rules proposals for the international rules for seed ... · c.5.1. harmonisation on seedling...

International Seed Testing Association Secretariat, Zürichstrasse 50, CH-8303 Bassersdorf, Switzerland Phone: +41 44 838 60 00 Fax: +41 44 838 60 01 Email: [email protected] - http://www.seedtest.org

Document OGM13-05

OGM13-05 Proposed Changes to the ISTA Rules Edition 2014 VOTING RESULTS.doc 2013-07-22 14:58 Approved by OGM 18 June 2013 /106

Rules Proposals for the International Rules for Seed Testing 2014 Edition

This document was prepared by the Technical Committees and the Rules Committee of the Association and has been endorsed by the ISTA Executive Committee. The proposals are submitted to the ISTA Ordinary Meeting 2013 for voting by the nominated ISTA Designated Members on behalf of their respective Governments. It is submitted to all ISTA Designated Authorities, ISTA Members and ISTA Observer Organizations for information two months prior to the ISTA Ordinary Meeting 2013. It contains proposed amendments and changes for the ISTA International Rules for Seed Testing and will be discussed and voted on at the Ordinary Meeting 2013 to be held on Tuesday, June 18, 2013 in Antalya, Turkey under Agenda point 11. Consideration and Adoption of the Proposed Rules Changes.

http://www.seedtest.org/


Introduction to the ISTA Rules Proposals to become effective 1 January 2014 The current version of the ISTA International Rules for Seed Testing is the 2013 edition. Single copies of replacement pages and front covers for the 2013 edition have been sent free to all ISTA Member Laboratories. Extra copies are available for purchase from the ISTA Publications section. As the Rules are an evolving document, it is worth remembering that pages can be headed with different ‘effective from’ dates. The Preface for each edition includes details of changes and when replacement pages were issued. Previous Prefaces as a ‘history of changes’ are available on the ISTA website. The ISTA Rules are the result of the work of the various ISTA Technical Committees with input from many different sources. Thanks go to all the Technical Committee members and the ISTA Secretariat for their help with this year’s proposals. The following Rules Proposals will be discussed at the ISTA Ordinary Meeting in Antalya, Turkey in June 2013 and may be amended during the meeting. If the proposals are accepted by the membership, Amendments will be issued, and they will become the 2014 edition of the ISTA Rules. Please let me know about any problems with these proposals. Many thanks. Steve Jones Chair of Rules Committee Contact details: Dr Steve Jones Canadian Food Inspection Agency Seed Science and Technology Section 301–421 Downey Road Saskatoon, SK, S7N 4L8 Canada Phone: +1 306 975 6505 Fax: +1 306 975 6450 E-mail: [email protected] Key to text changes : Deleted text

New text

New text in large blocks, not underlined for ease of reading

Any changes made after proposals published to the membership

mailto:[email protected]


Contents

PART A. INTRODUCTION OF EDITORIAL CHANGES 5

A.1. Editorial corrections 5

PART B. NEW SPECIES AND CHANGES TO SPECIES NAMES 6

B.1. Addition of new species to Table 2A. 6

B.2. Changes to the ISTA Stabilized list affecting names used in the ISTA Rules 6

1. Changes to species names 6

2. Changes to assignments of genera to families 9

PART C. RULES CHANGES AND NEW METHODS REQUIRING A VOTE 11

Chapter 1: Certificates 11

C.1.1. Changes to reporting for the tetrazolium test results for coated seed, seed tapes and mats. 11

C.1.2. Inclusion of reporting requirements for tetrazolium testing of seed mixtures Chapter 18. 11

C.1.3. Inclusion of reporting requirements for new Chapter 19. 11

Chapter 2: Sampling 12

C.2.1. Storage of samples after testing 12

C.2.2. Changes to the minimum submitted sample sizes of coated seeds 13

C.2.3. Consequential changes affecting Chapter 11: Testing of Coated Seeds 14 C.2.4. Consequential changes affecting Chapter 16: Rules for size and grading of seeds 15

Chapter 3: The Purity Analysis 16

C.3.1. Adding the use of an anemometer for the uniform blowing method 16

Chapter 5: The Germination Test 21

C.5.1. Harmonisation on seedling evaluation in respect to the evaluation of the cotyledons (50% rule) 21

C.5.2. Growing media for germination test. 23 C.5.3. List of seedling abnormalities 24

