren et al. 2011). Therefore, glycolysis is required to support the

proliferation of self-renewing ESCs.

hESCs and hiPSCs have a similar metabolic status, although small differences exist.

hESCs have more unsaturated fatty acid metabolites (i.e. ω-6 and ω-3 fatty acids,

70

arachidonic acid, linoleic acid, docosapentaenoic acid, and adrenic acid) than do hiPSCs,

which generate energy by breaking down fatty acids in the beta-oxidation pathway to

acetyl-coA, which then enters the Citric Acid Cycle (TCA) in mitochondria (Panopoulos,

Yanes et al. 2012). This suggests that inhibition of oxidative pathways is important for

maintaining pluripotency in pluripotent stem cells. Early in vivo and in vitro studies

confirmed that the metabolic pathway from lipids is significantly upregulated during oocyte

maturation. There is a higher concentration of unsaturated lipids, such as linoleic acids and

palmitic acid, and a lower concentration of total saturates in human preimplanation

embryos. The concentrations increase upon oocyte differentiation in the course of embryo

development, indicating that energy generation plays an essential role in the maturation of

oocytes (Waterman and Wall 1988). Unsaturated fatty acids induce the expression of

uncoupled proteins (UCPs). UCP2 has been found in the inner mitochondrial membrane; it

is able to uncouple the oxidation of substrates in the electron transport chain from ATP

synthesis, thus dissipating energy as heat and potentially affecting metabolic efficiency

(Pecqueur, Bui et al. 2008). Pecqueur and Bui‘s study demonstrated that undifferentiated

hESCs express more UCP2 than do differentiated hESCs and that the level of UCP2

expression does perturb the metabolic transition or impair hESC differentiation.

Gain-of-function (GOF) UCP2 has several effects: (1) it promotes mitochondrial fatty

acid oxidation but does not cause a major metabolic shift (i.e. there is no significant change

in oxygen, glucose consumption, ATP, or lactate production), (2) it does not affect

three-lineage differentiation, but does alter the quantity and quality of embryonic bodies

(EBs), (3) it reduces cell proliferation and viability, (4) it increases ribose generation from

glucose in undifferentiated hESCs, relative to that in differentiated hESCs, and (5) it

enhances resistance to glucose starvation by inducing autophagy. These findings indicate

71

that UCP2 has differential effects on proliferation and survival in undifferentiated and

differentiated hESCs because of differences in the cells‘ metabolism. Expression of GOF

UCP2 might help shunt pyruvate away from oxidation in mitochondria and towards the

pentose phosphate pathway (PPP) by upregulating glycolytic flux. Loss-of-function (LOF)

UCP2 also has several effects: (1) it maintains the expression of pluripotency markers, (2) it

improves cell proliferation, and (3) it facilitates the metabolic transition from fatty acid

oxidation to oxidative metabolism (i.e. reduced lactate and ATP production). This suggests

that loss of UCP2 reduces the metabolic activity of hESCs but does not affect their

pluripotency status. Overall, these findings demonstrate that UCP2 acts as a metabolic

regulator of hESC energy metabolism by preventing mitochondrial glucose oxidation and

facilitating glycolysis via a substrate shunting mechanism in order to maintain the

pluripotency of undifferentiated hESCs or facilitate early differentiation. This suggests that

mitochondria are directly involved in controlling the pluripotency of hESCs.

The mitochondrial membrane potential (Δψ) has been used as a measure of

mitochondrial competence during development. One study observed an increase in

mitochondrial membrane potential, evaluated using JC-1, during the preimplantation stages

(Acton, Jurisicova et al. 2004). This suggests that the mitochondrial membrane potential

progressively changes during the stages of development, reflecting constant fusion and

fission and demands for different amounts of energy. Schieke and co-workers (2008)

demonstrated a correlation between the mitochondrial membrane potential and

differentiation ability in mESCs (Schieke, Ma et al. 2008). mESCs colonies have different

levels of mitochondrial metabolism; those with a higher ΔΨ have a higher overall metabolic

rate. Stem cells with a high Δψ also exhibit high levels of tumor formation, lactate

production, oxygen consumption, and ATP production. In contrast, stem cells with a low Δψ

72

are more likely to differentiate into mesodermal lineage cells (Schieke, McCoy et al. 2008).

Under serum-starvation conditions, mESCs with a low Δψ are more likely to be in early G1

phase, whereas those with a higher Δψ are more likely to be in late G1 phase (Schieke,

McCoy et al. 2008). This suggests that changes in the mitochondrial membrane potential

correlate with pluripotency and/or the efficiency of differentiation.

2.22 Mitochondrial Property Changes upon Differentiation

Different tissues have different energy demands, and mitochondrial morphology can

therefore vary widely. The number and structure of mitochondria in skeletal muscle, heart,

and liver, can vary widely; developing heart cells contain larger mitochondria than other

cells, such as skin or neural tubes. However, the protein compositions of mitochondria in

different tissues are similar (Forner, Foster et al. 2006). Mitochondrial morphology in

cardiac myocytes and neurons can change during the aging process, possibly because

oxidative damage leads to mitochondrial damage and a reduction in the mitochondrial

membrane potential (Terman, Dalen et al. 2004).

Several studies have investigated the relationship between mitochondrial properties

and cell-type specific differentiation, such as neurogenesis, osteogenesis, adipogenesis,

and cardiogenesis (Cordeau-Lossouam, Vayssiere et al. 1991, Komarova, Ataullakhanov

et al. 2000, St John, Ramalho-Santos et al. 2005, Chung, Dzeja et al. 2007, Ducluzeau,

Priou et al. 2011). Several methods can be used to stimulate hESC differentiation, such as

the formation of embryoid bodies (St John, Ramalho-Santos et al. 2005, Cho, Kwon et al.

2006). Differentiating hESCs have a greater mitochondrial mass and a higher mtDNA copy

number when compared with undifferentiated hESCs (Cho, Kwon et al. 2006, Chung, Dzeja

73

et al. 2007, Saretzki, Walter et al. 2008). Common changes in mitochondrial properties

include: (1) upregulation of mitochondrial-encoded and mitochondrial biogenesis-related

genes (TFAM and POLG) (Facucho-Oliveira, Alderson et al. 2007, Facucho-Oliveira and St

John 2009, Armstrong, Tilgner et al. 2010), (2) more mature mitochondrial morphology (i.e.

distinct cristae and a dense matrix), (3) upregulated mitochondrial respiratory activity and

increased ATP production (Cho, Kwon et al. 2006, Ramalho-Santos, Varum et al. 2009),

and (4) a metabolic shift from glycolysis (anaerobic metabolism) to oxidative

phosphorylation (aerobic metabolism) in spontaneous or induced-differentiation cells. The

same metabolic shift has been observed during cardiomyogenesis from hESCs (Chung,

Dzeja et al. 2007). During cardiomyogenesis, the mitochondrial morphology changes from

spherical, cristae-poor, and peri-nuclear to elongated with abundant and well-organized

cristae and a cytosolic pattern in cardiomyocytes. The metabolic shift from anaerobic to

aerobic metabolism during cardio-differentiation indicates that the maturation of

mitochondrial properties is essential during cardiomyogenesis.

2.23 Autophagy: Introduction

Autophagy is derived from the Greek words auto, which means self, and phagy,

which means to eat. The autophagic process breaks down cellular components and plays a

particularly important role during periods of starvation and when organelles are damaged.

Autophagy allows cells to maintain a critical balance between the synthesis, degradation,

and recycling of cellular structures. This balance is important during development,

homeostasis, and cell proliferation. Three types of autophagy have been described:

chaperone-mediated, microautophagy, and macroautophagy (Cuervo 2004).

74

Chaperone-mediated autophagy involves the direct translocation of proteins with specific

protein motifs across lysosomal membranes; chaperone proteins that interact with

lysosomal membrane proteins facilitate the translocation. Microautophagy is the direct

intake of cytoplasm by invagination of lysosomal membranes. Macroautophagy, often

referred to simply as autophagy, involves the formation of double membrane vesicles

around organelles and other cytoplasmic components that then fuse with lysosomes

(Levine and Klionsky 2004).

Autophagosomes are double-membrane cytosolic vesicles that encapsulate and

break down cellular components to supply nutrients to the cell (Tolkovsky, Xue et al. 2002).

Autophagy is a major mechanism by which starving cells reallocate nutrients from

non-essential to essential processes. However, insufficient or excessive regulation of

autophagy can cause cell injury (Levine and Yuan 2005). Therefore, appropriate regulation

of autophagy is essential.

75

Figure 2.11 Stages of autophagosome formation in selective and non-selective pathways.

Autophagosome formation can be stimulated by the environment or drugs. Following an

inductive signal, autophagosome formation, mitochondrial engulfment, mitochondrial

breakdown, and export of metabolic components occur in both pathways. This figure is

modified from (Yen and Klionsky 2008).

The process of autophagy involves five discrete steps: (1) induction at the

pre-autophagosomal structure (PAS), (2) growth and elongation of the isolation membrane

of autophagosomes, (3) sequestration of cargo within the autophagosome, (4) fusion with

the lysosome/vacuole to form the autolysosome, and (5) degradation of the cellular

components by lysosomal proteases and release of the metabolic products into the

cytoplasm (Kundu and Thompson 2008) (Figure 2.11). The autophagosome membrane

was initially thought to derive from ribosome-free regions of the rough endoplasmic

reticulum (RER). However, other studies have presented evidence supporting that

76

autophagosome membranes derive from the RER (Suzuki, Kirisako et al. 2001, McEwan

and Dikic 2010, Rambold and Lippincott-Schwartz 2011). Thus the origin of phagosome

membranes remains to be determined.

The majority of the molecular mechanisms and genes that control autophagy (ATG

genes) were discovered in a yeast model (Ohsumi and Mizushima 2004), but the

mechanism of mitochondrial autophagy (mitophagy) remains to be investigated. Atg

proteins are categorized by function. For example, Uth1p, which resides in the outer

mitochondrial membrane, is involved in autophagic induction (Kissova, Deffieu et al. 2004).

Atg9 functions in membrane protein recycling. The Atg12-Atg8 complex, comprising a pair

of ubiquitin-like proteins, promotes vesicle extension and completion (Yorimitsu and

Klionsky 2004). Studies have shown that Atg3, 5, and 7 participate in quality control and

cell remodelling during T-lymphocyte and adipocyte differentiation (Lafontan 2008, Pua,

guo et al. 2009, Jia and He 2011). During the oocyte to embryo transition, autophagy is

activated within four hours of fertilization. The degradation of maternal proteins and the

regeneration of amino acids and proteins is important for the subsequent differentiation of

the fertilized oocyte (Mizushima and Levine 2010). During the recycling of cytosolic material,

autophagy might provide building blocks for cells to generate ATP. Autophagy also plays a

crucial role in programmed cell death during mammalian morphogenesis (Qu, Zou et al.

2007). Beclin1 and Atg5 might be essential for cavitation, the process by which the

proamniotic cavity is formed during embryonic development. Collectively, these data

suggest that autophagy provides cells with ATP for essential processes and contributes to

tissue sculpting during embryonic development.

The Atg12-Atg5-mediated pathway for the sequestration and formation of

autophagosomes in yeast involves the binding of Atg16, which translocates to the isolation

77

membrane and functions as a linker in the formation and elongation of autophagosomes

(Ohsumi and Mizushima 2004, matsushita, Suzuki et al. 2007). Studies suggest that the

yeast protein Atg32 is a transmembrane receptor that directs autophagosome formation to

mitochondria for mitophagy. Atg32 localizes on mitochondria and binds to the adaptor

protein Atg11 during selective types of autophagy; it is then recruited to and imported into

the vacuole along with mitochondria (Kanki and Klionsky 2009, Tolkovsky 2009, Okamoto

and Kondo-Okamoto 2012). This suggests that mitochondria are specifically targeted for

degradation. In some instances, mitochondria have been shown to be ubiquitin-tagged for

autophagy. This is the case for sperm mitochondria that are eliminated after oocyte

fertilization (Sutovsky, Moreno et al. 2000). Although it has been suggested that

mitochondria are selected for autophagy depending on the level of oxidative damage to

their membrane, this hypothesis has not been investigated (Terman and Brunk 2004).

LC3 is a mammalian autophagosomal orthologue of the yeast protein Atg8. In

mammalian cells, Atg4B cleaves newly synthesized pro-LC3 into its cytosolic form, LC3-I,

thus exposing the C-terminal glycine 120. LC3-I is then activated by Atg7p, an E1-like

enzyme, and conjugated to phosphatidylethanolamine (PE) by Atg3p, an E2-like enzyme

(Kabeya, Mizushima et al. 2000, Tanida, Ueno et al. 2004). LC3-II (16 kDa) has slightly

higher mobility than LC3-I (18 kDa) when run on SDS-PAGE gels. LC3-II is selectively

incorporated into forming and newly formed autophagosomes. After the autophagosome

fuses with the lysosome, LC3-II is trapped on the inner surface of the double membrane

autophagosome and degraded when deconjugated from PE by Atg4 (Mizushima,

Yamamoto et al. 2004).

Autophagy has been demonstrated during neuronal, adipocyte, and T-lymphocyte

differentiation. A reduction in autophagic activity abolishes differentiation or downregulates

78

differentiation in adipocyte cells, which exhibit decreased expression of differentiation

markers, lipid accumulation, and low levels white adipose, leading to a lean body mass

(Zeng and Zhou 2008, Singh, Xiang et al. 2009, Zhao, Huang et al. 2010). Moreover,

autophagy has been reported to play a crucial role in T-lymphocyte development (Pua, Guo

et al. 2009). The essential role of autophagy in maintaining T-lymphocyte survival and

proliferation has been demonstrated using mouse models with knockout of Atg5 or Beclin 1,

which possess a Bcl-2 homology 3 domain (BH3-only Atg6 in yeast). Loss of Atg5 or Beclin

1 results in T-lymphocyte deficiency and cell death, with disruption of T-cell proliferation

and a reduction in the number of mature total thymocytes and peripheral T and B

lymphocytes (Pua, Guo et al. 2009, Arsov, Adebayo et al. 2011).

Dysregulated autophagy has been linked to neurodegenerative diseases and cancer,

but the mechanisms are not well understood. Autophagy is thought to be essential for

healthy aging and longevity. The target of rapamycin (TOR) pathway, which regulates

autophagy, is one of three highly conserved signaling pathways that affect lifespan (Yen

and Klionsky 2008, Eisenberg, Knauer et al. 2009).

2.24 The Mammalian Target Of Rapamycin Signaling Pathway: (A) How does the

mTOR pathway work?

Mammalian target of rapamycin (mTOR) is a serine/threonine kinase that regulates

autophagy through its downstream effector, S6 kinase (Codogno and Meijer 2005, Kapahi,

Chen et al. 2010). mTOR phosphorylates S6K on T389, leading to S6K activation and the

phosphorylation of its downstream substrate, S6 (Figure 2.12). Generally, mTOR plays a

central role in the ability of cells to sense growth signals, amino acid levels, and energy

levels and make decisions that affect protein translation, cell growth, and proliferation

79

(Mizushima and Levine 2010). The mTOR complex comprises mTORC1 and mTORC2,

which share three common subunits (mTOR, mlST8, DEPTOR). In addition, mTORC1 has

two specific proteins (RAPTOR and PRAS40), while mTORC2 has three specific proteins

(RICTOR, mSIN1, and Protor-1) (Shahbazian, Roux et al. 2006, Yang and Guan 2007).

Activation of mTORC1 leading to the phosphorylation of S6 kinase and the inactivation of

the translation repressor 4E-BP suppresses autophagy, activates mitochondrial

metabolism, and inhibits ESC differentiation (Tee and Blenis 2005, Shahbazian, Roux et al.

2006, Yang and Guan 2007). Rapamycin is a macrolide fungicide that inhibits mTOR

signaling by binding to FK506-binding protein 12 (FKBP12) (Hidalgo and Rowinsky 2000).

mTORC1 is more sensitive than mTORC2 to short-term exposure to rapamycin (Kapahi,

Chen et al. 2010).

Figure 2.12. The mTOR signaling pathway. TSC1/2 and Rheb are the major upstream

regulators of mTORC1. Several external signals affect the mTOR signaling pathway, such

as low energy. When the intracellular ATP concentration is low, AMPK becomes active and

subsequently activates the TSC2/1 complex and mTORC1 downstream pathway to

regulate cellular energy levels. This figure is modified from (Yang, Yang et al. 2008).

80

The Mammalian Target Of Rapamycin Signaling Pathway: (B) How does the mTOR

pathway respond to and regulate energy demand?

The mTOR signaling pathway also cooperates with the tuberous sclerosis complex

(TSC) to control mitochondrial biogenesis and energy metabolism. TSC-mTOR is an

energy-sensing pathway. In ATP-depleted conditions, TSC2 forms a complex with TSC1

and activates AMP activated kinase (AMPK) to change the intercellular ATP/AMP ratio

(Zhou, Su et al. 2009).

One study has demonstrated that the TSC-mTOR pathway is essential for

maintaining quiescence and ROS production in HSCs (Chen, Liu et al. 2008). Depletion of

TSC1 in HSCs results in a shift from quiescent status to upregulation of mitochondrial

biogenesis and ROS production. Inhibition of mTOR expression by rapamycin leads to a

reduction in the interaction between mTOR, raptor, and the rapamycin-dependent

transcription factor ying-yang1 (YY1), which interacts with PGC1α (Cunningham, Rodgers

et al. 2007). Disruption of YY1 expression decreases mitochondrial-encoded gene

expression and respiration (i.e. oxygen consumption), which is consistent with decreased

PGC1α expression (Cunningham, Rodgers et al. 2007). During the reprogramming of

fibroblasts to cells with an ESC-like morphology by reprogramming factors, cells transition

to a state with a lower mitochondrial number and an immature mitochondrial structure and

shift from aerobic to anaerobic metabolism. It has been suggested that the mTOR signaling

pathway affects mitochondrial dynamics to segregate mitochondria by targeting defective

mitochondria to autophagosomes (mitophagy).

81

The Mammalian Target Of Rapamycin Signaling Pathway: (C) How does the mTOR

pathway relate to mitochondrial biogenesis and stem cell behavior?

The mTOR signaling pathway regulates metabolism, cell growth, and ATP/ADP

status in cells. Inhibition of mTOR activity by rapamycin in either HEK 293 cells or mESCs

alters mitochondrial biogenesis to produce effects such as low expression of

mitochondrial-related phosphoproteins, low oxygen consumption, loss of mitochondrial

membrane potential, loss of ATP synthetic capacity, reduced lactate production, slower

rates of proliferation, and disruption of the Δψ (Schieke, Phillips et al. 2006, Schieke,

McCoy et al. 2008). When mESCs were sorted into two populations with low and high

mitochondrial membrane potential, the population with a low mitochondrial membrane

potential was found to reside in early G1 phase, whereas the population with high

mitochondrial membrane potential resided in late G1 phase and exhibited higher mTOR

expression, respiration, and oxidative capacity (Schieke, Ma et al. 2008). Indeed, the

mTOR signaling pathway plays a role in maintaining the self-renewal and pluripotency of

hESCs (Zhou, Su et al. 2009, Easley, Ben-Yehudah et al. 2010).

Inhibition of the mTOR pathway by rapamycin represses mTOR/S6k, which

enhances osteoblastogenesis, and promotes differentiation into mesoderm and endoderm

lineages (Zhou, Su et al. 2009, Lee, Yook et al. 2010). This indicates that activation of the

mTOR pathway can promote differentiation in hESCs. Disruption of S6K-mediated

transcription in the mTORC1 pathway by rapamycin in undifferentiated hESCs does not

alter cell viability or the expression of pluripotency markers, whereas p70S6K

overexpression in hESCs induces hESC differentiation (Easley, Ben-Yehudah et al. 2010).

The level of mTOR/p70S6K might be a crucial factor for maintaining pluripotency status in

82

undifferentiated hESCs and for maintaining high levels of protein synthesis during

differentiation.

mTOR signaling allows cells to survive by increasing autophagy, thereby promoting

the degradation of internal proteins and organelles to generate the energy and raw

materials necessary for survival when extracellular nutrients are scarce. mTOR signaling

allows cells to grow when there are enough extracellular nutrients. Therefore, nutrient

depletion or inhibition of TOR with the drug rapamycin induces autophagy.

2.25 Selective Autophagy and Mitophagy

Mitophagy is an autophagic process that selectively degrades damaged

mitochondria (Kim, Lee et al. 2010). The selective degradation of mitochondria by

autophagosomes, called mitophagy, occurs in response to different conditions, such as

nutrient depletion, mitochondrial dysfunction, or red blood cell maturation. During nutrient

depletion or caloric restriction, which can increase longevity, Uth1p (Atg1) activates

autophagosome formation to break down unnecessary organelles for use as building

blocks and nutrients and to increase the removal of oxidatively damaged mitochondria and

mutated mtDNA (Camougrand, Kissova et al. 2004, Kissova, Deffieu et al. 2004, Keeney,

Quigley et al. 2009).

Mitochondrial damage or dysfunction is one of the main inducers of mitophagy.

Increased mitochondrial dysfunction might occur in the post-mitotic cells of aged organisms

that exhibit abnormal mitochondrial morphology (i.e. swelling, low number of cristae, and

destruction of inner membranes) (Ermini 1976, Beregi, Regius et al. 1988, Terman 1995).

Autophagic events decrease during aging; ATP production and respiration are lower in

83

aged animals than in younger ones (Terman 1995). There is frequent mitochondrial

turnover in tissues such as the brain, heart, liver, and kidney (Menzies and Gold 1971).

Mitochondria are more vulnerable to oxidative damage and have less robust DNA repair

systems when compared with the nucleus (Yakes and Van Houten 1997, Gredilla, Bohr et

al. 2010). Damage to mtDNA could result in the synthesis of abnormal mitochondrial

proteins or disrupt synthesis altogether, which would exacerbate mitochondrial dysfunction.

In this process, damaged mitochondria (i.e. those with a compromised Δψ or

overproduction of ROS) release signals that promote uptake by autophagosomes,

triggering degradation (Sandoval, Thiagarajan et al. 2008). This provides a mechanism for

mitochondrial quality control and a general, controlled cytoprotective response.

In neurodegenerative diseases, for example, the cell benefits from mitophagy

through the selective removal of damaged and free radical-generating mitochondria.

Parkinson‘s disease (PD) is a common neurodegenerative movement disorder

characterized by tremors, muscular rigidity, bradykinesia, and postural instability

(Bossy-Wetzel, Schwarzenbacher et al. 2004). PD may be induced by an environmental

toxin, 1-methyl-4-phenylpyridinium (MPP+), an inhibitor of Complex I in the electron

transport chain. A precursor of MPP+, 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine

(MPTP), can also induce Parkinsonism (Abou-Sleiman, Muqit et al. 2006), as can genetic

inheritance of PD-related genes (e.g. Parkin and PINK1), for example, in

autosomal-recessive juvenile-onset Parkinsonism (ARJP) (Bossy-Wetzel,

Schwarzenbacher et al. 2004, Choi, Woo et al. 2008, Harvey, Wang et al. 2008, Mellick,

Siebert et al. 2009). Studies of the mitochondrial proteins Parkin and PINK1 have

established a direct link between defective mitochondria and mitophagy (McBride 2008,

Narendra, Tanaka et al. 2008, Lutz, Exner et al. 2009). Parkin (encoded by PARK2) is an

84

E3 ubiquitin ligase and is the first protein known to bind eight Zn2+ ions. Binding to zinc

through conserved cysteine-rich motifs is essential for structural maintenance, an

observation that explains the significance of the cysteine-based ARJP mutations found

throughout Parkin (Giasson and Lee 2001, Hristova, Beasley et al. 2009). Studies have

shown that loss of Parkin function results in vulnerability to oxidative damage,

dopaminergic neuron loss, and abnormal mitochondrial structure (i.e. swollen, distorted

mitochondrial morphology and fragmented cristae). Loss-of-function mutations in Parkin

decrease ATP production and enhance fission activity, resulting in cell death (Greene,

Whitworth et al. 2003, Whitworth, Theodore et al. 2005, Lutz, Exner et al. 2009). Loss of

Parkin activity also results in the loss of a cellular monitor of dysfunctional mitochondria,

whereas overexpression of Parkin could help to protect against toxicity and mark damaged

mitochondria for degradation (Petrucelli, O‘Farrell et al. 2002, McBride 2008, Narendra,

Tanaka et al. 2008).

Phosphatase and tensin homolog-induced putative kinase 1 (PINK1, also known as

PARK6) is a mitochondrial serine/threonine kinase that functions as a sensor of

mitochondrial or cellular stress and is thought to prevent mitochondrial dysfunction

(Bossy-Wetzel, Schwarzenbacher et al. 2004, McBride 2008). Studies have shown that

loss-of-function mutations in PINK1 result in defects in mitochondrial morphology,

dynamics, and function. This leads to an imbalance in mitochondrial fusion and fission in

Drosophila (Lutz, Exner et al. 2009). Moreover, high levels of PINK1 kinase activity are

important for the translocation of Parkin to mitochondria, whereas overexpression of Parkin

alone results in a cytosolic localization (Yang, Ouyang et al. 2008, Geisler, Holmstrom et al.

2010, Vives-Bauza, Zhou et al. 2010). Studies have demonstrated that Parkin targets

dysfunctional mitochondria and recruits PINK1 to damaged mitochondria with low

85

membrane potential to promote autophagic degradation after treatment of cells with CCCP

(Narendra, Jin et al. 2010). The Parkin-PINK1 mechanism depends on voltage-dependent

inhibition in the clearance process. Through the proteolytic cleavage function of PINK1,

cleaved fragments are cleared by the proteasome (Narendra, Jin et al. 2010). Overall,

signals such as an increase in ROS production or a reduction in Δψ recruit the cytosolic

form of Parkin and PINK1 to fragmented mitochondria, which promotes the engulfment of

mitochondria by autophagosomes for degradation (McBride 2008, Narendra, Tanaka et al.

2008).

Mitophagy plays an essential role during differentiation when the elimination of

mitochondria is required, such as during the differentiation of reticulocytes into erythrocytes

(red blood cells). The autophagic gene Nix (also called Bnip3L) (Sandoval, Thiagarajan et

al. 2008) is upregulated in erythroid cells during terminal differentiation (Aerbajinai, Giattina

et al. 2003, Sandoval, Thiagarajan et al. 2008). Nix, a BH3-only member of the Bcl-2 family,

induces mitophagy by disrupting the Δψ(Sandoval, Thiagarajan et al. 2008). Therefore,

autophagy is important for maintaining homeostasis during development, differentiation,

and macromolecule synthesis and degradation (Mizushima and Levine 2010).

Mitophagy is also important for maintaining the number and function of mitochondria

during differentiation and de-differentiation. Knockdown of growth factor erv1-like (Gfer) in

ESCs upregulates dynamin-related protein 1 (DRP1) and results in decreased pluripotency

marker expression, smaller embryoid bodies (EBs), and loss of mitochondrial function (i.e.

mitochondrial membrane potential, cytochrome c expression). Knockdown of Gfer in ESCs

was also associated with fragmentation of mitochondria and an increase in apoptosis that

reduced the number of cells but did not affect differentiation ability (Todd, Damin et all.

2010) By contrast, overexpression of Gfer in ESCs reduced the expression of DRP1 and

86

maintained pluripotency marker expression, the size of EBs, mitochondrial function (i.e. the

mitochondrial membrane potential), and mitochondrial morphology (elongated with

well-defined cristae). The findings suggest that Gfer modulates mitochondrial fission activity

to preserve mitochondrial function while maintaining pluripotency status in ESCs. Another

study investigated the response of ESCs to a reduction in mitochondrial membrane

potential induced by treatment with CCCP. Moreover, the study demonstrated that Parkin

was upregulated in clustered perinuclear mitochondria when mitochondrial function was

attenuated by CCCP treatment (Narendra, Tanaka et al. 2008, Vives-Bauza, Zhou et al.

2010, Mandal, Lindgren et al. 2011). These observations may suggest that mitophagy is

the mechanism that controls mitochondrial quality within hESCs. hESCs do not contain a

large number of mitochondria during the inner cell mass-derivation stage. In addition,

hiPSCs exposed to a reprogramming factor were reprogrammed and transformed into cells

with an hESC-like morphology from somatic cells. iPSCs and hESCs have similar

metabolic and mitochondrial properties.

87

Chapter 3: Methods and Procedures

3.1 Cell Lines and Cell Cultures

All reagents were purchased from Invitrogen (Carlsbad, CA, USA) unless otherwise

stated. Human embryonic stem cell (hESC) lines were cultured on human foreskin

fibroblasts (hFFi) as a feeder and Matrigel with DMEM/F12 + 20% knockout serum

replacement (KOSR) + 1x L-glutamine solution (L-glut) + 1x non-essential amino acids

(NEAA) or conditioned medium (CM). HEK 293FT cells were cultured in DMEM with 10%

FBS for 2 to 3 days between passages. The hESC lines (Mel1, hES3, or H9) were cultured

using inactivated human foreskin fibroblasts as a feeder in DMEM/F12 with L-glut

supplemented with 20% KOSR, 1x NEAA, and 90 µM β-mercaptoethanol. For short-term

experimental purposes, hESC lines were maintained on Matrigel with conditioned medium,

which was collected from inactivated hFFi, and hESC culture medium. Cells were

passaged after the addition of 4 mg/ml collagenase I for 5 minutes and washed twice with

DMEM/F12. Cells were gently scraped to break colonies into clumps. Cell clumps were

centrifuged at 1,000 rpm for 3 minutes, resuspended in fresh KOSR medium, and gently

transferred to a new dish coated with hFFi cells at 7,000 cells/cm2 or Matrigel.

3.2 Harvesting and Passaging Cell Cultures:

(A) Human fibroblasts

At 80% confluence, cells were observed under microscope before splitting. Before

undergoing the splitting process, the culture medium, 1x PBS (wash solution) and TrypLE

(to detach cells from surface) were pre-warmed to 37°C and the culture medium in the cell

culture flask was suctioned off and discarded. Cells were then washed once with 1x PBS to

remove all remnants of the culture medium. The 1x PBS was removed through suction and

88

TrypLE was added and incubated with the cells at 37°C for 10 minutes until the cells were

detached from the surface (checked by microscope). A fixed volume of additional fresh

culture medium was added to attenuate the activity of TrypLE by dilution. Cells were split

1:4 or 1:6 and transferred to a new flask together with the growth medium with the contents

described using: 500 µl for each well for a 24-well plate, 1.5 ml for each well in a 6-well

plate, 4 ml total for small flasks and 15 ml total for medium flaks. After each splitting, the

flask was marked with a new passage number.

(B) Human embryonic stem cells (hESCs) co-cultured with human feeder (hFFi) or

hESCs grown on Matrigel

At 80% confluence, cells were observed under microscope before splitting. Before

splitting, the culture medium, 1x PBS (wash solution) and Collagenase V (1 mg/ml) (to

detach cells from surface) were pre-warmed to 37°C and then the original culture medium

on the cell culture flask was suctioned off and discarded. Cells were then washed for one

time with 1x PBS to remove all the remnant of the culture medium. The 1x PBS was

removed and Collagenase V was added to the cells at 37°C for 3 minutes until the cells

were detached from the surface (checked by microscope). hESCs co-cultured with hFFi

with hESCs‘ culture medium (DMEM/F12 with L-Glut supplemented with 20% KOSR, 1x

NEAA and 90 µM β-Mercaptoethanol). hESCs grown on Matrigel with conditioned medium

(CM) (McElroy and Reijo Pera 2008). The preparation of CM was collected the hESCs‘

culture medium from the hFFi (20,000 cells/cm2) every day for one week and filtered with

0.22μm filter after adding an additional 4 ng/ml bFGF. The Matrigel-coated plates were

prepared by slowly thaw the BD Matrigel hESC-qualified Matrix (BD, #354277) stock

solution on ice at 4°C to avoid gel formation and dilute the Matrigel stock solution (1:15) in

cold DMEM/F12 medium. Incubate the Matrigel-coated plates for 1-2 hour(s) at room

89

temperature or overnight at 4°C. A fixed volume of fresh culture medium was added to stop

the activity of Collagenase V. Cells were usually split into 1:4 or 1:6 and transferred to a

new growth flask together with the growth medium with the contents described as follows:

500 µl for each well of a 24-well plate, 1.5 ml for each well of a 6-well plate, 4 ml total for

small flasks and 15 ml total for medium flaks.

(C) Differentiation of hES Cell Cultures: Spontaneous-Differentiation

Spontaneous Differentiation: hESCs were either differentiated spontaneously or in

response to retinoic acid (RA, 10 µM; Sigma-Aldrich) and were allowed to precede for up

to 14 days in T-25 culture flasks (Figure 4.1). Retinoic acid (RA, 10 µM; Sigma-Aldrich)

induced experiment was applied from the method used in this published reference paper

(Parsons, Teng et al. 2011). For these experiments, cells were cultured in DMEM/F12 with

knockout serum replacement medium lacking bFGF and β-mercaptoethanol. DMSO

vehicle was added to the differentiation medium to serve as a negative control. Cells were

atmosphere with 5% CO2.

(D) Differentiation of hES Cell Cultures: Lineage-Specific Differentiation

Methods for the lineage-specific-differentiation of hESCs into ectoderm, endoderm,

mesendoderm, and cardiomyocytes (Fig 4.1).

Directed Ectoderm Differentiation: The differentiation of hESCs into neural lineages

was performed using the method of Briggs and Wolvetang et al (Briggs, Sun et al. 2013).

Briefly, hESCs were attached and transferred to a Matrigel-coated dish and cultured in

N2B7 media supplemented with 10 μM SB431542 (Calbiochem) and 5 μM Dorsomorphin

(DM, also known as Compound C, Sigma-Aldrich) for 6 days. After 6 days, the medium

90

was replaced with N2B7 medium supplemented with 5 μM Dorsomorphin and cells were

cultured for additional 6 days to form neurospheres.

Definitive Endoderm Differentiation: The method for the differentiation of hESCs into

definitive endoderm was according to (D‘Amour, Agulnickk et al. 2005). Once the cells were

70-80% confluent, differentiation was initiated by washing with PBS on Matrigel-coated

dishes and then incubating in RPMI (Invitrogen) containing 100 ng/ml activin A and 25

ng/ml WNT3A (R&D) without FBS (Sigma-Aldrich) for 24 hours. On the second day, cells

were then treated with RPMI containing 0.2% FBS and 100 ng/ml activin A for 24 hours. For

the third day, cells were maintained in RPMI containing 0.5% fetal bovine serum and 100

ng/ml activin A. Cultured cells were characterized after 3 days of differentiation.

Mesendoderm and Cardiomyocyte Differentiation: The differentiation of hESCs into

mesendoderm was performed according to reference (Hudson, Titmarsh et al. 2012).

hESCs cultures were obtained from ASCC StemCore in a conditioned medium (CM) and

expanded by daily exchanging the medium until the colonies were ~90% confluent in the

centre of the wells. CM was then replaced with a basal medium comprised of RPMI 1640

medium supplemented with 2% B27 supplement and 1% penicillin/streptomycin (RPMI

B27). For primitive streak-like cell induction, 20 ng/ml bone morphogenetic protein-4

(BMP-4) and 6 ng/ml activin A were added to the basal medium. The basal medium was

then exchanged for every 3 days. The medium was then replaced by RPMI B27 only and

exchanged for every 2 days until day 16. After this time, cells were cultured in

un-supplemented RPMI B27 and the medium was exchanged for every 2 days. The

difference between the medium contents for mesendoderm differentiation and

cardiomyocyte differentiation is IWP-4, a small molecule inhibitor of Wnt production

(Hudson, Titmarsh et al. 2012). After 3 days of differentiation, the medium for

91

cardiomyocyte differentiation RPMI B27 with 5 µM IWP-4 was added and the medium was

exchanged every 2 days until day 15.

3.3 Cryopreservation of Cell Cultures

Generally, the cells used in this thesis were cryopreserved by re-suspension the

cells in a cryopreservation medium (1 ml) followed by a stepwise freezing (~1°C/minute)

with a ―Mr Frosty‖ (Nalgene) in a -80°C freezer. After 3-5 days, the cryopreserved cells

were then storred in a liquid nitrogen tank until use.

Thawing medium (Fibroblasts: fibroblast DMEM culture medium; hESCs:

conditioned medium) was pre-warmed to 37°C first. The cell suspension of thawed cells (at

37°C) was transferred to a 4 ml of the thawing medium.

Additional thawing medium was then added drop by drop while agitating

continuously. After 500 μl of thawed medium was added the cell suspension was

centrifuged at room temperature at 1000 rpm for 5 minutes. The supernatant was discarded

and the cell pellet was resuspended in another 500 μl thawed medium and again

centrifuged as the condition described above. Lastly, the cell pellet was resuspended in

1000 μl culture medium and seeded in a 6-well plate.

3.4 Karyotypic Analysis

Cells were seeded in T25 flasks and cultured according to the conditions described

above. When reaching confluency, cells were treated with trypsin for 5 to 10 minutes at

37°C before harvest. The trypsin was then neutralized by the culture medium for further

karyotype analysis. Analysis of G-banded metaphase chromosomes was performed on

samples produced according to standard procedures from the School of Medicine at the

92

University of Queensland. Karyotypes were assessed at the cytogenetic laboratory of the

School of Medicine at the University of Queensland.

3.5 Preparation of mtDNA-Depleted Primary Human Fibroblasts

Human fibroblast cells were grown in a complete DMEM medium (Dulbecco‘s

modified Eagle‘s medium supplemented with 50 μg/ml uridine (Sigma-Aldrich), 10% FBS, 1

mM sodium pyruvate (Gibco) and 1% penicillin/streptomycin (P/S) in the presence of 100

ng/ml Ethidium bromide (EtBr) or 100 μg/ml chloramphenicol (CAP) in a high-glucose

medium (4500 mg/ml) (Gibco). EtBr and CAP were kept in the media for 6 weeks. After 6

weeks cells were fed with complete DMEM media without EtBr or CAP for another 2 weeks.

Cells were kept between 30% and 80% confluence with excess fresh medium to ensure an

exponential growth. Cells were harvested followed by the extraction of genomic DNA and

RNA.

3.6 Production of Lentiviral Supernatants and Infection of Target Cells

Lentiviral vectors were produced in HEK293T cells, purchased from Invitrogen.

HEK293T cells are human embryonic kidney cell lines with a eukaryotic expression plasmid

encoding the temperature-sensitive mutation derived from the SV40 large T-antigen

(DuBridge, Tang et al. 1987). In this study, they served as a cell line for packaging and

producing of lentiviral particles. The produced viruses were tested in vitro by transducing to

different cell lines (Appendix Tables 2 and 10) and analysed by the methods described

below.

Infectious lentiviral particles are generally produced via three main lentiviral genes

that are encoded in the retroviral genome. Those include: (1) Gag: encoding a polyprotein

required for viral capsid assembly, (2) Pol: encoding four main enzymes, such as protease,

93

integrase, reverse transcriptase and RNase H required for reverse transcription of the RNA

genome and finally (3) Env: encoding the necessary viral glycoproteins required for

budding at cellular membranes (Llano, Gaznick et al. 2009). Since pENTR-EF1α-TFAM

and pLKO-TFAM shRNAs lack all of the aforementioned viral structural genes, two

additional plasmids encoding the lentiviral structural genes were introduced.

