research repository for heritable disorders university of washington - department pathology peter...

Research Repository for Heritable Disorders

University of Washington - Department Pathology

Peter Byers, MDUlrike Schwarze, MDMelanie Pepin, MS, CGCDru Leistritz, MS

The Research Repository is housed alongside the Collagen Diagnostic Laboratory, a certified clinical laboratory that provides testing and consultation for patients with suspected connective tissue disorders.

Having DNA, tissues and clinical information from individuals with the disease – essential to our research work.

Research Repository for Heritable Disorders

RECRUITMENT FOR CLINICAL RESEARCH STUDIES

1. Diagnostic Testing Samples – Repository Consent is optional.

2. Internet recruitment via EDNF or EDSCares.

3. Recruitment at EDS meetings – e.g. currently enrolling for Pregnancy in EDS type IV study

Each study is approved by the University of Washington Human Subjects Committee (IRB).

Research Repository for Heritable Disorders of Bone, Blood Vessels and Skin

1. Gene Identification for a CLINICAL DIAGNOSIS – Periodontal EDS

2. Clinical Test Development after Gene Identification – Classical EDS and Hypermobility EDS

3. Understanding Disease Process – Genotype-Phenotype Relationship – Vascular EDS

4. Natural History Study: Evidence-based Clinical Care – Vascular EDS Pregnancy Study

EDS type VIII – Distinct Clinical Phenotype Mutation Unknown

Mataix et al B J Dermatology 2008

Severe gingival recession (16yo)Tissue fragility following repeated trauma to an injury-prone area.

Bleeding tendency & delayed wound healing.

Joint Hypermobility & Stretchy Skin

RR is pairing with by Dr. Debbie Nickerson in UW Genome Sciences department on an NIH-funded project to attempt to find disease yet-undiscovered genes for rare disorders.

Current Project: Whole Exome Sequencing of DNA in families with EDS type VIII, the periodontal form of EDS.

1. Gene Identification for a CLINICAL DIAGNOSIS of Periodontal EDS

DNA Sequence

Exons translate to PROTEINS

G1040SGGC>AGC

GGTGACCGTGGTGAGACCAGCCCC

Control

GGTGACCGTGGTGAGACCGGCCCC

EDS type VIII – Exome Sequencing Strategy

EXOME – 2% of genome but 85% of mutations. 20,000 genes. Thousands of variants in sequence.

Those studied must have the same clinical diagnosis.

Choose:

1. Multiple members of one family

2. Several unrelated individuals with identical phenotype

2009 First Whole exome sequencing

Causative Genes: Classical EDS (EDS type I and II)

Alterations in type V collagen genes: COL5A1 and COL5A2

Tenascin-X deficiency - XB gene

Other - unknown

40-50%5/151 EDS cases

Bristow 2001

Tenascin X deficiency: Classical EDS-like Syndrome

• Schalkwijk et al., 2001 reported the 5 (of 151 screened) patients with an EDS syndrome with deficiency of Tenascin X protein– an extracellular matrix protein resulting from recessive mutations in the encoding XB gene.

– hypermobile joints

– hyperextensible skin

– easy bruising

– slow wound healing, but normal scar formation

– autosomal recessive

“This finding indicates that factors other than the collagens or collagen-processing enzymes can cause the syndrome and suggests a central role for tenascin-X in maintaining the integrity of collagenous matrix. (N Engl J Med 2001;345:1167-75.)”

XB Mutations absent Tenascin X

Tenascin X

1. Regulates Fibril spacing2. Associates with other matrix

proteins to make this happen

Tenascin X heterozygosity: What is the role of TNX in Hypermobility EDS?

Zweers 2003 Test obligate relatives id’d 9/23 obligates with significant joint

Hypermobility. Puzzling finding was that this was most often found in females.

Zweers 2004 Measured TNX in 80 unrelated hypermobility EDS patients and

found 5-10% with very low levels. Heterozygous TNX mutation found in 2.

Consequence of the TNX gene sequencing

Sequencing of gene that encodes TNX protein already complete

Setting up a systematic way to sequence over 50 exons at one time

Offer as testing to classical EDS without wide gaping scars

Consider a pilot test of hypermobile EDS to determine test sensitivity

Reduction in type III collagen – “null” Alteration in type III collagen structure

Does the Mutation Type determine clinical outcome ? Is there a Genotype/Phenotype Correlation?

COL3A1 Mutation Types

Understanding Disease Process – COL3A1 Mutations – Genotype/Phenotype Correlation

Dru Leistritz is leading a study in the RR to review clinical data of consented “null” families to compare them with previously reported families.

Data will be presented at the November ASHG meeting 2010.

Preliminary data confirms significant difference in age of complications and age of ascertainment in null families. (e.g age of first complication 24 v 38)

Null (nonsense)n=21

MissenseN=400

The EDS IV natural history study in 2000 did not find a significant difference in complications when comparing families with different

mutations (Pepin et al 2000) n=135 No null mutations

EDS type IV – Pregnancy StudyEnrollment is Open

Women with EDS type IV who have undertaken pregnancies are recruited and interviewed (or records reviewed) to detail successes and problems encountered.

Study is being done in collaboration with UWMC MFM physician, Dr. Suzanne Peterson Primary Procedure: Phone Interview and Record Review

Goal: Establish evidence-based pregnancy care guidelines Evaluate the factors at play in decision-making about undertaking a

pregnancy.

•Natural History Study: Contribution to evidence-based Clinical Care


Financial Support

Donations to UW Collagen Research Laboratory (private donations from families, friends to UW (Byers))

2009 Freudman Fund - family foundation to support research in EDS (basic science research and clinical research) and related connective tissue disorders

“ because of the interest and generosity of patients and families with EDS”

Tenascin X deficiency: Classical EDS-like Syndrome

• Schalkwijk et al., 2001 reported the 5 (of 151 screened) patients with an EDS syndrome with deficiency of Tenascin X protein– an extracellular matrix protein resulting from recessive mutations in the encoding XB gene.

– hypermobile joints

– hyperextensible skin

– easy bruising

– slow wound healing, but normal scar formation

– autosomal recessive

“This finding indicates that factors other than the collagens or collagen-processing enzymes can cause the syndrome and suggests a central role for tenascin-X in maintaining the integrity of collagenous matrix. (N Engl J Med 2001;345:1167-75.)”

research repository for heritable disorders university of washington - department pathology peter...

Documents