C.5.4. Change required due to moving genus Arachis from PSD 11 to PSD 21 25

C.5.5. Duration of germination test for certain grass species 26

C.5.6. Modification to 5.6.4 to add clarity 27

Chapter 6: Biochemical Test for Viability. The Topographical Tetrazolium Test. 28

C.6.1. Amended explanation for testing Helianthus and Bracharia species . 28

Annex to Chapter 7: Seed Health Testing Methods 29

C.7.1. Changes to existing seed health methods to provide a uniform approach 29 C.7.2. Modification to existing seed health method 34

7-028: Detection of infectious tobamoviruses on Lycopersicon esculentum (tomato) by the local lesion assay (indexing) on Nicotiana tabacum plants 34

C.7.3. Modification to existing seed health method 37


7-019b: Detection of Xanthomonas campestris pv. campestris on Brassica spp. disinfested/disinfected seed 37

C.7.4. Modification to existing seed health method 49

7-021: Detection of Xanthomonas axonopodis pv. phaseoli and Xanthomonas axonopodis pv. phaseoli var. fuscans on Phaseolus vulgaris (Bean) seed 49

C.7.5. New seed health method 56 7-029: Detection of Pseudomonas syringae pv. pisi on Pisum sativum (Pea) seed 56

C.7.6. New seed health method 65

7-007: Detection of Alternaria linicola, Botrytis cinerea and Colletotrichum lini on Linum usitatissimum (Flax) seed 65

Chapter 8: Species and Variety Testing 74

C.8.1. Editorial and Committee review of the whole of Chapter 8. 74

C.8.2. New improved A-PAGE method for the verification of Triticum 85 C.8.3. New SDS-PAGE method for the verification of Triticum and xTriticosecale varieties 90

Chapter 11: Testing Coated Seeds 93

C.11.1 Testing methods and reporting for the tetrazolium test for coated seeds 93

Chapter 18: Seed Mixtures 95

C.18.1. Testing methods and reporting for the tetrazolium test for seed mixtures 95

Chapter 19: Testing for Seeds of Genetically Modified Organisms 96

C.19.1. New Chapter for the ISTA Rules 96


PART A. INTRODUCTION OF EDITORIAL CHANGES A.1. Editorial corrections General editorial corrections

- Since the 2014 ISTA Rules will be completely reissued, the current “effective from” dates will all be re-set to 1 January 2014.

- All marks which indicate changes from the previous edition will be removed, except for the latest changes made for the 2014 edition.

- The English version of the 2014 ISTA Rules will be in A4 format.

- Wherever ‘shall’ is used it will be replaced with ‘must’, if that is the intent, or where it makes grammatical sense.

- References to old family names (e.g. Compositae, Gramineae) will be deleted.

- The Seed Health Methods, currently referred to as “Annexe to Chapter 7”, will now be part of Chapter 7.

- In all Seed Health Methods, the phrase ‘sponsored by’ will be amended to ‘prepared by’ together with details of the organization which organized the comparative test. Prepared by is also used to list the authors so in this case prepared by will be replaced by Authors. The citation for ISHI-Veg will be updated to International Seed Health Initiative-Vegetables, ISF (ISHI-Veg).

- In all Seed Health Methods, standardise the way the equation for TSW is presented as: TSW = (weight of seeds / numbers of seeds) x 1000

CURRENT VERSION PROPOSED VERSION

1.5.2.2. Purity

3.7 Reporting results

§5… (e.g. Elytrigium repens).

1.5.2.2. Purity


§5… (e.g. Elytrigia repens).


Table 6A Part 1. Agricultural and horticultural seeds

Lactuca spp., column 7:

⅓ radicle, measured from radicle tip; ½ of distal end of cotyledons,if superficial; ⅓ at distal end, if pervading

⅓ radicle, measured from radicle tip; ½ of distal end of cotyledons,if superficial; ⅓ at distal end, if pervasive

ACCEPTED BY APPLAUSE RESULT

ACCEPTED


PART B. NEW SPECIES AND CHANGES TO SPECIES NAMES B.1. Addition of new species to Table 2A. None this year.