Stocks of all viral plasmids were prepared using Nucleospin Plasmid

Midi-Preparation Kit and stock concentrations were adjusted to 1 μg/μl. Production of viral

particles was conducted over a period of five days according to the protocol elaborated as

follows:

Day 1: Plating the viral packaging cell line. The HEK293T cells were used as the

standard cell line for packaging and producing infectious viral particles. HEK293T

cells were plated at a density of 3x106 cells/flask in a T25 flask in 3 ml aliquots of

medium and were left to grow overnight at 37°C with atmosphere containing 5%

CO2.

Day 2: Transfection of HEK293T cells with viral plasmids: HEK293T cells were

transfected by all employed viral plasmids in the presence of the standard

Lipofectamin plus transfection reagent (Invitrogen). This is an organic polymer with a

high cationic-charge potential to facilitate binding to anionic surface receptors for

promoting the process of endocytosis (Kichler, Remy et al. 1995). To this end,

phenol red-free DMEM/F12 medium without serum, but with other additives were

used to prepare the transfection solution. The transfection solution mixed with

plasmids in each T25 flask was set up as shown in the Appendix Table 10.

94

Meanwhile, all viral plasmids (i.e. viral plasmid or pCMV 8.2, VSVG together with the

Gag/Pol/Env plasmids) were also prepared in phenol red-free DMEM/F12 medium

containing DMEM/F12 medium (500 µl), plus reagent (4 µl), Lipofectamin transfection

regent (LTX, 8 µl). Total plasmid concentration per T25 flask contains 1 μg of viral plasmid,

2 μg of pCMV 8.2 (encoding for Env gene) and 1 μg of VSVG (encoding each for Gag and

Pol gene). The prepared transfection solution was then rapidly added to the viral plasmid

mixture and vortexes. The mixture was incubated at room temperature for 30 minutes. The

medium was then removed from the HEK293T cells and replaced with 4 ml of phenol

red-free DMEMF12 medium with 5% KSR. After 20 minutes, the 2 ml transfection mixture

was dropwisely added to the dish and incubated overnight at 37°C. Next day, the HEK293T

medium was replacd by KSR medium.

Day 5: Harvesting of viral particles and storage: HEK293T supernatants containing

infectious viral particles were filter-sterilized using a 0.45 um nitrocellulose filter. The

aliquots of the sterilized cell-free supernatants were stored at -80°C use.

3.7 Transduction (Infection) of Target Cells

In general, transduction or infection refers to the entry of the virus into the host cell

with certain exogeneous gene sequences being integrated into the cellular genome of the

host. Briefly, target cells (hESCs) were plated in 6-well cell culture plates at a density of

2x105 to 5x105 cells per well in 1 ml aliquots of medium and allowed to grow overnight. For

the second day, the medium of the target cells was removed and replaced with 2 ml of

undiluted viral stock solution containing 8 μg/ml polybrene and 10 ng/ml bFGF. For the

negative controls (i.e. un-transduced cells), viral particles were omitted. Cells were

incubated for additional 6 to 8 hours. Transduction was ultimately stopped by incubating

95

cells in their own medium for 72 hours prior to the harvesting step and also further growing

the cells. To downgrade the transduced cells from Biosafety Level 2 to Biosafety Level 1,

culture medium of cultured transduced cells were harvested after 72 hours of transduction

and filter-sterilized using 0.45μm nitrocellulose filters. The cell-free filtrate was later

subjected to further analysis to assess the absence of virus particle production.

3.8 Cloning of Human EF1α-LC3-GFP and TFAM cDNA

EF1α-LC3-GFP construct, encoding LC3 (GenBank ID: NM_032514), was obtained

from Dr. Prescott as a kindly gift to establish hES3-LC-GFP single cells. The feature of

LC3-GFP plasmid was generated by Tim Tra using the following methods. The

LC3-GFP-pENTRTM-directional plasmid (10 fmole) and the pENTR-EF1α plasmid (10 fmole)

were simultaneously cloned into the pLenti6/R4R2/V5-DEST vector using LR Clonase II

Plus (MultiSite Gateway® Technology; Invitorgen) to generate the expression plasmid of

pLenti6-EF1α-TFAM. After proteinase K digestion, the plasmid was used to transform into

One Shot ® Stbl3 competent E.coli cells (Invitrogen) for plasmid purification and sequence

confirmation. Expression of the LC3-GFP was driven by the EF1α promoter using a

replication-incompetent lentivirus and the LC3-GFP lentivirus plasmid was amplified by

One Shot ® Stbl3 competent E.coli cells (Invitrogen).

The cDNA encoding human TFAM (GenBank: NM_003201) was obtained by

RT-PCR from human embryonic stem cells (hESCs) using TFAM-forward primer (5‘-

CACCATGGCGTTTCTCCGAAG-3‘) and TFAM-reverse primer (5‘-

TTAACACTCCTCAGCACCATATTTTCGTTG-3‘). TFAM cDNA was amplified by PCR.

PCR reactions were performed by using 0.5 μl pFusion high fidelity hot start enzyme with

10 μl of 5x pFusion buffer, 1.5 μl of 10mM dNTP, 1 μl of 10 μM of each pair of forward and

96

reverse primers, 1 μl of 200 ng/μl cDNA and sterile water added to 50 μl total volume. PCR

reaction conditions were set as follows: 98°C for 1 minute, followed by 30 cycles at 98°C for

10 seconds, 56°C for 20 seconds, 72°C for 30 seconds and a final extension at 72°C, for 10

minutes before cooling down at 4°C. The TFAM amplification product was 741 base pairs

(bps) and was analysed by running in 1.5% agarose gel electrophoresis followed by UV

visualization. The product was purified with using the Agarose Gel DNA Extraction Kit

(Roche) and cloned into the pENTRTM-directional entry vector (Invitrogen). The sequence

of the TFAM cDNA was confirmed by PCR amplification and sequencing. EF1α (human

elongation factor-1α) promoter plasmid and EF1α-GFP expression plasmid were kindly

provided by members in the Wolvetang group. The TFAM-pENTRTM-directional plasmid (10

fmole) and the pENTR-EF1α plasmid (10 fmole) were simultaneously cloned into the

pLenti6/R4R2/V5-DEST vector using LR Clonase II Plus (MultiSite Gateway® Technology;

Invitorgen) to generate the pLenti6-EF1α-TFAM expression plasmid. After proteinase K

digestion, the recombination reaction was transformed into One Shot ® stbl3 competent

E.coli cells (Invitrogen) for further plasmid purification and sequence confirmation.

Expression of the TFAM cDNA was driven by the EF1α promoter while using a

replication-incompetent lentivirus.

3.9 shRNA Cloning

shRNA constructs were specific to TFAM to knockdown TFAM (termed TFAMi

shRNA) and a non-specific, control construct (termed ―targetless‖). Anneal 5 μl of 1 μg/μl of

double-stranded oligo (dsOligo) with 5 μl of 10x NEB buffer 2 and 35 μl of sterile water by

heating the sense and antisense sequence at 95°C for 4 minutes. Next step is the slow

cooling down at room temperature for 5 to 10 minutes. Serial dilution of dsOligo to 200 ng

mixed with T4 DNA ligase (New England Biolab) to further perform the ligation reaction with

97

50 ng of pLKO-1 TRC-cloning vector (Addgene) digested by AgeI and EcoRI in order to

insert dsOligo at 95°C, overnight. Transform 5 μl of the ligation mix into XL1Blue competent

E. coli. The reaction mixture was then incubated in ice for 30 minutes and then heat

shocked for 30 seconds and then incubated in ice for another 30 minutes. Afterwards, the

reaction mixture was mixed with 1 ml of LB without antibiotics for 1 hour of shaking 50 to

100 μl of the mixure containing 100 μg/ml ampicillin was applied on LB agar plates.

PCR was used to screen all the possible positive clones which may have inserted

dsOligo. The thermal cycling profile of the PCR reaction was: 95°C for 4 minutes, 36 cycles

at 95°C for 30 minutes, 60°C for 30 minutes and 72°C for 30 minutes and finally extending

at 72°C for 5 minutes. Next, the plasmid DNA was prepared using the plasmid extraction kit

(Macherey) according to the manufacturer‘s instructions. Different clones were inoculated

in 5 ml LB with 100 μg/ml ampicillin overnight at 37°C shaking in the speed of 180 rpm.

They were then transferred to 100 ml liquid with 100 μg/ml ampicillin for 12 hours at 37°C,

180 rpm. The pellets were collected by centrifuging the bacteria supernatant in 50 ml tubes

(BD). A small amount of plasmid DNA with sequencing primer was prepared to sequence

the vector. Lastly, different clones TFAM shRNAs and pLKO-targetless were generated.

pLKO-targetless vector served as used as the negative control.

3.10 Plasmid DNA Purification:

(A) Minipreparation

E. coli cells from glycerol stocks (freeze cultures) containing plasmid were streaked

on an LBamp100 agar plate and grown overnight in a 37°C incubator. Stationary phase

cultures in LBamp100 agar were started by single colonies and incubated overnight while

vigorously shaking at 37°C. 4 ml of overnight bacterial culture was harvested by

98

centrifugation at 200 rpm for 30 seconds at room temperature. The supernatant was

discarded. Plasmids were purified from stored E. coli culture pellets using NucleoSpin

Plasmid Column (Macherey), buffer A1 (resuspension buffer), A2 (lysis buffer), A3

(neutralization buffer), AW and A4 (wash buffers) and AE (eluation buffer). The protocol

followed the manufacturer‘s instructions. The pellets obtained in the previous step were

added to 250 µl of buffer A1 and inverted and vortexed until the pellet were completely

dissolved. Solution was then added 250 µl of buffer A2 and inverted before being incubated

at room temperature for 5 minutes. 300 µl of Buffer A3 was added and the solution was

inverted for several times to mix well before it was poured into a filter attached to a

collecting tube. The lysate was then transferred to the column and centrifuged at 200 rpm

for 5 minutes. The flow through was then removed and 500 µl of buffer AW preheated to

50°C was added to column and centrifuged at 200 rpm for 1 minute. 600 µl of buffer A4 was

added to the column and centrifuged at 200 rpm for 1 minute. The flow through was

discarded and re-centrifuged at 200 rpm for 2 minutes. The plasmid DNA was eluted with

50 µl of buffer AE at room temperature for 1 minute and centrifuged at 200 rpm for 1 minute.

The concentration of DNA was measured by Nano-drop ND-1000 (NanoDrop) before all the

samples were stored at -20°C seal.

(B) Midipreparation

E. coli cells from glycerol stocks (freeze cultures) containing plasmid were streaked

on an LBamp100 agar plate and grown overnight in a 37°C incubator. Stationary phase

cultures in LBamp100 agar were started by single colonies and incubated overnight by

vigorously shaking (200 rpm) it at 37°C. 1 ml of overnight bacterial culture was added into

each flask (100 ml of LBamp100). The flasks were then vigorously shaken at 180 rpm in a

37°C incubator overnight. The bacterial cells were harvested by centrifugation at 200 rpm

99

for 15 minutes at 4°C. The bacterial pellet left on the bottom after centrifugation was stored

at -20°C until being used. The supernatant was discarded. Plasmids were purified from

stored E. coli culture pellets using NucleoBond Xtra Column (Macherey), buffer RES-EF

(resuspension buffer), LYS-EF (lysis buffer), NEU-EF (neutralization buffer), FIL-EF (QIA

filter wash buffer), EQU-EF (equilibration buffer), ENDO-EF (wash buffer) and ELU-EF

(elution buffer). The protocol followed the manufacturer‘s instructions. The pellet obtained

in the previous steps was added into 8 ml of buffer RES-EF and inverted and vortexed until

the pellet was completely dissolved. Solution was then added to the 8 ml of buffer LYS-EF

and inverted before it was incubated at room temperature for 5 minutes. Buffer NEU-EF

was pre-chilled before use: 8 ml was added and the solution was inverted for several times

to mix before it was poured onto a filter attached to a collecting tube. The lysate was then

incubated for 10 minutes on ice and centrifuged at 200 rpm for 10 minutes. 15 ml of buffer

EQU-EF was added to column and the column was slowly emptied by gravity flow. The

supernant of mixture was then added into the column and was allowed to bind to the resin

coated on the column by gravity flow. Several washing steps were conducted and the

following contents would elaborate on these steps. 5 ml of FIL-EF, 35 ml of ENDO-EF and

15 ml of WASH-EF were applied to wash the column slowly through gravity flow. The

plasmid DNA was eluted with 5 ml of buffer ELU-EF. The DNA was then precipitated by

adding 3.5 ml room temperature isopropanol. The solution was mixed and centrifuged at

200 rpm for 60 minutes at 4°C. Supernatant was carefully decanted and discarded. The

pellet obtained after centrifugation was washed with 2 ml 70% room temperature ethanol

and centrifuged at 200 rpm for 60 minutes at 4°C. Supernatant was carefully decanted and

discarded. The pellet was left to air-dry for 10 minutes before being re-dissolved in

100

autoclaved water. Concentration of DNA was measured with Nano-drop ND-1000

(NanoDrop) before samples were stored at -20°C until being used.

3.11 Sequencing of cDNA

The dideoxynucleotide sequencing method was applied to confirm the sequence of

the interested gene. Sanger sequencing was performed using BigDye Terminator reagents

(Applied Biosystems). The sequencing primer was used at a concentration of 10 nM. The

sequencing product was purified by plasmid DNA before sending to the Australian Genome

Research Facility (AGRF) for analysis performed by the chromatograph. The

chromatograph was viewed using Chrome software.

3.12 Genomic DNA Isolation

Total genomic DNA was isolated from cultured human cells using a commercial kit

(Qiagen) and the concentration was determined by NanoDrop 1000 spectrophotometer

(Thermo Scientific). Mitochondrial DNA (mtDNA) copy number was determined by real-time

PCR using an ABI Prism 7500Fast thermocycler (Applied Biosystems). The -ACTIN gene

was simultaneously amplified as a normalization control standard. Amplification was

performed as the procedures described as follows: 95°C for 1 minute, 40 cycles at 95°C for

30 seconds, 52°C for 30 seconds; and final dissociation to generate a melting curve for

verification of amplification product specifically. During PCR amplification, the concentration

of amplified products was measured continuously by measuring fluorescence emission

strength. Then gDNAs were used for quantitative real-time PCR (qPCR) analysis.

101

3.13 RNA Extraction & cDNA Generation

Total RNAs were extracted using Qiagen RNA extraction kit (Qiagen) followed by

DNase treatment (Qiagen) and the same RNA sample was used for quantitation by

real-time PCR, or cDNA cloning. The cDNAs were then synthesized as follows: in a single

reaction, 1 μg of RNA quantified by NanoDrop, (NanoDrop 1000, Thermo Scientific) was

mixed with RNase-free water and 1 μl of oligo d(T)20 (500 μg/ml) (Geneworks) to reach the

final volume of 12 μl, then it was incubated at 65°C for 5 minutes. After incubation, the

reaction was placed on ice before the addition of 4 μl of 5x first-strand buffer and 2 μl of 0.1

M DTT (Invitrogen) and then incubated at 37°C for 2 minutes. Finally, 1 μl (200 U) of

M-MLV reverse transcriptase (Invitrogen) was added into the mixture and was incubated at

37°C for 50 minutes followed by an extension period for 15 minutes at 70°C.The cDNA

generated in previous steps was then used for quantitative real-time PCR (qPCR) analysis.

3.14 Quantitative Real-time PCR (qPCR)

The expression of gene was quantitated using the ABI 7500 real-time PCR detection

system (Applied Biosystem) which uses fluorescein as an internal passive reference dye for

the purpose of normalization of well-to-well optical variation. PCR amplifications were

carried out in a total volume of 10 μl, containing 5 μl of 2x SYBR Green supermix (Applied

Biosystem), 0.2 μl of 10 μM primers and 0.2 μl of cDNA samples mixed with sterile water.

The reaction was initiated at 95°C for 2 minutes, followed by 40 three-step amplification

cycles consisting of 30 seconds denaturation step at 95°C, 30 seconds annealing step at

52°C and 30 seconds extension step at 72°C. The final dissociation stage was run to

generate a melting curve for verifying the specificity of amplification. Real-time qPCR was

monitored and analysed by the ABI 7500 fast optical system software (Applied Biosystem).

102

Single primer in each sample was carried out in triplicate. Relative mRNA levels were

calculated using the comparative Ct method (Applied Biosystem instruction manual) and

presented by their ratio to their biological controls. The fold change in expression of each

target mRNA relative to -ACTIN was calculated as 2-Δ(ΔCt), where ΔCt=Ctgenes-ΔCt -ACTIN.

-ACTIN transcript levels were confirmed to correlate well with total RNA amounts and

therefore were used for normalization throughout. All primer pairs used were confirmed to

approximately double the amount of product within one cycle and to yield a single product

of the predicted sizes. Primers were designed by Seqtool

(http://seqtool.sdsc.edu/CGI/BW.cgi#) or (http://pga.mgh.harvard.edu/primerbank/). At the

end of PCR reactions, the specificity of the PCR products was confirmed after observing

the presence of a single peak while using 2% gel electrophoresis stained with EtBr and

visualized under UV light. For the calculation of PCR efficiencies, standard curves were

generated from assays made with serial dilutions of cDNA from experiments with triplicate,

which enabled the determination of the Ct values and PCR efficiencies of each individual

assay and the calculation of the correlation relation between them. The PCR efficiency (E)

was calculated according to the equation E= (10 [1/-slope] -1). The E is around 110% to 90%

when the slope falls between -3.1 to -3.6. The slope was calculated by plotting the dilution

fold of cDNA versus their Ct values

(http://www.stratagene.com/techtoolbox/calc/qpcr_slope_eff.aspx).

3.15 Cell-Staining protocols

(A) Live-cell staining protocols

The live-cell staining experiments were separated into two parts: (1) JC-1 staining:

Cells were grown in wells with normal culture media. The culture medium was removed

103

and cells were washed with PBS twice for 5 minutes at room temperature. The

mitochondrial membrane potential was determined by using 5, 5‘, 6, 6‘-tetrachloro-1, 1‘, 3,

3‘-tetraethylbenzimidazolylcarbocyanine iodide (JC-1, Sigma-Aldrich). JC-1 is a

fluorescent dye with cationic and lipophilic properties that accumulates in mitochondria

depending on differential membrane potentials. High membrane potential is indicated as

JC-1 aggregates and low membrane potential is indicated as JC-1 monomers. Studies

have shown that JC-1 is the better fluorescent dye compared with other (Salvioli, Ardizzoni

et al. 1997). JC-1 monomers and JC-1 aggregates were emitted at 488 nm (green) and

561 nm (red), respectively. Next, a probe was diluted to the optimal concentration for

working in a buffer (200 µl for 1 well of a chamber slide) and incubated for 30 minutes at

37˚C. Then the cells were washed with PBS twice for 5 minutes at room temperature. The

DNA was counterstained with 10 μM of Hoechst 33258 in PBS and the cells were covered

and incubated for 5 minutes. The cells were then washed with PBS twice for 5 minutes at

room temperature. Images were acquired via a 10x objective lens with a fluorescence

microscope. Each sample was compared with a control. (2) hES-LC3-GFP cells staining

with MitoTracker staining: Cells were grown in wells with normal culture media. The culture

medium was removed and washed with PBS twice for 5 minutes at room temperature.

Mitochondria were marked and determined using MitoTracker Deep Red dye (Invitrogen).

Next, the probe was diluted in a blocking buffer and incubated at 37°C for 30 minutes. The

cells were washed with PBS twice for 5 minutes at room temperature. Images were

acquired through a 10x objective lens with a fluorescence microscope.

(B) Timelapse Image Analysis of Mitophagy in Live hESCs

The hES-LC3-GFP cell line was manually cut and seeded on Matrigel in 6 well

plates and grown to ~80% confluency for 2 days prior to initiating the experiments of

104

phase-contrast timelapse microscopy. The required agent (200 nM rapamycin, 50 µM

CCCP, 100 ng/ml EtBr; Sigma-Aldrich) was added to the medium and cells were

incubated under 5% CO2

induced by withdrawing bFGF for 7 or 14 days, or induced by RA (Sigma-Aldrich). The

cells were washed with PBS, stained with 100 nM MitoTracker Red (Invitrogen) in PBS for

30 minutes at 37°C and then washed again. Finally, the hESC medium was added. The

experiment was continued and each one of the serial images was acquired for every 1

710). Each sample was compared with undifferentiated hESCs. Images were analysed

using Zen 2008 Light Edition software (Carl Zeiss).

(C) Immuno-Staining Protocols: Fixed-cell staining

The cells were grown on coverslips with normal culture media. The culture medium

was removed and washed with PBS twice for 5 minutes at room temperature. The cells

were then fixed with 4% paraformaldehyde solution in PBS for 15 to 20 minutes. They

were removed from the fixation solution and washed with PBS twice for 5 minutes at room

temperature. (When staining nuclear markers, cells require permeabilization while

incubated in 0.1% Triton X-100 in PBS/TBS for 20 minutes at room temperature.) The cells

were washed with PBS twice for 5 minutes at room temperature. The non-specific binding

was blocked by using a sufficient volume of 4% goat serum solution in PBS (200 µl for 1

well of a chamber slide). The cells were incubated for 30 minutes at room temperature.

Next, the primary antibodies were diluted to working concentration with blocking buffer and

added to the cells for 1 to 2 hour(s) at room temperature or 4oC overnight (Appendix Table

9). Then the cells were washed with PBS twice for 5 minutes at room temperature. Next,

the secondary antibodies were diluted to working concentration with blocking buffer before

105

added to the cells for 1 hour at room temperature. The cells were then washed with PBS

twice for 5 minutes at room temperature. The DNA was counterstained with 1 μg/ml of

DAPI in PBS and the cells were covered and incubated for 5 minutes. Then the cells were

washed with PBS twice for 5 minutes at room temperature. The slides were mounted using

Vectashield or ProLong Gold following the manufacturers‘ instructions. Images were

acquired via a 10x objective lens with a fluorescence microscope. Each sample was

compared with the control.

(D) Immuno-Staining hES-LC3-GFP Fixed-Cell Staining

hES-LC3-GFP cells were grown on coverslips in normal culture medium or

differentiation medium. They were fixed with 2% (w/v) paraformaldehyde at room

temperature for 20 minutes and then stained with antibodies to pluripotency markers

POU5F1 (Santa-Cruz Biotechnology) and tumor recognition antigens (TRA-1-60.

Millipore). After incubation with the primary antibody, the cells were washed three times in

phosphate-buffered saline (PBS) and incubated with the appropriate secondary antibody

(1:2,000, goat anti-mouse Alexa 488 (or goat anti-rabbit Alexa 568)-conjugated IgG,

Invitrogen) at room temperature for 30 minutes (Appendix Table 9). The cells were then

washed with PBS and mounted in mounting medium containing DAPI (Sigma-Aldrich).

microscope (Zeiss LSM 710).

3.16 Transmission Electron Microscopy (TEM)

Electron photomicrographs for mitochondrial morphology of hESCs were prepared

as described previously (Graham and Orenstein 2007). In brief, cell pellets were washed

in PBS buffer and fixed with the final concentration of 2.5% glutaraldehyde in PB buffer for

106

15 minutes. Pellets were then post-fixed in osmium tetroxide (OsO4) and dehydrated

through a series of acetone solutions and embedded in epoxy. Thin sections were stained

with uranyl acetate (Fahmy‘s) and lead citrate. Images were acquired by using a

JEOL1010B microscope (Japanese Electron Optics Laboratories, Peabody, MA).

3.17 Flow Cytometry General Protocol

Cells were stained using the following general protocol. The specific protocol is

indicated in the relevant chapter. All flow cytometry analysis was conducted by either an

LSRII or ACCURI flow cytometer (BD Biosciences) with (generally) 10,000 counts taken

from per sample. Negative control was indicated by staining with secondary antibodies for

all analysis to distinguish the signal form noisy background and non-specific binding.

Fluorescence gates for positive cells were set to give false positive rates of <1%.

(A) Live-imaging Flow Cytometry and Data Acquisition

The hES-LC3-GFP cell line was seeded on Matrigel in T-25 flasks and grown for 2

days until ~80% confluent. The desired agent (200 nM rapamycin, 50 µM CCCP, 100

ng/ml EtBr; Sigma-Aldrich) was added to the medium and cells were incubated under 5%

CO2 at 37°C for 2 hours. Differentiation was either spontaneously induced by withdrawing

bFGF for 7 or 14 days or induced by RA (Sigma-Aldrich). The cells were then trypsinized

using TrypLE (Invitrogen) and collected into 15-ml centrifuge tubes. The cells were

washed with PBS, stained with 100 nM MitoTracker Deep Red (Invitrogen) for 30 minutes

at 37°C and then washed again. They were analysed by flow cytometry at 488 nm with

simultaneous fluorescence image captured at 633 nm using the ImageStream system

(Amnis Corporation, Seattle, WA). Data represents the results of triplicate analyses. For all

samples, populations were gated for both GFP and single cells and processed further by

107

spot counting. Once cells of interest were gated, the feature of spot count analysis could

be performed. Spot counts of LC3 punctuate of representative cells were then applied to

the default mask for autophagosome analysis using ImageStream Data Exploration and

Analysis Software (IDEAS) v3.0.

(B) Flow Cytometry for Live-cell Staining

Cells were harvested in a single cell-suspension using trypsin. The suspension was

gently and repeatedly suctioned in and out to break up the aggregates. The cells were

centrifuged for 5 minutes at 1000 rpm and supernatant was removed and resuspended in 1

ml blocking buffer. The non-specific binding was blocked by sufficient volume of 500 µl of

4% goat serum solution in PBS and incubating for 15 minutes at room temperature. Next,

the primary antibodies were diluted in blocking buffer and incubated on ice for 20 minutes

(Appendix Table 9). For controls, only secondary antibodies or vehicles were used. The

cells were washed by centrifuging them for 3 minutes at 1000 rpm and the supernatant was

removed and resuspended in 1 ml of PBS twice for 3 minutes at room temperature. Next,

the secondary antibodies were diluted to working concentration in a blocking buffer and

incubated on ice for 20 minutes (Appendix Table 9). The cells were washed by centrifuging

them for 3 minutes at 1000 rpm and the supernatant was removed and resuspended in 250

µl of PBS for twice. The cells were transferred to flow cytometry tubes on ice and analysis

was conducted by the flow cytometer. Each sample would be compared with a control.

Each sample, representing 10,000 events of counting, was analysed using appropriate

software and measured in triplicate. The flow cytometry data are all the averages of

triplicate experiments.

108

(C) Flow Cytometry for Mitochondrial Staining of Living Cells

The cells were harvested in a single cell-suspension approach using trypsin. The

suspension was gently and repeatedly suctioned in and out to break up aggregates. The

cells were centrifuged for 5 minutes at 1000 rpm and the supernatant was removed and

resuspended in a 1 ml working solution of probes such as MitoTracker Deep Red dyes

(Invitrogen) or 5, 5‘, 6, 6‘-tetrachloro-1, 1‘, 3, 3‘-tetraethylbenzimidazolylcarbocyanine

iodide (JC-1, Sigma-Aldrich) (Appendix Table 9). JC-1 is a fluorescent dye with cationic and

lipophilic properties and it accumulates in mitochondria depending on differential

membrane potentials. A high membrane potential is indicated by JC-1 aggregates and a

low membrane potential is indicated by JC-1 monomers. Studies have shown that JC-1 is

the better fluorescent dye compared with others (Salvioli, Ardizzoni et al. 1997). JC-1

monomers and JC-1 aggregates were emitted at 488 nm (green) and 561 nm (red),

respectively. Next, the probe was diluted into blocking buffer and incubated at 37°C for 30

minutes. The cells were washed by centrifuging them for 3 minutes at 1000 rpm and the

supernatant was removed and resuspended in 250 µl of PBS for twice. The cells were

transferred to flow cytometry tubes on ice and analysis was conducted by the flow

cytometer. Each sample was compared with the corresponding control. Each sample,

representing 10,000 events of counting, was analysed by using appropriate software and

measured in triplicate. The flow cytometry data are all the averages of triplicate

experiments.

(D) Flow Cytometry of Fixed-Cells

The cells were harvested in a single cell-suspension approach using trypsin. The

suspension was gently and repeatedly suctioned in and out to break up aggregates. The

109

cells were centrifuged for 5 minutes at 1000 rpm and the supernatant was removed and

resuspended in 1 ml 2% paraformaldehyde solution in PBS for 20 to 30 minutes with

occasional mixing motion. The cells were washed by centrifuging them for 5 minutes at

1000 rpm. The supernatant was removed and resuspended in the blocking buffer. (This

was repeated to wash away excess paraformaldehyde if necessary). The non-specific

binding was blocked by using sufficient volume of 500 µl of 4% goat serum solution in PBS

and incubating for 15 minutes at room temperature. (If it is staining nuclear markers, the

cells require permeabilisation by being incubated in 0.1% Triton X-100 in PBS incubates for

5 minutes at room temperature.) The cells were washed by centrifuging them for 3 minutes

at 1000 rpm and the supernatant was removed and resuspended in 1 ml of PBS twice. Next,

the primary antibodies were diluted in a blocking buffer for 1 hour at room temperature or

4oC overnight. For controls, only secondary antibodies or vehicles were used. The cells

were washed by centrifuging them for 3 minutes at 1000 rpm and the supernatant was

removed and resuspended in 1 ml of PBS twice for 30 minutes at room temperature. Next,

the secondary antibodies were diluted to appropriate working concentration in a blocking

buffer before added to the cells for 30 minutes at room temperature. The cells were washed

by centrifuging them for 3 minutes at 1000 rpm and the supernatant was removed and

resuspended in 250 µl of PBS for twice. The cells were transferred to flow cytometry tubes

for further analysis undergone by the flow cytometer. Each sample was compared with its

corresponding control. Each sample, representing 10,000 events of counting, was analysed

using proper software and measured in triplicate. The flow cytometry data are all the

averages of triplicate experiments.

110

3.18 Lactate Production and Glucose Consumption

In order to assess lactate production and glucose consumption, 1x105 cells were

seeded for 24 hours before medium collection and filtration through a 0.22um filter.

Triplicate samples were then analysed by using YSI Glucose/Lactate Analyser (YSI 2300

STAT Plus). L-lactate and glucose consumption per cell were calculated according to the

standard curve and converting their concentration (mg/l) to mM by dividing with their

molecular weight (i.e. molecular weight of L-lactate and glucose are 90.08 and 180.15588,

respectively). Cell medium only and normalised control are all subtracted from the

calculation values.

3.19 Detection of Intracellular Total and Oxidised Glutathione (GSH) in Cells

For quantification of the ratio between oxidized glutathione (GSSG) and reduced

glutathione (GSH), cells were trypsined and collected in tubes for counting processes. Cells

were lyzed by adding 100 ul of 5% metaphosphoricacid (MPA, 2.5 g/50 ml) and sonciated

for 10 seconds with 10 seconds of break on ice. Supernatant of each sample was placed on

ice after centrifugation. Aliquots of each sample and standards were then incubated with 40

mM of 4-vinylpyridine at room temperature for 1 hour. Kinetic monitor of optical density was

carried out following the addition of reaction mix that contained 5,5‘-dithiobis-2-nitrobenzoic

acid. The sulfhydryl group of GSH reacted with DTNB (5,5‘-dithiobis-2-nitrobenzoic acid,

Ellman‘s reagent) to produce a yellow colored 5-thio-2-nitrobenzoic acid (TNB) that would

absorbed the fluorescence at 405 nm. The rate of TNB production was directly proportional

to the concentration of glutathione in the samples. Changes in the OD 405 nm values per

minute were converted into the total oxidized glutathione concentrations using the GSH

standard curve (Griffith 1980) (Assay designs).

111

3.20 Intracellular ATP and ADP Concentrations of Mitochondrial Depleted Cells

ATP was measured using bioluminescence based on the procedures of the

luciferin-luciferase reaction (Higashi, Isomoto et al. 1985). The reaction was catalyzed by

luciferase and would emit 450 nm light. Experiments were carried out in triplicate in opaque

384-well tissue culture opaque plates. First, trypsinised cells were collected in tubes and

resuspended in 200 µl PBS. Then is sonicated twice for 10 seconds for each plate and

placed on ice. Cells were centrifuged before beginning the ATP/ADP (EnzyLight ADP/ATP

Ratio Assay Kit, Bioassay Systems, Hayward, CA) and Bradford protein concentration

(Sigma-Aldrich) assays. In 384-well plates, 10 µl of samples or standard, respectively

(Sigma-Aldrich) in the 24.4 µl of the reaction mixture, includes 0.3 µl substrate and 0.3 µl

ATP enzyme. Samples were mixed and incubated at room temperature for 10 minutes. The

ATP signal was allowed to undergo spontaneous decay for 10 minutes in order to reach a

steady state and then measured by a SpectraMax M5 microplate spectrophotometer

(Molecular Devices, Australia) to express by values of relative light units (RLU). After 10

minutes, the ADP in the well was converted to ATP after addition of 2.5 µl ADP converting

reagent. The 2.25 µl of the reaction mixture consisted of 0.25 µl of ADP enzyme. After

10-minute incubation, RLUs were recorded and converted to the amount of ADP with an

ADP standard curve. Under optimal conditions and at concentrations of ATP and ADP from

0 to 30 µM, the RLUs were directly proportional to the amount of ATP and ADP presents

(data not shown). The mean value and standard deviation (SD) of the triplicate samples

were recorded by the SoftMaxPro software and then calculated and normalised to the

protein concentration by Excel (Microsoft).

112

3.21 Statistical Analysis

Data are presented in the form of the mean ± standard deviation (SD) or standard

error (SEM). The statistical differences between two groups were tested by Student‘s t-test.

The statistical differences among more than two groups were tested by two way ANOVA

or student t-test. P value less than 0.05 was considered to show significant differences in

all experiments for multiple comparisons (n=3). Analysis of the data was done using

GraphPad software (version 5, University of Queensland). The plotting of the figures was

done using SigmaPlot or Excel software (Version 8.0, Chicago, IL, U.S.A).

113

Chapter 4: Results

Objective 1: Mitochondrial-Encoded and Mitochondrial Biogenesis-Related Gene

Expression During Lineage-Specific Differentiation of Human Embryonic Stem

Cells

4.1 Phase I: Mitochondrial Changes in Differentiating hESCs

For this study, hESCs (cell line hES3) were allowed to differentiate spontaneously by

withdrawing the pluripotency maintenance factor (basic fibroblast growth factor, bFGF)

from the culture medium or by adding retinoic acid (RA) at the time points shown in Figure

4.1. Differentiation of ESCs is characterized by the loss of pluripotency and upregulation of

lineage-specific transcription factors. Here, cell differentiation was monitored using the

surface antigen marker (or a pluripotency marker) TRA-1-60 (Table 4.1). Flow cytometric

analysis showed a significant decrease in the expression of TRA-1-60 in cells treated with

RA or upon withdrawal of bFGF (Figure 4.2), indicating that the cells underwent

differentiation (Figure S1).

Since it is known that mitochondria provide the energy required for cell differentiation,

their mass is expected to increase during differentiation. We determined the mitochondrial

mass by flow cytometry using fluorescent MitoTracker Red (a dye specific to mitochondria)

and demonstrated a significant increase in mitochondrial mass at day 7, but not at day 14,

during the differentiation (P < 0.05 compared with control, Figure 4.2 and Table 4.1). These

data indicated that there is a temporary increase in mitochondrial mass in the early stage of

spontaneous differentiation (day 7) and a decrease at day 14 of spontaneous

differentiation.

114

Quantitative real-time PCR (qPCR) was then conducted to determine whether and how

the differentiation process (spontaneous and RA-treated) affected mitochondrial gene

expression. We showed that POU5F1 (a pluripotency gene) expression was dramatically

reduced after 7–14 days of spontaneous differentiation and after 3 days of RA treatment

(Figure 4.3A and Table 4.2). Interestingly, mtDNA copy number, determined using D-loop

as a template for PCR, was elevated at day 7, but decreased at day 14 (Figure 4.3 and

Table 4.2). Such profile changes, however, were not seen in cells treated with RA for 3

days, suggesting that the underlying mechanisms of action of these two commonly used

techniques to induce ESC differentiation are quite different.

To test whether the profile changes in mitochondrial genes are dependent on cell line

during differentiation, we next examined two different stem cell lines, hES3 and Mel 1, to

determine whether the effect of differentiation on mitochondrial gene expression could be

duplicated between these two cell lines.

First, we observed that the expression patterns between the mitochondrial genes, ND1

and CYTB, were quite similar in differentiated hES3 cells (Figure 4.3A and Table 4.2). At

day 7 of spontaneous differentiation, the expression level of ND1 remained the same as

that of the control. The level of CYTB in the hES3 cells was 1.36-fold higher (P < 0.05) than

that in the control (Figure 4.3A and Table 4.2). At day 14, the expression of ND1 and CYTB

was almost identical to that of controls. At day 3 of RA treatment, ND1 expression was not

significantly different to that in the control, while CYTB expression showed a 4-fold

reduction (P < 0.05). From our results, the mitochondrial responses of hESCs to

spontaneous differentiation differed widely depending on the hESC lines being used.

115

At day 7 of spontaneous differentiation, ND1 expression in the cell line Mel 1

decreased 2.5-fold relative to that in the control (P < 0.05), but this reduction was not

observed for CYTB (Figure 4.3A and Table 4.2). At day 14 of spontaneous differentiation,

the expression of ND1 was not significantly different from the control, but there was a 3-fold

increase in the expression of CYTB (P < 0.05). At day 3 of RA treatment, the expression of

ND1 was reduced by 10-fold (P < 0.05) in contrast to that of CYTB, which showed a 10-fold

increase (P < 0.05) compared with the control. Our data indicated that mitochondrial gene

expressions may be varied in response to differentiation as well as to the differentiation

method employed. There are differences between cell lines and between differentiation

protocols in terms of mtDNA gene expression.

To examine the genes that regulate mitochondrial biogenesis, expression levels of

TFAM, NRF1, and POLG were assessed (Figure 4.3A and Table 4.2). In the hES3 cell line,

at day 7 of spontaneous differentiation, the expression levels of TFAM, NRF1, and POLG

were reduced by 1.3-, 7-, and 6-fold (P < 0.05), respectively, relative to that in the control

(Figure 4.3A and Table 4.2). At day 14, TFAM expression was reduced by 4-fold (P < 0.05),

and NRF1 and POLG expression reduced by 8- and 7-fold, respectively (P < 0.05). At day 3

of RA treatment, TFAM expression was reduced by 2-fold (P < 0.05), whereas expression

of NRF1 and POLG was not significantly reduced. Despite the inconsistent pattern of

mitochondrial-encoded gene expression, the expression of transcription factors involved in

mitochondrial biogenesis seemed to be steadily decreasing

In Mel 1, the expression level of TFAM remained the same as that of control at day 7 of

spontaneous differentiation, while the expressions of NRF1 and POLG showed a 10-fold

decrease (P < 0.05) (Figure 4.3A and Table 4.2). At day 14, TFAM and NRF1 expression

remained the same as that in the control, but POLG expression increased by 1.1-fold (P <

116

0.05). After three days of RA treatment, TFAM and NRF1 expression remained the same

as that in the control and POLG expression decreased by 3-fold (P < 0.05). Collectively

these data indicated that the expression of known mitochondrial biogenesis-related

transcriptional factors do not necessarily coincide with changes in mitochondrial mass,

mitochondrial copy number, and mitochondrial-encoded genes.

PGC1α is a master regulator in mitochondrial biogenesis and energy expenditure, and

in most cell types, it facilitates the differentiation process by positively regulating the

expression of TFAM and NRF1 (Goffart and Wiesner 2003, Scarpulla 2011). To determine

the role of PGC1α expression during differentiation, hES3 and Mel 1 cell lines were initially

used for the study. In hES3 cells, the expression level of PGC1α showed 14.3- and 7-fold

increase at days 7 and 14, respectively (Figure 4.3A and Table 4.2). After RA treatment,

the expression of PGC1α was markedly elevated by 7.5-fold. In Mel 1 cells, the expression

level of PGC1α mRNA was also significantly elevated at days 7 and 14 during spontaneous

differentiation (1.7- and 2.7-fold, respectively) relative to that in the control (Figure 4.3A and

Table 4.2). At day 3 of RA treatment, the expression level of PGC1α was slightly elevated

(1.2-fold) relative to that in the control. Collectively, these data indicated that mitochondrial

mass and PGC1α expression were transiently elevated during the early stages of hESC

differentiation, suggesting that differentiation is highly dependent on energy consumption.

Surprisingly, PGC1α affects mitochondrial biogenesis in hESCs without influencing TFAM

levels. Thus, PGC1α expression may be an early indicator of mitochondrial biogenesis

during cell differentiation.

117

Morphological Changes in Mitochondria during Differentiation

Changes in mitochondrial morphology during cell differentiation remain mostly

unknown thus far. By TEM, we examined the morphology of hESCs (Mel 1) during

differentiation. Figure 4.3B reveals that mitochondria exhibited an immature morphology

with only few cristae in the cells before differentiation (Figure 4.3B). They possessed more

mature cristae with an orthodox morphology at day 14 of the differentiation process (Figure

4.3C), indicating that mitochondria mature morphologically during spontaneous

differentiation.

We hypothesized that an increase in cellular energy may drive an initial differentiation

of mitochondria or alternatively, it may simply be a consequence of differentiation. One of

the interesting findings in murine erythroleukemia cell differentiation is that the

mitochondrial membrane potential appears to be important in the control of the

differentiation (Levenson, Macara et al. 1982). This finding shows that mitochondria may

regulate cytoplasmic calcium levels at the initiation of differentiation. Therefore, we

attempted to measure the mitochondrial membrane potential in order to address the

hypothesis mentioned above. In general, an accumulation of ratiometric fluorescent dye,

JC-1, within the mitochondrial matrix can be used to assess membrane potential. When the

potential is high, JC-1 aggregates and emits fluorescence in red. In contrast, under low

potential, JC-1 forms monomers and emits fluorescence in green (Salvioli, Ardizzoni et al.

1997, Mandal, Lindgren et al. 2011). In undifferentiated hESCs, we showed that the

mitochondrial membrane potential was low and generally clustered near the center of

hESC colonies (Figure 4.3D). Interestingly, after spontaneous differentiation for 14 days,

cells exhibited a marked increase in membrane potential on the edges of the hESC

colonies with low membrane potential scattered throughout the colonies (Figure 4.3E). The

118

observation suggests that mitochondria become depolarized during the differentiation

process. The mitochondrial transmembrane potential of a subset of differentiated hESCs

has been changed during the differentiation. It is clear that additional work will be required

before achieving a complete understanding of the changes in membrane potential.

Phase II: Mitochondrial Biogenesis during Lineage-Specific Differentiation

During early embryogenesis, stem cells are exposed to different growth factor regimes

to induce the growth of primitive mesendodermal, endodermal, and ectodermal precursor

cells (Thomson, Itskovitz-Eldor et al. 1998). In phase II of the study, we attempted to

evaluate whether mitochondrial-encoded and mitochondrial biogenesis-related

transcription factors are correlated with various between differentiations into the three germ

layers. A general experimental design was carried out with the time points given in Figure

4.1. Expression of cell type-specific genes was used to track the lineage differentiation as

previously described (Reubinoff, Pera et al. 2000).

Ectoderm, endoderm, and mesoderm differentiation were monitored by determining

the expression of POU5F (pluripotency), paired box 6 (PAX6, ectoderm), SRY-box 17

(SOX17, endoderm), insulin-like growth factor 2 (IGF2, endoderm), GATA binding protein 4

(GATA4, endoderm), mix paired-like homeobox (MIXL1, mesoderm), and brachyury (BRY

mesoderm).

Ectoderm Differentiation

When stem cells differentiate into ectoderm cells, they are initially processed from

neural progenitor cells into the neurosphere. The expression of neural-specific markers

during ectoderm differentiation has been previously reported (Briggs, Sun et al. 2013).

Figure 4.4 shows that the mRNA level of PAX6 (neuronal biomarker) was dramatically

119

elevated after 8 and 12 days of differentiation by 517- and 357-fold, respectively, relative to

the control (Figure 4.4 and Table 4.3), a result which is consistent with our previous finding

(Briggs, Sun et al. 2013). The expression of a pluripotency marker, POU5F1, was

attenuated at days 8 and 12 by 4.5- and 16.7-fold, respectively. Mitochondrial-encoded

ND5 and COX3 were transcriptionally upregulated 12-fold and 13-fold, respectively, at day

8 of neural induction (P < 0.05), but returned to baseline levels 4 days after neurosphere

formation. The expression of genes involved in mitochondrial biogenesis, TFAM and NRF1,

were not significantly affected. However, POLG was upregulated 1.6-fold (P < 0.05) at day

8, but its expression returned to baseline levels 4 days after neurosphere formation.

PGC1α mRNA was upregulated 7.8-fold and 2-fold at days 8 and 12, respectively, during

neuronal differentiation. Because gene expression increased and subsequently returned to

baseline, it is suggested that mitochondrial-encoded genes and mitochondrial

biogenesis-related transcription factors are transiently increased during neuronal

differentiation.

Endoderm Differentiation

To induce endoderm differentiation, activin A and bone morphogenetic protein 4

(BMP4) were added into hESCs culture (D‘Amour, Agulnick et al. 2005). We showed that

the mRNA level of SOX17, a member of the SOX family of transcription factors that

contains a high-mobility DNA binding domain, was markedly elevated from days 1 to 3,

whereas expression of POU5F1, a marker for pluripotency, decreased over time (Figure

4.5 and Table 4.4). The expression of genes encoded from mtDNA was either slightly

attenuated (ND5) or remained unchanged (COX3). This finding suggests that SOX17, a

transcription factor encoded by nuclear DNA, plays a role in or its expression may serve as

120

a pivotal marker for endoderm differentiation. The expression of mitochondrial

biogenesis-related genes does not change during definitive endoderm differentiation.

Mesendoderm Differentiation

To investigate the changes in gene expression during mesoderm differentiation,

expression of markers of mesoderm (MIXL1 and BRY), endoderm (IGF2 and GATA4), and

ectoderm (PAX6) were monitored (Figure. 4.6 and Table 4.5). First, we showed that the

levels of mRNA of the mesoderm marker MIXL1 was significantly raised at days 3 and 5

(40- and 7-fold, respectively) and returned to baseline level from days 7 to 16. BRY mRNA

expression was markedly elevated in the early stage at days 3 and 5 (15- and 13-fold,

respectively) and its level returned to baseline value from days 5 to 16. Surprisingly,

expression of endoderm markers (IGF2 and GATA4) increased substantially throughout the

16 days of differentiation, with the levels being much greater than those of mesoderm

markers. The expressions of the latter two genes also lasted longer for up to 16 days. No

changes were found in the ectoderm marker PAX6. The data suggest that stem cells may

differentiate into a mixture of mesodermal and endodermal cell types under our

experimental condition.

Expression of POU5F1 was significantly decreased over the 16 days of

differentiation. On the other hand, ND1, encoded by mtDNA, was upregulated after 7 days

of mesendoderm differentiation (2.2-fold). Most interestingly, the expression of genes

involved in mitochondrial biogenesis (TFAM, NRF1 and POLG) was not affected by the

differentiation into mesoderm.

121

Cardiomyocyte Differentiation

The expression of cardiac-specific markers during cardiomyocyte differentiation

have been previously reported (Hudson, Titmarsh et al. 2012). We investigated the

changes in mitochondrial-related gene expression during cardiac-specific differentiation.

Figure 4.6 shows the expression of genes encoded by mtDNA, in which ND5 was

upregulated 2-fold at day 7, but its expression decreased 10-fold at day 16. In contrast,

COX3 expression did not change significantly during the 16 days of cardiomyocyte

differentiation. Transcription of the mitochondrial biogenesis gene TFAM was significantly

reduced throughout 16 days of cardiomyocyte differentiation. Interestingly, PGC1α mRNA

expression was dramatically elevated (252-fold) after 16 days of cardiomyocyte

differentiation (Figure 4.7 and Table 4.6). These results suggest that ND5 and PGC1α may

primarily affect the early stages of mesoderm differentiation and suggest that PGC1α is a

driver of cardiomyogenesis, which is accompanied by an early upregulation of ND5.

122

Objective 2: Regulation of Mitochondrial Biogenesis in Chloramphenicol- and

EtBr-treated Primary Human Fibroblasts

4.2 Morphology and Karyotyping of Mitochondria-Depleted Cells

Human fetal fibroblasts were cultured for six weeks in the presence of 100 ng/mL EtBr,

an agent that inhibits the replication of mtDNA, or 100 µg/mL chloramphenicol, a widely

used antibiotic that inhibits mitochondrial protein synthesis. The fibroblast culture exhibited

a large amount of dead cells in the presence of EtBr or chloramphenicol within six weekss.

After recovery for two weeks, the proliferation rate of EtBr-treated fibroblasts recovered

significantly more slowly relative to the chloramphenicol-treated cells. Both EtBr- and

chloramphenicol-treated fibroblasts displayed normal karyotypes (Figure 4.8).

Expression of Mitochondrial-Encoded and Mitochondrial Biogenesis-Related Genes

of Mitochondria-Depleted Cells

Human fetal fibroblasts were cultured for six weeks in the presence of EtBr to block

DNA synthesis or in the presence of chloramphenicol to inhibit mitochondrial protein

synthesis, which mimics the six-week antibiotics treatment. To evaluate the ability of

primary human fibroblasts to recover from these mitochondrial insults, fibroblasts were then

cultured under standard conditions for an additional two weeks following the removal of the

drugs. Samples were collected for analysis after six weeks of treatment and after two

weeks of recovery to determine the effect on the expression of mtDNA-encoded genes

posed by EtBr and chloramphenicol, performed via qPCR. As shown in Figure 4.9 and

Table 4.7, both EtBr and chloramphenicol treatments inhibited transcription of

mitochondrial genes, but to various extents. qPCR analysis of the D-loop was used to

123

estimate the mtDNA copy number (i.e., the number of mtDNA molecules per cell). The

analysis revealed that mtDNA was almost completely abolished in EtBr-treated cells,

whereas the mtDNA copy number in chloramphenicol-treated fibroblasts was not

significantly affected.

After cells were treated with EtBr for six weeks, expressions of ND1 and ND4 (both

encoded by mtDNA) were undetectable (Figure 4.9 and Table 4.7). After two weeks of

recovery, however, the expression of these genes rose slightly to 0.07 and 0.11 times that

of untreated control levels, respectively (Figure 4.9 and Table 4.7). Similarly, expression of

CYTB was undetectable after six weeks of EtBr treatment, but increased to only 0.08 times

that of control levels after two weeks of recovery. Expression of COX2 was undetectable

after six weeks of EtBr treatment, but rose to 0.36 times that of control levels after two

weeks of recovery. Following chloramphenicol treatment for six weeks, expressions of ND1

and ND4 were both undetectable. After two weeks of recovery, however, expression levels

of these genes rose to 0.35 and 1.81 times that of untreated controls, respectively (Figure

4.9 and Table 4.7). Expression of CYTB decreased to 0.50 times that of the control levels

after six weeks of chloramphenicol treatment, but did not change after two weeks of

recovery. Expression of COX2 decreased to 0.02 times that of control levels after six weeks

of chloramphenicol treatment, but rebounded to 1.34 times that of control levels after two

weeks of recovery (Figure 4.9 and Table 4.7).

Taken together, these results showed that both EtBr and chloramphenicol lead to a

virtual cessation of mitochondrial gene transcription. The only exception was for CYTB, the

expression of which dropped by only 50% in response to chloramphenicol. After two weeks

of recovery from EtBr treatment, expressions of ND1, ND4, CYTB, and COX2 were still

considerably lower than the corresponding experimental control group. In contrast, after

124

two weeks of recovery from chloramphenicol treatment, expressions of ND1 and CYTB

recovered by 50%. Expression of ND4 and COX2 increased relative to control levels after

recovery from chloramphenicol treatment. It was concluded that inhibition of both protein

synthesis and mtDNA replication would effectively eliminate mtDNA-derived gene

expression with the exception of CYTB in the chloramphenicol treatment condition.

Following the removal of the drug from the medium, mRNA levels began to recover,

although the rate of recovery was highly variable. These findings led us to test how these

different treatments and recoveries were related to mitochondrial biogenesis responses in

the nucleus.

To this end, qPCR was used to evaluate the expression of nuclear-encoded

mitochondrial biogenesis genes, including TFAM, NRF1, and POLG. Expression levels

were determined after six weeks of EtBr or chloramphenicol treatment, and after two weeks

of recovery (Figure 4.9 and Table 4.7), TFAM was chosen because it regulates the

transcription of genes within the mitochondrial genome and interacts with other

transcription factors. TFAM is also a direct transcriptional target of NRF1. After six weeks of

EtBr treatment, TFAM expression levels decreased to 0.42 times that of untreated control

levels, but rebounded to 5.09 that of control levels following two weeks of recovery.

Expression of NRF1 decreased to 0.19 times that of control levels after six weeks of EtBr

treatment, but increased to 2.92 times that of control levels after two weeks of recovery.

Expression of POLG decreased to 0.10 times that of control levels after six weeks of EtBr

treatment, but increased to 1.15 times that of control levels after two weeks of recovery.

After cells were treated with chloramphenicol for six weeks, expression of TFAM decreased

to 0.53 times that of control levels, but increased to 3.53 times that of control levels after

two weeks of recovery. Expression of NRF1 decreased to 0.02 times that of control levels

125

after six weeks of chloramphenicol treatment, but increased to 0.83 times that of control

levels after two weeks of recovery. Expression of POLG decreased to 0.34 times that of

control levels after six weeks of chloramphenicol treatment, but increased to 2.02 times that

of control levels after two weeks of recovery.

Collectively, these data showed that mRNA levels of TFAM, NRF1, and POLG were

downregulated in response to EtBr or chloramphenicol treatment. Recovery from EtBr

treatment, however, involved the upregulation of TFAM and NRF1, whereas recovery from

chloramphenicol treatment involved the upregulation of TFAM and POLG. Thus, primary

human fibroblasts may employ different strategies of mitochondrial biogenesis to recover

from EtBr or chloramphenicol treatment.

Lactate Production, Glucose Consumption, Redox Status, Oxygen Consumption,

and Energy Production

Next, we determined whether the two distinct recovery responses were correlated with

specific metabolic or cellular parameters. Effects of EtBr and chloramphenicol treatment on

mitochondrial function in primary human fibroblasts were investigated with respect to

lactate production and glucose consumption. We showed that the lactate production and

glucose consumption were 2.38 × 10–8 µmmol/cell/h and 1.36 × 10–8 µmmol/cell/h,

respectively, at 48 h (Figures 4.10A, 4.10B and Table 4.8). Reduced GSH and GSSG

levels were 8.46 × 10–4 pmol/cell and 7.46 × 10–5 pmol/cell, respectively (Figure 4.10C and

Table 4.8). EtBr treatment increased lactate production (3.43 × 10–8 µmmol/cell/h), glucose

consumption (2.07 × 10–8 µmmol/cell/h), and the GSSG/GSH ratio. In contrast,

chloramphenicol treatment did not significantly affect the production of lactate (2.49 × 10–8

126

µmmol/cell/h), glucose metabolism (1.25 × 10–8 µmmol/cell/h), or the GSSG/GSH ratio

(Figure 4.10C and Table 4.8).

The next aim was to determine the respiratory activity in control, EtBr-treated, and

chloramphenicol-treated fibroblasts. Figure 4.10D shows that EtBr-treated cells displayed a

90% reduction in oxygen consumption, whereas chloramphenicol-treated cells showed only

approximately a 20% reduction. To compare the effects of EtBr and chloramphenicol

treatment on mitochondrial function in primary human fibroblasts, the ratio of ATP/ADP was

measured. This difference in mitochondrial energy production level directly reflected the

energy status of the cells, with EtBr-treated cells displaying a 76% reduction in the

ATP/ADP ratio and chloramphenicol-treated cells exhibiting a more modest 30% reduction

in the ATP/ADP ratio (Figure 4.10E and Table 4.8). These results suggest that

mitochondrial dysfunction is higher in fibroblasts treated with EtBr than in those treated with

chloramphenicol and are consistent with the observation that EtBr results in a greater redox

imbalance and severely alters glycolytic flux.

Mitochondrial Membrane Potential (Δψm)

Δψm was visualized using JC-1 staining and quantified via FACS analysis. In fibroblast

treated with EtBr, red fluorescence associated with JC-1 (high Δψm) was decreased to 0.68

times that of the control value, whereas green fluorescence (low Δψm) was similar to control

levels. Neither high nor low IMM potentials were significantly affected in

chloramphenicol-treated cells. These data indicated that EtBr treatment reduced the

number of mitochondria with a high Δψm (Figure 4.11 and Table 4.9). Such effect was not

observed in cells treated with chloramphenicol.

127

Transmission Electron Microscopy of Mitochondria

Both EtBr- and chloramphenicol-treated fibroblasts displayed normal karyotypes and

morphologies (Figure 4.8). At the ultra-structural level, however, differences between EtBr-

and chloramphenicol-treated cells were observed. Transmission electron microscopy

indicated that control cells contained homogeneous, elongated mitochondria with an oval,

budding, or spindle appearance. In addition, wild-type mitochondria had transverse or

oblique parallel cristae. In contrast, EtBr-treated fibroblasts contained round, fragmented

mitochondria and were very few in number. Cristae within these mitochondria were either

absent, generating ghost-like mitochondrial scaffolding, or formed a disorganized whorled

pattern. Chloramphenicol-treated cells possessed a normal number of mitochondria, but

they seemed immature with morphologically abnormal cristae (Figure 4.12) (King, Godman

et al. 1972). Collectively, these data indicated that EtBr treatment caused oxidative stress,

loss of mitochondria with high Δψm, and morphological impairments to mitochondria. The

effects of EtBr treatment were much more severe than those observed after exposure to

chloramphenicol.

128

Objective 3: Manipulation of TFAM Expression in Human Embryonic Stem Cells

4.3 TFAM overexpression in hESC lines

hESCs were engineered to overexpress recombinant TFAM in ESCs (Norrman,

Fischer et al. 2010) using human elongation factor-1α (EF1α) as a promoter. This process

was achieved by constructing TFAM cDNA with the pLenti6 vector. hESCs expressing

green fluorescent protein (GFP) served as vehicle controls. hESCs were transduced with

these lentiviruses and selected for stable overexpression of TFAM by culturing in medium

containing 1 μg/mL blasticidin for one week. qPCR was then used to measure both

endogenous and exogenous TFAM mRNA levels in blasticidin-resistant clones of hESCs.

In three distinct hES cell lines (Mel 1, hES3, and H9), the EF1α-TFAM construct

increased TFAM expression (2.06-, 1.71-, and 1.65-fold, respectively) (Figure 4.13, Table

4.10 and Figure S2). In addition, the mtDNA copy number determined using D-loop as a

template increased 28-fold in hES3 and 5-fold in H9 compared with controls, but did not

increase in Mel 1 cells. Essentially, overexpression of TFAM did not affect the morphology

of hESCs, but resulted in increased cell proliferation in all three cell lines. However, these

cells had low viability after being frozen for storage. During the first 2–3 passages, the

plating efficiency was reduced to <3%. The sensitivity of the TFAM-overexpressing hESCs

in the condition of freezing and/or thawing created a substantial technical barrier for the

study.

129

TFAM repression in hESC Line: Development of cell line with constitutive repression

of TFAM

Lentiviral transduction was used to assess the effects of both constitutive and inducible

repression of TFAM in hESCs (Figure S9). Preliminary data demonstrated that TFAM

expression was repressed at different levels by different shRNAs. Unexpectedly, the

expression of TFAM was elevated 2.5-fold and 2-fold when targeted by shRNA to the

sequence 266–286 and 591–611 in Mel 1 cells, respectively (Figure 4.14). When the

position 618–638 was targeted, the expression of TFAM was reduced by 20% (Figure 4.14).

Moreover, constitutive knockdown of TFAM in hESCs substantially induced cell death,

making subsequent experimentation difficult. Inducible knockdown of TFAM expression in

hESCs was used to circumvent these difficulties.

TFAM Repression in hESC Lines: Development of cell lines with inducible repression

of TFAM

Genetic knockout of Tfam resulted in mouse embryonic death (Larsson, Wang et al.

1998). In addition, constitutive knockdown of TFAM in hESCs appeared to affect their

survival and pluripotency, making it difficult to analyze these cells. To circumvent these

difficulties, an inducible system was used to suppress TFAM expression in hESCs (Figure

4.15, Table 4.11 and Figure S3). With this strategy, transfected cell lines were apparently

stable. To induce knockdown, the cells were treated with doxycycline (4 μg/mL) for three

days. Cells without doxycycline treatment were used as a control. Vector transformation

was selected using 2 μg/mL puromycin for one week. The results of qPCR analysis

130

indicated that all hESC clones selected by the antibiotic expressed the TFAM knockdown

construct (Figure 4.15 and Table 4.11).

To assess the efficiency of the shRNA-mediated TFAM knockdown, hESCs were

exposed to doxycycline and the levels of TFAM mRNA were determined. The effects were

different in the three hESC lines. In addition, different target sites within the TFAM mRNA

resulted in different levels of repression. When exon 5 was targeted (TFAMi-3), TFAM

expression was repressed 5-, 1.3-, and 1.8-fold in Mel 1, hES3, and H9 cells, respectively

(Figure 4.15A and Table 4.11). Targeting exon 7 (TFAMi-5) resulted in 30- and 2-fold

repression in Mel 1 and H9 cells, respectively.

Flow cytometry was also used to determine the levels of TFAM in these cells.

Targeting exon 5 reduced the TFAM levels 7-fold in Mel 1 cells, 1.8-fold in hES3 cells and

2-fold in H9 cells (Figure 4.15B-C and Table 4.11). Targeting exon 7 reduced the TFAM

protein levels 6-fold in Mel 1 cells and 2-fold in H9 cells.

The effects of reduced TFAM expression on the morphology of hESCs were also

examined. The morphologies of Mel 1 cells were not affected by reduced TFAM expression

(Figure 4.16). The proliferation rates appeared to be similar between the control without

virus transduction and the virus-transduced cell lines without any addition of doxycycline.

Next, the proliferation rates between virus-transduced cell lines in the presence and

absence of doxycycline were mutually compared. The proliferation rate was slower in

virus-transduced cells in the presence of doxycycline compared with those in the absence

of doxycycline.

More extensive reduction in the expression of TFAM was seen in H9 cells than in the

two other cell lines (Figure 4.16). A similar observation was made when TFAM was

131

inducibly repressed via exon 7 targeting. These inducible knockdown lines were easier to

grow after being frozen in contrast to those constitutively expressed for TFAM. However,

high levels of cell death were still seen in these TFAM knockdown cells in culture. Once

again, this result created a considerable technical barrier for the study on the effect of

TFAM downregulation on cell differentiation.

132

Objective 4: Mitophagy in Human Embryonic Stem Cells

4.4 Characterization of Autophagosome in GFP Reporter Cell Line

The establishment of an hESC line expressing the LC3-GFP fusion protein has been

previously reported (Tra, Gong et al. 2011) and yet, it was difficult to recover the

hES-LC3-GFP cells from the frozen storage. A new hES3 cell line that expresses the

LC3-GFP fusion protein was therefore prepared and adapted in our study to allow single cell

growth as described in the Materials and Methods. Punctuated green dots within these cells

represent autophagosomes (Figure 4.17A). Under normal culture conditions, this

hES-LC3-GFP line exhibited a diffused distribution of GFP fluorescence throughout the

cytosol with typically one or two fluorescence punctates (Figure 4.17A). The expression of

pluripotency markers POU5F1 and TRA-1-60 in these cells is also shown (Figure 4.17B and

Figures S4 and S5)

Mitophagy in hESCs by Time-Lapse Microscope

Since mitochondrial turnover remained to be investigated, levels of autophagy and

mitophagy in hESCs were assessed next. To determine the extent of mitophagy, the

hES-LC3-GFP reporter line was labeled with MitoTracker Red and the extent of

co-localization of GFP and MitoTracker Red was analyzed. First, hES-LC3-GFP cells were

treated with reagents known to induce mitochondrial damage, such as rapamycin (an

inducer of autophagy), carbonyl cyanide m-chlorophenyl hydrazone (CCCP, a mitochondrial

membrane potential uncoupler) (Figure S6), and EtBr (a mtDNA replication inhibitor).

Time-lapse microscopic examination of MitoTracker-labeled hES-LC3-GFP cells treated

with CCCP or EtBr revealed that these agents triggered mitophagy in an asynchronous

133

manner within the individual cells from 0 to 10 minutes followed by changes in the colonies

(Figure 4.18A–D, Videos 4.1–4.4 and Figures S7 and S8). The occurrence of mitophagy

during differentiation was examined. Mitophagic events were increased between 0 to 20

minutes of differentiation compared with the control (Figure 4.18E, Video 4.5 and Figures S7

and S8). Therefore, mitophagy appears to be a dynamic process.

The biological significance of mitophagy taking place in hESCs was further

investigated. First, a time course analysis of EtBr treatment was conducted in hESCs. EtBr

triggers widespread and rapid mitophagy across the colonies of the cells within the first 16

hours (Figure 4.18F, Video 4.6 and Figures S7 and S8). After one week of exposure to 100

ng/ml EtBr, cell death occurred in a significantly higher number of hESCs than the controls

(Figure 4.18G-H, Video 4.7-4.8 and Figures S7 and S8).

Quantification of Mitophagy Using Live Cell Cytometry

The number of autophagosomes was subsequently determined using AMNIS

live-imaging flow cytometry in order to quantify mitophagic events. Compared with that in the

DMSO-treated control, the number of autophagosomes was clearly higher in hESCs treated

with rapamycin, CCCP, or EtBr (Figures 4.19A and 4.20 and Table 4.12). Because it is

technically difficult to determine spot count using the AMNIS live cytometer (as a result of

the two fluorescence images), >500 images captured under each experimental condition

were manually scored. The number of autophagosomes that were positively stained for

MitoTracker was determined. In control samples, hESCs possessed an average of one

autophagosome and one mitophagosome per cell. The majority of the cells contained zero

to two autophagosomes, whereas some cells exhibited as many as five or more

autophagosomes (Figures 4.19B and 4.20 and Table 4.12). In samples treated with

134

rapamycin, CCCP, or EtBr, the number of autophagosomes increased to one to two per cell.

In addition, the average number of mitophagosomes also increased to one to two per cell (P

< 0.05, Figures 4.19B and 4.20 and Table 4.12). In samples treated with rapamycin, CCCP,

or EtBr, the majority of cells possessed two to three autophagosomes, whereas some cells

exhibited up to fifteen autophagosomes. The average number climbed to three to four per

cell (P < 0.05, Figures 4.19B and 4.20 and Table 4.12). Therefore, induced mitochondrial

dysfunction (i.e., dysfunction brought about by the addition of rapamycin, CCCP, or EtBr)

resulted in an enhanced autophagic process, which was related to mitophagy.

As indicated above, control levels of autophagosomes and mitophagosomes within

hESCs were 0.69 and 0.65 per cell, respectively (Figure 4.19B and 4.20 and Table 4.12). In

RA-treated or spontaneously differentiated cells, at days 7 and 14, the average number of

autophagosomes was 1.6, 1.4, and 0.83 per cell and that of mitophagosomes was 1.4, 1.2,

and 0.8 per cell, respectively (Figure 4.19B and 4.20 and Table 4.12). For autophagosomes,

at days 7 and 14, most cells exhibited one to two autophagosomes, whereas some cells

possessed up to five autophagosomes per cell. Average values climbed to 3.1, 3.0, and 2.1,

respectively (Figure 4.19B and 4.20 and Table 4.12). The number of autophagosomes

ranged from two to three. These data demonstrated that during the early stages of hESC

differentiation, both autophagosome formation and mitophagy increased. TEM analysis

showed that hESCs treated with rapamycin, CCCP, or EtBr (24 hours) had fragmented

mitochondria with very few cristae (Figure 4.19C). Furthermore, more mitochondria inside

the autophagic vacuoles were detected in these cells as compared with controls (Figure

4.19C).

135

Chapter 5: Discussion

Objective 1: Mitochondrial-Encoded and Mitochondrial Biogenesis-Related Gene

Expression During Lineage-Specific Differentiation of Human Embryonic Stem

Cells

The levels of mtDNA can affect oocyte maturation, which occurs after fertilization,

and embryo differentiation (Spikings, Alderson et al. 2007). A number of studies have

shown that mitochondrial maturation is involved in the differentiation process (Cho, Kwon et

al. 2006). However, the role of mitochondrial-encoded genes and genes related to

mitochondrial biogenesis remains mostly unknown. To the best of our knowledge, our study

is the first to describe the expression profiles of these genes during spontaneous

differentiation, lineage-specific differentiation (in the ectoderm, endoderm, and mesoderm),

and specific cell-type differentiation (neuronal and cardiomyocytic). The first objective was

to determine the gene expression patterns of mitochondrial-encoded and mitochondrial

biogenesis-related genes during spontaneous and directed lineage-specific differentiation.

MtDNA Copy Number and mtDNA-Encoded Gene Expression during Spontaneous

Differentiation

Dynamic changes (e.g. downregulation of pluripotency genes, upregulation of

differentiation genes and a shift to a different set of metabolic enzymes) in the early phase

of cellular differentiation have been recently observed (Prigione and Adjaye 2010, Prigione,

Lichtner et al. 2011). Yet, differentiation and changes in mitochondrial gene expression

may not always occur concurrently (Facucho-Oliveira, Alderson et al. 2007). We have

shown that the mtDNA copy number was significantly elevated at the 7th day of

spontaneous differentiation and gradually reduced by the 14th day (Figure 4.3). In addition,

136

the expression of the pluripotency markers TRA-1-60 and POU5F1 was downregulated

during differentiation, thus suggesting that the expression of mitochondrial-related genes

may be transient. We studied the expression of two mitochondrial-encoded genes, ND1

and CYTB, and found that ND1 expression was significantly downregulated at day 7 in

spontaneous and RA-induced differentiation of the Mel 1 cell line; however, there was no

significant subsequent change in its expression at day 14. The level of CYTB, however,

was significantly upregulated at day 14 (Figure 4.3 and Table 4.2). This result suggests that

the expression of mitochondrial-related genes may be transient.

It has been reported that different cell lines at various stages of pluripotency may show

similar gene expression (Giritharan, Ilic et al. 2011). Our finding, however, has shown that

different hES cell lines exhibited different mitochondrial-encoded gene expression at the

same time point during differentiation. Different copy numbers of mtDNA were observed

when the cells were differentiated using different induction protocols. Amplification of the

D-loop region also seemed to trigger transcription of genes encoded by mtDNA. It was

surprising to find that dynamic changes in gene expression were seen in different cell lines

at various time points. We further showed that the apparent discrepancy of mtDNA copy

number obtained by using different treatments might be due to the level of differentiation

obtained with the different treatments at various time points, which affected the level of

mitochondrial replication. However, there is limited information attributed to this finding;

hence, additional work is required to achieve a complete understanding of this result.

137

Expression of Mitochondrial Biogenesis-Related Genes during Spontaneous

Differentiation

In recent years, several reports have described mitochondrial biogenesis-related gene

expression during differentiation of hESCs. When hESCs are allowed to differentiate

spontaneously (by removing the basic fibroblast growth factor 2 (bFGF2), KOSR and the

feeder layer), the expression of both mtDNA-encoded and mitochondrial biogenesis-related

genes is upregulated (Cho, Kwon et al. 2006). However, our results suggest that the

expression of genes encoding mitochondrial biogenesis-related transcription factors (TFAM,

NRF1 and POLG) may not coordinate with the expression of mitochondrial

biogenesis-related transcription factors upon spontaneous differentiation. Undoubtedly, it

remains to be determined whether the difference is due to the use of different cell lines or

differentiation protocols.

The changes in gene expression at various time points during spontaneous hESC

differentiation remain elusive. The differentiation of mESCs is initially associated with

decreased mtDNA copy number, but this number gradually increases as pluripotency

markers are downregulated (Facucho-Oliveira, Alderson et al. 2007). Our data are

consistent with the notion that there may have been a difference in mitochondria number in

undifferentiated and differentiated stem cells. The transcription levels of TFAM, NRF1 and

POLG, which may not be the main mitochondrial biogenesis-related transcription factors,

were not increased during hESC differentiation.

Cellular differentiation is often accompanied by changes in gene expression and

enzymatic activities associated with the mitochondrial oxidative phosphorylation process

(Wieckowski, Giorgi et al. 2009). The results obtained in the present study further

138

demonstrated that mitochondria in undifferentiated hESCs exhibit an immature morphology.

In addition, differentiated hESCs possessed more JC1 aggregates than undifferentiated

cells, indicating a higher mitochondrial membrane potential in the differentiated cells. These

results suggest that mitochondrial differentiation is associated with early cellular

differentiation; this could indicate that energy produced from mitochondria is needed during

the differentiation process, as proposed in the study by Tormos et al (Tormos, Anso et al.

2011). Genes involved in mitochondrial biogenesis (e.g. polymerase RNA (POLRMT),

mitochondrial transcription termination factor (MTERF), TFBM1/2, NRF1/3 and UCP2/4)

are downregulated upon differentiation (Zhang, Khvorostov et al. 2011). Our results

demonstrated that mitochondrial-content increases in response to early spontaneous

differentiation and that the master of mitochondrial biogenesis-related genes (PGC1α) is

also responsible for early spontaneous differentiation.

Lastly, ROS can function as a signal that triggers adipogenesis (Tormos, Anso et al.

2011). During the early stages, adipocyte differentiation, oxygen consumption and ATP

production were upregulated and a PPAR-gamma-dependent transcriptional cascade was

initiated. This implied that changes in mitochondrial metabolism, which occurred during

differentiation, might have resulted from the evolving energy demands or from the

production of ROS; this could lead to characteristics of aging as a result of ROS

overproduction (i.e. the mitochondrial theory of aging) (Adhya, Mahato et al. 2011, Yamada,

Furukawa et al. 2011). Therefore, the increase in ROS production upon differentiation may

be implied.

139

MtDNA-Encoded and Mitochondrial Biogenesis-Related Gene Expression during

Lineage-Specific Differentiation

Mitochondrial properties are altered during the process of lineage-specific

differentiation in early gastrulation (Baker 1964) and neurogenesis (Cordeau-Lossouam,

Vayssiere et al. 1991). The increase in mitochondrial mass that accompanies each step of

neurogenesis produces large variations in mitochondrial protein levels (Cordeau-Lossouam,

Vayssiere et al. 1991). In this section, the results of the study on lineage-specific

differentiation help to understand that the mitochondrial biogenesis also requires precise

coordination between the mitochondrial and nuclear genomes.

Neural differentiation:

Neurons are metabolically active cells with high energy demands, but the expression

profiles of mitochondrial-encoded and mitochondrial biogenesis-related genes remain to be

determined. Our results revealed that the expression of genes, which were involved in

mitochondrial biogenesis, was elevated after 8 days of neurosphere formation, but reduced

at day 12. First, we showed that the differentiation may result in an increase in

mitochondrial-encoded gene expression, suggesting that the mitochondrial genome has

been replicated. Second, one of the most significantly upregulated mitochondrial

biogenesis-related genes, which we identified as PGC1α, had elevated expression after 8

days of neuronal-specific differentiation, whereas the expression of TFAM, NRF1 and

POLG was not significantly upregulated when compared to PGC1α. The latter result is

similar to that reported by Marchetto et al. in 2010 (Marchetto, Carromeu et al. 2010), which

revealed that the expression levels of TFAM, NRF1 and POLG either remained the same or

decreased. The results suggest that PGC1α is probably one of the early genes potentially

140

involved in the upstream regulation of mitochondrial biogenesis upon neuronal

differentiation. However, PGC1α expression was upon neural differentiation, and therefore,

further investigation is needed to study the relative ROS production, antioxidant-related

gene expression, and protein expression. Our data indicated that PGC1α could be a driver

for mitochondrial biogenesis-related gene expression in mitochondrial regulation during

neural differentiation.

Endoderm differentiation

Next, we demonstrated that mitochondrial-encoded and mitochondrial

biogenesis-related genes played important roles in the early differentiation of hESCs into

the endoderm. TFAM, NRF1, POLG and PGC1α have been reported to be involved in and

be responsible for the distinct regulation of endoderm differentiation (Kanai-Azuma, Kanai

et al. 2002, Grapin-Botton and Constam 2007, Kim, Yoon et al. 2011, Spence, Mayhew et

al. 2011, Teo, Arnold et al. 2011). The results of our study are similar to those of the study

by Spence et al. which showed low TFAM, NRF1, POLG and PGC1α expression upon

activin-induced definitive endoderm formation and mimicking embryonic intestinal

development (Spence, Mayhew et al. 2011). As shown in previous studies, mRNAs derived

from mtDNA (e.g. CYB and ND1) are expressed throughout the small intestine and colonic

epithelium in humans (Macpherson, Mayall et al. 1992) and expression levels of

mitochondrial rRNAs and mRNAs in these tissues are somewhat similar to those in

immature enteroblasts. Interestingly, some researchers also reported higher levels of

mitochondrial mRNA and TFAM expression in immature enteroblasts as compared with the

mature cells of the villus (D‘Amour, Agulnick et al. 2005). We observed a different result in

our study of the early endoderm-specific differentiation (Figure 4.5); this discrepancy is due

to the fact that the maturation of villus cells occurs only 50–60 days after differentiation. In

141

addition, mitochondrial biogenesis-related gene expression patterns within specific

endodermal cell types were not analyzed. Therefore, in future studies, the duration of

endoderm differentiation could be extended in order to further understand the mechanism

involved in enterocyte maturation related to mitochondrial biogenesis.

Mesendodermal or cardiomyocyte differentiation

The heart is a very important organ that is heavily dependent on oxidative energy

generated from mitochondria. Distorted structure and dysfunction of the mitochondria are

found in patients associated with cardiovascular diseases. The heart is also the first organ

to mature in an embryo. For this reason, it was our strategy to utilize differentiating

cardiomyocytes in this study to investigate the expression of mitochondrial-encoded and

mitochondrial biogenesis-related genes in order to understand the role of mitochondria in

cell differentiation. In addition, the study may provide an insight for regenerative medicine

since cardiomyocytes cannot be reproduced in patients with ischemic damage. Our results

are consistent with those obtained by Salomonis et al. (Salomonis, Nelson et al. 2009) that

showed that the expression of PGC1α was markedly upregulated, whereas that of TFAM

and NRF1 was is downregulated upon mesendoderm and cardiomyocyte differentiation.