B.2. Changes to the ISTA Stabilized list affecting names used in the ISTA Rules The ISTA Stabilized List is updated every 6 years as a result of discussion within the ISTA Nomenclature Committee. The following items have been taken from the document “Proposed Changes to the ISTA List of Stabilized Plant Names” prepared on 1 November 2012. The items of that document have been considered and approved by the ISTA Nomenclature Committee, and the document will be submitted to the ISTA Executive Committee for voting at the ISTA Ordinary Meeting 2013. Only those items from this document that affect the 2014 ISTA Rules are detailed here. The changes below show the changes to species names as they will appear in Table 2A. References to older changes to species names will be removed. Other tables and references to species names will be amended accordingly. Once accepted by vote at the Annual General Meeting, the Stabilised List can come into effect on 1 January 2014, to be consistent with the 2014 ISTA Rules, which also come into effect on 1 January 2014. The following proposal was developed and approved by a vote of the Nomenclature Committee.

1. Changes to species names a. Agricultural and vegetable


Andropogon gerardii Vitman Andropogon gerardi Vitman Bromus marginatus Nees ex Steud. Bromus marginatus Steud. Cajanus cajan (L.) Millsp. Cajanus cajan (L.) Huth Centrosema pubescens Benth. (Centrosema pubescens Benth. see

Centrosema molle Mart. ex Benth.) Centrosema molle Mart. ex Benth.

(previously Centrosema pubescens Benth.)

Dichondra repens J. R. Forst & G. Forst. (Dichondra repens J. R. Forst. & G. Forst. see Dichondra micrantha Urb.)

Dichondra micrantha Urb. (previously Dichondra repens J. R. Forst. & G. Forst.)

Lolium ×boucheanum Kunth (Lolium ×boucheanum Kunth see Lolium ×hybridum Hausskn.)

Lolium ×hybridum Hausskn. (previously Lolium ×boucheanum Kunth)

Lotononis bainesii Baker (Lotononis bainesii Baker see Listia bainesii (Baker) B.-E. van Wyk & Boatwr.)

Listia bainesii (Baker) B.-E. van Wyk & Boatwr. (previously Lotononis bainesii Baker)

Lycopersicon esculentum Mill. (Lycopersicon esculentum Mill. see Solanum lycopersicum L.)

Solanum lycopersicum L. (previously Lycopersicon esculentum Mill.)



Lycopersicon hybrids (Lycopersicon hybrids see Solanum (sect. Lycopersicon) hybrids)

Solanum (sect. Lycopersicon) hybrids (previously Lycopersicon hybrids)

Lycopersicon spp. (Lycopersicon spp. see Solanum (sect. Lycopersicon) spp.)

Solanum (sect. Lycopersicon) spp. (previously Lycopersicon spp.)

Pascopyrum smithii (Rydb.) Á. Löve Pascopyrum smithii (Rydb.) Barkworth & D. R. Dewey

Paspalum wettsteinii Hack. (Paspalum wettsteinii Hack. see Paspalum virgatum L.)

Paspalum virgatum L. (previously Paspalum wettsteinii Hack.)

Petroselinum crispum (Mill.) Nyman ex A. W. Hill

Petroselinum crispum (Mill.) Fuss

b. Tree and shrub


Cupressus macrocarpa Hartw. ex Gordon

Cupressus macrocarpa Hartw.

Eucalyptus citriodora Hook. (Eucalyptus citriodora Hook. see Corymbia citriodora (Hook.) K. D. Hill & L. A. S. Johnson)

Corymbia citriodora (Hook.) K. D. Hill & L. A. S. Johnson (previously Eucalyptus citriodora Hook.)

Eucalyptus ficifolia F. Muell. (Eucalyptus ficifolia F. Muell. see Corymbia ficifolia (F. Muell.) K. D. Hill & L. A. S. Johnson)

Corymbia ficifolia (F. Muell.) K. D. Hill & L. A. S. Johnson (previously Eucalyptus ficifolia F. Muell.)

Eucalyptus maculata Hook. (Eucalyptus maculata Hook. see Corymbia maculata (Hook.) K. D. Hill & L. A. S. Johnson)

Corymbia maculata (Hook.) K. D. Hill & L. A. S. Johnson (previously Eucalyptus maculata Hook.)

Mahonia aquifolium (Pursh) Nutt. (Mahonia aquifolium (Pursh) Nutt. see Berberis aquifolium Pursh)

Berberis aquifolium Pursh (previously Mahonia aquifolium (Pursh) Nutt.)

Pinus heldreichii H. Christ Pinus heldreichii Christ Pinus patula Schiede ex Schltdl. & Cham.