On the other hand, there were no significant changes in the expression of POLG. PGC1α is

known to be a key factor involved in the induction of mitochondrial biogenesis in many

tissues (Kelly and Scarpulla 2004) and its expression is upregulated after osteogenic

differentiation of human mesenchymal stem cells or after cardiomyocytic differentiation of

mESCs (Pietila, Lehtonen et al. 2010). PGC1α is proposed to be acting, upstream of both

TFAM and NRF1, as a master genetic switch. However, our study showed that upregulation

of PGC1α expression was not accompanied by increased TFAM and NRF1 expression,

142

suggesting that PGC1α utilizes an alternative signal transduction pathway, which is

independent of TFAM and NRF1, to upregulate mitochondrial activity.

During cellular differentiation, mitochondria must also differentiate and mature via

processes involving both structural and functional changes, such as changes in the

mitochondrial membrane potential. In developing cardiomyocytes, changes in

mitochondrial activity occur at both the pre- and post-natal stages of development, which

are associated with the upregulation of oxidative phosphorylation and an increase in

mtDNA copy number. We showed that the mitochondrial-encoded genes (ND1 and ND5)

were upregulated at the 7th day of mesendoderm and cardiomyocyte differentiation. Here,

we attempted to study the correlation between mitochondrial-encoded genes and

mitochondrial biogenesis-related transcription factors in cardiomyocyte differentiation.

We examined several genes encoded by mtDNA and genes related to mitochondrial

biogenesis. It was surprising to find that, during hESC differentiation, the expression levels

of several mitochondria-related genes did not correlate with levels of PGC1α. Interestingly,

PGC1α is consistently upregulated in spontaneous, RA-induced, ectoderm-specific, or

cardiomyocyte-specific differentiation, but not in endoderm-specific differentiation.

Differences in the temporal expression patterns during the transition of undifferentiated to

differentiated hESCs might have been the result of the variable half-lives of mitochondrial

mRNAs (Nagao, Hino-Shigi et al. 2008). Different lineage-specific differentiations, such as

ectoderm-specific and cardiomyocyte-specific differentiations, displayed different patterns

in mitochondrial biogenesis. In summary, we conclude that the specific nucleus-encoded

mitochondrial biogenesis-related transcription factors have different gene expression

patterns upon lineage differentiation. Therefore, in future studies, we will focus primarily on

evaluating the feasibility of changes in mitochondrial biogenesis upon differentiation of

143

hESCs in a time manner and gain a better understanding of the role of mitochondria during

differentiation.

This study did not address the molecular mechanism explaining how mitochondrial

maturation is associated with differentiation (St John, Ramalho-Santos et al. 2005, Cho,

Kwon et al. 2006, St John, Amaral et al. 2006). Many researchers indicated their

observation of mitochondrial maturation upon differentiation. In this study, we measured

gene expression levels, but we were unable to find enough evidence to explain the

molecular mechanism of role of mitochondrial maturation in differentiation. Therefore,

additional studies will need to be carried out to determine the possible effect of mtDNA

copy number and to explore whether mitochondrial maturation is responsible for the

mitochondrial activity in different hESC lines. First, the protein levels of the pluripotency

markers (TRA-1-60 and POU5F1), lineage-specific biomarkers, mitochondrial-encoded

genes, and mitochondrial biogenesis-related genes should be analyzed using a western

blot to determine their significance in the process of differentiation. Another consideration is

to examine mitochondrial functions by looking into mitochondrial respiration, membrane

potential, energy metabolism (ATP/ADP, glucose uptake and lactate production), and the

level of reactive oxygen species (DCF or mitoSOX red staining or GSH/GSSG) in order to

gain an insight on mitochondrial metabolism during differentiation. Finally, the molecular

mechanism of PGC1α in the mitochondrial biogenesis signaling pathway (Scarpulla 2008)

could be investigated to explain how it could respond to lineage-specific differentiation.

PGC1α seems to be an early indicator of the upregulation of mitochondrial biogenesis in

the lineage-specific differentiation of hESCs. Overall, a combination of these experimental

results would provide unique and valuable insights into the regulation of mitochondrial

biogenesis in stem cell differentiation.

144

Objective 2: Regulation of Mitochondrial Biogenesis in Chloramphenicol- and

EtBr-treated Primary Human Fibroblasts

Defects in mitochondrial function due to mtDNA mutations or chemicals that affect

mitochondrial protein function lead to a range of pathologies, often serious (Zeviani and

Antozzi 1997, Lane 2006). The exact mechanism by which mitochondrial impairments

cause the wide range of observed pathologies remains to be determined. Some studies

have shown that, during the early preimplantation stage, there is limited or no active

mitochondrial replication (Cao, Shitara et al. 2007, Wai, Ao et al. 2010). A minimum mtDNA

copy number threshold is required before the cells of the fertilized oocyte can differentiate

into various tissues. The second objective was to investigate the effects of mitochondrial

depletion on human fibroblasts and hESCs. The novel finding in this study was that there is

compensation in the expression of mitochondrial-encoded and mitochondrial

biogenesis-related genes after removing the treatments.

In the present study, mitochondrial functions were impaired by treating the cells with

EtBr (an inhibitor of mtDNA replication) or chloramphenicol and the impacts of these two

drugs on mitochondrial function and nuclear expression of mitochondrial biogenesis

regulators was compared. Both drugs impaired mitochondrial function, albeit to a different

extent, and led to the differential expression of both mtDNA-encoded genes and nuclear

transcription factors that control mitochondrial biogenesis. This study is the first to

demonstrate that established human fibroblast cell lines devoid of characteristic mtDNA

markers can be obtained from cell populations exposed to EtBr for a long time. Each cell

may contain different mitochondrial content, and each mitochondrion may contain 1–10

145

mtDNA. The mitochondrial mass or content of a cell will affect its mtDNA copy number.

Here we report the generation of characterized primary human fibroblasts, which exhibited

a substantial reduction in mtDNA levels and a concomitant reduction in respiratory-chain

enzyme activities.

The data derived in this study showed that the inhibition of protein synthesis (by

chloramphenicol) or of mtDNA synthesis (by EtBr) caused severe reductions in the

transcription of mtDNA genes, with the exception of CYTB, after chloramphenicol exposure.

After two weeks of recovery from chloramphenicol treatment, some genes encoded by the

mitochondrial genome (ND1 and CYTB) exhibited partial recovery of expression. Other

mtDNA genes (ND4 and COX2) exhibited an overcompensation (i.e. expression levels

were higher after recovery than those before the treatment). However, the cells only

showed a minor recovery from mitochondrial genome depletion by EtBr treatment. EtBr and

chloramphenicol, therefore, had different effects on mitochondrial transcription in human

fibroblasts. In response to both treatments, TFAM expression was upregulated. In contrast,

POLG expression was upregulated by chloramphenicol and NRF1 expression was

upregulated by EtBr. We do not know why the cells choose to employ these different

compensatory mechanisms. Seeking to identify cellular parameters underlying these

different responses, we found that EtBr-treated cells exhibited a reduced Δψm, an

increased lactate/glucose ratio, morphologically abnormal mitochondria, and increased

oxidative stress-effects that were generally not observed in chloramphenicol-treated cells

(Soslau and Nass 1971, Storrie and Attardi 1973, Stuchell, Weinstein et al. 1975, Lipton

and McMurray 1977, Wiseman and Attardi 1978). The EtBr data closely resembles that

previous studies performed with HeLa and C2C12 cells (Hayashi, Ohta et al. 1991, Joseph,

Rungi et al. 2004), which showed that the elimination of mtDNA causes deficiencies within

146

the electron transport chain, an increase in intracellular ROS, a metabolic shift towards

glycolysis, increased lactate production, reduced ATP synthesis and lower Δψm. These

changes collectively resulted in the upregulation of NRF1 and TFAM expression. It should

be noted, however, that increases in NRF1 and TFAM mRNA expression do not

necessarily affect protein levels (Davis, Ropp et al. 1996, Miranda, Foncea et al. 1999).

TFAM may be less stable in the absence of mtDNA (Miranda, Foncea et al. 1999).

Replication and transcription of mtDNA depend on proteins encoded by genes on the

nuclear genome, such as NRF1 and TFAM (Scarpulla 2006, Scarpulla 2008). In agreement

with this notion, disruption of NRF1 or TFAM in mice leads to reduced levels of mtDNA and

lethality during early stages of embryogenesis (Larsson, Wang et al. 1998, Huo and

Scarpulla 2001).

Chloramphenicol inhibits mitochondrial protein synthesis and delays muscle

regeneration (Wagatsuma, Kotake et al. 2011) and in a reversible manner (Rebelo,

Williams et al. 2009). Surprisingly, the data obtained in this study revealed, after the

chloramphenicol treatment was stopped, NRF1 was not up-regulated during recovery.

Rather, this recovery process involved POLG and TFAM, suggesting that the inhibition of

mitochondrial protein synthesis elicits a different retrograde signal than that triggered by

mtDNA depletion. The data in this study suggest that the chloramphenicol-based signal

does not involve the ATP/ADP ratio, the Δψm, altered glycolytic flux, or altered oxygen

consumption, as these parameters were not affected by chloramphenicol treatment.

As the mtDNA copy number goes down, so do respiratory chain activities. In

EtBr-treated fibroblasts, respiratory activity dropped more rapidly than in

chloramphenicol-treated ones, possibly because of the toxic side effects associated with

EtBr. Similar decreases in respiratory function (including complex activities and oxygen

147

consumption) have been observed in ρ° cells (King and Attardi 1989). EtBr-treated cells

exhibited lower levels of mtDNA expression and respiratory activity. Once mtDNA levels

dropped beneath a certain level, the cell‘s bioenergetic status rapidly deteriorated. This

result suggests that each cell has a mtDNA threshold beneath which it cannot maintain a

sufficient level of energy production. It is likely that cells have a surplus of mtDNA

molecules that extend well above this mtDNA threshold, which could protect the cell from

sporadic mutations to the mtDNA. The results in this study have shown that reductions in

Δψm, together with the elevation in lactate formation, suggested oxidative phosphorylation

(OXPHOS) impairment. However, there was a clear decrease in the red/green fluorescence

ratio in the treated group, and some cells failed to show a lower Δψm after EtBr treatment.

Interestingly, some cells with ρ° status maintained a normal Δψm independent of impaired

OXPHOS. Despite the apparent impairment in OXPHOS in the treated groups, the amount

of mtDNA per cell did not decrease over time with EtBr treatment (Buchet and Godinot

1998). According to King and Attardi (1996) (King and Attardi 1996), it is impossible to

isolate ρ° derivate of all human cell lines using EtBr. Our results suggest that the

mitochondrial content may not be erased completely and some mitochondrial activity

remains in some cells.

Depletion of mtDNA genes resulted in the reduction of mitochondrial-encoded gene

expression. In the present objective, the fibroblasts initially showed a decrease in the

amount of mtDNA when treated with EtBr, but they subsequently regained normal levels of

mtDNA after being withdrawn from treatments. The amount of mtDNA was increased in

treated cells compared with controls, as exemplified by a lower ΔΨm and higher levels of

lactate production. The higher levels of lactate production might correspond to a cellular

alternative for the generation of ATP by the glycolytic process. In both treatments, the

148

mtDNA replication might be due to the failure of RNA polymerase to transcribe mtDNA,

leading to a decline in Δψm. Finally, the data in this thesis could provide insights into the

response of human cells to mtDNA depletion

In future, additional studies should be carried out to determine if other effects on the

depletion of mtDNA copy number are observed with different dosages of EtBr and

chloramphenicol in different cell lines; these studies should include the use of two or more

fibroblasts and two or more hES cell lines. A higher resolution of mitochondrial

morphologies examined by TEM would also benefit us with more information in this study.

Recently, few practitioners and researchers have become aware that the mutant

mitochondrial DNA can carry over and affect the differentiation of embryonic stem cells into

various cell types, a discovery that can possibly help prevent the transmission of

mitochondrial diseases to one‘s offspring (Tanaka, Sauer et al. 2013).

In summary, the results presented in this thesis demonstrated that treatment with EtBr

and chloramphenicol affect the mtDNA replication to different degrees. By characterizing

the mitochondrial-encoded and the nucleus-encoded mitochondrial biogenesis-related

genes in mitochondria-depleted cells subjected to two different treatments, it is shown that

chloramphenicol interferes with mtDNA replication and results in a moderate depletion of

mtDNA copy number and function to a larger extent as compared with EtBr. The

observations guide us to understand that the reduction in mitochondrial gene expression

could be a signal of the retrograde recovery of mitochondrial biogenesis-related

transcription factors as an example of altered nuclear gene expression. However,

additional mechanisms of retrograde mitochondrial signaling, such as mitochondrial

autophagy, remain to be investigated.

149

Objective 3: Manipulation of TFAM Expression in Human Embryonic Stem Cells

When generatingrho-minus cells with which to investigate how the mtDNA copy

number affects hESC survival, one of the main challenges is that cells cannot survive

without mitochondria. The third objective waso establish hESC lines in which TFAM was

overexpressed or knocked down and to characterize the effects of TFAM expression on

mitochondrial biogenesis during the proliferation of hESCs. The purpose of this study was

to test the hypothesis that TFAM expression is associated with mtDNA copy number and

cell proliferation in hESCs. The study was the first to manipulate TFAM expression in

hESCs. An expression vector was used to overexpress TFAM, while TFAM-specific short

hairpin RNAs (shRNAs) were used to suppress TFAM expression in three hESC lines (Mel

1, hES3, and H9).

We observed different expression levels of TFAM in various hESC lines, suggesting

that these cells use different mechanisms to regulate mtDNA. The results presented here

showed that TFAM overexpression results in an increase in mtDNA copy number to various

degrees in different hESC lines. EF1α-TFAM hESCs exhibited higher rates of proliferation

relative to control cells. Previous studies have shown that the overexpression of TFAM in

other cell types resulted in an increase in mtDNA copy number (Larsson, Wang et al. 1998,

Ekstrand, Falkenberg et al. 2004, Kanki, Ohgaki et al. 2004), whereas the knockdown of

TFAM resulted in a decrease in mtDNA. Interestingly, it has been reported in the study by

Ylikallio et al. (2010) that the high mtDNA copy number is associated with cell death

(Ylikallio, Tyynismaa et al. 2010) which is possibly, because C-MYC (MYC) binds to the

TFAM promoter (Li, Wang et al. 2005) to regulate cell proliferation and energy metabolism

150

by regulating glycolysis (Zeller, Jegga et al. 2003). This result suggests that MYC may

upregulate TFAM expression in hESCs, thereby acting as a master switch to control

mitochondrial biogenesis and to couple the metabolic needs of a cell to its growth and

proliferation.

This observation is supported by a previous demonstration that the C-terminal tail of

TFAM is critical for binding to the light-strand and heavy-strand promoters (Malarkey,

Bestwick et al. 2012). TFAM that lacks a C-terminal tail retains the ability to bind DNA, but

does not activate transcription (Pastukh, Shokolenko et al. 2007). Overexpression of TFAM

restores memory impairment (including working memory and hippocampal long-term

potentiation), attenuates the mitochondrial production of ROS and limits mtDNA damage in

aged mice (Hayashi, Yoshida et al. 2008). The optimal stoichiometry is five molecules of

TFAM per copy of mtDNA. However, TFAM-mediated transcriptional activity is reduced or

eliminated if the TFAM:mtDNA ratio exceeds five (Garrido, Griparic et al. 2003, Kanki,

Nakayama et al. 2004) Both endogenous and exogenous TFAM bind mtDNA to form a

mitochondrial-nucleoid complex (kanki, Nakayama et al. 2004). Consequently, a decrease

in TFAM expression may lead to reduced mtDNA copy number, which may disrupt

oxidative phosphorylation in organs. This result may explain that the overexpression of

TFAM in hESCs was not compatible with survival well after thawing. It is possible that

overexpression of TFAM stimulates cell proliferation, which may lead to insufficient levels of

ATP production. However, EF1α-TFAM hESCs typically had low survival rates during the

first 24 hours for 1–2 passages. hESCs that overexpress TFAM could grow, but they could

not be re-thawed; this may have been a result of increased levels of ROS during the early

stages of plating. Additional experiments are needed to determine the level of cell

proliferation and the rate of ATP and ROS production before and after freezing.

151

Because TFAM may affect mitochondrial transcription and replication, inhibition of

TFAM would result in some mitochondrial dysfunction. The extent of the damage caused by

mitochondrial dysfunction can vary greatly depending on the type of tissue or cell, but

muscle and heart tissues are particularly sensitive to this effect. In mice, homozygous

TFAM knockout embryos exhibited severe mtDNA depletion with abolished oxidative

phosphorylation and died before complete embryo development at day 7.5, whereas the

heterozygous mice exhibited reduced mtDNA copy number and respiratory chain

deficiency in the heart (Larsson, Wang et al. 1998). Our preliminary data indicated that

downregulation of TFAM affected the in vitro survivability and proliferation of hESCs.

Several factors could have also influenced the outcome of this study (cell death

induced after knockdown of TFAM). The experimental design in the present study revealed

that there are some discrepancies in comparison with previous reports. Therefore, in the

future, some additional studies should be carried out:

(1) To analyze and determine the mechanisms by which constitutive and inducible

repression of TFAM results in cell death, although there are no studies documenting

cell death in TFAM knockout stem cells;

(2) To use other strategies for manipulating TFAM expression in different hESC lines in

order to determine mtDNA copy number, mitochondrial gene transcription,

mitochondrial respiration, cell proliferation, cell survival, and pluripotency on

differentiated cells;

(3) To ultimately determine any other possible changes in mitochondrial function (such as

changes in mitochondrial respiration and membrane potential), energy metabolism

(ATP/ADP, glucose uptake and lactate production), and ROS level (DCF, mitoSOX red

staining, or GSH/GSSG). Moreover, higher resolution investigations of cell and

152

mitochondria morphologies should be conducted using light and transmission electron

microscopy.

The importance and role of an upregulated PGC1α expression should be evaluated in

the lineage-specific differentiation of hESCs. Manipulation of PGC1α expression in these

cells may provide insights into the mechanism underlying the involvement of mitochondria

in the differentiation of hESCs into specific cell lineages.

In summary, the results of this study revealed that downregulation and upregulation of

TFAM expression decreased and increased mtDNA expression, respectively, suggesting

that TFAM must be expressed at tightly controlled levels for cell survival and to maintain

mitochondrial functions.

153

Objective 4: Mitophagy in Human Embryonic Stem Cells

The autophagic process breaks down cellular components and plays a particularly

important role during periods of starvation or when organelles are damaged.

Autophagosomes allow each cell to maintain a critical balance between the synthesis,

degradation, and recycling of cellular structures. Therefore, it is not surprising that

autophagy plays a significant role in cell growth and homeostasis during development. It is

thought that autophagy is essential for healthy aging and longevity. The last objective was

to compare mitochondrial turnover (mitophagy) following exposure to mitochondrial toxins

and during the differentiation of hESCs. This study investigated the processes that occur

during differentiation- and toxin-induced mitophagy. The primary aims were: (1) to establish

the LC3-GFP system as a means to measure mitophagy quantitatively; (2) to understand

the dynamics of mitophagy when cells are challenged with toxins that affect mitochondrial

function; and (3) to understand the dynamics of mitophagy during hESC differentiation.

The fourth objective was to determine whether mitochondrial turnover is essential in

maintaining optimal cellular function for cell differentiation. In regards to mitochondrial

turnover, there is little evidence illustrating the mechanism by which it occurs. In this study,

differentiation and toxic stimuli were used to demonstrate that mitochondrial turnover in

hESCs occurs via the uptake of mitochondria into autophagosomes, a process called

mitophagy. To this end, a sensitive method using live-imaging flow cytometry (AMNIS) was

used for the determination of mitophagy. First, we showed that mitophagy in hESCs is

triggered by interfering mtDNA replication and mitochondrial membrane potential. Second,

increased levels of mitophagy were found to be associated with hESC differentiation, either

spontaneous or RA-induced. Spontaneous differentiation was initiated by removing

154

pluripotency maintenance factors from the culture medium. At day 7 of spontaneous

differentiation, mitophagy levels were elevated, but they returned to baseline by day 14. The

short window of mitophagy (during a time of differentiation and mitochondrial biogenesis)

reflects the removal of mitochondrial components contaminated by free radicals in order to

ensure that a healthy population of mitochondria is present for cell differentiation.

The high rate of mitophagy found in our study seemed to contradict some

characteristics of differentiated hESCs with elevated mitochondrial gene expression,

increased mtDNA copy numbers and a more mature mitochondrial morphology. Autophagy

plays an important role in the degradation of maternal RNA and proteins during mammalian

embryonic development (Mizushima and Levine 2010). Mitochondria with low membrane

potentials or excessive ROS production could trigger mitophagy. Furthermore,

differentiation-induced mitophagy may selectively cull the germ line copies of mtDNA that

contain mutations, as reported in mouse models (Yang, Przyborski et al. 2008). Here, our

preliminary data showed that, during the early stage of differentiation, hESCs may

selectively eliminate defective mitochondria via mitophagy; however, the detailed

limitations of the mechanisms involved in the initiation of mitophagy during cell

differentiation remain to be addressed as follows:

We need to show the pluripotency status (the loss of stem cell markers POU5F1 and

TRA-1-60) of the undifferentiated hESCs before and after EtBr and rapamycin

treatments and the early differentiation of hESCs subjected to retinoic acid treatment.

It is necessary to further test whether the upregulation of autophagic or mitophagic

events are equally associated with treatments and/or retinoic acid treatments, as

indicated in the early differentiation phase, in relation to time and dosage.

Mitophagy-related markers, such as PINK1 and PARK and autophagy markers need to

155

be established in future studies to understand specific mitophagic mechanisms.

Since CCCP triggers an increase in the number of autophagosomes and in mitophagic

activity, we need to use CCCP to depolarize mitochondrial membrane potential and

fragments, as described by (Narendra, Tanaka et al. 2008), to further explore

whether mitophagy plays a role in scavenging the damaged mitochondria and, thus,

in maintaining the quality of hESCs. Furthermore, it is important to examine whether

mitophagy precedes the expansion of mitochondria upon differentiation and

selectively removes damaged mitochondria to prevent the accumulation of mtDNA

mutations. Interestingly, PTEN-induced putative kinase 1 (PINK1) has been shown to

be selectively accumulated in damaged mitochondria that possess a low membrane

potential due to depolarization] caused by CCCP (Acton, Jurisicova et al. 2004).

Parkinson protein 2 (PARK2/PARKIN) ubiquitinates the voltage-dependent anion

channel 1 (VDAC1) and plays a role in generating mitochondrial outer membrane

potential, and recruits P62, an autophagy receptor, to the mitochondria damaged by

autophagy. P62 interacts with microtubule-associated protein 1/light chain 3 alpha

(MAP1LC3A/LC3) on the phagophore surface, leading to engulfment by the

autophagosomal structure and subsequent lysosomal degradation (i.e. mitophagy).

The mechanism of mitophagy still remains to be determined and reinforced in which

an early mitochondrial turnover could associate with the mechanism of

PINK1/PARK2/P62/LC3-dependent mitophagy upon differentiation of hESCs.

One of the strategies in this study was to expose hESCs to EtBr for various time

intervals (short-term exposure, such as 20 minutes, two-hour exposure followed by

observation for 16 hours, and long-term exposure). Images acquired by time-lapse

microscopy showed that the early stage of mitophagic events occur within 20 minutes to

156

two hours of EtBr treatment, while a significant upregulation of mitophagic events occurred

within 16 hours. Eventually, the images revealed that there was significant cell death after

EtBr treatment for one week. Such mitophagy may be responsible for the high rate of cell

death observed in this study.

The identification of mitophagy in hESCs with the modulation of mitochondrial turnover

in either hESCs exposed to toxins or upon hESC differentiation represents the first steps in

understanding the role of mitophagy and mitochondria in hESC differentiation.

Nevertheless, we have shown that: (1) all autophagy in hESCs with EtBr or

CCCP-treatment appears to be mitophagy, (2) rapamycin could induce mitophagy (Figure

4.18) and (3) mitophagy increases during hESC differentiation, which may be either

spontaneous or retinoic acid-induced. The conclusion of this study is that the differentiation

of hESCs was accompanied by an increase in both mitochondrial biogenesis and

mitochondrial turnover. In future, some experiments are required to determine whether

other factors may interfere with mitophagy and indirectly affect mitochondrial quality. It is

also worth mentioning here that we demonstrated the up-regulation of the expression of

mitochondrial and autophagy markers in differentiated hESCs. The use of knockdown

technique to measure expression levels of mitophagy-associated genes (e.g., PARK2 or

PINK1) could be considered in the future in a parallel study of autophagy-associated genes

(e.g., Atg5 or LC3). These studies will help to further delineate the similarities and

differences between mitophagy and autophagy. To this end, we could selectively

manipulate mitophagy that would be relevant to clinical applications using hESCs or human

inducible pluripotent stem cells (hiPSCs), particularly the applications involving iPSCs

obtained from older individuals who have accumulated mtDNA damage.

157

This study demonstrated for the first time that mitophagy occurs in hESCs. It also

provided evidence that during or immediately preceding hESC differentiation, mitophagy is

involved in the selective turnover of mitochondria, which may represent a mechanism of

optimizing or controlling mitochondrial quality within differentiating hESCs. A better

understanding of the molecular mechanisms that control mitophagy in hESCs may facilitate

the manipulation and improve the quality of hESCs that can be used in regenerative

medicine.

158

Chapter 6: Final Conclusion

While most studies of human pluripotent stem cells have focused on changes in the

expression of nuclear genes during differentiation (Cho, Kwon et al. 2006, Saretzki, Walter

et al. 2008), relatively little attention has been paid to mitochondrial gene expression during

this process. mRNA changes do not necessarily result in protein expression changes

because protein levels are also controlled by mRNA translation, protein stability, and protein

turnover. In the present study, we investigated some of the changes in mitochondrial gene

expression in stem cells differentiating into three specific lineages, namely, ectoderm,

endoderm, and mesoderm.

Our results revealed that different hESC lines (hES3 and Mel 1) possess different

differentiation capabilities and mechanisms for regulating mtDNA expression. We further

found that the transcription of peroxisome proliferator-activated receptor gamma

coactivator 1 alpha (PGC1α) gene is upregulated as the cells differentiate into ectoderm or

mesoderm (Watkins, Basu et al. 2008). Changes in mitochondrial gene expression

observed during lineage-specific differentiation possibly reflect changes necessary for the

metabolic maturation of mitochondria.

The main finding in the second study was the apparent and different gene expression

patterns before and after treatmnt in human of fibroblasts with agents that interefere with

mitochondrial translation or DNA replication. Inhibition of mtDNA or protein synthesis

resulted in altered expression of both the mtDNA-encoded proteins and the nuclear

transcription factors that control mitochondrial biogenesis, and the existence of different

compensatory mechanisms.

The main discovery in the third study was that the TFAM expression affects the

survival of hESCs. No study on manipulating the mtDNA copy number or TFAM expression

159

in hESCs and mouse embryonic stem cells (mESCs) exists in the literature. In our work, we

demonstrated that TFAM expression level has a positive effect on mtDNA copy number.

Furthermore, these preliminary data suggest that artificially increasing/decreasing mtDNA

copy number influences cell survival. This information is relevant for developing gene

therapy approaches for regenerative medicine of mtDNA related diseases.

Finally, the main finding in the fourth study was that mitophagy is a possible

mechanism for regulation of mitochondrial turnover during rapamcyin, CCCP or EtBr

treatment or early differentiation in hESCs. The data also suggest that mitophagy may be

responsible for the selective removal and quality control of mitochondria in hESCs upon

differentiation. No study has investigated any of the differences and the mechanisms of

mitophagy in hESCs in detail. A better understanding of the molecular mechanisms that

control mitophagy in hESCs may allow manipulation of this process for minimizing the

number of dysfunctional mitochondria in long-term cultured hESCs for use in

regenerative medicine.

Overall, the data in this thesis provide information on the interplay between

mtDNA copy number, cell-specific differentiation and cell response upon alteration of the

mtDNA copy number and the expression of nuclear regulators of mitochondrial

biogenesis. Moreover, these data may provide valuable information to fully understand

mitochondrial diseases and might be useful for regenerative medicine approaches in the

future.

160

References:

Abeyta, M. J., A. T. Clark, R. T. Rodriguez, M. S. Bodnar, R. A. Pera and M. T. Firpo (2004). "Unique gene expression signatures of independently-derived human embryonic stem cell

lines." Hum Mol Genet 13(6): 601-608.

Abou-Sleiman, P. M., M. M. Muqit and N. W. Wood (2006). "Expanding insights of mitochondrial dysfunction in Parkinson's disease." Nat Rev Neurosci 7(3): 207-219.

Acton, B. M., A. Jurisicova, I. Jurisica and R. F. Casper (2004). "Alterations in mitochondrial membrane potential during preimplantation stages of mouse and human embryo

development." Mol Hum Reprod 10(1): 23-32.

Adhya, S., B. Mahato, S. Jash, S. Koley, G. Dhar and T. Chowdhury (2011). "Mitochondrial gene therapy: The tortuous path from bench to bedside." Mitochondrion 11(6): 839-844.

Aerbajinai, W., M. Giattina, Y. T. Lee, M. Raffeld and J. L. Miller (2003). "The proapoptotic factor Nix is coexpressed with Bcl-xL during terminal erythroid differentiation." Blood

102(2):712-717.

Aghajanova, L., H. Skottman, A. M. Stromberg, J. Inzunza, R. Lahesmaa and O. Hovatta (2006). "Expression of leukemia inhibitory factor and its receptors is increased during

differentiation of human embryonic stem cells." Fertility and sterility 86(4 Suppl):1193-1209.

Alam, T. I., T. Kanki, T. Muta, K. Ukaji, Y. Abe, H. Nakayama, K. Takio, N. Hamasaki and D. Kang (2003). "Human mitochondrial DNA is packaged with TFAM." Nucleic Acids Res 31(6):1640-1645.

Amaral, A., J. Ramalho-Santos and J. C. St John (2007). "The expression of polymerase gamma and mitochondrial transcription factor A and the regulation of mitochondrial DNA

content in mature human sperm." Hum Reprod 22(6): 1585-1596.

Anderson, S., A. T. Bankier, B. G. Barrell, M. H. de Bruijn, A. R. Coulson, J. Drouin, I. C. Eperon, D. P. Nierlich, B. A. Roe, F. Sanger, P. H. Schreier, A. J. Smith, R. Staden and I. G. Young (1981). "Sequence and organization of the human mitochondrial genome." Nature

290(5806): 457-465.

Appleby, R. D., W. K. Porteous, G. Hughes, A. M. James, D. Shannon, Y. H. Wei and M. P. Murphy (1999). "Quantitation and origin of the mitochondrial membrane potential in human

cells lacking mitochondrial DNA." Eur J Biochem 262(1): 108-116.

Armand, R., J. Y. Channon, J. Kintner, K. A. White, K. A. Miselis, R. P. Perez and L. D. Lewis (2004). "The effects of ethidium bromide induced loss of mitochondrial DNA on mitochondrial phenotype and ultrastructure in a human leukemia T-cell line (MOLT-4

cells)."Toxicol Appl Pharmacol 196(1): 68-79.

Armstrong, L., O. Hughes, S. Yung, L. Hyslop, R. Stewart, I. Wappler, H. Peters, T. Walter, P. Stojkovic, J. Evans, M. Stojkovic and M. Lako (2006). "The role of PI3K/AKT, MAPK/ERK and NFkappabeta signalling in the maintenance of human embryonic stem cell pluripotency and viability highlighted by transcriptional profiling and functional analysis."

Hum Mol Genet 15(11): 1894-1913.

161

Armstrong, L., K. Tilgner, G. Saretzki, S. P. Atkinson, M. Stojkovic, R. Moreno, S. Przyborski and M. Lako (2010). "Human induced pluripotent stem cell lines show stress defense mechanisms and mitochondrial regulation similar to those of human embryonic stem cells."Stem Cells 28(4): 661-673.

Arsov, I., A. Adebayo, M. Kucerova-Levisohn, J. Haye, M. MacNeil, F. N. Papavasiliou, Z. Yue and B. D. Ortiz (2011). "A role for autophagic protein beclin 1 early in lymphocyte

development." J Immunol 186(4): 2201-2209.

Ausubel, L. J., P. M. Lopez and L. A. Couture (2011). "GMP scale-up and banking of pluripotent stem cells for cellular therapy applications." Methods Mol Biol 767: 147-159.

Avilion, A. A., S. K. Nicolis, L. H. Pevny, L. Perez, N. Vivian and R. Lovell-Badge (2003). "Multipotent cell lineages in early mouse development depend on SOX2 function." Genes

Dev 17(1): 126-140.

Badcock, G., C. Pigott, J. Goepel and P. W. Andrews (1999). "The human embryonal carcinoma marker antigen TRA-1-60 is a sialylated keratan sulfate proteoglycan." Cancer

Res 59(18): 4715-4719.

Baker, P. C. (1964). "Fine Structure of Mesodermal and Entodermal Cells of the

Blastoporal Groove in the Treefrog. Hyla Regilla." Z Zellforsch Mikrosk Anat 64: 636-654.

Balliet, R. M., C. Capparelli, C. Guido, T. G. Pestell, U. E. Martinez-Outschoorn, Z. Lin, D. Whitaker-Menezes, B. Chiavarina, R. G. Pestell, A. Howell, F. Sotgia and M. P. Lisanti (2011). "Mitochondrial oxidative stress in cancer associated fibroblasts drives lactate production, promoting breast cancer tumor growth: Understanding the aging and cancer connection." Cell Cycle 10(23): 4065-4073.

Bastin, J., F. Aubey, A. Rotig, A. Munnich and F. Djouadi (2008). "Activation of peroxisome proliferator-activated receptor pathway stimulates the mitochondrial respiratory chain and can correct deficiencies in patients' cells lacking its components." J Clin Endocrinol Metab 93(4): 1433-1441.

Belin, A. C., B. F. Bjork, M. Westerlund, D. Galter, O. Sydow, C. Lind, K. Pernold, L. Rosvall, A. Hakansson, B. Winblad, H. Nissbrandt, C. Graff and L. Olson (2007). "Association study of two genetic variants in mitochondrial transcription factor A (TFAM) in Alzheimer's and Parkinson's disease." Neurosci Lett 420(3): 257-262.160

Beregi, E., O. Regius, T. Huttl and Z. Gobl (1988). "Age-related changes in the skeletal

muscle cells." Z Gerontol 21(2): 83-86.

Bossy-Wetzel, E., R. Schwarzenbacher and S. A. Lipton (2004). "Molecular pathways to

neurodegeneration." Nat Med 10 Suppl: S2-9.

Bowmaker, M., M. Y. Yang, T. Yasukawa, A. Reyes, H. T. Jacobs, J. A. Huberman and I. J. Holt (2003). "Mammalian mitochondrial DNA replicates bidirectionally from an initiation

zone." J Biol Chem 278(51): 50961-50969.

Briggs, J. A., J. Sun, J. Shepherd, D. A. Ovchinnikov, T. L. Chung, S. P. Nayler, L. P. Kao, C. A. Morrow, N. Y. Thakar, S. Y. Soo, T. Peura, S. Grimmond and E. J. Wolvetang (2013).

162

"Integration-free induced pluripotent stem cells model genetic and neural developmental

features of down syndrome etiology." Stem Cells 31(3): 467-478.

Brown, T. A., C. Cecconi, A. N. Tkachuk, C. Bustamante and D. A. Clayton (2005). "Replication of mitochondrial DNA occurs by strand displacement with alternative light-strand origins, not via a strand-coupled mechanism." Genes & development

19(20):2466-2476.

Buchet, K. and C. Godinot (1998). "Functional F1-ATPase essential in maintaining growth and membrane potential of human mitochondrial DNA-depleted rho degrees cells." J Biol Chem 273(36): 22983-22989.

Camougrand, N., I. Kissova, G. Velours and S. Manon (2004). "Uth1p: a yeast mitochondrial protein at the crossroads of stress, degradation and cell death." FEMS Yeast

Res 5(2): 133-140.

Cao, L., H. Shitara, T. Horii, Y. Nagao, H. Imai, K. Abe, T. Hara, J. Hayashi and H. Yonekawa (2007). "The mitochondrial bottleneck occurs without reduction of mtDNA

content in female mouse germ cells." Nat Genet 39(3): 386-390.

Cao, L., H. Shitara, M. Sugimoto, J. Hayashi, K. Abe and H. Yonekawa (2009). "New evidence confirms that the mitochondrial bottleneck is generated without reduction of mitochondrial DNA content in early primordial germ cells of mice." PLoS Genet

5(12):e1000756.

Chan, D. C. (2006). "Mitochondria: dynamic organelles in disease, aging, and

development." Cell 125(7): 1241-1252.

Chen, C., Y. Liu, R. Liu, T. Ikenoue, K. L. Guan and P. Zheng (2008). "TSC-mTOR maintains quiescence and function of hematopoietic stem cells by repressing mitochondrial

biogenesis and reactive oxygen species." J Exp Med 205(10): 2397-2408.

Chen, G., D. R. Gulbranson, Z. Hou, J. M. Bolin, V. Ruotti, M. D. Probasco, K. Smuga-Otto, S. E. Howden, N. R. Diol, N. E. Propson, R. Wagner, G. O. Lee, J. Antosiewicz-Bourget, J. M. Teng and J. A. Thomson (2011). "Chemically defined conditions for human iPSC

derivation and culture." Nat Methods 8(5): 424-429.

Chen, H. and D. C. Chan (2005). "Emerging functions of mammalian mitochondrial fusion

and fission." Hum Mol Genet 14 Spec No. 2: R283-289.

Chen, H., S. A. Detmer, A. J. Ewald, E. E. Griffin, S. E. Fraser and D. C. Chan (2003). "Mitofusins Mfn1 and Mfn2 coordinately regulate mitochondrial fusion and are essential for

embryonic development." J Cell Biol 160(2): 189-200.

Chinnery, P. F., S. DiMauro, S. Shanske, E. A. Schon, M. Zeviani, C. Mariotti, F. Carrara, A. Lombes, P. Laforet, H. Ogier, M. Jaksch, H. Lochmuller, R. Horvath, M. Deschauer, D. R. Thorburn, L. A. Bindoff, J. Poulton, R. W. Taylor, J. N. Matthews and D. M. Turnbull (2004).

"Risk of developing a mitochondrial DNA deletion disorder." Lancet 364(9434): 592-596.

Cho, Y. M., S. Kwon, Y. K. Pak, H. W. Seol, Y. M. Choi, J. Park do, K. S. Park and H. K. Lee (2006). "Dynamic changes in mitochondrial biogenesis and antioxidant enzymes during the

163

spontaneous differentiation of human embryonic stem cells." Biochemical and biophysical

research communications 348(4): 1472-1478.

Choi, J. M., M. S. Woo, H. I. Ma, S. Y. Kang, Y. H. Sung, S. W. Yong, S. J. Chung, J. S. Kim, H. W. Shin, C. H. Lyoo, P. H. Lee, J. S. Baik, S. J. Kim, M. Y. Park, Y. H. Sohn, J. H. Kim, J. W. Kim, M. S. Lee, M. C. Lee, D. H. Kim and Y. J. Kim (2008). "Analysis of PARK genes in

a Korean cohort of early-onset Parkinson disease." Neurogenetics 9(4): 263-269.

Choi, Y. S., S. Kim and Y. K. Pak (2001). "Mitochondrial transcription factor A (mtTFA) and

diabetes." Diabetes Res Clin Pract 54 Suppl 2: S3-9.

Chung, S., P. P. Dzeja, R. S. Faustino, C. Perez-Terzic, A. Behfar and A. Terzic (2007). "Mitochondrial oxidative metabolism is required for the cardiac differentiation of stem cells."

Nature clinical practice. Cardiovascular medicine 4 Suppl 1: S60-67.

Clayton, D. A. (1982). "Replication of animal mitochondrial DNA." Cell 28(4): 693-705. Clayton, D. A. (1992). "Transcription and replication of animal mitochondrial DNAs." Int Rev

Cytol 141: 217-232.

Codogno, P. and A. J. Meijer (2005). "Autophagy and signaling: their role in cell survival

and cell death." Cell Death Differ 12 Suppl 2: 1509-1518.

Constantinescu, R., A. T. Constantinescu, H. Reichmann and B. Janetzky (2007). "Neuronal differentiation and long-term culture of the human neuroblastoma line SH-SY5Y." J Neural Transm Suppl 72(72): 17-28.

Cordeau-Lossouarn, L., J. L. Vayssiere, J. C. Larcher, F. Gros and B. Croizat (1991). "Mitochondrial maturation during neuronal differentiation in vivo and in vitro." Biology of the

cell under the auspices of the European Cell Biology Organization 71(1-2): 57-65.

Cotney, J., Z. Wang and G. S. Shadel (2007). "Relative abundance of the human mitochondrial transcription system and distinct roles for h-mtTFB1 and h-mtTFB2 in

mitochondrial biogenesis and gene expression." Nucleic acids research 35(12): 4042-4054.

Cree, L. M., D. C. Samuels, S. C. de Sousa Lopes, H. K. Rajasimha, P. Wonnapinij, J. R. Mann, H. H. Dahl and P. F. Chinnery (2008). "A reduction of mitochondrial DNA molecules during embryogenesis explains the rapid segregation of genotypes." Nat Genet

40(2):249-254.

Cuervo, A. M. (2004). "Autophagy: many paths to the same end." Mol Cell Biochem

263(1-2): 55-72.

Cunningham, J. T., J. T. Rodgers, D. H. Arlow, F. Vazquez, V. K. Mootha and P. Puigserver (2007). "mTOR controls mitochondrial oxidative function through a YY1-PGC-1alpha

transcriptional complex." Nature 450(7170): 736-740.

D'Amour, K. A., A. D. Agulnick, S. Eliazer, O. G. Kelly, E. Kroon and E. E. Baetge (2005). "Efficient differentiation of human embryonic stem cells to definitive endoderm." Nat Biotechnol 23(12): 1534-1541.

164

Dairaghi, D. J., G. S. Shadel and D. A. Clayton (1995). "Addition of a 29 residue carboxyl-terminal tail converts a simple HMG box-containing protein into a transcriptional

activator." Journal of molecular biology 249(1): 11-28.

Davis, A. F., P. A. Ropp, D. A. Clayton and W. C. Copeland (1996). "Mitochondrial DNA polymerase gamma is expressed and translated in the absence of mitochondrial DNA

maintenance and replication." Nucleic Acids Res 24(14): 2753-2759.

Debray, F. G., M. Lambert, I. Chevalier, Y. Robitaille, J. C. Decarie, E. A. Shoubridge, B. H. Robinson and G. A. Mitchell (2007). "Long-term outcome and clinical spectrum of 73 pediatric patients with mitochondrial diseases." Pediatrics 119(4): 722-733.

Deodato F, L. S., Rizzo C, Meschini MC, Santorelli FM, Bertini E, Dionisi-Vici C and Carrozzo R (2009). "Mitochondrial DNA depletion syndromes: an update." Paediatrics and

Child Health 19, Supplement 1: S32-S37.

Detmer, S. A. and D. C. Chan (2007). "Functions and dysfunctions of mitochondrial

dynamics." Nat Rev Mol Cell Biol 8(11): 870-879.

Di Cristofano, A., B. Pesce, C. Cordon-Cardo and P. P. Pandolfi (1998). "Pten is essential

for embryonic development and tumour suppression." Nat Genet 19(4): 348-355.

Diaz, F. and C. T. Moraes (2008). "Mitochondrial biogenesis and turnover." Cell Calcium

44(1): 24-35.

Diffley, J. F. and B. Stillman (1991). "A close relative of the nuclear, chromosomal high-mobility group protein HMG1 in yeast mitochondria." Proc Natl Acad Sci U S A

88(17):7864-7868.

DuBridge, R. B., P. Tang, H. C. Hsia, P. M. Leong, J. H. Miller and M. P. Calos (1987). "Analysis of mutation in human cells by using an Epstein-Barr virus shuttle system." Mol Cell Biol 7(1): 379-387.

Ducluzeau, P. H., M. Priou, M. Weitheimer, M. Flamment, L. Duluc, F. Iacobazi, R. Soleti, G. Simard, A. Durand, J. Rieusset, R. Andriantsitohaina and Y. Malthiery (2011). "Dynamic regulation of mitochondrial network and oxidative functions during 3T3-L1 fat cell differentiation." J Physiol Biochem 67(3): 285-296.

Easley, C. A. t., A. Ben-Yehudah, C. J. Redinger, S. L. Oliver, S. T. Varum, V. M. Eisinger, D. L. Carlisle, P. J. Donovan and G. P. Schatten (2010). "mTOR-mediated activation of p70 S6K induces differentiation of pluripotent human embryonic stem cells." Cell Reprogram 12(3): 263-273.

Ebert, K. M., H. Liem and N. B. Hecht (1988). "Mitochondrial DNA in the mouse

preimplantation embryo." J Reprod Fertil 82(1): 145-149.

Eisenberg, T., H. Knauer, A. Schauer, S. Buttner, C. Ruckenstuhl, D. Carmona-Gutierrez, J. Ring, S. Schroeder, C. Magnes, L. Antonacci, H. Fussi, L. Deszcz, R. Hartl, E. Schraml, A. Criollo, E. Megalou, D. Weiskopf, P. Laun, G. Heeren, M. Breitenbach, B. Grubeck-Loebenstein, E. Herker, B. Fahrenkrog, K. U. Frohlich, F. Sinner, N. Tavernarakis,

165

N. Minois, G. Kroemer and F. Madeo (2009). "Induction of autophagy by spermidine

promotes longevity." Nat Cell Biol 11(11): 1305-1314.

Ekstrand, M. I., M. Falkenberg, A. Rantanen, C. B. Park, M. Gaspari, K. Hultenby, P. Rustin, C. M. Gustafsson and N. G. Larsson (2004). "Mitochondrial transcription factor A regulates mtDNA copy number in mammals." Hum Mol Genet 13(9): 935-944.

Ekstrand, M. I. and D. Galter (2009). "The MitoPark Mouse - an animal model of Parkinson's disease with impaired respiratory chain function in dopamine neurons."

Parkinsonism & related disorders 15 Suppl 3: S185-188.

Ekstrand, M. I., M. Terzioglu, D. Galter, S. Zhu, C. Hofstetter, E. Lindqvist, S. Thams, A. Bergstrand, F. S. Hansson, A. Trifunovic, B. Hoffer, S. Cullheim, A. H. Mohammed, L. Olson and N. G. Larsson (2007). "Progressive parkinsonism in mice with respiratory-chain-deficient dopamine neurons." Proc Natl Acad Sci U S A 104(4):1325-1330.

El Shourbagy, S. H., E. C. Spikings, M. Freitas and J. C. St John (2006). "Mitochondria

directly influence fertilisation outcome in the pig." Reproduction 131(2): 233-245.

Ermini, M. (1976). "Ageing changes in mammalian skeletal muscle: biochemical studies."

Gerontology 22(4): 301-316.

Evans, M. J. and M. H. Kaufman (1981). "Establishment in culture of pluripotential cells from mouse embryos." Nature 292(5819): 154-156.

Evans, M. J. and R. C. Scarpulla (1990). "NRF-1: a trans-activator of nuclear-encoded

respiratory genes in animal cells." Genes Dev 4(6): 1023-1034.

Facucho-Oliveira, J. M., J. Alderson, E. C. Spikings, S. Egginton and J. C. St John (2007). "Mitochondrial DNA replication during differentiation of murine embryonic stem cells." J Cell Sci 120(Pt 22): 4025-4034.

Facucho-Oliveira, J. M. and J. C. St John (2009). "The relationship between pluripotency and mitochondrial DNA proliferation during early embryo development and embryonic stem

cell differentiation." Stem Cell Rev 5(2): 140-158.

Falkenberg, M., M. Gaspari, A. Rantanen, A. Trifunovic, N. G. Larsson and C. M. Gustafsson (2002). "Mitochondrial transcription factors B1 and B2 activate transcription of

human mtDNA." Nat Genet 31(3): 289-294.

Falkenberg, M., N. G. Larsson and C. M. Gustafsson (2007). "DNA replication and

transcription in mammalian mitochondria." Annu Rev Biochem 76: 679-699.

Fan, W., K. G. Waymire, N. Narula, P. Li, C. Rocher, P. E. Coskun, M. A. Vannan, J. Narula, G. R. Macgregor and D. C. Wallace (2008). "A mouse model of mitochondrial disease

reveals germline selection against severe mtDNA mutations." Science 319(5865): 958-962.

Fisher, R. P. and D. A. Clayton (1985). "A transcription factor required for promoter recognition by human mitochondrial RNA polymerase. Accurate initiation at the heavy- and

166

light-strand promoters dissected and reconstituted in vitro." J Biol Chem

260(20):11330-11338.

Fisher, R. P. and D. A. Clayton (1988). "Purification and characterization of human

mitochondrial transcription factor 1." Mol Cell Biol 8(8): 3496-3509.

Fisher, R. P., T. Lisowsky, M. A. Parisi and D. A. Clayton (1992). "DNA wrapping and bending by a mitochondrial high mobility group-like transcriptional activator protein." J Biol

Chem 267(5): 3358-3367.

Fliss, M. S., H. Usadel, O. L. Caballero, L. Wu, M. R. Buta, S. M. Eleff, J. Jen and D. Sidransky (2000). "Facile detection of mitochondrial DNA mutations in tumors and bodily fluids." Science 287(5460): 2017-2019.

Forner, F., L. J. Foster, S. Campanaro, G. Valle and M. Mann (2006). "Quantitative proteomic comparison of rat mitochondria from muscle, heart, and liver." Molecular &

cellular proteomics : MCP 5(4): 608-619.

Frank, S., B. Gaume, E. S. Bergmann-Leitner, W. W. Leitner, E. G. Robert, F. Catez, C. L. Smith and R. J. Youle (2001). "The role of dynamin-related protein 1, a mediator of

mitochondrial fission, in apoptosis." Dev Cell 1(4): 515-525.

Frey, T. G. and C. A. Mannella (2000). "The internal structure of mitochondria." Trends

Biochem Sci 25(7): 319-324.

Galter, D., K. Pernold, T. Yoshitake, E. Lindqvist, B. Hoffer, J. Kehr, N. G. Larsson and L. Olson (2010). "MitoPark mice mirror the slow progression of key symptoms and L-DOPA

response in Parkinson's disease." Genes Brain Behav 9(2): 173-181.

Garesse, R. and C. G. Vallejo (2001). "Animal mitochondrial biogenesis and function: a

regulatory cross-talk between two genomes." Gene 263(1-2): 1-16.

Garrido, N., L. Griparic, E. Jokitalo, J. Wartiovaara, A. M. van der Bliek and J. N. Spelbrink (2003). "Composition and dynamics of human mitochondrial nucleoids." Mol Biol Cell

14(4):1583-1596.

Garstka, H. L., W. E. Schmitt, J. Schultz, B. Sogl, B. Silakowski, A. Perez-Martos, J. Montoya and R. J. Wiesner (2003). "Import of mitochondrial transcription factor A (TFAM) into rat liver mitochondria stimulates transcription of mitochondrial DNA." Nucleic Acids Res

31(17): 5039-5047.

Geisler, S., K. M. Holmstrom, D. Skujat, F. C. Fiesel, O. C. Rothfuss, P. J. Kahle and W. Springer (2010). "PINK1/Parkin-mediated mitophagy is dependent on VDAC1 and p62/SQSTM1." Nature cell biology 12(2): 119-131.

Giasson, B. I. and V. M. Lee (2001). "Parkin and the molecular pathways of Parkinson's

disease." Neuron 31(6): 885-888.

Ginis, I., Y. Luo, T. Miura, S. Thies, R. Brandenberger, S. Gerecht-Nir, M. Amit, A. Hoke, M. K. Carpenter, J. Itskovitz-Eldor and M. S. Rao (2004). "Differences between human and mouse embryonic stem cells." Dev Biol 269(2): 360-380.

167

Giritharan, G., D. Ilic, M. Gormley and A. Krtolica (2011). "Human embryonic stem cells derived from embryos at different stages of development share similar transcription

profiles." PLoS One 6(10): e26570.

Gleyzer, N., K. Vercauteren and R. C. Scarpulla (2005). "Control of mitochondrial transcription specificity factors (TFB1M and TFB2M) by nuclear respiratory factors (NRF-1

and NRF-2) and PGC-1 family coactivators." Mol Cell Biol 25(4): 1354-1366.

Goffart, S. and R. J. Wiesner (2003). "Regulation and co-ordination of nuclear gene

expression during mitochondrial biogenesis." Experimental physiology 88(1): 33-40.

Goto, T., J. Adjaye, C. H. Rodeck and M. Monk (1999). "Identification of genes expressed in human primordial germ cells at the time of entry of the female germ line into meiosis."

Mol Hum Reprod 5(9): 851-860.

Graham, L. and J. M. Orenstein (2007). "Processing tissue and cells for transmission electron microscopy in diagnostic pathology and research." Nat Protoc 2(10): 2439-2450. Grapin-Botton, A. and D. Constam (2007). "Evolution of the mechanisms and molecular

control of endoderm formation." Mech Dev 124(4): 253-278.

Gray, H. and T. W. Wong (1992). "Purification and identification of subunit structure of the

human mitochondrial DNA polymerase." J Biol Chem 267(9): 5835-5841.

Graziewicz, M. A., M. J. Longley and W. C. Copeland (2006). "DNA polymerase gamma in mitochondrial DNA replication and repair." Chem Rev 106(2): 383-405.

Gredilla, R., V. A. Bohr and T. Stevnsner (2010). "Mitochondrial DNA repair and association

with aging--an update." Exp Gerontol 45(7-8): 478-488.

Greene, J. C., A. J. Whitworth, I. Kuo, L. A. Andrews, M. B. Feany and L. J. Pallanck (2003). "Mitochondrial pathology and apoptotic muscle degeneration in Drosophila parkin mutants." Proc Natl Acad Sci U S A 100(7): 4078-4083.

Griffith, O. W. (1980). "Determination of glutathione and glutathione disulfide using

glutathione reductase and 2-vinylpyridine." Anal Biochem 106(1): 207-212.

Griparic, L., N. N. van der Wel, I. J. Orozco, P. J. Peters and A. M. van der Bliek (2004). "Loss of the intermembrane space protein Mgm1/OPA1 induces swelling and localized constrictions along the lengths of mitochondria." J Biol Chem 279(18): 18792-18798.

Guan, K., H. Chang, A. Rolletschek and A. M. Wobus (2001). "Embryonic stem cell-derived neurogenesis. Retinoic acid induction and lineage selection of neuronal cells." Cell Tissue

Res 305(2): 171-176.

Hance, N., M. I. Ekstrand and A. Trifunovic (2005). "Mitochondrial DNA polymerase gamma is essential for mammalian embryogenesis." Hum Mol Genet 14(13): 1775-1783.

Hansis, C., J. A. Grifo and L. C. Krey (2000). "Oct-4 expression in inner cell mass and

trophectoderm of human blastocysts." Mol Hum Reprod 6(11): 999-1004.

168

Hansson, A., N. Hance, E. Dufour, A. Rantanen, K. Hultenby, D. A. Clayton, R. Wibom and N. G. Larsson (2004). "A switch in metabolism precedes increased mitochondrial biogenesis in respiratory chain-deficient mouse hearts." Proc Natl Acad Sci U S A 101(9):3136-3141.

Hart, A. H., L. Hartley, M. Ibrahim and L. Robb (2004). "Identification, cloning and expression analysis of the pluripotency promoting Nanog genes in mouse and

human."Developmental Dynamics 230(1): 187-198.

Harvey, B. K., Y. Wang and B. J. Hoffer (2008). "Transgenic rodent models of Parkinson's disease." Acta neurochirurgica. Supplement 101: 89-92.

Hayashi, J., S. Ohta, A. Kikuchi, M. Takemitsu, Y. Goto and I. Nonaka (1991). "Introduction of disease-related mitochondrial DNA deletions into HeLa cells lacking mitochondrial DNA

results in mitochondrial dysfunction." Proc Natl Acad Sci U S A 88(23): 10614-10618.

Hayashi, Y., M. Yoshida, M. Yamato, T. Ide, Z. Wu, M. Ochi-Shindou, T. Kanki, D. Kang, K. Sunagawa, H. Tsutsui and H. Nakanishi (2008). "Reverse of age-dependent memory impairment and mitochondrial DNA damage in microglia by an overexpression of human

mitochondrial transcription factor a in mice." J Neurosci 28(34): 8624-8634.

Henderson, J. K., J. S. Draper, H. S. Baillie, S. Fishel, J. A. Thomson, H. Moore and P. W. Andrews (2002). "Preimplantation human embryos and embryonic stem cells show comparable expression of stage-specific embryonic antigens." Stem Cells 20(4): 329-337. Hidalgo, M. and E. K. Rowinsky (2000). "The rapamycin-sensitive signal transduction pathway as a target for cancer therapy." Oncogene 19(56): 6680-6686.

Higashi, T., A. Isomoto, I. Tyuma, E. Kakishita, M. Uomoto and K. Nagai (1985). "Quantitative and continuous analysis of ATP release from blood platelets with firefly

luciferase luminescence." Thromb Haemost 53(1): 65-69.

Hock, M. B. and A. Kralli (2009). "Transcriptional control of mitochondrial biogenesis and function." Annu Rev Physiol 71: 177-203.

Hoffman, L. M. and M. K. Carpenter (2005). "Characterization and culture of human

embryonic stem cells." Nat Biotechnol 23(6): 699-708.

Holt, I. J., H. E. Lorimer and H. T. Jacobs (2000). "Coupled leading- and lagging-strand

synthesis of mammalian mitochondrial DNA." Cell 100(5): 515-524.

Hoschele, D., M. Wiertz and I. Garcia Moreno (2008). "A duplex real-time PCR assay for detection of drug-induced mitochondrial DNA depletion in HepG2 cells." Anal Biochem

379(2): 208-210.

Hristova, V. A., S. A. Beasley, R. J. Rylett and G. S. Shaw (2009). "Identification of a novel Zn2+-binding domain in the autosomal recessive juvenile Parkinson-related E3 ligase

parkin." J Biol Chem 284(22): 14978-14986.

Hudson, J., D. Titmarsh, A. Hidalgo, E. Wolvetang and J. Cooper-White (2012). "Primitive

cardiac cells from human embryonic stem cells." Stem Cells Dev 21(9): 1513-1523.

169

Huo, L. and R. C. Scarpulla (2001). "Mitochondrial DNA instability and peri-implantation lethality associated with targeted disruption of nuclear respiratory factor 1 in mice." Mol Cell

Biol 21(2): 644-654.

Idelson, M., R. Alper, A. Obolensky, E. Ben-Shushan, I. Hemo, N. Yachimovich-Cohen, H. Khaner, Y. Smith, O. Wiser, M. Gropp, M. A. Cohen, S. Even-Ram, Y. Berman-Zaken, L. Matzrafi, G. Rechavi, E. Banin and B. Reubinoff (2009). "Directed differentiation of human embryonic stem cells into functional retinal pigment epithelium cells." Cell stem cell 5(4):396-408.

Ingman, M. and U. Gyllensten (2006). "mtDB: Human Mitochondrial Genome Database, a resource for population genetics and medical sciences." Nucleic Acids Res 34(Database

issue): D749-751.

168

Inoue, K., K. Nakada, A. Ogura, K. Isobe, Y. Goto, I. Nonaka and J. I. Hayashi (2000). "Generation of mice with mitochondrial dysfunction by introducing mouse mtDNA carrying a

deletion into zygotes." Nat Genet 26(2): 176-181.

Inoue, S., S. Noda, K. Kashima, K. Nakada, J. Hayashi and H. Miyoshi (2010). "Mitochondrial respiration defects modulate differentiation but not proliferation of hematopoietic stem and progenitor cells." FEBS Lett 584(15): 3402-3409.

Inzunza, J., K. Gertow, M. A. Stromberg, E. Matilainen, E. Blennow, H. Skottman, S. Wolbank, L. Ahrlund-Richter and O. Hovatta (2005). "Derivation of human embryonic stem cell lines in serum replacement medium using postnatal human fibroblasts as feeder cells."Stem Cells 23(4): 544-549.

Irrcher, I., V. Ljubicic and D. A. Hood (2009). "Interactions between ROS and AMP kinase activity in the regulation of PGC-1alpha transcription in skeletal muscle cells." Am J Physiol

Cell Physiol 296(1): C116-123.

Itskovitz-Eldor, J., M. Schuldiner, D. Karsenti, A. Eden, O. Yanuka, M. Amit, H. Soreq and N. Benvenisty (2000). "Differentiation of human embryonic stem cells into embryoid bodies

compromising the three embryonic germ layers." Mol Med 6(2): 88-95.

Ivanova, N. B., J. T. Dimos, C. Schaniel, J. A. Hackney, K. A. Moore and I. R. Lemischka

(2002). "A stem cell molecular signature." Science 298(5593): 601-604.

James, D., A. J. Levine, D. Besser and A. Hemmati-Brivanlou (2005). "TGFbeta/activin/nodal signaling is necessary for the maintenance of pluripotency in

human embryonic stem cells." Development 132(6): 1273-1282.

Jeng, J. Y., T. S. Yeh, J. W. Lee, S. H. Lin, T. H. Fong and R. H. Hsieh (2008).

"Maintenance

of mitochondrial DNA copy number and expression are essential for preservation of mitochondrial function and cell growth." J Cell Biochem 103(2): 347-357.

170

Jia, W. and Y. W. He (2011). "Temporal regulation of intracellular organelle homeostasis in

T lymphocytes by autophagy." J Immunol 186(9): 5313-5322.

Joseph, A. M., A. A. Rungi, B. H. Robinson and D. A. Hood (2004). "Compensatory responses of protein import and transcription factor expression in mitochondrial DNA defects." Am J Physiol Cell Physiol 286(4): C867-875.

Kabeya, Y., N. Mizushima, T. Ueno, A. Yamamoto, T. Kirisako, T. Noda, E. Kominami, Y. Ohsumi and T. Yoshimori (2000). "LC3, a mammalian homologue of yeast Apg8p, is

localized in autophagosome membranes after processing." Embo J 19(21): 5720-5728.

Kameyama, Y., F. Filion, J. G. Yoo and L. C. Smith (2007). "Characterization of mitochondrial replication and transcription control during rat early development in vivo and

in vitro." Reproduction 133(2): 423-432.

Kanai-Azuma, M., Y. Kanai, J. M. Gad, Y. Tajima, C. Taya, M. Kurohmaru, Y. Sanai, H. Yonekawa, K. Yazaki, P. P. Tam and Y. Hayashi (2002). "Depletion of definitive gut

endoderm in Sox17-null mutant mice." Development 129(10): 2367-2379.

Kaneda, H., J. Hayashi, S. Takahama, C. Taya, K. F. Lindahl and H. Yonekawa (1995). "Elimination of paternal mitochondrial DNA in intraspecific crosses during early mouse

embryogenesis." Proc Natl Acad Sci U S A 92(10): 4542-4546.

Kang, D. and N. Hamasaki (2006). "Mitochondrial disease: maintenance of mitochondrial genome and molecular diagnostics." Adv Clin Chem 42: 217-254.

Kang, H. B., Y. E. Kim, H. J. Kwon, D. E. Sok and Y. Lee (2007). "Enhancement of NF-kappaB expression and activity upon differentiation of human embryonic stem cell line

SNUhES3." Stem cells and development 16(4): 615-623.

Kanki, T. and D. J. Klionsky (2009). "Atg32 is a tag for mitochondria degradation in yeast." Autophagy 5(8): 1201-1202.

Kanki, T., H. Nakayama, N. Sasaki, K. Takio, T. I. Alam, N. Hamasaki and D. Kang (2004).

"Mitochondrial nucleoid and transcription factor A." Ann N Y Acad Sci 1011: 61-68.

Kanki, T., K. Ohgaki, M. Gaspari, C. M. Gustafsson, A. Fukuoh, N. Sasaki, N. Hamasaki and D. Kang (2004). "Architectural role of mitochondrial transcription factor A in maintenance of human mitochondrial DNA." Mol Cell Biol 24(22): 9823-9834.

Kannagi, R., N. A. Cochran, F. Ishigami, S. Hakomori, P. W. Andrews, B. B. Knowles and D. Solter (1983). "Stage-specific embryonic antigens (SSEA-3 and -4) are epitopes of a unique globo-series ganglioside isolated from human teratocarcinoma cells." Embo J 2(12):2355-2361.

Kapahi, P., D. Chen, A. N. Rogers, S. D. Katewa, P. W. Li, E. L. Thomas and L. Kockel

(2010). "With TOR, less is more: a key role for the conserved nutrient-sensing TOR

pathway in aging." Cell Metab 11(6): 453-465.

Keeney, P. M., C. K. Quigley, L. D. Dunham, C. M. Papageorge, S. Iyer, R. R. Thomas, K. M. Schwarz, P. A. Trimmer, S. M. Khan, F. R. Portell, K. E. Bergquist and J. P. Bennett, Jr.

171

(2009). "Mitochondrial gene therapy augments mitochondrial physiology in a Parkinson's

disease cell model." Hum Gene Ther 20(8): 897-907.

Kelly, D. P. and R. C. Scarpulla (2004). "Transcriptional regulatory circuits controlling

mitochondrial biogenesis and function." Genes Dev 18(4): 357-368.

Kichler, A., J. S. Remy, O. Boussif, B. Frisch, C. Boeckler, J. P. Behr and F. Schuber (1995). "Efficient gene delivery with neutral complexes of lipospermine and thiol-reactive

phospholipids." Biochemical and biophysical research communications 209(2): 444-450.

Kim, D. S., J. S. Lee, J. W. Leem, Y. J. Huh, J. Y. Kim, H. S. Kim, I. H. Park, G. Q. Daley, D. Y. Hwang and D. W. Kim (2010). "Robust enhancement of neural differentiation from human ES and iPS cells regardless of their innate difference in differentiation propensity."

Stem Cell Rev 6(2): 270-281.

Kim, S. W., S. J. Yoon, E. Chuong, C. Oyolu, A. E. Wills, R. Gupta and J. Baker (2011). "Chromatin and transcriptional signatures for Nodal signaling during endoderm formation in

hESCs." Dev Biol 357(2): 492-504.

King, M. E., G. C. Godman and D. W. King (1972). "Respiratory enzymes and mitochondrial morphology of HeLa and L cells treated with chloramphenicol and ethidium bromide." J Cell

Biol 53(1): 127-142.

King, M. P. and G. Attardi (1989). "Human cells lacking mtDNA: repopulation with exogenous mitochondria by complementation." Science 246(4929): 500-503.

King, M. P. and G. Attardi (1996). "Isolation of human cell lines lacking mitochondrial DNA."

Methods Enzymol 264: 304-313.

Kissova, I., M. Deffieu, S. Manon and N. Camougrand (2004). "Uth1p is involved in the

autophagic degradation of mitochondria." J Biol Chem 279(37): 39068-39074.

Komarova, S. V., F. I. Ataullakhanov and R. K. Globus (2000). "Bioenergetics and mitochondrial transmembrane potential during differentiation of cultured osteoblasts." Am J

Physiol Cell Physiol 279(4): C1220-1229.

Krishnan, K. J., A. K. Reeve, D. C. Samuels, P. F. Chinnery, J. K. Blackwood, R. W. Taylor, S. Wanrooij, J. N. Spelbrink, R. N. Lightowlers and D. M. Turnbull (2008). "What causes mitochondrial DNA deletions in human cells?" Nat Genet 40(3): 275-279.

Kundu, M. and C. B. Thompson (2008). "Autophagy: basic principles and relevance to

disease." Annu Rev Pathol 3: 427-455.

Lafontan, M. (2008). "Advances in adipose tissue metabolism." Int J Obes (Lond) 32 Suppl

7: S39-51.

Lagouge, M., C. Argmann, Z. Gerhart-Hines, H. Meziane, C. Lerin, F. Daussin, N. Messadeq, J. Milne, P. Lambert, P. Elliott, B. Geny, M. Laakso, P. Puigserver and J. Auwerx (2006). "Resveratrol improves mitochondrial function and protects against

metabolic disease by activating SIRT1 and PGC-1alpha." Cell 127(6): 1109-1122.

172

Lane, N. (2006). "Mitochondrial disease: powerhouse of disease." Nature

440(7084):600-602.

Larsson, N. G., G. S. Barsh and D. A. Clayton (1997). "Structure and chromosomal localization of the mouse mitochondrial transcription factor A gene (Tfam)." Mamm Genome 8(2): 139-140.

Larsson, N. G., J. D. Garman, A. Oldfors, G. S. Barsh and D. A. Clayton (1996). "A single mouse gene encodes the mitochondrial transcription factor A and a testis-specific nuclear

HMG-box protein." Nat Genet 13(3): 296-302.

Larsson, N. G., A. Oldfors, E. Holme and D. A. Clayton (1994). "Low levels of mitochondrial transcription factor A in mitochondrial DNA depletion." Biochem Biophys Res Commun

200(3): 1374-1381.

Larsson, N. G., J. Wang, H. Wilhelmsson, A. Oldfors, P. Rustin, M. Lewandoski, G. S. Barsh and D. A. Clayton (1998). "Mitochondrial transcription factor A is necessary for

mtDNA maintenance and embryogenesis in mice." Nat Genet 18(3): 231-236.

Lee, H. C. and Y. H. Wei (2005). "Mitochondrial biogenesis and mitochondrial DNA maintenance of mammalian cells under oxidative stress." Int J Biochem Cell Biol

37(4):822-834.

Lee, K. W., J. Y. Yook, M. Y. Son, M. J. Kim, D. B. Koo, Y. M. Han and Y. S. Cho (2010). "Rapamycin promotes the osteoblastic differentiation of human embryonic stem cells by blocking the mTOR pathway and stimulating the BMP/Smad pathway." Stem Cells Dev

19(4): 557-568.

Lemoli, R. M., F. Bertolini, R. Cancedda, M. De Luca, A. Del Santo, G. Ferrari, S. Ferrari, G. Martino, F. Mavilio and S. Tura (2005). "Stem cell plasticity: time for a reappraisal?"

Haematologica 90(3): 360-381.

Levenson, R., I. G. Macara, R. L. Smith, L. Cantley and D. Housman (1982). "Role of mitochondrial membrane potential in the regulation of murine erythroleukemia cell differentiation." Cell 28(4): 855-863.

Levine, B. and D. J. Klionsky (2004). "Development by self-digestion: molecular

mechanisms and biological functions of autophagy." Dev Cell 6(4): 463-477.

Levine, B. and J. Yuan (2005). "Autophagy in cell death: an innocent convict?" J Clin Invest

115(10): 2679-2688.

Li, F., Y. Wang, K. I. Zeller, J. J. Potter, D. R. Wonsey, K. A. O'Donnell, J. W. Kim, J. T. Yustein, L. A. Lee and C. V. Dang (2005). "Myc stimulates nuclearly encoded mitochondrial

genes and mitochondrial biogenesis." Mol Cell Biol 25(14): 6225-6234.

Li, H., J. Wang, H. Wilhelmsson, A. Hansson, P. Thoren, J. Duffy, P. Rustin and N. G. Larsson (2000). "Genetic modification of survival in tissue-specific knockout mice with mitochondrial cardiomyopathy." Proc Natl Acad Sci U S A 97(7): 3467-3472.

173

Liesa, M., M. Palacin and A. Zorzano (2009). "Mitochondrial dynamics in mammalian health

and disease." Physiol Rev 89(3): 799-845.

Lipton, J. H. and W. C. McMurray (1977). "Mitochondrial biogenesis in cultured animal cells. I. Effect of chloramphenicol on morphology and mitochondrial respiratory enzymes." Biochim Biophys Acta 477(3): 264-272.

Liu, L., C. Liu, Y. Zhong, A. Apostolou and S. Fang (2012). "ER stress response during the differentiation of H9 cells induced by retinoic acid." Biochem Biophys Res Commun

417(2):738-743.

Llano, M., N. Gaznick and E. M. Poeschla (2009). "Rapid, controlled and intensive lentiviral vector-based RNAi." Methods Mol Biol 485: 257-270.

Lopes, F. M., R. Schroder, M. L. da Frota, Jr., A. Zanotto-Filho, C. B. Muller, A. S. Pires, R. T. Meurer, G. D. Colpo, D. P. Gelain, F. Kapczinski, J. C. Moreira, C. Fernandes Mda and F. Klamt (2010). "Comparison between proliferative and neuron-like SH-SY5Y cells as an in

vitro model for Parkinson disease studies." Brain Res 1337: 85-94.

Lu, S. J., Q. Feng, J. S. Park and R. Lanza (2010). "Directed differentiation of red blood

cells from human embryonic stem cells." Methods in molecular biology 636: 105-121.

Lutz, A. K., N. Exner, M. E. Fett, J. S. Schlehe, K. Kloos, K. Lammermann, B. Brunner, A. Kurz-Drexler, F. Vogel, A. S. Reichert, L. Bouman, D. Vogt-Weisenhorn, W. Wurst, J. Tatzelt, C. Haass and K. F. Winklhofer (2009). "Loss of parkin or PINK1 function increases

Drp1-dependent mitochondrial fragmentation." J Biol Chem 284(34): 22938-22951.

Macpherson, A. J., T. P. Mayall, K. A. Chester, A. Abbasi, I. Forgacs, A. D. Malcolm and T. J. Peters (1992). "Mitochondrial gene expression in the human gastrointestinal tract." Journal of cell science 102 ( Pt 2): 307-314.

Maitra, A., D. E. Arking, N. Shivapurkar, M. Ikeda, V. Stastny, K. Kassauei, G. Sui, D. J. Cutler, Y. Liu, S. N. Brimble, K. Noaksson, J. Hyllner, T. C. Schulz, X. Zeng, W. J. Freed, J. Crook, S. Abraham, A. Colman, P. Sartipy, S. Matsui, M. Carpenter, A. F. Gazdar, M. Rao and A. Chakravarti (2005). "Genomic alterations in cultured human embryonic stem cells."

Nat Genet 37(10): 1099-1103.

Maitra, A., Y. Cohen, S. E. Gillespie, E. Mambo, N. Fukushima, M. O. Hoque, N. Shah, M. Goggins, J. Califano, D. Sidransky and A. Chakravarti (2004). "The Human MitoChip: a high-throughput sequencing microarray for mitochondrial mutation detection." Genome Res

14(5): 812-819.

Malarkey, C. S., M. Bestwick, J. E. Kuhlwilm, G. S. Shadel and M. E. Churchill (2012). "Transcriptional activation by mitochondrial transcription factor A involves preferential distortion of promoter DNA." Nucleic Acids Res 40(2): 614-624.

Mandal, S., A. G. Lindgren, A. S. Srivastava, A. T. Clark and U. Banerjee (2011). "Mitochondrial function controls proliferation and early differentiation potential of embryonic

stem cells." Stem Cells 29(3): 486-495.

174

Maniura-Weber, K., S. Goffart, H. L. Garstka, J. Montoya and R. J. Wiesner (2004). "Transient overexpression of mitochondrial transcription factor A (TFAM) is sufficient to stimulate mitochondrial DNA transcription, but not sufficient to increase mtDNA copy number in cultured cells." Nucleic Acids Res 32(20): 6015-6027.

Marchetto, M. C., C. Carromeu, A. Acab, D. Yu, G. W. Yeo, Y. Mu, G. Chen, F. H. Gage and A. R. Muotri (2010). "A model for neural development and treatment of Rett syndrome

using human induced pluripotent stem cells." Cell 143(4): 527-539.

Marchington, D. R., G. M. Hartshorne, D. Barlow and J. Poulton (1997). "Homopolymeric tract heteroplasmy in mtDNA from tissues and single oocytes: support for a genetic

bottleneck." Am J Hum Genet 60(2): 408-416.

Martin, W., M. Hoffmeister, C. Rotte and K. Henze (2001). "An overview of endosymbiotic models for the origins of eukaryotes, their ATP-producing organelles (mitochondria and hydrogenosomes), and their heterotrophic lifestyle." Biol Chem 382(11): 1521-1539.

Matsushita, M., N. N. Suzuki, K. Obara, Y. Fujioka, Y. Ohsumi and F. Inagaki (2007). "Structure of Atg5.Atg16, a complex essential for autophagy." J Biol Chem

282(9):6763-6772.

May-Panloup, P., M. F. Chretien, C. Jacques, C. Vasseur, Y. Malthiery and P. Reynier (2005). "Low oocyte mitochondrial DNA content in ovarian insufficiency." Hum Reprod

20(3): 593-597.

McBride, H. M. (2008). "Parkin mitochondria in the autophagosome." J Cell Biol

183(5):757-759.

McConell, G. K., G. P. Ng, M. Phillips, Z. Ruan, S. L. Macaulay and G. D. Wadley (2010). "Central role of nitric oxide synthase in AICAR and caffeine-induced mitochondrial

biogenesis in L6 myocytes." J Appl Physiol 108(3): 589-595.

McElroy, S. L. and R. A. Reijo Pera (2008). "Culturing human embryonic stem cells in

feeder-free conditions." CSH Protoc 2008: pdb prot5044.

McEwan, D. G. and I. Dikic (2010). "Not all autophagy membranes are created equal." Cell 141(4): 564-566.

Medeiros, D. M. (2008). "Assessing mitochondria biogenesis." Methods 46(4): 288-294. Meeusen, S., J. M. McCaffery and J. Nunnari (2004). "Mitochondrial fusion intermediates

revealed in vitro." Science 305(5691): 1747-1752.

Mellick, G. D., G. A. Siebert, M. Funayama, D. D. Buchanan, Y. Li, Y. Imamichi, H. Yoshino, P. A. Silburn and N. Hattori (2009). "Screening PARK genes for mutations in early-onset Parkinson's disease patients from Queensland, Australia." Parkinsonism Relat Disord

15(2):105-109.

Menzies, R. A. and P. H. Gold (1971). "The turnover of mitochondria in a variety of tissues of young adult and aged rats." J Biol Chem 246(8): 2425-2429.