Pinus patula Schltdl. & Cham.

Pinus ponderosa C. Lawson Pinus ponderosa P. Lawson & C. Lawson

c. Flower, spice, herb and medicinal


Armeria maritima Willd. Armeria maritima (Mill.) Willd. Asparagus densiflorus (Kunth) Jessop (Asparagus densiflorus (Kunth) Jessop

see Asparagus aethiopicus L.)



Asparagus aethiopicus L. (previously Asparagus densiflorus (Kunth) Jessop)

Asparagus setaceus (Kunth) Jessop (Asparagus setaceus (Kunth) Jessop see Asparagus plumosus L.)

Asparagus plumosus L. (previously Asparagus setaceus (Kunth) Jessop)

Centaurea americana Nutt. (Centaurea americana Nutt. see Plectocephalus americana (Nutt.) D. Don)

Plectocephalus americana (Nutt.) D. Don (previously Centaurea americana Nutt.)

Centaurea dealbata Willd. (Centaurea dealbata Willd. see Psephellus dealbatus (Willd.) K. Koch)

Psephellus dealbatus (Willd.) K. Koch (previously Centaurea dealbata Willd.)

Cnicus benedictus L. (Cnicus benedictus L. see Centaurea benedicta (L.) L.)

Centaurea benedicta (L.) L. (previously Cnicus benedictus L.)

Coleus blumei Benth. (Coleus blumei Benth. see Plectranthus scutellarioides (L.) R. Br.)

Plectranthus scutellarioides (L.) R. Br. (previously Coleus blumei Benth.)

Cymbalaria muralis P. Gaertn. et al. Cymbalaria muralis G. Gaertn. et al. Geranium hybrids* Geranium hybrids Gerbera jamesonii Bolus ex Hook. f. Gerbera jamesonii Adlam Helichrysum bracteatum (Vent.) Andrews

(Helichrysum bracteatum (Vent.) Andrews see Xerochrysum bracteatum (Vent.) Tzvelev)

Xerochrysum bracteatum (Vent.) Tzvelev (previously Helichrysum bracteatum (Vent.) Andrews)

Helipterum humboldtianum (Gaudich.) DC.

(Helipterum humboldtianum (Gaudich.) DC. see Rhodanthe humboldtiana (Gaudich.) Paul G. Wilson)

Rhodanthe humboldtiana (Gaudich.) Paul G. Wilson (previously Helipterum humboldtianum (Gaudich.) DC.)

Helipterum manglesii (Lindl.) F. Muell. ex Benth.

(Helipterum manglesii (Lindl.) F. Muell. ex Benth. see Rhodanthe manglesii Lindl.)

Rhodanthe manglesii Lindl. (previously Helipterum manglesii (Lindl.) F. Muell. ex Benth.)

Helipterum roseum (Hook.) Benth. (Helipterum roseum (Hook.) Benth. see Rhodanthe chlorocephala (Turcz.) Paul G. Wilson)

Rhodanthe chlorocephala (Turcz.) Paul G. Wilson (includes Helipterum roseum (Hook.) Benth.)

Kochia scoparia (L.) Schrad. (Kochia scoparia (L.) Schrad. see Bassia scoparia (L.) A. J. Scott)

Bassia scoparia (L.) A. J. Scott (previously Kochia scoparia (L.) Schrad.)



Leontopodium alpinum Cass. (Leontopodium alpinum Cass. see Leontopodium nivale (Ten.) Hand.-Mazz.)

Leontopodium nivale (Ten.) Hand.-Mazz. (previously Leontopodium alpinum Cass.)

Lobelia fulgens Willd. Lobelia fulgens Humb. & Bonpl. ex Willd.

Lupinus hybrids* Lupinus hybrids Matricaria recutita L. (Matricaria recutita L. see Matricaria

chamomilla L.) Matricaria chamomilla L. (previously

Matricaria recutita L.) Myosotis hybrids* Myosotis hybrids Petunia ×hybrida hort. ex E. Vilm. (Petunia ×hybrida hort. ex E. Vilm. see

Petunia ×atkinsiana (Sweet) D. Don ex W. H. Baxter)

Petunia ×atkinsiana (Sweet) D. Don ex W. H. Baxter (previously Petunia ×hybrida hort. ex E. Vilm.)

Scabiosa caucasica M. Bieb. (Scabiosa caucasica M. Bieb. see Lomelosia caucasica (M. Bieb.) Greuter & Burdet)

Lomelosia caucasica (M. Bieb.) Greuter & Burdet (previously Scabiosa caucasica M. Bieb.)

Senecio cineraria DC. (Senecio cineraria DC. see Jacobaea maritima (L.) Pelser & Meijden)

Jacobaea maritima (L.) Pelser & Meijden (previously Senecio cineraria DC.)

Senecio cruentus (Masson ex L’Hér.) DC.)

(Senecio cruentus (Masson ex L’Hér.) DC. see Pericallis cruenta (Masson ex L’Hér.) Bolle)

Pericallis cruenta (Masson ex L’Hér.) Bolle (previously Senecio cruentus (Masson ex L’Hér.) DC.)

Sinningia speciosa (G. Lodd.) Hiern Sinningia speciosa (Lodd. et al.) Hiern Solanum diflorum Vell. (Solanum diflorum Vell. see Solanum

pseudocapsicum L.) . Solanum pseudocapsicum L. (previously

Solanum diflorum Vell.) Tripleurospermum perforatum (Mérat) M. Laínz

(Tripleurospermum perforatum (Mérat) M. Laínz see Tripleurospermum inodorum (L.) Sch. Bip.)

Tripleurospermum inodorum (L.) Sch. Bip. (previously Tripleurospermum perforatum (Mérat) M. Laínz)

2. Changes to assignments of genera to families CURRENT VERSION PROPOSED VERSION

a. Agricultural and vegetable

Claytonia Portulacaceae Montiaceae

b. Tree and shrub

Cryptomeria Taxodiaceae Cupressaceae



Liquidambar Hamamelidaceae Altingiaceae

Nothofagus Fagaceae Nothofagaceae

Sequoia Taxodiaceae Cupressaceae

Sequoiadendron Taxodiaceae Cupressaceae

Taxodium Taxodiaceae Cupressaceae

c. Flower, spice, herb and medicinal

Asclepias Asclepiadaceae Apocynaceae

Cleome Capparaceae Cleomaceae

Nemophila Hydrophyllaceae Boraginaceae

Phacelia Hydrophyllaceae Boraginaceae

Pholistoma Hydrophyllaceae Boraginaceae


2.8 Tables for lot size and sample sizes Table 2A … the 2007 ISTA Congress …

… to 2007 Congress changes; …

2.8 Tables for lot size and sample sizes Table 2A … the 2013 ISTA Congress …

… to 2013 Congress changes; …

Previous changes to Festuca ovina classifications in particular for Festuca ovina var. tenufolia and var. capillata resulted in the inclusion of Festuca filiformis into the Rules.

Festuca ovina subvar. trachyphylla Hack. was not included into the Rules as Festuca trachyphylla but it could have been. There is currently a nomenclature debate about whether Festuca trachyphylla or F. brevipila is the correct name to use. The NOM Committee advice is that until this is resolved to use Festuca trachyphylla (Hack.) Krajina (synonym Festuca brevipila R. Tracey). Note: Festuca trachyphlla is the name used in the European Rules/Standards.

The sampling, purity and germination testing details for Festuca trachyphlla / F. brevipila will be the inserted in the relevant tables and will be the same as the current entries for Festuca ovina.

CURRENT VERSION

PROPOSED VERSION

Festuca trachyphylla (Hack.) Krajina (synonym Festuca brevipila R. Tracey)

VOTE TO ACCEPT ITEM YES VOTES NO VOTES RESULT

B.2 GREEN MAJORITY 0 ACCEPTED


PART C. RULES CHANGES AND NEW METHODS REQUIRING A VOTE Chapter 1: Certificates C.1.1. Changes to reporting for the tetrazolium test results for coated seed, seed tapes and mats. New text for reporting Tetrazolium test resuts for coated seed, seed mats and seed tapes, see proposal under Chapter 11.

Note not for voting now but for reference only. See after Chapter 11 for voting.

C.1.2. Inclusion of reporting requirements for tetrazolium testing of seed mixtures Chapter 18.

Changes to Chapter 1 are required due the acceptance of the text for Tetrazolium testing of seed mixtures in Chapter 18. See voting record following proposal C.18.1.


C.1.3. Inclusion of reporting requirements for new Chapter 19.