175

Miceli, M. V. and S. M. Jazwinski (2005). "Nuclear gene expression changes due to mitochondrial dysfunction in ARPE-19 cells: implications for age-related macular

degeneration." Invest Ophthalmol Vis Sci 46(5): 1765-1773.

Miller, S. W., P. A. Trimmer, W. D. Parker, Jr. and R. E. Davis (1996). "Creation and characterization of mitochondrial DNA-depleted cell lines with "neuronal-like" properties." J

Neurochem 67(5): 1897-1907.

Miranda, S., R. Foncea, J. Guerrero and F. Leighton (1999). "Oxidative stress and upregulation of mitochondrial biogenesis genes in mitochondrial DNA-depleted HeLa cells." Biochem Biophys Res Commun 258(1): 44-49.

Mitsui, K., Y. Tokuzawa, H. Itoh, K. Segawa, M. Murakami, K. Takahashi, M. Maruyama, M. Maeda and S. Yamanaka (2003). "The homeoprotein Nanog is required for maintenance of

pluripotency in mouse epiblast and ES cells." Cell 113(5): 631-642.

Mizushima, N. and B. Levine (2010). "Autophagy in mammalian development and

differentiation." Nat Cell Biol 12(9): 823-830.

Mizushima, N., A. Yamamoto, M. Matsui, T. Yoshimori and Y. Ohsumi (2004). "In vivo analysis of autophagy in response to nutrient starvation using transgenic mice expressing a

fluorescent autophagosome marker." Mol Biol Cell 15(3): 1101-1111.

Mohammadi-Sangcheshmeh, A., E. Held, N. Ghanem, F. Rings, D. Salilew-Wondim, D. Tesfaye, H. Sieme, K. Schellander and M. Hoelker (2011). "G6PDH-activity in equine oocytes correlates with morphology, expression of candidate genes for viability, and

preimplantative in vitro development." Theriogenology 76(7): 1215-1226.

Moraes, C. T. (2001). "What regulates mitochondrial DNA copy number in animal cells?" Trends Genet 17(4): 199-205.

Mummery, C. L., J. Zhang, E. S. Ng, D. A. Elliott, A. G. Elefanty and T. J. Kamp (2012). "Differentiation of human embryonic stem cells and induced pluripotent stem cells to

cardiomyocytes: a methods overview." Circ Res 111(3): 344-358.

Nagao, A., N. Hino-Shigi and T. Suzuki (2008). "Measuring mRNA decay in human mitochondria." Methods Enzymol 447: 489-499.

Nakanishi, M., A. Kurisaki, Y. Hayashi, M. Warashina, S. Ishiura, M. Kusuda-Furue and M. Asashima (2009). "Directed induction of anterior and posterior primitive streak by Wnt from embryonic stem cells cultured in a chemically defined serum-free medium." FASEB J 23(1)114-122.

Narendra, D., A. Tanaka, D. F. Suen and R. J. Youle (2008). "Parkin is recruited selectively

to impaired mitochondria and promotes their autophagy." J Cell Biol 183(5): 795-803.

Narendra, D. P., S. M. Jin, A. Tanaka, D. F. Suen, C. A. Gautier, J. Shen, M. R. Cookson and R. J. Youle (2010). "PINK1 is selectively stabilized on impaired mitochondria to activate Parkin." PLoS biology 8(1): e1000298.

176

Niederreither, K. and P. Dolle (2008). "Retinoic acid in development: towards an integrated

view." Nat Rev Genet 9(7): 541-553.

Norddahl, G. L., C. J. Pronk, M. Wahlestedt, G. Sten, J. M. Nygren, A. Ugale, M. Sigvardsson and D. Bryder (2011). "Accumulating mitochondrial DNA mutations drive premature hematopoietic aging phenotypes distinct from physiological stem cell aging."

Cell Stem Cell 8(5): 499-510.

Norrman, K., Y. Fischer, B. Bonnamy, F. Wolfhagen Sand, P. Ravassard and H. Semb (2010). "Quantitative comparison of constitutive promoters in human ES cells." PLoS One 5(8): e12413.

Odorico, J. S., D. S. Kaufman and J. A. Thomson (2001). "Multilineage differentiation from

human embryonic stem cell lines." Stem Cells 19(3): 193-204.

Oh, S. K., H. S. Kim, H. J. Ahn, H. W. Seol, Y. Y. Kim, Y. B. Park, C. J. Yoon, D. W. Kim, S. H. Kim and S. Y. Moon (2005). "Derivation and characterization of new human embryonic

stem cell lines: SNUhES1, SNUhES2, and SNUhES3." Stem Cells 23(2): 211-219.

Ohgaki, K., T. Kanki, A. Fukuoh, H. Kurisaki, Y. Aoki, M. Ikeuchi, S. H. Kim, N. Hamasaki and D. Kang (2007). "The C-terminal tail of mitochondrial transcription factor a markedly

strengthens its general binding to DNA." J Biochem 141(2): 201-211.

Ohsumi, Y. and N. Mizushima (2004). "Two ubiquitin-like conjugation systems essential for autophagy." Semin Cell Dev Biol 15(2): 231-236.

Ohtsuka, S. and S. Dalton (2008). "Molecular and biological properties of pluripotent

embryonic stem cells." Gene Ther 15(2): 74-81.

Okamoto, K. and N. Kondo-Okamoto (2012). "Mitochondria and autophagy: critical

interplay between the two homeostats." Biochim Biophys Acta 1820(5): 595-600.

Olichon, A., L. Baricault, N. Gas, E. Guillou, A. Valette, P. Belenguer and G. Lenaers (2003). "Loss of OPA1 perturbates the mitochondrial inner membrane structure and

integrity, leading to cytochrome c release and apoptosis." J Biol Chem 278(10): 7743-7746.

Paling, N. R., H. Wheadon, H. K. Bone and M. J. Welham (2004). "Regulation of embryonic stem cell self-renewal by phosphoinositide 3-kinase-dependent signaling." J Biol Chem 279(46): 48063-48070.

Pan, G. and J. A. Thomson (2007). "Nanog and transcriptional networks in embryonic stem

cell pluripotency." Cell Res 17(1): 42-49.

Panopoulos, A. D., O. Yanes, S. Ruiz, Y. S. Kida, D. Diep, R. Tautenhahn, A. Herrerias, E. M. Batchelder, N. Plongthongkum, M. Lutz, W. T. Berggren, K. Zhang, R. M. Evans, G. Siuzdak and J. C. Izpisua Belmonte (2012). "The metabolome of induced pluripotent stem

cells reveals metabolic changes occurring in somatic cell reprogramming." Cell Res

22(1):168-177.

177

Parisi, M. A., B. Xu and D. A. Clayton (1993). "A human mitochondrial transcriptional activator can functionally replace a yeast mitochondrial HMG-box protein both in vivo and in

vitro." Mol Cell Biol 13(3): 1951-1961.

Park, S. Y., B. Choi, H. Cheon, Y. K. Pak, M. Kulawiec, K. K. Singh and M. S. Lee (2004). "Cellular aging of mitochondrial DNA-depleted cells." Biochemical and biophysical research

communications 325(4): 1399-1405.

Parsons, X. H., Y. D. Teng, J. F. Parsons, E. Y. Snyder, D. B. Smotrich and D. A. Moore (2011). "Efficient derivation of human neuronal progenitors and neurons from pluripotent human embryonic stem cells with small molecule induction." J Vis Exp 56(56): e3273.

Pastukh, V., I. Shokolenko, B. Wang, G. Wilson and M. Alexeyev (2007). "Human mitochondrial transcription factor A possesses multiple subcellular targeting signals." Febs

J 274(24): 6488-6499.

Pecqueur, C., T. Bui, C. Gelly, J. Hauchard, C. Barbot, F. Bouillaud, D. Ricquier, B. Miroux and C. B. Thompson (2008). "Uncoupling protein-2 controls proliferation by promoting fatty

acid oxidation and limiting glycolysis-derived pyruvate utilization." FASEB J 22(1): 9-18.

Petrucelli, L., C. O'Farrell, P. J. Lockhart, M. Baptista, K. Kehoe, L. Vink, P. Choi, B. Wolozin, M. Farrer, J. Hardy and M. R. Cookson (2002). "Parkin protects against the toxicity associated with mutant alpha-synuclein: proteasome dysfunction selectively affects

catecholaminergic neurons." Neuron 36(6): 1007-1019.

Phanstiel, D. H., J. Brumbaugh, C. D. Wenger, S. Tian, M. D. Probasco, D. J. Bailey, D. L. Swaney, M. A. Tervo, J. M. Bolin, V. Ruotti, R. Stewart, J. A. Thomson and J. J. Coon (2011). "Proteomic and phosphoproteomic comparison of human ES and iPS cells." Nat

Methods 8(10): 821-827.

Pietila, M., S. Lehtonen, M. Narhi, I. E. Hassinen, H. V. Leskela, K. Aranko, K. Nordstrom, A. Vepsalainen and P. Lehenkari (2010). "Mitochondrial function determines the viability and osteogenic potency of human mesenchymal stem cells." Tissue Eng Part C Methods

16(3):435-445.

Piko, L. and L. Matsumoto (1976). "Number of mitochondria and some properties of

mitochondrial DNA in the mouse egg." Dev Biol 49(1): 1-10.

Piko, L. and K. D. Taylor (1987). "Amounts of mitochondrial DNA and abundance of some mitochondrial gene transcripts in early mouse embryos." Dev Biol 123(2): 364-374.

Pohjoismaki, J. L., S. Wanrooij, A. K. Hyvarinen, S. Goffart, I. J. Holt, J. N. Spelbrink and H. T. Jacobs (2006). "Alterations to the expression level of mitochondrial transcription factor A, TFAM, modify the mode of mitochondrial DNA replication in cultured human cells." Nucleic Acids Res 34(20): 5815-5828.

Polyak, K., Y. Li, H. Zhu, C. Lengauer, J. K. Willson, S. D. Markowitz, M. A. Trush, K. W. Kinzler and B. Vogelstein (1998). "Somatic mutations of the mitochondrial genome in

human colorectal tumours." Nat Genet 20(3): 291-293.

178

Poulton, J., K. Morten, C. Freeman-Emmerson, C. Potter, C. Sewry, V. Dubowitz, H. Kidd, J. Stephenson, W. Whitehouse, F. J. Hansen and et al. (1994). "Deficiency of the human mitochondrial transcription factor h-mtTFA in infantile mitochondrial myopathy is associated with mtDNA depletion." Hum Mol Genet 3(10): 1763-1769.

Prigione, A. and J. Adjaye (2010). "Modulation of mitochondrial biogenesis and bioenergetic metabolism upon in vitro and in vivo differentiation of human ES and iPS

cells." Int J Dev Biol 54(11-12): 1729-1741.

Prigione, A., B. Lichtner, H. Kuhl, E. A. Struys, M. Wamelink, H. Lehrach, M. Ralser, B. Timmermann and J. Adjaye (2011). "Human induced pluripotent stem cells harbor homoplasmic and heteroplasmic mitochondrial DNA mutations while maintaining human

embryonic stem cell-like metabolic reprogramming." Stem Cells 29(9): 1338-1348.

Przyborski, S. A., V. B. Christie, M. W. Hayman, R. Stewart and G. M. Horrocks (2004). "Human embryonal carcinoma stem cells: models of embryonic development in humans."

Stem Cells Dev 13(4): 400-408.

Pua, H. H., J. Guo, M. Komatsu and Y. W. He (2009). "Autophagy is essential for

mitochondrial clearance in mature T lymphocytes." J Immunol 182(7): 4046-4055.

Puigserver, P., J. Rhee, J. Donovan, C. J. Walkey, J. C. Yoon, F. Oriente, Y. Kitamura, J. Altomonte, H. Dong, D. Accili and B. M. Spiegelman (2003). "Insulin-regulated hepatic

gluconeogenesis through FOXO1-PGC-1alpha interaction." Nature 423(6939): 550-555.

Qu, X., Z. Zou, Q. Sun, K. Luby-Phelps, P. Cheng, R. N. Hogan, C. Gilpin and B. Levine (2007). "Autophagy gene-dependent clearance of apoptotic cells during embryonic development." Cell 128(5): 931-946.

Racanicchi, L., P. Montanucci, G. P. Basta, A. Pensato, V. Conti and R. Calafiore (2008). "Effect of all trans retinoic acid on lysosomal alpha-D-mannosidase activity in HL-60

cell:correlation with HL-60 cells differentiation." Mol Cell Biochem 308(1-2): 17-24.

Rakovic, A., A. Grunewald, J. Kottwitz, N. Bruggemann, P. P. Pramstaller, K. Lohmann and C. Klein (2011). "Mutations in PINK1 and Parkin impair ubiquitination of Mitofusins in

human fibroblasts." PLoS One 6(3): e16746.

Ramalho-Santos, J., S. Varum, S. Amaral, P. C. Mota, A. P. Sousa and A. Amaral (2009). "Mitochondrial functionality in reproduction: from gonads and gametes to embryos and embryonic stem cells." Hum Reprod Update 15(5): 553-572.

Rambold, A. S. and J. Lippincott-Schwartz (2011). "Mechanisms of mitochondria and

autophagy crosstalk." Cell Cycle 10(23): 4032-4038.

Ramos-Mejia, V., C. Bueno, M. Roldan, L. Sanchez, G. Ligero, P. Menendez and M. Martin (2012). "The adaptation of human embryonic stem cells to different feeder-free culture conditions is accompanied by a mitochondrial response." Stem Cells Dev 21(7):

1145-1155.

179

Rao, R. R., J. D. Calhoun, X. Qin, R. Rekaya, J. K. Clark and S. L. Stice (2004). "Comparative transcriptional profiling of two human embryonic stem cell lines." Biotechnol

Bioeng 88(3): 273-286.

Rebelo, A. P., S. L. Williams and C. T. Moraes (2009). "In vivo methylation of mtDNA reveals the dynamics of protein-mtDNA interactions." Nucleic Acids Res 37(20):

6701-6715.

Reubinoff, B. E., M. F. Pera, C. Y. Fong, A. Trounson and A. Bongso (2000). "Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro." Nat Biotechnol 18(4): 399-404.

Reynier, P., P. May-Panloup, M. F. Chretien, C. J. Morgan, M. Jean, F. Savagner, P. Barriere and Y. Malthiery (2001). "Mitochondrial DNA content affects the fertilizability of

human oocytes." Mol Hum Reprod 7(5): 425-429.

Ristevski, S., D. A. O'Leary, A. P. Thornell, M. J. Owen, I. Kola and P. J. Hertzog (2004). "The ETS transcription factor GABPalpha is essential for early embryogenesis." Mol Cell

Biol 24(13): 5844-5849.

Salomonis, N., B. Nelson, K. Vranizan, A. R. Pico, K. Hanspers, A. Kuchinsky, L. Ta, M. Mercola and B. R. Conklin (2009). "Alternative splicing in the differentiation of human embryonic stem cells into cardiac precursors." PLoS Comput Biol 5(11): e1000553.

Salvioli, S., A. Ardizzoni, C. Franceschi and A. Cossarizza (1997). "JC-1, but not DiOC6(3) or rhodamine 123, is a reliable fluorescent probe to assess delta psi changes in intact cells: implications for studies on mitochondrial functionality during apoptosis." FEBS Lett 411(1): 77-82.

Sandoval, H., P. Thiagarajan, S. K. Dasgupta, A. Schumacher, J. T. Prchal, M. Chen and J. Wang (2008). "Essential role for Nix in autophagic maturation of erythroid cells." Nature

454(7201): 232-235.

Santos, T. A., S. El Shourbagy and J. C. St John (2006). "Mitochondrial content reflects oocyte variability and fertilization outcome." Fertil Steril 85(3): 584-591.

Saretzki, G., T. Walter, S. Atkinson, J. F. Passos, B. Bareth, W. N. Keith, R. Stewart, S. Hoare, M. Stojkovic, L. Armstrong, T. von Zglinicki and M. Lako (2008). "Downregulation of multiple stress defense mechanisms during differentiation of human embryonic stem cells." Stem Cells 26(2): 455-464.

Sato, A., K. Nakada, H. Shitara, A. Kasahara, H. Yonekawa and J. Hayashi (2007). "Deletion-mutant mtDNA increases in somatic tissues but decreases in female germ cells

with age." Genetics 177(4): 2031-2037.

Scarpulla, R. C. (2006). "Nuclear control of respiratory gene expression in mammalian

cells." J Cell Biochem 97(4): 673-683.

Scarpulla, R. C. (2008). "Transcriptional paradigms in mammalian mitochondrial biogenesis

and function." Physiol Rev 88(2): 611-638.

180

Scarpulla, R. C. (2011). "Metabolic control of mitochondrial biogenesis through the PGC-1

family regulatory network." Biochimica et biophysica acta 1813(7): 1269-1278.

Schieke, S. M., M. Ma, L. Cao, J. P. McCoy, Jr., C. Liu, N. F. Hensel, A. J. Barrett, M. Boehm and T. Finkel (2008). "Mitochondrial metabolism modulates differentiation and teratoma formation capacity in mouse embryonic stem cells." J Biol Chem 283(42):

28506-28512.

Schieke, S. M., J. P. McCoy, Jr. and T. Finkel (2008). "Coordination of mitochondrial

bioenergetics with G1 phase cell cycle progression." Cell Cycle 7(12): 1782-1787.

Schieke, S. M., D. Phillips, J. P. McCoy, Jr., A. M. Aponte, R. F. Shen, R. S. Balaban and T. Finkel (2006). "The mammalian target of rapamycin (mTOR) pathway regulates mitochondrial oxygen consumption and oxidative capacity." J Biol Chem

281(37):27643-27652.

Schmitt, M. E. and D. A. Clayton (1993). "Conserved features of yeast and mammalian

mitochondrial DNA replication." Curr Opin Genet Dev 3(5): 769-774.

Schroeder, P., T. Gremmel, M. Berneburg and J. Krutmann (2008). "Partial depletion of mitochondrial DNA from human skin fibroblasts induces a gene expression profile

reminiscent of photoaged skin." J Invest Dermatol 128(9): 2297-2303.

Schuldiner, M., O. Yanuka, J. Itskovitz-Eldor, D. A. Melton and N. Benvenisty (2000). "Effects of eight growth factors on the differentiation of cells derived from human embryonic

stem cells." Proc Natl Acad Sci U S A 97(21): 11307-11312.

Seidel-Rogol, B. L. and G. S. Shadel (2002). "Modulation of mitochondrial transcription in response to mtDNA depletion and repletion in HeLa cells." Nucleic Acids Res 30(9):1929-1934.

Shadel, G. S. and D. A. Clayton (1997). "Mitochondrial DNA maintenance in vertebrates."

Annu Rev Biochem 66: 409-435.

Shahbazian, D., P. P. Roux, V. Mieulet, M. S. Cohen, B. Raught, J. Taunton, J. W. Hershey, J. Blenis, M. Pende and N. Sonenberg (2006). "The mTOR/PI3K and MAPK pathways converge on eIF4B to control its phosphorylation and activity." Embo J 25(12): 2781-2791.

Shamblott, M. J., J. Axelman, S. Wang, E. M. Bugg, J. W. Littlefield, P. J. Donovan, P. D. Blumenthal, G. R. Huggins and J. D. Gearhart (1998). "Derivation of pluripotent stem cells

from cultured human primordial germ cells." Proc Natl Acad Sci U S A 95(23):13726-13731.

Shepard, T. H., L. A. Muffley and L. T. Smith (2000). "Mitochondrial ultrastructure in embryos after implantation." Hum Reprod 15 Suppl 2: 218-228.

Siciliano, G., M. Mancuso, L. Pasquali, M. L. Manca, A. Tessa and A. Iudice (2000).

"Abnormal levels of human mitochondrial transcription factor A in skeletal muscle in

mitochondrial encephalomyopathies." Neurol Sci 21(5 Suppl): S985-987.

Sidhu, K. S., S. Walke and B. E. Tuch (2008). "Derivation and propagation of hESC under a therapeutic environment." Curr Protoc Stem Cell Biol Chapter 1: Unit 1A 4.

181

Silva, J. P., M. Kohler, C. Graff, A. Oldfors, M. A. Magnuson, P. O. Berggren and N. G. Larsson (2000). "Impaired insulin secretion and beta-cell loss in tissue-specific knockout

mice with mitochondrial diabetes." Nat Genet 26(3): 336-340.

Silva, M. F., C. C. Aires, P. B. Luis, J. P. Ruiter, I. J. L, M. Duran, R. J. Wanders and I. Tavares de Almeida (2008). "Valproic acid metabolism and its effects on mitochondrial fatty

acid oxidation: a review." J Inherit Metab Dis 31(2): 205-216.

Singh, R., Y. Xiang, Y. Wang, K. Baikati, A. M. Cuervo, Y. K. Luu, Y. Tang, J. E. Pessin, G. J. Schwartz and M. J. Czaja (2009). "Autophagy regulates adipose mass and differentiation in mice." The Journal of clinical investigation 119(11): 3329-3339.

Sligh, J. E., S. E. Levy, K. G. Waymire, P. Allard, D. L. Dillehay, S. Nusinowitz, J. R. Heckenlively, G. R. MacGregor and D. C. Wallace (2000). "Maternal germ-line transmission of mutant mtDNAs from embryonic stem cell-derived chimeric mice." Proc Natl Acad Sci U S A 97(26): 14461-14466.

Smirnova, E., L. Griparic, D. L. Shurland and A. M. van der Bliek (2001). "Dynamin-related protein Drp1 is required for mitochondrial division in mammalian cells." Mol Biol Cell

12(8):2245-2256.

Sorensen, L., M. Ekstrand, J. P. Silva, E. Lindqvist, B. Xu, P. Rustin, L. Olson and N. G. Larsson (2001). "Late-onset corticohippocampal neurodepletion attributable to catastrophic

failure of oxidative phosphorylation in MILON mice." J Neurosci 21(20): 8082-8090.

Soslau, G. and M. M. Nass (1971). "Effects of ethidium bromide on the cytochrome content

and ultrastructure of L cell mitochondria." J Cell Biol 51(21): 514-524.

Spelbrink, J. N., F. Y. Li, V. Tiranti, K. Nikali, Q. P. Yuan, M. Tariq, S. Wanrooij, N. Garrido, G. Comi, L. Morandi, L. Santoro, A. Toscano, G. M. Fabrizi, H. Somer, R. Croxen, D. Beeson, J. Poulton, A. Suomalainen, H. T. Jacobs, M. Zeviani and C. Larsson (2001). "Human mitochondrial DNA deletions associated with mutations in the gene encoding Twinkle, a phage T7 gene 4-like protein localized in mitochondria." Nat Genet 28(3):

223-231.

Spence, J. R., C. N. Mayhew, S. A. Rankin, M. F. Kuhar, J. E. Vallance, K. Tolle, E. E. Hoskins, V. V. Kalinichenko, S. I. Wells, A. M. Zorn, N. F. Shroyer and J. M. Wells (2011). "Directed differentiation of human pluripotent stem cells into intestinal tissue in vitro."

Nature 470(7332): 105-109.

Sperger, J. M., X. Chen, J. S. Draper, J. E. Antosiewicz, C. H. Chon, S. B. Jones, J. D. Brooks, P. W. Andrews, P. O. Brown and J. A. Thomson (2003). "Gene expression patterns in human embryonic stem cells and human pluripotent germ cell tumors." Proc Natl Acad

Sci U S A 100(23): 13350-13355.

Spikings, E. C., J. Alderson and J. C. St John (2007). "Regulated mitochondrial DNA

replication during oocyte maturation is essential for successful porcine embryonic development." Biol Reprod 76(2): 327-335.

182

Spiropoulos, J., D. M. Turnbull and P. F. Chinnery (2002). "Can mitochondrial DNA

mutations cause sperm dysfunction?" Mol Hum Reprod 8(8): 719-721.

St John, J. and R. Lovell-Badge (2007). "Human-animal cytoplasmic hybrid embryos,

mitochondria, and an energetic debate." Nat Cell Biol 9(9): 988-992.

St John, J. C., A. Amaral, E. Bowles, J. F. Oliveira, R. Lloyd, M. Freitas, H. L. Gray, C. S. Navara, G. Oliveira, G. P. Schatten, E. Spikings and J. Ramalho-Santos (2006). "The analysis of mitochondria and mitochondrial DNA in human embryonic stem cells." Methods

Mol Biol 331: 347-374.

St John, J. C., J. Ramalho-Santos, H. L. Gray, P. Petrosko, V. Y. Rawe, C. S. Navara, C. R. Simerly and G. P. Schatten (2005). "The expression of mitochondrial DNA transcription factors during early cardiomyocyte in vitro differentiation from human embryonic stem

cells." Cloning Stem Cells 7(3): 141-153.

Storrie, B. and G. Attardi (1973). "Expression of the mitochondrial genome in HeLa cells. IX. Effect of inhibition of mitochondrial protein synthesis on mitochondrial formation." J Cell Biol

56(3): 819-831.

Stuchell, R. N., B. I. Weinstein and D. S. Beattie (1975). "Effects of ethidium bromide on the respiratory chain and oligomycin-sensitive adenosine triphosphatase in purified mitochondria from the cellular slime mold Dicyostelium discoideum." J Biol Chem

250(2):570-576.

Sutovsky, P., R. D. Moreno, J. Ramalho-Santos, T. Dominko, C. Simerly and G. Schatten (2000). "Ubiquitinated sperm mitochondria, selective proteolysis, and the regulation of mitochondrial inheritance in mammalian embryos." Biol Reprod 63(2): 582-590.

Suzuki, K., T. Kirisako, Y. Kamada, N. Mizushima, T. Noda and Y. Ohsumi (2001). "The pre-autophagosomal structure organized by concerted functions of APG genes is essential

for autophagosome formation." Embo J 20(21): 5971-5981.

Takahashi, K., M. Murakami and S. Yamanaka (2005). "Role of the phosphoinositide 3-kinase pathway in mouse embryonic stem (ES) cells." Biochem Soc Trans 33(Pt

6):1522-1525.

Takahashi, K. and S. Yamanaka (2006). "Induction of pluripotent stem cells from mouse

embryonic and adult fibroblast cultures by defined factors." Cell 126(4): 663-676.

Takamatsu, C., S. Umeda, T. Ohsato, T. Ohno, Y. Abe, A. Fukuoh, H. Shinagawa, N. Hamasaki and D. Kang (2002). "Regulation of mitochondrial D-loops by transcription factor

A and single-stranded DNA-binding protein." EMBO Rep 3(5): 451-456.

Tanaka, A. J., M. V. Sauer, D. Egli and D. H. Kort (2013). "Harnessing the stem cell

potential: the path to prevent mitochondrial disease." Nat Med 19(12): 1578-1579.

Tang, S., M. C. Halberg, K. C. Floyd and J. Wang (2012). "Analysis of common mitochondrial DNA mutations by allele-specific oligonucleotide and Southern blot

hybridization." Methods Mol Biol 837: 259-279.

183

Tanida, I., T. Ueno and E. Kominami (2004). "LC3 conjugation system in mammalian

autophagy." Int J Biochem Cell Biol 36(12): 2503-2518.

Tee, A. R. and J. Blenis (2005). "mTOR, translational control and human disease." Semin

Cell Dev Biol 16(1): 29-37.

Teo, A. K., S. J. Arnold, M. W. Trotter, S. Brown, L. T. Ang, Z. Chng, E. J. Robertson, N. R. Dunn and L. Vallier (2011). "Pluripotency factors regulate definitive endoderm specification

through eomesodermin." Genes Dev 25(3): 238-250.

Terman, A. (1995). "The effect of age on formation and elimination of autophagic vacuoles

in mouse hepatocytes." Gerontology 41 Suppl 2: 319-326.

Terman, A. and U. T. Brunk (2004). "Myocyte aging and mitochondrial turnover." Exp Gerontol 39(5): 701-705.

Terman, A., H. Dalen, J. W. Eaton, J. Neuzil and U. T. Brunk (2004). "Aging of cardiac myocytes in culture: oxidative stress, lipofuscin accumulation, and mitochondrial turnover."

Ann N Y Acad Sci 1019: 70-77.

Tessa, A., M. L. Manca, M. Mancuso, M. R. Renna, L. Murri, B. Martini, F. M. Santorelli and G. Siciliano (2000). "Abnormal H-Tfam in a patient harboring a single mtDNA deletion."

Funct Neurol 15(4): 211-214.

Thomson, J. A., J. Itskovitz-Eldor, S. S. Shapiro, M. A. Waknitz, J. J. Swiergiel, V. S. Marshall and J. M. Jones (1998). "Embryonic stem cell lines derived from human blastocysts." Science 282(5391): 1145-1147.

Thomson, J. A. and J. S. Odorico (2000). "Human embryonic stem cell and embryonic germ

cell lines." Trends Biotechnol 18(2): 53-57.

Todd, L. R., M. N. Damin, R. Gomathinayagam, S. R. Horn, A. R. Means and U. Sankar (2010). "Growth factor erv1-like modulates Drp1 to preserve mitochondrial dynamics and

function in mouse embryonic stem cells." Molecular biology of the cell 21(7): 1225-1236.

Tolkovsky, A. M. (2009). "New gene on the block: Atg32--a specific receptor for selective mitophagy in S. cerevisiae." Autophagy 5(8): 1077-1078.

Tolkovsky, A. M., L. Xue, G. C. Fletcher and V. Borutaite (2002). "Mitochondrial disappearance from cells: a clue to the role of autophagy in programmed cell death and

disease?" Biochimie 84(2-3): 233-240.

Tormos, K. V., E. Anso, R. B. Hamanaka, J. Eisenbart, J. Joseph, B. Kalyanaraman and N. S. Chandel (2011). "Mitochondrial Complex III ROS Regulate Adipocyte Differentiation."

Cell Metab 14(4): 537-544.

Tra, T., L. Gong, L. P. Kao, X. L. Li, C. Grandela, R. J. Devenish, E. Wolvetang and M.

Prescott (2011). "Autophagy in human embryonic stem cells." PLoS One 6(11): e27485.

184

Unger, C., H. Skottman, P. Blomberg, M. S. Dilber and O. Hovatta (2008). "Good manufacturing practice and clinical-grade human embryonic stem cell lines." Hum Mol

Genet 17(R1): R48-53.

Valdimarsdottir, G. and C. Mummery (2005). "Functions of the TGFbeta superfamily in human embryonic stem cells." APMIS 113(11-12): 773-789.

Vallejo, C. G., M. Lopez, P. Ochoa, M. Manzanares and R. Garesse (1996). "Mitochondrial differentiation during the early development of the brine shrimp Artemia franciscana." The

Biochemical journal 314 ( Pt 2): 505-510.

Vallier, L., M. Alexander and R. A. Pedersen (2005). "Activin/Nodal and FGF pathways cooperate to maintain pluripotency of human embryonic stem cells." J Cell Sci 118(Pt

19):4495-4509.

Van Blerkom, J. (2004). "Mitochondria in human oogenesis and preimplantation embryogenesis: engines of metabolism, ionic regulation and developmental competence."

Reproduction 128(3): 269-280.

Varum, S., O. Momcilovic, C. Castro, A. Ben-Yehudah, J. Ramalho-Santos and C. S. Navara (2009). "Enhancement of human embryonic stem cell pluripotency through

inhibition of the mitochondrial respiratory chain." Stem Cell Res 3(2-3): 142-156.

Viader, A., J. P. Golden, R. H. Baloh, R. E. Schmidt, D. A. Hunter and J. Milbrandt (2011). "Schwann cell mitochondrial metabolism supports long-term axonal survival and peripheral

nerve function." J Neurosci 31(28): 10128-10140.

Viader, A., E. C. Wright-Jin, B. P. Vohra, R. O. Heuckeroth and J. Milbrandt (2011). "Differential regional and subtype-specific vulnerability of enteric neurons to mitochondrial dysfunction." PLoS One 6(11): e27727.

Virbasius, C. A., J. V. Virbasius and R. C. Scarpulla (1993). "NRF-1, an activator involved in nuclear-mitochondrial interactions, utilizes a new DNA-binding domain conserved in a

family of developmental regulators." Genes Dev 7(12A): 2431-2445.

Vives-Bauza, C., C. Zhou, Y. Huang, M. Cui, R. L. de Vries, J. Kim, J. May, M. A. Tocilescu, W. Liu, H. S. Ko, J. Magrane, D. J. Moore, V. L. Dawson, R. Grailhe, T. M. Dawson, C. Li, K. Tieu and S. Przedborski (2010). "PINK1-dependent recruitment of Parkin to mitochondria in

mitophagy." Proc Natl Acad Sci U S A 107(1): 378-383.

Wagatsuma, A., N. Kotake and S. Yamada (2011). "Muscle regeneration occurs to coincide with mitochondrial biogenesis." Mol Cell Biochem 349(1-2): 139-147.

Wai, T., A. Ao, X. Zhang, D. Cyr, D. Dufort and E. A. Shoubridge (2010). "The role of

mitochondrial DNA copy number in mammalian fertility." Biol Reprod 83(1): 52-62.

Wallace, D. C. (1999). "Mitochondrial diseases in man and mouse." Science

283(5407):1482-1488.

Wallace, D. C. and W. Fan (2010). "Energetics, epigenetics, mitochondrial genetics." Mitochondrion 10(1): 12-31.

185

Wang, J., J. P. Silva, C. M. Gustafsson, P. Rustin and N. G. Larsson (2001). "Increased in vivo apoptosis in cells lacking mitochondrial DNA gene expression." Proc Natl Acad Sci U S

A 98(7): 4038-4043.

Wang, J., H. Wilhelmsson, C. Graff, H. Li, A. Oldfors, P. Rustin, J. C. Bruning, C. R. Kahn, D. A. Clayton, G. S. Barsh, P. Thoren and N. G. Larsson (1999). "Dilated cardiomyopathy and atrioventricular conduction blocks induced by heart-specific inactivation of

mitochondrial DNA gene expression." Nat Genet 21(1): 133-137.

Wang, W., Y. Esbensen, D. Kunke, R. Suganthan, L. Rachek, M. Bjoras and L. Eide (2011). "Mitochondrial DNA damage level determines neural stem cell differentiation fate." J

Neurosci 31(26): 9746-9751.

Waterman, R. A. and R. J. Wall (1988). "Lipid interactions with in vitro development of

mammalian zygotes." Gamete Res 21(3): 243-254.

Watkins, J., S. Basu and D. F. Bogenhagen (2008). "A quantitative proteomic analysis of mitochondrial participation in p19 cell neuronal differentiation." J Proteome Res 7(1):

328-338.

Weissman, I. L. (2000). "Stem cells: units of development, units of regeneration, and units

in evolution." Cell 100(1): 157-168.

Westermann, B. (2010). "Mitochondrial fusion and fission in cell life and death." Nat Rev Mol Cell Biol 11(12): 872-884.

Whitworth, A. J., D. A. Theodore, J. C. Greene, H. Benes, P. D. Wes and L. J. Pallanck (2005). "Increased glutathione S-transferase activity rescues dopaminergic neuron loss in a

Drosophila model of Parkinson's disease." Proc Natl Acad Sci U S A 102(22): 8024-8029.

Wieckowski, M. R., C. Giorgi, M. Lebiedzinska, J. Duszynski and P. Pinton (2009). "Isolation of mitochondria-associated membranes and mitochondria from animal tissues

and cells." Nat Protoc 4(11): 1582-1590.

Williams, S. L., H. R. Scholte, R. G. Gray, J. V. Leonard, A. H. Schapira and J. W. Taanman (2001). "Immunological phenotyping of fibroblast cultures from patients with a mitochondrial respiratory chain deficit." Lab Invest 81(8): 1069-1077.

Wiseman, A. and G. Attardi (1978). "Reversible tenfod reduction in mitochondria DNA

content of human cells treated with ethidium bromide." Mol Gen Genet 167(1): 51-63.

Wobus, A. M. and K. R. Boheler (2005). "Embryonic stem cells: prospects for

developmental biology and cell therapy." Physiol Rev 85(2): 635-678.

Wredenberg, A., R. Wibom, H. Wilhelmsson, C. Graff, H. H. Wiener, S. J. Burden, A. Oldfors, H. Westerblad and N. G. Larsson (2002). "Increased mitochondrial mass in

mitochondrial myopathy mice." Proc Natl Acad Sci U S A 99(23): 15066-15071.

Wu, Z., P. Puigserver, U. Andersson, C. Zhang, G. Adelmant, V. Mootha, A. Troy, S. Cinti, B. Lowell, R. C. Scarpulla and B. M. Spiegelman (1999). "Mechanisms controlling

186

mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1." Cell

98(1): 115-124.

Xu, B. and D. A. Clayton (1995). "A persistent RNA-DNA hybrid is formed during transcription at a phylogenetically conserved mitochondrial DNA sequence." Mol Cell Biol 15(1): 580-589.

Xu, R. H., R. M. Peck, D. S. Li, X. Feng, T. Ludwig and J. A. Thomson (2005). "Basic FGF and suppression of BMP signaling sustain undifferentiated proliferation of human ES cells."

Nat Methods 2(3): 185-190.

Yakes, F. M. and B. Van Houten (1997). "Mitochondrial DNA damage is more extensive and persists longer than nuclear DNA damage in human cells following oxidative stress."

Proc Natl Acad Sci U S A 94(2): 514-519.

Yamada, Y., R. Furukawa, Y. Yasuzaki and H. Harashima (2011). "Dual function MITO-Porter, a nano carrier integrating both efficient cytoplasmic delivery and mitochondrial macromolecule delivery." Molecular therapy : the journal of the American

Society of Gene Therapy 19(8): 1449-1456.

Yang, C., S. Przyborski, M. J. Cooke, X. Zhang, R. Stewart, G. Anyfantis, S. P. Atkinson, G. Saretzki, L. Armstrong and M. Lako (2008). "A key role for telomerase reverse transcriptase unit in modulating human embryonic stem cell proliferation, cell cycle dynamics, and in vitro

differentiation." Stem Cells 26(4): 850-863.

Yang, M. Y., M. Bowmaker, A. Reyes, L. Vergani, P. Angeli, E. Gringeri, H. T. Jacobs and I. J. Holt (2002). "Biased incorporation of ribonucleotides on the mitochondrial L-strand accounts for apparent strand-asymmetric DNA replication." Cell 111(4): 495-505.

Yang, Q. and K. L. Guan (2007). "Expanding mTOR signaling." Cell Res 17(8): 666-681.

Yang, X., C. Yang, A. Farberman, T. C. Rideout, C. F. de Lange, J. France and M. Z. Fan (2008). "The mammalian target of rapamycin-signaling pathway in regulating metabolism

and growth." J Anim Sci 86(14 Suppl): E36-50.

Yang, Y., Y. Ouyang, L. Yang, M. F. Beal, A. McQuibban, H. Vogel and B. Lu (2008). "Pink1 regulates mitochondrial dynamics through interaction with the fission/fusion

machinery." Proc Natl Acad Sci U S A 105(19): 7070-7075.

Yasukawa, T., M. Y. Yang, H. T. Jacobs and I. J. Holt (2005). "A bidirectional origin of replication maps to the major noncoding region of human mitochondrial DNA." Mol Cell 18(6): 651-662.

Yen, W. L. and D. J. Klionsky (2008). "How to live long and prosper: autophagy,

mitochondria, and aging." Physiology (Bethesda) 23: 248-262.