Changes to Chapter 1 are required due the acceptance of the new Chapter 19 in the ISTA Rules. See voting record following proposal C.19.1.



Chapter 2: Sampling C.2.1. Storage of samples after testing The storage time of submitted samples is proposed to be moved from 2.5.4.6 to 2.5.3. As a consequence the storage time should be applied also to the submitted samples on which ISTA Blue Certificates have been issued. Also due to practical reasons it is proposed that the storage time of one year should be counted from the receipt of samples and not from the issuance of ISTA Certificates. It is also proposed that in the cases where storage time of one year is expected to affect test results though samples are preserved in appropriate conditions the requirement of storage time of one year is not a requirement for moisture proof containers and samples of recalcitrant or intermediate species. The following proposal was developed by the Bulking and Sampling Committee and has been discussed with the Moisture and Storage Committees. This proposal has been approved by a vote of the Bulking and Sampling Committee. CURRENT VERSION PROPOSED VERSION

2.5.3. Storage of samples after testing … Protection against insects and rodents may be necessary.

2.5.3. Storage of samples after testing … Protection against insects and rodents may be necessary.

To provide for re-testing by the original or by another seed testing laboratory, samples on which ISTA Certificates have been issued must be stored at least for one year from the receipt of the sample. Submitted samples in moisture proof containers, and samples of recalcitrant or intermediate species, must be stored under appropriate conditions for as long as it can be expected that the results of a re-test are not affected by the storage.

When a re-test in a different testing laboratory is required, a portion shall be drawn from the stored sample in accordance with 2.5.2.2, and submitted to the designated laboratory. The remainder shall be retained in store.

…

When a re-test in a different testing laboratory is required, a portion must be drawn from the stored sample in accordance with 2.5.2.2, and submitted to the designated laboratory. The remainder must be retained in store.

…

2.5.4.6 Storage of submitted samples after testing

To provide for re-testing by the original or by another seed testing laboratory, submitted samples on which ISTA Certificates have been issued shall be stored for one year from the date of issue of the certificate. Only in the case of very expensive seeds …

2.5.4.6 Storage of submitted samples after testing

Submitted samples on which ISTA Certificates have been issued must be stored. Only in the case of very expensive seeds …


C.2.1 GREEN MAJORITY 0 ACCEPTED


C.2.2. Changes to the minimum submitted sample sizes of coated seeds Bulking and Sampling Committee (BSC) proposes that the minimum submitted sample sizes of coated seeds are decreased. In the current Rules the requirements for submitted sample sizes are inconsistent between non-coated seeds and coated seeds. For non-coated seeds the submitted sample size can be equal to the working sample size for purity (i.e. to be 2500 seeds) if determination of other seeds by number is not requested. This is not possible for coated seeds. In the current Rules the submitted sample size for coated seeds is always 7500 seeds for purity and germination tests though e.g. the minimum working sample size for purity test is 2500 seeds. For coated seeds, the submitted samples shall contain at least the number of pellets or seeds indicated in column 2 of Table 2B Part 1 and 2. A survey was sent to six laboratories. Five laboratories were of the opinion that sample sizes can be decreased and one laboratory hesitated due to possible heterogeneity in seed lots. However, according to the opinion of the BSC possible heterogeneity problem should be smaller in coated seeds than in non-coated seeds and on the otherhand the submitted sample size does not solve heterogeneity problems. The following proposal was therefore developed by the Bulking and Sampling Committee and approved by a vote. CURRENT VERSION PROPOSED VERSION

2.5.4.4 Submitted sample

Minimum size of submitted samples are as follows:

a) For moisture determination, 100 g for species that have to be ground (see Table 9A) and 50 g for all other species. When moisture meters are to be used for testing, a larger sample size may be necessary. Contact the ISTA seed testing laboratory for specific instructions.

2.5.4.4 Submitted sample

The minimum size of submitted samples are as follows:

a) For moisture determination, 100 g for species that must be ground (see Table 9A) and 50 g for all other species. When moisture meters are to be used for testing, a larger sample size may be necessary. Contact the ISTA seed testing laboratory for specific instructions.

b)… b)…

c) For all other tests, at least the weight prescribed in column 3 of Table 2A. As long as a determination of other seeds by number is not requested, the submitted sample shall weigh at least the amount indicated for the working sample for purity analysis in column 4 of Table 2A. In the case of coated seeds, the submitted samples shall contain not less than the number of pellets or seeds indicated in column 2 of Table 2B, Part 1 and Part 2.

c) For all other tests, at least the weight prescribed in column 3 of Table 2A. As long as a determination of other seeds by number is not requested, the submitted sample must weigh at least the amount indicated for the working sample for purity analysis in column 4 of Table 2A. In the case of coated seeds, the submitted samples must contain not less than the number of pellets or seeds indicated in column 2 of Table 2B, Part 1 and Part 2. As long as a determination of other seed by number or size grading is not requested, the submitted sample need only contain as a minimum the number of seeds indicated for the working sample for purity analysis in column 3 of Table 2B Parts 1 and 2.

If the submitted sample is smaller than prescribed, …

If the submitted sample is smaller than prescribed, …


Table 2B Part 1. Sample sizes (number of seeds) for pelleted seeds, encrusted seed and seed granules

Determinations Minimum submitted sample

Minimum working sample

Purity analysis (including verification of species) 2500 2500 Weight determination 2500 Pure pellet

fraction Germination 2500 400 Determination of other seeds 10000 7500 Determination of other seeds (encrusted seeds and seeds granules)

25000 25000

Size grading 5000 1000

Table 2B Part 2. Sample sizes (number of seeds) for seed tapes and mats



Verification of species 300 100 Germination 2000 400 Purity analysis (if required) 2500 2500 Determination of other seeds

10000 7500

C.2.3. Consequential changes affecting Chapter 11: Testing of Coated Seeds In the Chapter 11: Testing of Coated Seeds there are Tables 11A and 11B that are copies of the Tables 2B Part 1 and Part 2. In the case that the proposal concerning Tables 2B Part 1 and Part 2 is accepted then also Tables 11A and 11B should be changed. Table 11A. Sample sizes of pelleted seeds in number of pellets.

Note: this table is a copy of Table 2B Part 1



Purity analysis (including verification of species)

2500 2500

Weight determination 2500 Pure pellet fraction

Germination 2500 400 Determination of other seeds 10000 7500 Determination of other seeds (encrusted seeds and seeds granules)

25000 25000

Size grading 5000 1000


Table 11A. Sample sizes of seed tapes

Note: this table is a copy of Table 2B Part 2



Verification of species 300 100 Germination 2000 400 Purity analysis (if required) 2500 2500 Determination of other seeds

10000 7500



C.2.4. Consequential changes affecting Chapter 16: Rules for size and grading of seeds Current Rules for size grading of seeds for Beta seeds and pelleted seeds indicate the same working sample weights (two samples of 50 grams) regardless of seed species or coating material. In Chapter 16 there is no reference to Chapter 2, Table 2B Part 1 where the submitted sample and working sample sizes for coated seeds are described. The following proposal was developed by the Bulking and Sampling Committee and approved by a vote.


16.1 For Beta seeds and pelleted seeds

The control of size grading is carried out on a sample, weighing at least 250g, which must be sent must be sent to the testing laboratory in an airtight container. Two working samples of about 50 g (not less than 45g and not more than 55g) each are used. Each sample is subjected to a screening analysis. ….

16.1 For Beta seeds and pelleted seeds

The control of size grading is carried out on a sample, weighing at least 250g or for pelleted seeds, a sample consisting of the number of seeds indicated in the Table 2B Part 1. The sample must be sent to the testing laboratory in an airtight container. Two working samples of about 50 g (not less than 45g and not more than 55g) each are used. For pelleted seeds, two working samples of about 1000 seed each are used. Each sample is subjected to a screening analysis. …

If this tolerance is exceeded, a further sample of 50g (and if necessary a fourth sample) must be analysed. ….

If this tolerance is exceeded, a further sample of 50g or 1000 pelleted seeds (and if necessary a fourth sample) must be analysed. …




Chapter 3: The Purity Analysis C.3.1. Adding the use of an anemometer for the uniform blowing method