Ylikallio, E., H. Tyynismaa, H. Tsutsui, T. Ide and A. Suomalainen (2010). "High mitochondrial DNA copy number has detrimental effects in mice." Hum Mol Genet 19(13):2695-2705.

187

Yoon, T. M., B. Chang, H. T. Kim, J. H. Jee, D. W. Kim and D. Y. Hwang (2010). "Human embryonic stem cells (hESCs) cultured under distinctive feeder-free culture conditions display global gene expression patterns similar to hESCs from feeder-dependent culture conditions." Stem Cell Rev 6(3): 425-437.

Yorimitsu, T. and D. J. Klionsky (2005). "Autophagy: molecular machinery for self-eating."

Cell Death Differ 12 Suppl 2: 1542-1552.

Yoshida, Y., H. Izumi, T. Ise, H. Uramoto, T. Torigoe, H. Ishiguchi, T. Murakami, M. Tanabe, Y. Nakayama, H. Itoh, H. Kasai and K. Kohno (2002). "Human mitochondrial transcription factor A binds preferentially to oxidatively damaged DNA." Biochemical and biophysical

research communications 295(4): 945-951.

Youle, R. J. and M. Karbowski (2005). "Mitochondrial fission in apoptosis." Nat Rev Mol

Cell Biol 6(8): 657-663.

Yu, J., M. A. Vodyanik, K. Smuga-Otto, J. Antosiewicz-Bourget, J. L. Frane, S. Tian, J. Nie, G. A. Jonsdottir, V. Ruotti, R. Stewart, Slukvin, II and J. A. Thomson (2007). "Induced pluripotent stem cell lines derived from human somatic cells." Science

318(5858):1917-1920.

Zangrossi, S., M. Marabese, M. Broggini, R. Giordano, M. D'Erasmo, E. Montelatici, D. Intini, A. Neri, M. Pesce, P. Rebulla and L. Lazzari (2007). "Oct-4 expression in adult human differentiated cells challenges its role as a pure stem cell marker." Stem Cells

25(7):1675-1680.

Zeller, K. I., A. G. Jegga, B. J. Aronow, K. A. O'Donnell and C. V. Dang (2003). "An integrated database of genes responsive to the Myc oncogenic transcription factor:

identification of direct genomic targets." Genome biology 4(10): R69.

Zeng, M. and J. N. Zhou (2008). "Roles of autophagy and mTOR signaling in neuronal

differentiation of mouse neuroblastoma cells." Cell Signal 20(4): 659-665.

Zeviani, M. and C. Antozzi (1997). "Mitochondrial disorders." Mol Hum Reprod 3(2):133-148.

Zeviani, M. and S. Di Donato (2004). "Mitochondrial disorders." Brain 127(Pt

10):2153-2172.

Zhang, J., I. Khvorostov, J. S. Hong, Y. Oktay, L. Vergnes, E. Nuebel, P. N. Wahjudi, K. Setoguchi, G. Wang, A. Do, H. J. Jung, J. M. McCaffery, I. J. Kurland, K. Reue, W. N. Lee, C. M. Koehler and M. A. Teitell (2011). "UCP2 regulates energy metabolism and

differentiation potential of human pluripotent stem cells." EMBO J 30(24): 4860-4873.

Zhao, Y., Q. Huang, J. Yang, M. Lou, A. Wang, J. Dong, Z. Qin and T. Zhang (2010). "Autophagy impairment inhibits differentiation of glioma stem/progenitor cells." Brain Res

1313: 250-258.

Zhou, J., P. Su, L. Wang, J. Chen, M. Zimmermann, O. Genbacev, O. Afonja, M. C. Horne, T. Tanaka, E. Duan, S. J. Fisher, J. Liao and F. Wang (2009). "mTOR supports long-term

188

self-renewal and suppresses mesoderm and endoderm activities of human embryonic stem

cells." Proc Natl Acad Sci U S A 106(19): 7840-7845.

189

Tables

Objective 1: Mitochondrial-Encoded and Mitochondrial Biogenesis-Related Gene

Expression During Lineage-Specific Differentiation of Human Embryonic Stem Cells

Table 4.1 Comparison of TRA-1-60 and mitochondrial staining in undifferentiated and

differentiated hESCs.

Markers for pluripotency (TRA-1-60) and mitochondria (MitoTracker Red) were analyzed in

hESCs under the indicated treatment conditions. Histogram is also shown in the Figure 4.2. Data

reflect the mean ± standard deviation (SD, n = 3). *P<0.05 as compared to control. Abbreviations:

Undiff, undifferentiated hESCs cultured in conditioned medium; Spd. diff-day 7, hESCs cultured

without basic fibroblast growth factor for 7 days; Spd. diff-day14, hESCs cultured without basic

fibroblast growth factor for 14 days; RA-day 3, hESCs cultured with retinoic acid (RA) for 3 days.

Undiff Spd. Diff-day 7 Spd. Diff-day 14 RA-day 3

Intensity of

TRA-1-60

staining

164,124 ± 7110

(1.00 ± 0.04)

168,146 ±

18,775

(1.01 ± 0.16)

91,091 ± 4406 *

(0.56 ± 0.05 *)

14,841 ± 188 *

(0.09 ± 0.01 *)

Intensity of

MitoTracker

staining

6,518,461 ±

189,787

(1.00 ± 0.03)

11,216,946 ±

1,410,269 *

(2.01 ± 0.16 *)

757,6781 ±

181,829

(1.16 ± 0.02)

6,577,975 ±

121,149 „

(1.01 ± 0.02)

190

Table 4.2 Changes in gene expression upon hESC differentiation.

RT-PCR analysis was used to determine gene expression levels within undifferentiated and

differentiated hESCs. Both the Mel 1 and hES3 cell lines were examined. Expression levels were

normalized to β-ACTIN (ACTB). Histogram is also shown in the Figure 4.3. Data were the mean ±

SD. *P<0.05 as compared to control. Abbreviations: POU5F1, POU class 5 homeobox 1; ND1,

NADH dehydrogenase 1; CYTB, cytochrome b; TFAM, mitochondrial transcription factor A; NRF1,

nuclear respiratory factor 1; POLG, DNA polymerase subunit gamma; PGC1α, peroxisome

proliferator-activated receptor gamma coactivator 1 alpha; β-ACTIN(ACTB), beta-actin; D-loop,

displacement loop.

191

Mel 1 line Undiff. Spd. diff.-day 7 Spd. diff.-day 14 RA-day 3

POU5F1 1.00 ± 0.10 0.01 ± 0.01 **** 0.01 ± 0.01 **** 0.01 ± 0.001

****

ND1 1.00 ± 0.10 0.38 ± 0.01 * 1.11 ± 0.85 0.01 ± 0.001

****

CYTB 1.00 ± 0.13 0.97 ± 0.03 3.32 ± 0.09 **** 2.79 ± 0.07

****

TFAM 1.00 ± 0.88 0.60 ± 0.10 1.18 ± 0.16 0.14 ± 0.04

NRF1 1.00 ± 0.04 0.08 ± 0.07 * 0.37 ± 0.58 0.34 ± 0.02

POLG 1.00 ± 0.01 0.05 ± 0.05 **** 1.11 ± 0.02 ** 0.30 ± 0.01

****

PGC1α 1.00 ± 0.13 1.67 ± 0.20 * 2.66 ± 0.80 ** 1.20 ± 0.32 *

D-loop 1.00 ± 0.51 2.61 ± 0.66 * 1.30 ± 0.27 N/A

hES3 line Undiff. Spd. diff.-day 7 Spd. diff.-day 14 RA-day 3

POU5F1 1.00 ± 0.62 0.21 ± 0.10 0.19 ± 0.02 0.06 ± 0.02 *

ND1 1.00 ± 0.50 1.10 ± 0.30 0.66 ± 0.46 1.29 ± 0.54

CYTB 1.00 ± 0.03 1.36 ± 0.04 * 0.99 ± 0.06 0.66 ± 0.19 *

TFAM 1.00 ± 0.15 0.63 ± 0.03 ** 0.25 ± 0.02 **** 0.48 ± 0.03 ***

NRF1 1.00 ± 0.03 0.14 ± 0.09 ** 0.12 ± 0.04 ** 0.59 ± 0.34

POLG 1.00 ± 0.25 0.16 ± 0.17 ** 0.14 ± 0.13 ** 0.67 ± 0.29

PGC1α 1.00 ± 0.27 14.25 ± 1.40 **** 6.98 ± 0.27 *** 7.47 ± 1.32 ***

D-loop 1.00 ± 0.23 31.49 ± 2.47 **** 2.11 ± 0.12 0.46 ± 0.05

192

Table 4.3 Changes in gene expression associated with ectoderm-specific differentiation of hESCs.

Expression and qPCR expression fold changes were shown for gene associated with

pluripotency (POU5F1), ectoderm-differentiation (PAX6), genes encoded by mitochondria (ND5

and COX3) and mitochondrial biogenesis–related genes (TFAM, NRF1, POLG and PGC1α). Data

were normalised to β-Actin (ACTB). Histogram is also shown in the Figure 4.4. Data were the mean

± SD. *P<0.05 as compared to control. Abbreviations: PAX6, paired box 6; ND5, NADH

dehydrogenase 5; COX3, Cytochrome oxidase 3.

Genes Day 0 Day 8 Day 12

PAX6 1.00 ± 0.39 517.19 ± 116.64 *** 357.55 ± 9.77 **

POU5F1 1.00 ± 0.12 0.22 ± 0.04 **** 0.06 ± 0.01 ****

ND5 1.00 ± 0.08 11.69 ± 0.92 **** 1.33 ± 0.13

COX3 1.00 ± 0.05 12.74 ± 0.40 **** 1.45 ± 0.13

TFAM 1.00 ± 0.12 1.10 ± 0.17 0.86 ± 0.09

NRF1 1.00 ± 0.21 1.59 ± 0.68 0.93 ± 0.08

POLG 1.00 ± 0.02 1.56 ± 0.27 * 0.61 ± 0.04

PGC1α 1.00 ± 0.16 7.76 ± 0.32 **** 2.03 ± 0.25 **

193

Table 4.4 Changes in gene expression associated with endoderm-specific differentiation of hESCs.

Expression and qPCR expression fold changes were shown for gene associated with

pluripotency (POU5F1), endoderm differentiation (SOX17), genes encoded by mitochondria (ND5

and COX3) and mitochondrial biogenesis–related genes (TFAM and PGC1α). Data were normalised

to β-Actin (ACTB). Histogram is also shown in the Figure 4.5. Data were the mean ± SD. *P<0.05

as compared to control. Abbreviations: SOX17, SRY-box 17.

Genes Day 0 Day 1 Day 2 Day 3

SOX17 1.00 ± 0.14 5.57 ± 0.48 * 12.95 ± 2.43 **** 21.09 ± 0.85 ****

POUT5F1 1.00 ± 0.22 0.54 ± 0.13 * 0.63 ± 0.05 * 0.40 ± 0.03 **

ND5 1.00 ± 0.16 0.45 ± 0.03 *** 0.54 ± 0.01 *** 0.52 ± 0.01 ***

COX3 1.00 ± 0.02 0.92 ± 0.03 0.95 ± 0.08 0.89 ± 0.04

TFAM 1.00 ± 0.06 0.64 ± 0.07 * 0.69 ± 0.21 * 0.57 ± 0.01 **

PGC1α 1.00 ± 0.39 0.56 ± 0.11 0.85 ± 0.21 0.42 ± 0.08

194

Table 4.5 Changes in gene expression associated with mesendoderm-specific differentiation of

hESCs.

qPCR analysis was used to determine expression fold changes for genes associated with

pluripotency (POU5F1), ectoderm differentiation (PAX6), mesoderm differentiation (BRY and

MIXL1), endoderm differentiation (IGF2 and GATA4) and mitochondrial biogenesis (TFAM, NRF1

and POLG). A gene encoded by mtDNA (ND1) was also examined. Data were normalised to

β-Actin (ACTB). Histogram is also shown in the Figure 4.6. Data were the mean ± SD. *P<0.05 as

compared to control. Abbreviations: BRY, Brachyury; MIXL1, Mix paired-like homeobox; IGF2,

Insulin-like growth factor 2; GATA4, GATA binding protein4.

Genes Day 0 Day 3 Day 5 Day 7 Day 16

PAX6 1.00 ± 0.45 0.60 ± 0.15 0.32 ± 0.30 0.32 ± 0.38 3.07 ± 0.55 ***

BRY 1.00 ± 0.30 40.38 ± 0.22 ****

7.19 ± 0.40 **** 0.90 ± 0.14 0.27 ± 0.25

MIXL1 1.00 ± 0.23 14.70 ± 0.08 ****

13.35 ± 0.06 ****

7.83 ± 0.10 ****

2.86 ± 0.28 ****

IGF2 1.00 ± 0.09 27.94 ± 0.21 ****

305.36 ± 0.11 ****

924.35 ± 0.09 ****

2210.79 ± 0.18 ****

GATA4 1.00 ± 0.24 510.59 ± 0.13 ****

133.68 ± 0.22 ****

173.61 ± 0.12 ****

485.15 ± 0.15 ****

POU5F1 1.00 ± 0.05 0.50 ± 0.25 ** 0.14 ± 0.10 **** 0.03 ± 0.06 ****

0.00 ± 0.08 ****

ND1 1.00 ± 0.29 0.45 ± 0.20 N/A 2.21 ± 0.61** 1.02 ± 0.27

TFAM 1.00 ± 0.24 0.39 ± 0.58 0.46 ± 0.35 0.46 ± 0.59 0.30 ± 0.52

NRF1 1.00 ± 0.34 0.64 ± 0.24 0.57 ± 0.41 0.78 ± 0.22 0.64 ± 0.20

POLG 1.00 ± 0.08 0.86 ± 0.27 1.21 ± 0.07 1.68 ± 0.22 ** 1.13 ± 0.14

195

Table 4.6 Changes in gene expression associated with cardiomyocyte-specific differentiation of

hESCs.

qPCR analysis was used to determine expression fold changes for genes encoded by mtDNA

(ND5 and COX3) and genes related to mitochondrial biogenesis (TFAM and PGC1α). Data were

normalised to β-Actin (ACTB). Histogram is also shown in the Figure 4.7. Data were the mean ± SD.

*P<0.05 as compared to control.

Genes Day 0 Day 3 Day 7 Day 16

ND5 1.00 ± 0.22 0.92 ± 0.05 1.97 ± 0.22 *** 0.02 ± 0.01 ***

COX3 1.00 ± 0.54 0.95 ± 0.08 0.80 ± 0.10 0.61 ± 0.14

TFAM 1.00 ± 0.06 0.58 ± 0.07 *** 0.56 ± 0.11 *** 0.02 ± 0.01 ****

PGC1α 1.00 ± 0.59 1.01 ± 0.24 1.22 ± 0.21 252.75 ± 63.97 ****

196

Objective 2: Regulation of Mitochondrial Biogenesis in Chloramphenicol- and EtBr-treated

Primary Human Fibroblasts

Table 4.7 Gene expression and qPCR expression fold changes of mitochondria-encoded genes,

transcription factors, and mtDNA copy number in control, ethidium bromide– or

chloramphenicol-treated cells after treatment for 6 weeks and release from treatment for 2 weeks.

Expression of mitochondria-encoded genes (ND1, ND4, CYTB and COX2) and mitochondrial

biogenesis transcription factors (TFAM, NRF-1 and POLG) in each sample was normalised to

β-Actin (ACTB). Histogram is also shown in the Figure 4.9. Data were the mean ± SD. *P<0.05 as

compared to control. Abbreviations: ND4, NADH dehydrogenase subunit IV; COX2, cytochrome c

oxidase subunit II; control, human fibroblasts; EtBr-treated, human fibroblasts treated with 100

ng/ml ethidium bromide; and CAP-treated, human fibroblasts treated with 100 µg/ml

chloramphenicol.

197

Genes Control-6w EtBr-treated-6w CAP-treated-6w

ND1 0.12 ± 0.04 (1.00) 3.50x10

-6 ± 1.50x10

-6 *

(0.00) 8.33x10

-4 ± 1.49x10

-4 * (0.01)

ND4 0.16 ± 0.04 (1.00) 4.00x10

-7 ± 1.00 x10

-7 *

(0.00) 3.11x10

-5 ± 4.80x10

-6 * (0.00)

CYTB 0.91 ± 0.04 (1.00) 6.52x10

-4 ± 4.79x10

-5 *

(0.00) 0.45 ± 0.11* (0.50)

COX2 0.10 ± 0.02 (1.00) 6.00x10

-7 ± 3.00x10

-7 *

(0.00) 2.08x10

-3 ± 2.56x10

-4 * (0.02)

TFAM 1.70x10

-6 ± 8.00

x10-7

(1.00)

7.00x10-7

± 4.00x10-7

(0.42) 9.00x10

-7 ± 4.00x10

-7 (0.53)

NRF1 2.95x10

-6 ± 5.30

x10-6

(1.00)

5.60x10-6

± 8.00x10-7

* (0.19)

5.00x10-7

± 1 x10-8

* (0.02)

POLG 2.13x10

-4 ± 5.76 x10

-5

(1.00)

2.16x10-5

± 9.50x10-6 *

(0.10) 7.33x10

-5 ± 1.83x10

-5 *

(0.34)

D-loop 0.21 ± 0.11 (1.00) 5.28x10

-4 ± 3.60x10

-4 *

(0.00) 0.18 ± 0.03 (0.28)

Control-6+2w EtBr-treated-6+2w CAP-treated-6+2w

ND1 0.63 ± 0.12 (1.00) 0.04 ± 0.01 * (0.06) 0.19 ± 0.02* (0.30)

ND4 0.27 ± 0.03 (1.00) 0.02 ± 0.08 * (0.08) 0.42 ± 0.05 (1.56)

CYTB 0.04 ± 0.01 (1.00) 0.01 ± 0.001 * (0.06) 0.02 ± 0.01 (0.44)

COX2 0.35 ± 0.01 (1.00) 0.10 ± 0.03 * (0.28) 0.40 ± 0.18 (1.15)

TFAM 0.01 ± 0.001(1.00) 0.01 ± 0.001 * (4.05) 0.01 ± 0.001 * (3.09)

NRF1 0.01 ± 0.001 (1.00) 0.01 ± 0.001 * (2.29) 0.01 ± 0.001 (0.71)

POLG 0.01 ± 0.001 (1.00) 0.01 ± 0.001 * (0.92) 0.01 ± 0.002 * (1.77)

D-loop 0.91 ± 0.09 (1.00) 0.09 ± 0.03 * (0.10) 0.39 ± 0.04 * (0.42)

198

Table 4.8 Relative amounts of glucose, lactate, GSH, and GSSG, and intracellular ATP, ADP

concentrations in control, ethidium bromide– or chloramphenicol-treated cells after treatment for 6

weeks and release from treatment for 2 weeks.

The quantities of intracellular ATP concentration, intracellular ADP concentration, and

intracellular ATP/ADP ratio per cell were expressed in mg. The rate of lactate production or

glucose consumption per cell was expressed in pmol/cell. The background was subtracted from all

measurements, which were performed in triplicate. The quantities of GSH and GSSG per cell were

expressed in fmol/cell. Histogram is also shown in the Figure 4.10. Data were the mean ± SD.

*P<0.05 as compared to control.

Control EtBr-treated CAP-treated

Total GSH (fmol/cell) 0.92 ± 0.05 0.55 ± 0.04 * 3.84 ± 0.03 *

Oxidized GSSG (fmole/cell) 0.07 ± 0.01 0.54± 0.03 * 0.05

± 0.02

Reduced GSH (fmol/cell) 0.85± 0.03 0.02 ± 0.002 * 3.78 ± 0.03 *

Oxidized GSSG / reduced GSH (ratio)

0.09 35.00 * 0.01

ATP avg (uM) / protein (mg) 80.08 ± 36.82 1.20 ± 0.59 * 3.47 ± 1.26 *

ADP avg (uM) / protein (mg) 44.90 ± 14.88 2.75 ± 0.46 * 2.76 ± 0.55 *

ATP / ADP (ratio) 1.78 0.44 * 1.26 *

199

Table 4.9 Comparison of the mitochondrial membrane potential in control, ethidium bromide– or

chloramphenicol-treated cells after treatment for 6 weeks and release from treatment for 2 weeks.

Mitochondrial membrane potential staining by JC1: JC1-monomers and JC1-aggregates

indicate low and high mitochondrial membrane potential, respectively. The fluorescence intensity

of JC1-monomers and JC1-aggregates was indicated in mean ± SD. *P<0.05 as compared to

control. Histogram is also shown in the Figure 4.11.

Avg ± SD (Folds) JC1-monomers JC1-aggregates

Control 1892.00 ± 228.33 (1.00) 681.43 ± 130.90 (1.00)

Ethidium bromide-treated 1669.77 ± 98.98 (0.88) 397.20 ± 23.32 * (0.58 *)

Chloramphenicol-treated 2124.97 ± 39.65 (1.12) 577.30 ± 18.10 (0.85)

200

Objective 3: Manipulation of TFAM Expression in Human Embryonic Stem Cells

Table 4.10 Levels of TFAM expression in hESC lines (gain-of-function).

(A) TFAM expression and (B) mtDNA copy number (D-loop) were normalised to β-Actin (ACTB).

(C) TFAM protein levels were determined by flow cytometer, and were normalised to the negative

control. Histogram is also shown in the Figure 4.13. Data were the mean ± SD. *P<0.05 as

compared to control.

(A) TFAM mRNA expression

Mel 1 hES3 H9

hESCs 1.00 ± 0.10 1.00 ± 0.03 1.00 ± 0.14

hESC-Vector 0.32 ± 0.10 *** 0.76 ± 0.15 ** 0.95 ± 0.20

hESC-EF1α-TFAM 2.06 ± 0.03 **** 1.71 ± 0.15 * 1.65 ± 0.43

(B) D-loop expression

hESCs 1.00 ± 0.29 1.00 ± 0.10 1.00 ± 0.11

hESC-Vector 0.69 ± 0.07 0.67 ± 0.10 0.86 ± 0.15

hESC-EF1α-TFAM 1.42 ± 0.32 28.34 ± 0.51 **** 5.44 ± 0.50 **

(C) TFAM protein expression (fluorescence intensity)

hESCs N/A 22894.95 ± 4675.06 29,186.07 ± 5223.61

hESC-Vector N/A 4186.15 ± 1093.36 * N/A

hESC-EF1α-TFAM N/A 50394.71 ± 8123.81 ** 114737.50 ± 28940.68 *

201

Table 4.11 Levels of TFAM expression in hESC lines (loss-of-function).

(A) TFAM mRNA levels were normalised to β-Actin (ACTB). (B) TFAM protein levels were

determined via flow cytometer, and were normalised to the negative control. Histogram is also

shown in the Figure 4.15. Data were the mean ± SD. Abbreviations: dox, doxycycline. *P<0.05 as

compared to control.

TFAM mRNA expression

Mel 1 hES3 H9

(A) Without dox

With dox Without dox

With dox Without dox With dox

hESCs 1.00 ± 0.07

0.60 ± 0.02 1.00 ± 0.34 1.23 ± 0.11 1.00 ± 0.07 3.22 ± 0.64 *

TFAMi-3

1.00 ± 0.09

0.17 ± 0.02 *

1.00 ± 0.23 0.84 ± 0.18 *

1.00 ± 0.19 0.55 ± 0.19 *

TFAMi-5

1.00 ± 0.39

0.03 ± 0.01 *

N/A N/A 1.00 ± 0.25 0.17 ± 0.04 *

TFAMi-6

N/A N/A 1.00 ± 0.01 0.92 ± 0.02 1.00 ± 0.15 1.22 ± 0.21

TFAM protein expression (fluorescence intensity)

Mel 1 hES3 H9

(B) Without dox

With dox Without dox

With dox Without dox With dox

hESCs 4.17x104

± 1.27x10

3

5.50x104

± 8.05x103

1.97x104

± 7.46x102

2.01x104

± 3.27x102

1.58x104

± 1.23x103

1.58x104

± 8.05x102

TFAMi-3

6.77x104

± 2.28x10

3*

9.76x103

± 5.06x102

*

1.11x105

± 1.30x103

7.39x104

± 4.44x103

*

8.31x103

± 1.30x102

7.01x103

± 2.93x102

*

TFAMi-5

2.82x104

± 2.62x10

3*

5.16x103

± 1.71x102

*

N/A N/A 1.28 x104

± 5.03x102

7.62x103

± 4.65x102

*

TFAMi-6

N/A N/A 2.16x104

± 5.72x102

2.21x104

± 3.28x102

8.25x103

± 6.63x101

8.25x103

± 2.31x102

202

Objective 4: Mitophagy in Human Embryonic Stem Cells

Table 4.12. The number of autophagosomes and mitophagy events per hES cell.

Following the indicated treatment, the number of autophagosomes was calculated either from

the statistical data with the ANOVA or from images of single cells, which were exported from

AMNIS, respectively. The average number of mitophagy events was calculated manually from

live-cell flow cytometry images. Histogram is also shown in the Figure 4.20. *P<0.05 as compared

to control. Abbreviations: control, hES-LC3-GFP cells treated with DMSO; Rap, hES-LC3-GFP

cells treated with rapamycin; CCCP, hES-LC3-GFP cells treated with carbonyl cyanide

3-chlorophenylhydrazone; EtBr, hES-LC3-GFP cells treated with ethidium bromide; RA-3,

hES-LC3-GFP cells culture treated with retinoic acid for 3 days; Spd. Diff-7, hES-LC3-GFP cells

culture without basic fibroblast growth factor for 7 days; Spd. Diff-14, hES-LC3-GFP cells culture

without basic fibroblast growth factor for 14 days.

Number of autophagosomes

per cell was counted from

statistical data, exported from

AMNIS.

Number of autophagosomes and mitophagic

events per cell was manually counted from

images of single cell, exported from AMNIS.

Treatment Sample

size

Autophagosomes

(mean SEM)

Sample

size

Autophagosome

s (mean SEM)

Mitophagosomes

(mean SEM)

Control 995 1.87 1.00 * 270 0.69 0.02 * 0.65 0.02 *

Rap 1300 3.65 0.07 * 322 1.63 0.01 * 1.46 0.01 *

CCCP 1156 3.64 0.07 * 481 1.49 0.01 * 1.30 0.01 *

EtBr 1453 3.42 0.07 * 474 1.43 0.01 * 1.30 0.01 *

RA-3 1560 3.06 0.07 * 693 1.59 0.01 * 1.42 0.01 *

Spd. Diff-7 1906 3.02 0.06 * 613 1.37 0.02 * 1.24 0.02 *

Spd. Diff-14 209 2.08 0.12 * 86 0.83 0.03 0.81 0.03 *

203

Figures

Objective 1: Mitochondrial-Encoded and Mitochondrial Biogenesis-Related Gene Expression

During Lineage-Specific Differentiation of Human Embryonic Stem Cells

Figure 4.1. Schematic drawing of the experimental design for spontaneous and lineage-specific

differentiation in hESCs.

Time courses are shown for the protocols to induce (A) spontaneous differentiation, (B)

ectoderm-, (C) endoderm-, and (D) mesendoderm- and cardiomyocyte-differentiation in days.

204

* * *

*

205

Figure 4.2 Comparison of TRA-1-60 and mitochondrial staining in undifferentiated and

differentiated hESCs.

(A) Markers for pluripotency (TRA-1-60) and (B) mitochondria (MitoTracker Deep Red) were

analyzed in live hESCs. Analyzed samples included undifferentiated (control), 7 and 14 days of

spontaneous differentiation, and 3 days of RA treatment. Dot plots were analyzed by ACCURI

software. Black and red lines represent unstained and stained samples, respectively. (C) Graph

represents the fluorescence intensity associated with TRA-1-60 immunoreactivity (black) and

MitoTracker Red (grey). Data were normalised to the control, and reflect the mean ± standard

deviation (SD, n = 3). *P<0.05 as compared to control.

206

B

D

C

E

207

Figure 4.3 Characterization of mitochondria in undifferentiated and differentiated hESCs. D-loop

expression in Mel 1 and hES3.

(A) Gene expression of pluripotency (POU5F1), mtDNA-encoded genes (ND1 and CYTB), and

nuclear-encoded mitochondrial biogenesis genes (TFAM, NRF1, PLOG and PGC1α) in Mel 1(bar

without diagonal lines) and hES3 (bar with diagonal lines) cell lines was subjected to qPCR

analyzes both before and after differentiation, respectively. Analyzed samples of hESCs include

undifferentiated (white), 7 days of spontaneous differentiation (light grey), 14 days of spontaneous

differentiation (dark grey), and 3 days of RA treatment (black). Gene expression levels were

normalised to β-Actin (ACTB). Gene expression values are also shown in the Table 4.2. Data reflect

the mean ± SD. *P<0.05 as compared to control.

TEM analysis of mitochondria (M) in (B) undifferentiated and (C) 14 days of spontaneously

differentiated hESCs. JC-1 staining was used to assess mitochondrial-membrane potential of (D)

undifferentiated and (E) 14 days of spontaneously differentiated hESCs. Low and high membrane

potentials are indicated by green and red staining, respectively. Arrows indicate JC-1 staining.

Representative images are shown. Scale bars represent either 500 nm (B, C) or 100 m (D, E).

Abbreviations: POU5F1, POU class 5 homeobox 1; ND1, NADH dehydrogenase 1; CYTB,

cytochrome b; TFAM, mitochondrial transcription factor A; NRF1, nuclear respiratory factor 1;

POLG, DNA polymerase subunit gamma; PGC1α, peroxisome proliferator-activated receptor

gamma coactivator 1 alpha; β-Actin (ACTB), beta-actin; D-loop, displacement loop.

208

Figure 4.4 Mitochondrial biogenesis profiles during ectoderm differentiation.

A time course of ectoderm differentiation is shown. Undifferentiated hESC (white), day 8 (light

grey), and day 12 (black) of differentiation are shown. Gene expression values are also shown in the

Table 4.3. Analyzed genes included an ectoderm marker (PAX6), a pluripotency marker (POU5F1),

mtDNA-encoded genes (ND5 and COX3), and mitochondrial biogenesis genes (TFAM, NRF1,

POLG and PGC1α). All qPCR values were normalised to β-Actin (ACTB). Gene expression values

are also shown in the Table 4.3. Data are the mean ± SD. *P<0.05 as compared to control.

Abbreviations: PAX6, Paired box 6; ND5, NADH dehydrogenase 5; COX3, Cytochrome oxidase 3.

209

Figure 4.5 Mitochondrial biogenesis profiles during endoderm differentiation.

Time courses of ectoderm and endoderm differentiation are shown. Undifferentiated hESC

(white), day 1 (light grey), day 2 (dark grey), and day 3 (black) of differentiation are shown.

Analyzed genes included a gene associated with endoderm (SOX17), a pluripotency marker

(POU5F1), mtDNA-encoded genes (ND5 and COX3), and mitochondrial biogenesis genes (TFAM

and PGC1α). All qPCR values were normalised to β-Actin (ACTB). Gene expression values are also

shown in the Table 4.4. Data are the mean ± SD. *P<0.05 as compared to control. Abbreviations:

SOX17, SRY-box 17.

210

Figure 4.6 Mitochondrial biogenesis profiles during mesendoderm differentiation.

Time courses of ectoderm and mesendoderm differentiation are shown. Undifferentiated hESC

(white), day 3 (light grey), day 5 (dark grey), day 7 (black), and day 16 (white with diagonal lines)

of differentiation are shown. Analyzed genes included genes associated with the primitive streak

(BRY and MIXL1), an ectoderm marker (PAX6), endoderm markers (IGF2 and GATA4), a

pluripotency marker (POU5F1), a mtDNA-encoded gene (ND1), and mitochondrial biogenesis

genes (TFAM, NRF1 and POLG). All qPCR values were normalised to β-Actin (ACTB). Gene

expression values are also shown in the Table 4.5. Data are the mean ± SD. *P<0.05 as compared to

control. Abbreviations: BRY, Brachyury; MIXL1, Mix paired-like homeobox; IGF2, Insulin-like

growth factor 2; GATA4, GATA binding protein 4.

211

Figure 4.7 Mitochondrial biogenesis profiles during cardiomyocyte differentiation.

Time courses of cardiomyocyte differentiation are shown. Undifferentiated hESC (white), day

3 (light grey), day 7 (dark grey), and day 16 of differentiation (black) are represented. Analyzed

genes included mtDNA-encoded genes (ND5 and COX3), and mitochondrial biogenesis genes

(TFAM and PGC1α). All qPCR values were normalised to β-Actin (ACTB). Gene expression values

are also shown in the Table 4.6. Data are the mean ± SD. *P<0.05 as compared to control.

212

Objective 2: Regulation of Mitochondrial Biogenesis in Chloramphenicol- and EtBr-treated

Primary Human Fibroblasts

Figure 4.8 Morphology and karyotypes of human rho minus cells.

(A and B) Image of control and (E and F) ethidium bromide-treated and (I and J)

chloramphenicol-treated cells were taken by inverted microscopy (Olympus) with a 10x objective

lens. (C and D) G-band karyotypes of control and (G and H) ethidium bromide-treated and (K and L)

chloramphenicol-treated cells. Abbreviations: control, human fibroblasts; Ethidium bromide-treated,

human fibroblasts treated with 100 ng/ml ethidium bromide; and Chloramphenicol-treated, human

fibroblasts treated with 100 µg/ml chloramphenicol.

213

214

Figure 4.9 Relative expressions of mitochondrial-encoded and mitochondrial biogenesis-related

genes after treatment for 6 weeks (6w) and release from treatment for 2 weeks (6+2w, bar with

diagonal lines).

Mitochondria-encoded genes (ND1, ND4, CYTB and COX2), mitochondrial biogenesis

transcription factors (TFAM, NRF1 and POLG), and mitochondrial content (D-loop) in control

(black), EtBr-treated (grey), and CAP-treated fibroblasts (black) at 6 weeks (6w) and release from

treatment for 2 weeks (6+2w). Gene expression of each sample was normalized to β-ACTIN (ACTB).

Gene expression values are also shown in the Table 4.7. Data are the mean ± SD. *P<0.05 as

compared to control. Abbreviations: ND4, NADH dehydrogenase subunit 4; COX2, cytochrome c

oxidase subunit 2.

215

A B

C D

E

* *

*

216

Figure 4.10 Metabolic effect of ethidium bromide and chloramphenicol treatment on human

fibroblasts after treatment for 6 weeks and release from treatment for 2 weeks.

(A) The lactate production, (B) glucose consumption, and (C) ratio of oxidized GSSG to

reduced GSH after treatment for 6 weeks and release from treatment for 2 weeks. The background

was subtracted from all measurements, which were performed in triplicate. (D) Comparison of the

effect of ethidium bromide and chloramphenicol treatment on oxygen consumed by human

fibroblasts. The plot shows the oxygen concentration in the cell culture medium with time. The

decrease in oxygen concentration with time seen in the chloramphenicol-treated samples was due to

oxygen uptake by the cells. No oxygen uptake by cells treated with ethidium bromide (red) was

detectable with this assay. Red line indicates ethidium bromide-treated fibroblasts, and blue line

indicates chloramphenicol-treated fibroblasts. (E) Intracellular ATP/ADP ratio. The values are also

shown in the Table 4.8. Data are the mean ± SD. *P<0.05 as compared to control.

217

C

218

Figure 4.11 Mitochondrial membrane potential in ethidium bromide– or chloramphenicol-treated

cells after treatment for 6 weeks and release from treatment for 2 weeks.

Low membrane potential is indicated by JC-1 monomers (green), and high membrane potential

is indicated by JC-1 aggregates (red). (A) Fluorescent image of control, ethidium bromide-treated

and chloramphenicol-treated human fibroblasts cells. Images were taken with a 20× objective lens

with an Olympus IX81 microscope and analyzed with Cell^ software (Olympus). (B) Mitochondrial

membrane potential was analyzed by WEASEL software. (C) Histogram represents mean intensity

of JC1-monomers and -aggregates in control (white bar), ethidium bromide- (black bar) or

chloramphenicol-treated cells (grey bar). The values are also shown in the Table 4.9. Data are the

mean ± SD. *P<0.05 as compared to control.

219

Figure 4.12 Assessment of mitochondrial ultrastructure transmitted by electron microscopy after

treatment for 6 weeks and release from treatment for 2 weeks (Figure S10). Ultrastructure of

mitochondria of (A) control, (B) ethidium bromide-treated and (C) chloramphenicol-treated human

fibroblasts cells. The original magnification was 12 kV.

A: Control B: EtBr-treated C: CAP-treated

220

Objective 3: Manipulation of TFAM Expression in Human Embryonic Stem Cells

221

Figure 4.13 Levels of TFAM expression in hESC lines (gain-of-function).

(A) TFAM gene expression and mtDNA copy number (D-loop) for Mel 1 (white), hES3 (grey),

and H9 (black) single cells. Data were normalised to β-ACTIN (ACTB). (B) TFAM protein levels

were determined by flow cytometer. Data were normalised to the negative control. Data are the

mean ± SD. Gene expression values are also shown in the Table 4.10. Data are the mean ± SD.

*P<0.05 as compared to control. Abbreviations: Ctrl, hESCs without viral transduction; vector,

hESCs transduced with the vector backbone; TFAM, hESC transduced with EF1α-TFAM viral

particles.

222

Figure 4.14 Constitutive knockdown of TFAM levels in hESCs (Figure S9).

Three TFAM shRNA (TFAM-shRNA-1, TFAM-shRNA-2, and TFAM-shRNA-3) are targeted

to position 266-286, 591-611 and 618-638, respectively. (A) Western blot analysis of TFAM

expression in the control and lentivirus-transduced hESCs was performed using antibodies against

the proteins indicated on the left. β-ACTIN (ACTB) was included as a loading control. Untreated

hESCs were analyzed as a negative control. (B) TFAM expression in hESCs was quantified by

phosphor-imager analysis of the western blots.

223

*

*

* * * *

* *

*

* * *

* *

* *

*

224

Figure 4.15 Levels of TFAM expression in hESC lines (loss-of function, Figure S9).

(A) Levels of TFAM mRNA were determined for each sample using PCR. (B) Levels of

TFAM protein were determined for each sample using flow cytometry. (C) TFAM was analyzed by

CFLOW software. Different cell lines (Mel 1, hES3 or H9) transfected by different TFAM shRNA

(control: black; TFAMi-3: red; TFAMi-5: blue; TFAMi-6: green) are shown. mRNA levels (both

endogeneous and exogenous) were normalised to β-ACTIN (ACTB), whereas protein levels were

normalised to the negative controls. Gene expression values are also shown in the Table 4.11. Data

are the mean ± SD. *P<0.05 as compared to control. Abbreviations: dox, doxycycline; 1-TFAMi-3,

Mel 1 single cells transduced with TFAMi-3; 3-TFAMi-3, hES3 single cells transduced with

TFAMi-3; 9-TFAMi-3, H9 single cells transduced with TFAMi-3; 1-TFAMi-5, Mel 1 single cells

transduced with TFAMi-5; 9-TFAMi-5, H9 single cells transduced with TFAMi-5; 1-TFAMi-6,

Mel 1 single cells transduced with targetless shRNA; 3-TFAMi-6, hES3 single cells transduced

with targetless shRNA; 9-TFAMi-6, H9 single cells transduced with targetless shRNA.

225

Figure 4.16 Morphological phenotypes associated with TFAM loss- and gain-of function in hESC

lines.

Images represent hESCs incubated in the presence or absence of doxycycline (controls). TFAM

knockdown (TFAMi-3 of targeting exon 5; TFAMi-5 of targeting exon 7; TFAMi-6 of targetless) is

shown for Mel 1, and H9 cells. Images were acquired using inverted microscopy (Olympus) and a

10 x objective.

226

Objective 4: Mitophagy in Human Embryonic Stem Cells

Figure 4.17 Characterization of the hES-LC3-GFP reporter cell line.

(A) LC3-GFP localisation within hESCs. (B) Localisation of POU5F1 (left, red) and TRA-1-60

(right, green) within the hES-LC3-GFP cell line. Nuclei are counterstained with DAPI (blue).

Representative images are shown. Scale bars represent 50 m.

227

A Control

B Rap

C CCCP

D EtBr

E Spd. Diff-7

F EtBr-16

hours

G EtBr-1 week

H Control

228

Figure 4.18 Mitochondrial toxin and differentiation-induced mitophagy in hES-LC3-GFP cells.

Images represented from left to right in time manner. Images are combination of LC3-GFP

signal (green), and MitoTracker Red signal (red) channels. Treatment conditions are listed at left: (A)

control (DMSO), (B) rapamycin (positive control, 200 nM) in 0, 5 and 10 minutes, respectively, (C)

CCCP (mitophagy induction, 50 µM) in 0, 7 and 15 minutes, (D) EtBr (mitophagy induction, 100

ng/ml) treatment, (E) 7 days of bFGF withdrawal (spontaneous differentiation) in 0, 10 and 20

minutes, (F) EtBr (100 ng/ml) treatment in 0, 8 and 16 hours, (G) EtBr (100 ng/ml for 1 week)

treatment in 0, 8 and 16 hours, and (H) control in 0, 8, 16 hours, respectively. Representative images

from supplementary videos and Appendix Figures 7 and 8 are shown and mitophagy events are

circled by red circles. Scale bars represent 50 m. Abbreviations: control, hES-LC3-GFP cells

treated with DMSO; Rap, hES-LC3-GFP cells treated with Rapamycin; CCCP, hES-LC3-GFP cells

treated with carbonyl cyanide 3-chlorophenylhydrazone; EtBr, hES-LC3-GFP cells treated with

ethidium bromide; Spd. Diff-7, hES-LC3-GFP cells culture without basic fibroblast growth factor

for 7 days.

229

A. Control

B. Rapaymin

C. CCCP

D. EtBr

E. RA-3

F. Spd. Diff-7

230

C. Rapamycin-induction CCCP-induction EtBr-induction

231

Figure 4.19 Quantification of mitophagy in hES-LC3-GFP cells using live-imaging flow-cytometer.

(A) Representative images of single cells are shown. From left to right, images are bright-field,

LC3-GFP signal (green), MitoTracker Red signal (red), and combined green and red channels. (B)

The number of autophagosomes per cell was determined for each treatment condition. Data were

displayed as a histogram. Compared to control cells, each treatment condition resulted in a

statistically significant increase in autophagic events (p < 0.05). Treatment conditions are listed at

left and included control (DMSO, blue), rapamycin (positive control), CCCP (mitophagy induction),

EtBr (mitophagy induction), 3 days of retinoic acid (RA) treatment (induced differentiation), 7 days

of bFGF withdrawal (spontaneous differentiation), and 14 days of bFGF withdrawal (spontaneous

differentiation), (C) TEM images of mitochondrial ultrastructure following treatment with

rapamycin, CCCP, or EtBr. Autophagic vacuoles containing mitochondria (black arrows) were

found for all treatment conditions. Scale bars represent 1 m. Abbreviations: control,

hES-LC3-GFP cells treated with DMSO; Rap, hES-LC3-GFP cells treated with rapamycin; CCCP,

hES-LC3-GFP cells treated with carbonyl cyanide 3-chlorophenylhydrazone; EtBr, hES-LC3-GFP

cells treated with ethidium bromide; Spd. Diff-7, hES-LC3-GFP cells culture without basic

fibroblast growth factor for 7 days; Spd. Diff-14, hES-LC3-GFP cells culture without basic

fibroblast growth factor for 14 days; RA-3, hES-LC3-GFP cells culture treated with retinoic acid

for 3 days.

232

Figure 4.20 Quantification of autophagosomes and mitophagosomes in hESCs.

The average number of autophagosomes per cell was calculated automatically using the

ImageStream system software (white), the average number of autophagosomes (grey) and the

average number of mitophagosomes (black) were calculated manually from live-cell flow cytometry

images. The values are also shown in the Table 4.12. Data are the mean ± SD. *P<0.05 as compared

to control.

* * * * * * * * * * * * * *

233

Videos:

Video 4.1: Live-imaging of mitophagy in hES-LC3-GFP.

Representative video of combination of LC3-GFP signal (green), and MitoTracker Red signal

(red) is shown. Images were captured every 1 minute for 10 cycles. Scale bars represent 50 m.

Video 4.2: Live-imaging of mitophagy in hES-LC3-GFP with 200 nM rapamycin.

Representative video of combination of LC3-GFP signal (green), and MitoTracker Red signal

(red) is shown. Images were captured every 1 minute for 10 cycles. Scale bars represent 50 m.

Video 4.3: Live-imaging of mitophagy in hES-LC3-GFP with 50 µM CCCP.

Representative video of combination of LC3-GFP signal (green), and MitoTracker Red signal

(red) is shown. Images were captured every 1 minute for 15 cycles. Scale bars represent 50 m.

Abbreviation: CCCP, carbonyl cyanide 3-chlorophenylhydrazone

Video 4.4: Live-imaging of mitophagy in hES-LC3-GFP with 100 ng/ml EtBr.

Representative video of combination of LC3-GFP signal (green), and MitoTracker Red signal

(red) is shown. Images were captured every 1 minute for 20 cycles. Scale bars represent 50 m.

Abbreviation: EtBr, ethidium bromide.

Video 4.5: Live-imaging of mitophagy in spontaneously differentiated hES-LC3-GFP without basic

fibroblast growth factor for 7 days.

234

Representative video of combination of LC3-GFP signal (green), and MitoTracker Red signal

(red) is shown. Images were captured every 1 minute for 20 cycles. Scale bars represent 50 m.

Video 4.6: Live-imaging of mitophagy in hES-LC3-GFP with 100 ng/ml EtBr.

Representative video of combination of LC3-GFP signal (green), and MitoTracker Red signal

(red) is shown. Images were captured in 0, 8th

and 16th

hour.

Video 4.7: Live-imaging of mitophagy in hES-LC3-GFP with 100 ng/ml EtBr for one week.

Representative video of combination of LC3-GFP signal (green) and MitoTracker Red signal

(red) is shown. Images were captured in 0, 8th

and 16th

hour.

Video 4.8: Live-imaging of mitophagy in hES-LC3-GFP for one week.

Representative video of combination of LC3-GFP signal (green) and MitoTracker Red signal

(red) is shown. Images were captured in 0, 8th

and 16th

hour.

235

Appendix

Appendix Table 1. List of Abbreviations

Units

h Hours

w Weeks

bp Base pairs

SDS Sodium dodecyl sulphate

SD Standard deviation

rRNA Ribosomal RNA

tRNA Transfer RNA

Β-ACTIN (ACTB) Actin, beta

GAPDH Glyceraldehyde-3-phosphate dehydrogenase

Dox Doxycyclin

VSV-G Vesicular stomatitis virus glycoprotein G

VP Viral particles

WPRE Woodchuck hepatitis virus post-transcriptional regulatory element

PB Phosphate buffer

PBS Phosphate-buffered saline

DMEM Dulbecoo‟s Modified Eagle‟s Medium

EGFP Enhanced green fluorescent protein

GFP Green fluorescent protein

HEK 293 Human embryonic kidney cell line

Stem cells

dpc Days post coitum

ASC Adult stem cells

ASCC Australian Stem Cell Centre

236

b-FGF Basic Fibroblast Growth Factor

CM Conditioned medium

E Embryonic day

EC Embryonal carcinoma

EBs Embryonic bodies

hESCs Human embryonic stem cells

hiPSCs Human induced pluripotent stem cell

HSCs Haemoatopoietic stem cells

HTERT Human telomerase reverse transcriptase

ICM Inner cell mass

ID Inhibitor of differentiation

IVF In vitro fertilization

KSR Knockout serum replacement

NANOG Nanog homeobox

NEAA Non-Essential Amino Acids

NFκB Nuclear Factor Kappa B

MESC Mouse embryonic stem cell

PGCS Primordial germ cells

PSCS Pluripotent stem cells

POU5F1 or OCT4 POU class 5 homeobox 1

SCID Severe combined immunodeficient

SOX2 SRY (sex determining region Y)-box 2

SSEA Stage-specific embryonic antigen

TOR The Target Of Rapamycin

Mitochondrion

ΔΨ Mitochondrial membrane potential

ADP Adenosine diphosphate

237

ATP Adenosine triphosphate

ATP6 ATP synthase subunit VI (Complex V)

ATP8 ATP synthase subunit VIII (Complex V)

CAP Chloramphenicol

CCCP Carbonyl cyanide 3-chlorophenylhydrazone

COX1-3 Cytochrome c oxidase subunit I-III (Complex IV)

CYTB Cytochrome b (Complex III)

D-loop Displacement loop

ER Endoplasmic reticulum

EtBr Ethidium bromide

ETC Electron transport chain

HMG High-mobility group

IMM Inner mitochondrial membrane

JC1 5, 5‟, 6, 6‟-tetrachloro-1, 1‟, 3, 3‟-tetraethylbenzimidazolylcarbocyanine

iodide

MD Mitochondrial dysfunction

MDS Mitochondrial depletion syndromes

MRC Mitochondrial respiratory chain

mtDNA Mitochondrial DNA

ND1-6 NADH dehydrogenase subunit I-VI (Complex I)

NRF-1 Nuclear respiratory factor I

NRF-2 (GABP) GA binding protein transcription factor, alpha subunit

ρ˚ cells Mitochondrial depleted cells

PD Parkinson disease

PGC1α/PGC1A Homo sapiens peroxisome proliferator-activated receptor gamma,

coactivator 1 alpha (PPARGC1A), mRNA

POLG Polymerase gamma

POLRMT Polymerase (RNA) mitochondrial (DNA directed)

PPP Pentose phosphate pathway

238

ROS Reactive oxygen species

TFAM Mitochondrial transcription factor A

SOD Superoxide dismutase

Autophagy

ATG Autophagy-related genes

LC3 Microtubules-associated protein light chain 3

PAS Pre-autophagosomal structure

TOR Target of rapamycin

Techniques

FACS Fluorescence-activated cell sorting

PCR Polymerase chain reaction

qPCR Quantitative polymerase chain reaction

RISC RNA-induced silencing complex

RNAi RNA interference

SCNT Somatic cell nuclear transfer

shRNA Short hairpin RNA

siRNA Small interfering RNA

SCNT Somatic cell nuclear transfer

TEM Transmission electron microscopy

239

Appendix Table 2. Cell lines used in this study

Cell lines Description Reference

Normal human

dermal fibroblasts

(HFF)

Normal human dermal fibroblasts and cultured

with F-DMEM.

ATCC: ATCC

PCS-201-012

Human

fibroblast-treated

with EtBr

Human fetal fibroblast cells and cultured with

F-DMEM, addition of uridine. In-House

Human

fibroblast-treated

with chloramphenicol

(CAP)

Human fetal fibroblast cells and cultured with

F-DMEM, addition of uridine. In-House

HEK 293T

Called as 293T/17, Human embryonic kidney

cells (Clone 17) expressing T antigen for plasmid

episomal replication and cultured with

F-DMEM.

Invitrogen,

ATCC: CRL-11268

Human foreskin

fibroblasts (hFFi) or

mouse embryonic

fibroblasts (mEFi)

Fibroblasts were collected and irradiated in 0.33

Х 106 cells/cm

2 and cultured. They are

co-cultured with hESC or conditioned medium

collection purpose.

ASCC

Mel, hES3, H9

Human embryonic stem cells and cultured with

KSR on hEFi or culture with conditioned

medium on Matrigel.

ASCC

240

Appendix Table 3-A. Cell Culture Medium Recipes: The various culture medium compositions

and recipes used in this thesis are listed as below, respectively. Where required, medium

formulations were filtered using a 0.22 μm low protein binding syringe filter to ensure sterility.

Materials Abbreviation

Company Cat. No Description

Tissue culture flasks

and plates

B&D Bioscience

NA Tissue culture plastic for cell culture

Tissue culture plates B&D Bioscience

NA Tissue culture plastic for cell culture

High glucose Dulbecco‟s Modified Eagles Medium

HG-DMEM Invitrogen 11965 DMEM containing high glucose (4 g/l) with sodium pyruvate

Low glucose Dulbecco‟s Modified Eagles Medium

LG-DMEM Invitrogen 11865 DMEM containing high glucose (1 g/l) with sodium pyruvate

Phosphate buffered saline PBS Invitrogen E404 Buffered saline with required pH and osmolarity for cells

Fetal Bovine Serum FBS Invitrogen 10099-141

FBS used in this was from Australian cows with no BVDV and demonstrated ability of culture HEK293, and fibroblasts cells.

Knockout Serum Replacement

KSR Invitrogen 10828-028

KSR used to culture human embryonic stem cells and conditioned medium collection.

TrypLE Express TrypLE Invitrogen 12605 Recombinant trypsin solution

Dimethylsulphoxide DMSO Sigma-Aldrich

D2438 Solvent used for efficient cryopreservation of cells to dissolve reagents.

Ethanol Sigma-Aldrich

E7023 Solvent used for efficient to dissolve reagents.

Basic fibroblast growth factor

bFGF Millipore GF-003-AF

Growth factor for maintaining hESCs.

Activin A R&D Systems

338-AC

Growth factor for the differentiation of hESCs into primitive streak cells

Bone morphogenic BMP-4 R&D 314-BP Growth factor for the

241

protein-4 Systems differentiation of hESCs into primitive streak cells

Bovine serum albumin BSA Sigma-Aldrich

A9647 Protein presented at a very high concentrations in serum

Sodium pyruvate Sigma-Aldrich

P5607 Non-glucose substrate for cells

Penicillin/Strptomycin P/S Invitrogen 1750-063

Antibiotic formation for cell in cell culture to reduce contamination

MEM Non-Essential Amino Acids Solution

NEAA Invitrogen 11140-050

Supplement for culture hESCs.

β-mercaptoethanol B-Me Sigma-Aldrich

M6250 Supplement for culture hESCs.

L-Glutamine L-Glu Invitrogen 25030081

Supplement for culture hESCs.

Puromycin dihydrochloride Puromycin Sigma-Aldrich

P7130 Antibiotic formation for selecting the stable hESC lines

Blasticidin Invitrogen R210-01

Antibiotic formation for selecting the stable hESC lines

Geneticine Invitrogen 10131-027

Antibiotic formation for selected the stable hESC lines

Chloramphenicol CAP Sigma-Aldrich

C0378 Reagent for depleting mitochondria in cell culture

Ethidium bromide EtBr Sigma-Aldrich

E7637 Reagent for depleting mitochondria in cell culture

Carbonyl cyanide 3-chlorophenylhydrazone

CCCP Sigma-Aldrich

C2759 Uncoupler of oxidative phosphorylation in mitochondria

Rapamycin Rap Sigma-Aldrich

R8781 Induced autophagosomes in hESCs

Uridine Sigma-Aldrich

U3003 Supplement for mitochondrial-depleted cells

Appendix Table 3-B. Cell Culture Medium Recipes

242

hESCs growth medium:

80% KnockOut Dulbecco‟s modified Eagle‟s medium nutrient mixture

F-12, (KO-DMEM F-12, Invitrogen) 394 ml

20% Knock-Out Serum Replacement (KOSR) (Invitrogen) 100 ml

1% NEAA (Gibco BRL) 5 ml

0.1 mM β-mercaptoethanol (Sigma-Aldrich) 928 μl

4 ng/ml human recombinant basic fibroblast growth factor (bFGF)

(Invitrogen) (fresh addition)

60,000 cells/cm2 of mEFi or hFFi were seeded for conditioned medium

collection for 7 days and filtered before used.

Inactivated human foreskin fibroblast (hFFi) as feeder growth medium

90% Dulbecco‟s modified Eagle‟s medium, (KO-DMEM F-12,

Invitrogen) 440 ml

10% FBS (Invitrogen) 50 ml

1% L-Glu (Gibco BRL) 5 ml

1% NEAA (Gibco BRL) 5 ml

Human fibroblast cells (hFF) growth medium:

90% Dulbecco‟s modified Eagle‟s medium, (DMEM, Invitrogen) 435 ml

10% FBS (Invitrogen) 50 ml

1% L-Glu (Gibco) 5 ml

1% NEAA (Gibco) 5 ml

1mM Sodium pyruvate (Gibco) 5 ml

Human fibroblast cells (hFF) with ethidium bromide or chloramphenicol-treated growth

medium

90% Dulbecco‟s modified Eagle‟s medium, (DMEM, Invitrogen) 430 ml

10% FBS (Invitrogen) 50 ml

1% L-Glu (Gibco) 5 ml

1% NEAA (Gibco) 5 ml

1mM Sodium pyruvate (Gibco) 5 ml

1% of 50 mg/ml uridine (Sigma-Aldrich) 5 ml

243

Ethidium bromide (EtBr) (100 ng/ml) or chloramphenicol (CAP) (100

μg/ml) (Sigma-Aldrich)

HEK 293T (ATCC: CCRL-11268) growth medium:

90% Dulbecco‟s modified Eagle‟s medium, (DMEM, Invitrogen) 445 ml

10% FBS (Invitrogen) 50 ml

500 ng/ml Geneticine (Gibco) 5 ml

Cryopreservation medium for hFF, mEFi, and HEK293T

90% FBS 900 µl

10% DMSO 100 µl

Cryopreservation medium for hESCs

Conditioned media 900 µl

10% DMSO 100 µl

244

Appendix Table 4. Molecular Biology Reagents

Materials Abbreviation Company Cat. No Description

Luria Broth Base LB Sigma-Aldrich

L1900 Bacteria growth

QIAquick Gel Extraction Kit

QIAGEN 28704 Gel extraction

NucleoSpin®

Plasmid QuickPure

Macherey 740615.10 Plasmid extraction for viruses production purpose

NucleoBond®

Xtra Midi /

Maxi Macherey 740410.10 Plasmid

extraction from bacteria

RNeasy Mini Kit QIAGEN 74104 Total RNA extraction

DNeasy Blood & Tissue Kit

QIAGEN 69504 Total genomic DNA extraction

MMLV Reverse transcriptase

MMLV Invitrogen AM2043 Moloney Murine Leukemia Virus Reverse Transcriptase for cDNA synthesis

Oligo d(T)12-18

Primers

Invitrogen

Integrated DNA Technologies (IDT)

12577011

N/A

Primers for cDNA synthesis or PCR reactions.

RNase Sigma-Aldrich

R6513 Apply for DNA and plasmid DNA extraction.

Protease K Roche 03115828001 Dissolve 1 mg/ml of protease K in 1 ml of double-distilled water.

245

Protease inhibitors cocktail

Roche 05 892 791 001 Combination of protease inhibitors in 10 ml of PBS in cell lysate for Western Blot

DNase

Deoxynucleotide solution mix

1 kb and 100 bp DNA ladders

Restriction enzymes

dNTP

New England Biolabs (NEB)

M0303L

N0447

N332, N3231

Molecular biology purpose

SoSoFast SYBR reagent

SYBR green

Bio-Rad

ABI

172-5200

4309155

For quantitative real-time PCR.

Goat Serum

Sigma-Aldrich

G9023 Blocking reagent for immunostaining

Bromophenol Blue

β-mercaptoethanol

BME

Sigma-Aldrich

B0126

M6250

Dye

BME is suitable for reducing protein disulfide bonds prior to polyacrylamide gel electrophoresis and apply in protein lysis buffer.

Tween-20 Sigma-Aldrich

P1379 Buffer detergent

Triton X-100 Sigma-Aldrich

T9284 Cell permeabilisation detergent

Milli-Q water In house NA Ultra-pure water

Tris (hydroxymethyl-amino

TRIS Amerseco 0234 Buffer salt

246

methane

Ethylenediaminetetraacetic acid

EDTA Ajax Finechem

A180 Metal chelator

Hydrogen chloride HCl Ajax Finechem

256-2.5L-GL Buffer salt

Tryphan Blue Sigma-Aldrich

T8254 Satins dead but not live cells

Glycerol Sigma-Aldrich

5516 Used in slide embedding solution

Permount Mounting medium

Invitrogen 00810 Slide mounting medium

Doxycycline Dox Sigma-Aldrich

D9891 Doxycycline is a member of the tetracycline antibiotics group, and applied in tet-on induce system.

Retinoic Acid RA Sigma-Aldrich

R2625 Retinoic Acid applied for hESCs differentiation

LipofectamineTM

LTX & Plus Reagent

Invitrogen 15338-199 For plasmid DNA delivery.

Total Glutathione Detection Kit

Assay Designs

900-160 Total Glutathione Detection in mitochondrial –depleted fibroblast cells.

Paraformaldehyde PFA Sigma-Aldrich

P6148 Fixative

Sodium dodecyl sulphate

SDS Sigma-Aldrich

71728 Detergent for decellularisation process

247

Appendix Table 5. Buffer Receipts Applied in Molecular Biology Techniques

6x DNA loading dye (250 ml)

80% glycerol 93.6 ml

0.5 M EDTA 3 ml

Bromophenol Blue 0.3 g

Xyanol 0.3 g

50x TAE (1L)

Tris base 242 g

Glacial acetic acid 57.1 ml

0.5 M EDTA, pH 8.0 100 ml

0.5 M EDTA, pH 8.0 (M.W. 336.2) (500 ml)

EDTA 84.05 g

5 M NaOH 71 ml

3 M sodium acetate, pH 8.0 (500 ml)

Sodium acetate 204.15 g

Glacial acetic acid 90 ml

248

Appendix Table 6. PCR Primer Sequences

Genes Forward 5‟-3‟

Reverse 5‟ 3‟ Tm Eff Size Acc. No.

Beta-ACTIN GCTGTGCTACGTCGCCCTG GGAGGAGCTGGAAGCAGCC

60 0.983 60 NM_001101

OCT4 TGAAGCTGGAGAAGGAGAAG ATCGGCCTGTGTATATCCC

60 0.985 134

NM_002701, NM_203289, NM_001173531

NANOG GATTTGTGGGCCTGAAGAAA AAGTGGGTTGTTTGCCTTTG

60 0.984 101 NM_024865

SOX2 AACCCCAAGATGCACAACTC CGGGGCCGGTATTTA TAATC

60 0.996 52 NM_003106

MtDNA copy number

D-loop CCCTAACACCAGCCTAACCA GTTAGCAGCGGTGTGTGTGT

60 0.997 165 NC_012920

Mitochondria-encoded genes

MT-ND1 ATGGCCAACCTCCTACTCCT GCGGTGATGTAGAGGGTGAT

52 0.999 214 YP_003024026

MT-ND4 CCTGACTCCTACCCCTCACA

ATCGGGTGATGATAGCCAAG

52 0.990 150 YP_003024035

MT-ND5 ACATCTGTACCCACGCCTTC TCGATGATGTGGTCTTTGGA

60 0.987 189 YP_003024036

MT-COX2 TTCATGATCACGCCCTCATA TAAAGGATGCGTAGGGATGG

52 0.999 186 YP_003024029

MT-COX3 CCCGCTAAATCCCCTAGAAG GGAAGCCTGTGGCTACAAAA

60 0.990 82 YP_003024032

MT-CYTB TATCCGCCATCCCATACATT GGTGATTCCTAGGGGGTTGT

52 0.996 169 YP_003024038

Mitochondrial biogenesis-related genes

TFAM CCGAGGTGGTTTTCATCTGT TCCGCCCTATAAGCATCTTG

52 0.995 203 NM_003201

NRF-1 ACAGAAGAGCAAAAGCAGAG

GCTGATCTTCAAAGGCATAC 60 0.831 111 NM_0010

40110

POLG CAAGGTCCAGAGAGAAACTG 60 0.951 116 NM _0011261

249

GCAATGCTCTCAAGCTTATT 31

PGC1α CCATATTCCAGGTCAAGATCAAG TCACATACAAGGGAGAATTTCG

60 0.997 118 NM_013261

Ectoderm differentiation-markers

PAX6 CAGCACCAGTGTCTACCAACCA CAGATGTGAAGGAGGAAACCG

60 0.995 67 NM_000280

Mesoderm differentiation-markers

BRACHYURY (BRY)

TCAGCAAAGTCAAGCTCACCA

CCCCAACTCTCACTATGTGGATT 60 0.98 102

NM_003181

MIXL1 CCGAGTCCAGGATCCAGGTA

CTCTGACGCCGAGACTTGG 60 0.95 58

NM_031944

Endoderm differentiation-markers

GATA4 TCTCACTATGGGCACAGCAG

GGGACAGCTTCAGAGCAGAC 60 0.98 116

NM_008092

IGF2 TGGCATCGTTGAGGAGTGCTGT ACGGGGTATCTGGGGAAGTTGT

60 0.995 136

NM_000612

NM_001007139

NM_001127598

SOX17 GGCGCAGCAGAATCCAGA CCACGACTTGCCCAGCAT

60 0.995 59 NM_022454

Cloning

GFP CTGGTCGAGCTGGACGGCGACG

CACGAACTCCAGCAGGACCATG 60 N/A 631 N/A

TFAM

CACCATGGCGTTTCT CCGAAG

TTAACACTCCTCAGCACCATA TTTTCGTTG

60 N/A 741 NM_003201

250

Appendix Table 7. Target sequences of shRNAs against human TFAM

shRNA cloned into constitutive knockdown plasmid (the pLenti5-U6-TFAMi, Invitrogen)

Name Sequence (5‟-3‟)

TFAMi-1

(266-286)

F:CCGGGGGAACTTCCTGATTCAAAGACTCGAGTCTTTGAATCAG

GAAGTTCCCTTTTTG

R:AATTCAAAAAGGGAACTTCCTGATTCAAAGACTCGAGTCTTTG

AATCAGGAAGTTCCC

TFAMi-2

(591-611)

F:CCGGGGAATTATATATTCAGCATGCCTCGAGGCATGCTGAATA

TATAATTCCTTTTTG

R:AATTCAAAAAGGAATTATATATTCAGCATGCCTCGAGGCATG

CTGAATATATAATTCC

TFAMi-3

(618-638)

F:CCGGGGACGAAACTCGTTATCATAACTCGAGTTATGATAACGA

GTTTCGTCCTTTTTG

R:AATTCAAAAAGGACGAAACTCGTTATCATAACTCGAGTTATG

ATAACGAGTTTCGTCC

shRNA cloned into inducible knockdown plasmid (the pLKO-Tet-on-TFAMi)

Name Sequence (5‟-3‟)

TFAMi-3

(489-509)

F:CCGGCGTTTATGTAGCTGAAAGATTCTCGAGAATCTTTCAGCT

ACATAAACGTTTTTG

R:AATTCAAAAACGTTTATGTAGCTGAAAGATTCTCGAGAATCTT

TCAGCTACATAAACG

TFAMi-5

(7764-784)

F:CCGGCGTGAGTATATTGATCCAGAACTCGAGTTCTGGATCAAT

ATACTCACGTTTTTG

R:AATTCAAAAACGTGAGTATATTGATCCAGAACTCGAGTTCTGG

ATCAATATACTCACG

TFAMi-6

(Targetless-

shRNA)

F:CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTT

AACCTTAGGTTTTTG

R:AATTCAAAAACCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGG

GCGACTTAACCTTAGG (Sarbassov, Guertin, et al. 2005).

F: Forward; and R: Reverse

251

Appendix Table 8. Buffers for Immunostaining and Microscopy

Phosphate buffer saline (PBS) 200 ml

PBS tablet 1 tablet

Make up with ddH2O to 200 ml

4% Paraformaldehyde, pH 7.5 100 ml

Paraformaldehyde 4 g

Make up with 1x PBS to 100 ml and used NaOH to adjust the pH to 7.5 and aliquot

for -20°C storage.

Permeabilization buffer 500 ml

10% Triton 500 μl

Make up with 1x PBS to 500 ml.

Hoechst 33258 or DAP 1 ml

Hoechst 33258 or DAPI 10 mg

Make up with ddH2O to 1 ml and aliquot into small aliquots.

Blocking buffer

5% skim milk power in PBS or 1% bovine serum albumin (BSA)

Make up with 1x PBS

10x Phosphate buffer (PB) 1 L

1.37 M NaCl 80 g

30 mM KCl 2 g

65 mM Na2HPO4H2O 17.8 g

15 mM KH2PO4 2.4 g

Make up with ddH2O to 1 L.

252

Appendix Table 9-A. Working Concentrations for fixed-cell-immunostaining

Antibody Application Company Animal Source

Dilution

Anti-human-TRA-1-60 IC; FC Millipore mouse 1:500 (to 1 mg/ml)

Anti-human-POU5F1 IC; WB Sigma-Aldrich rabbit 1:500

Anti-human-β-ACTIN

(45 kDa) WB

Cell Signaling Biotechnology

rabbit 1:2000

Anti-human-TFAM (24 kDa) WB; FC

Cell Signaling Biotechnology

rabbit 1:2000

Anti-mouse IgG Alexa Fluro 488 IC Invitrogen goat 1:2000

Anti-rabbit IgG Alexa Fluro 568 IC Invitrogen goat 1:2000

Anti-mouse IgG HRP WB Santa Cruz Biotechnology

goat 1:4000 (to 200 μg/0.5 ml)

Anti-rabbit IgG HRP WB Santa Cruz Biotechnology

goat 1:4000 (to 200 μg/0.5 ml)

Note: skim milk was used as blocking in Western Blotting, and 1% BSA was used as blocking in fixed-cell immunostaining and flow cytometry.

IC, Immunocytochemistry; FC, Flow cytometry; WB, Immunoblotting

253

Appendix Table 9-B. Working Concentrations for live-cell-staining

Materials Application Company Cat. No Description

MitoTracker Red IC; IFC Invitrogen M22425

Mitochondria staining dye excitated at 581 nm for imaging purpose: (Flow cytometry use 100 nM final concentration; immunocytochemistry use 100 nM final concentration)

MitoTracker Deep Red FC Invitrogen M22426

Mitochondria staining dye excitated at 644 nm for AMNIS purpose: (Flow cytometry use 100 nM final concentration; immunocytochemistry use 100 nM final concentration)

Mitochondria staining kit (JC-1)

IC; FC Sigma-Aldrich CS0390

For mitochondrial potential changes detection: (Flow cytometry use 0.1 µg/ml final concentration of JC1;immunocytochemistry use 0.1 µg/ml final concentration of JC1)

IC, Immunocytochemistry; IFC, Imaging flow cytometry; FC, Flow cytometry

Reference:

Sarbassov, D. D., D. A. Guertin, S. M. Ali and D. M. Sabatini (2005). “Phosphorylation and

regulation of Akt/PKB by the rictor-mTOR complex.” Science 307 (5712):1098-1101.

255

Supplementary Method

Immunoblotting

Western blot analysis was performed on cytosolic of hESCs with drugs as described in

this thesis. First the cells were lyzed with an extraction buffer (Tris 10 mM, pH 7.0, NaCl 140

mM, PMSF 2 mM, DTT 5 mM, NP-40 0.5%, pepstatin A 0.05 mM and leupeptin 0.2 mM) for

protein extraction, and then centrifuged at 12,500 g for 30 min. To measure the expression

levels of proteins, the total proteins were extracted and Western blotting analyses were

performed as established in the Wolvetang laboratory. An aliquot of 20 μg total protein of

each cell lysates was loaded and separated on 10-15% Tris-Glycine-SDS polyacrylamide

gels and electroblotted onto PVDF membranes (PALL Life, Science, Pensacola, FL). After

the incubation with 5% fat-free skim milk in TBS buffer (10mM Tris, 150mM Nacl, pH7.4) for

1 hour at room temperature, primary antibodies, which consisted of β-ACTIN (1:2000, Cell

Signaling Biotechnology), TFAM (1:2000, Cell Signaling Biotechnology), OCT4 (1:500,

Sigma-Aldrich) were applied to probe the blots (Appendix Table 9). After incubation at 4

degree overnight, the membrane were washed with TBS-T (0.05% Tween-20 in TBS buffer)

three times and then incubated with horseradish peroxidase (HRP)-conjugated secondary

antibodies (1:4000, Santa Cruz Biotechnology). The membranes were then developed

using Western Pico Super ECL reagent (Pierce). Images were developed by the Typhoon

scanner (GE Healthcare), and signal intensity quantification was performed by Image J

software (http://rsb.info.nih.gov/ij/).

256

Supplementary Figures

Figure S1 Characterization of the hESC with Tra-1-60 in undifferentiated and differentiated

hESCs.

Markers for pluripotency (TRA-1-60, green) and mitochondria (MitoTracker Red, red)

were analyzed in fixed hESCs. (A) Undifferentiated hESCs exhibited significantly protein

expression of TRA-1-60 immunoreactivity and low in mitochondrial staining in the fixed

sample, and (B) 14 days differentiated hESCs exhibited significantly reduction in TRA-1-60

immunoreactivity and significantly increased in mitochondrial staining. Nuclei are

counterstained with DAPI (blue). Representative images are shown. Scale bars represent

50 m.

257

258

Figure S2 Constitutive overexpression of TFAM protein levels in hES cell lines (Mel 1, hES3

and H9).

Three samples were hESC without lentivirus-transduction (negative control), hESC

transduced with EF1α-GFP and hESC transduced with EF1α-TFAM, respectively. (A)

Western blot analysis of TFAM expression in the control and lentivirus-transduced hESCs

was performed using antibodies against the proteins indicated on the left. β-actin was

included as a loading control. Untreated hESCs were analyzed as a negative control. (B)

TFAM expression in hESCs was quantified by phosphor-imager analysis of the western

blots. Western blot analysis confirmed that the level of TFAM was higher by overexpressing

TFAM in three different hES cell lines.

259

260

Figure S3 Inducible knockdown of TFAM levels in hES cell lines (Mel 1, hES3 and H9).

Three TFAM shRNA were TFAM-shRNA-3, TFAM-shRNA-5 and TFAM-shRNA-6

(targetless), respectively. (A) Western blot analysis of TFAM expression before and after

doxycycline addition in the control and lentivirus-transduced hESCs was performed using

antibodies against the proteins indicated on the left. β-ACTIN was included as a loading

control. Untreated hESCs were analyzed as a negative control. (B) TFAM expression in

hESCs was quantified by phosphor-imager analysis of the western blots. Western blot

analysis confirmed that the level of TFAM can be knockdown by TFAM-shRNAi-3 and

TFAM-shRNAi-5 in three different hES cell lines.

261

Figure S4 Expression of relative OCT4 expression in the cell lysates detected by using

Western blot assay (A), and quantified analysis represented in histogram (B). Untreated

hESCs were analyzed as a negative control. β-ACTIN was included as a loading control.

Western blot analysis confirmed that the level of POU5F1 protein was not affect in a

short-term treatment, and decreased dramatically upon 3 days of RA-induced differentiation

and spontaneously differentiation.

262

Figure S5 Characterization of

the hES-LC3-GFP reporter

cell line.

(A) Localisation of

TRA-1-60 (green) (B)

Localisation of POU5F1 (red)

within the hES-LC3-GFP cell

line. Nuclei are

counterstained with DAPI

(blue). Representative

images are shown. Scale

bars represent 50 m.

263

264

Figure S6 Characterization of mitochondria in undifferentiated hESCs with 50 μM CCCP in 2

hours or 24 hours.

(A) Undifferentiated hESCs treated with 2 hours of CCCP and stained with JC-1. (B)

Undifferentiated hESCs treated with 24 hours of CCCP and stained with JC-1. The

JC-aggregates form (Red) had shown significantly reduction in 24 hours of CCCP compared

with 2 hours of CCCP in hESCs. This suggested that CCCP significantly depolarised the

mitochondrial membrane potential in hESCs. Low and high membrane potentials are

indicated by green and red staining, respectively. Nuclei are counterstained with DAPI (blue).

Representative images are shown. Scale bars represent 50 m inverted confocal

laser-scanning microscope (Zeiss LSM 710).

265

Figure S7 Scheme of different treatments in hES3-LC3-GFP cells videos by imaging

fluorescence microscopy.

Data were displayed as in images. Abbreviations: control, hES3-LC3-GFP cells treated

with DMSO; Rap, hES3-LC3-GFP cells treated with rapamycin; CCCP, hES3-LC3-GFP

cells treated with carbonyl cyanide 3-chlorophenylhydrazone; EtBr, hES3-LC3-GFP cells

treated with ethidium bromide; Spd. Diff-7, hES3-LC3-GFP cells culture without basic

fibroblast growth factor for 7 days.

266

267

268

269

Figure S8 A more detailed dosage of treatment toxin and differentiation-induced mitophagy

in hES-LC3-GFP cells.

Images represented from left to right. Images are combination of LC3-GFP signal

(green) and MitoTracker Red signal (red) channels. Treatment conditions are listed at left:

(A) control (DMSO), (B and C) rapamycin (positive control, 200nM and 500 nM) in 0, 5 and

10 minutes, respectively, (D-F) CCCP (mitophagy induction, 10, 5, and 100 µM) in 0, 7 and

15 minutes, (G) EtBr (mitophagy induction, 100 ng/ml) treatment, (H) 7 days of bFGF

withdrawal (spontaneous differentiation) in 0, 10 and 20 minutes, (I) control in 0, 8, 16 hours,

(J-L) EtBr (10, 50, and 100 ng/ml) treatment in 0, 8 and 16 hours, (M) EtBr (100 ng/ml for 1

week) treatment in 0, 8 and 16 hours, respectively. Representative images from

supplementary videos are shown and mitophagy events are circled by red circles. Scale

bars represent 50 m. Abbreviations: control, hES-LC3-GFP cells treated with DMSO; Rap,

hES-LC3-GFP cells treated with Rapamycin; CCCP, hES-LC3-GFP cells treated with

carbonyl cyanide 3-chlorophenylhydrazone; EtBr, hES-LC3-GFP cells treated with ethidium

bromide; Spd. Diff-7, hES-LC3-GFP cells culture without basic fibroblast growth factor for 7

days.

270

Figure S9 Schematic structure of TFAM. TFAM is composed of seven exons (indicated as

“E” inside blue boxes). The first HMG-motif contains Ex1 to Ex 4 and second HMG-motif

contains end of Ex4 to Ex 6. There had a small linker region connected between two

HMG-motifs and a small carboxy-terminal tail at the end of the second HMG-motif.

There are two sets of shRNA that are constructed in either a constitutive repression

vector or an inducible-repression vector. The shRNA construct in the constitutive

expression vector are 1 (266-286), 2 (591-611), and 3 (618-638) as indicated by the green

arrows. The shRNA construct in the inducible expression vector are 3 (489-509), and 5

(764-784), as indicated by the red arrows.

N-terminus C-terminus

E1 E3 E2 E5 E4 E7 E6

Constitutive

knockdown

shRNA1

Constitutive

knockdown

shRNA

2 & 3

Inducible

knockdown

shRNA 3

Inducible

knockdown

shRNA 5