To use an anemometer to monitor the equivalent air velocity (EAV) value of the optimum blowing point obtained using the ISTA calibration samples. There is no existing procedure for using the EAV value to monitor the calibration points for General blowers in the ISTA Rules. Expected benefits Currently, ISTA requires a regular calibration of the blowers using the ISTA uniform calibration sample (UCS). However, the frequent use of a UCS can cause it to rapidly deteriorate. Using simply the air gate opening between calibrations is reliable in some blowers but not in others. Using a desired air velocity point regardless of gate opening, motor conditions, etc. is a more reliable way to reproduce the correct point as it is determined with a calibration sample. The EAV of the optimum blowing point is the air velocity value of the air gate opening at the optimum blowing point for a specific calibration sample. The casual factor in seed separations in any blowing procedure is the velocity of air that flows through the working sample. Therefore, using the EAV directly to monitor the procedure allows the analyst to detect any undesirable variation. In addition, using the EAV makes the application of the blowing procedure simple and verifiable at any time. Using an anemometer will minimize the use of the UCS, and thus protect the integrity of the calibration samples. This approach is critical to maintain the integrity of the UCS in all future blowing procedures. This technology in combination with the use of uniform calibration samples should increase the uniformity within and across laboratories. Measuring the EAV takes only a few minutes, thus it will be easy for laboratories to keep records of the equivalent air velocity value of the optimum blowing point for quality control purposes. The following proposal was developed by the Blowing Procedure Working Group of the Purity Committee and approved by vote. CURRENT VERSION PROPOSED VERSION

3.4 Apparatus Aids …

Hand lenses …

Sieves …

3.4 Apparatus 3.4.1 Magnifiers, reflected light and sieves Aids …

Hand lenses …

Sieves …



3.4.2 Seed blowers

Seed blowers can be used to separate light-weight material such as chaff and empty florets in grasses from the heavier seeds.

Blowers that will give the most accurate separations normally handle only small samples (up to 5g). A good blower should provide a uniform flow of air, be capable of standardization and retain all the particles which it separates.

Seed blowers can be used to separate light-weight material such as chaff and empty florets from the heavier seeds for all species as a tool for purity analysis.

Blowers that will give the most accurate separations normally handle only small samples (up to 5g). A good blower should provide a uniform flow of air, be capable of standardization and retain all the particles which it separates.

For certain species and varieties of Poaceae, seed blowers must be used by the uniform blowing method (3.5.2.5) to separate light-weight material such as chaff and empty florets from the heavier seeds.

In order to maintain a uniform flow of air the blower should have one or more air compression chambers and a fan driven by a uniform speed motor. The diameter of the blowing tube should be in proportion to the size of the working sample and the tube should be long enough to allow satisfactory separation of the sample. The valve or gate that regulates the air flow should be capable of precise adjustment, should be calibrated and marked to permit easy reading, and its construction and location should prevent areas of strong and weak currents in the blowing tube.

In order to maintain a uniform flow of air, the blower should have one or more air compression chambers and a fan driven by a uniform-speed motor. The diameter of the blowing tube should be in proportion to the size of the working sample, and the tube should be long enough to allow satisfactory separation of the sample. The valve or air gate that regulates the air flow should be capable of precise adjustment, should be calibrated and marked to permit easy reading, and its construction and location should prevent areas of strong and weak currents in the blowing tube.

A manometer is desirable for standardizing the blower.

A blower to be used for the uniform blowing method must be capable of:

a) blowing at different pressures (determined by the use of the calibration samples) to suit different species;

b) maintaining a uniform flow of air along the tube at any required pressure;

c) rapid adjustment to any pressure likely to be required. The setting to provide each pressure should be checked periodically by blowing a calibration sample issued under the authority of ISTA;

d) accurate time setting.

A seed blower to be used for the uniform blowing method must be capable of:

a) blowing at different air velocities (determined by the use of the calibration samples) to suit different species;

b) maintaining a uniform flow of air at the velocity required by the crop species under test;

c) rapid adjustment to any velocity likely to be required. The setting to provide each velocity should be checked annually by blowing a calibration sample issued under the authority of ISTA;

d) accurate time setting.



3.4.2.1 Calibration of the seed blower The air gate openings and the Equivalent Air Velocity (EAV) value (see 3.4.2.2) of the optimum blowing point for a General type seed blower are determined by using the uniform calibration samples. Calibration samples are issued under the authority of ISTA and are available for Dactylis glomerata and Poa pratensis. Prior to calibration, the calibration samples must be exposed to room conditions overnight.

For those not having a General type seed blower, please contact the ISTA Secretariat.

The air gate opening for the varieties of Poa pratensis listed in Table 3A, with an average thousand-seed weight less than 0.35 g, and for Poa trivialis is obtained by multiplying the value of the air gate setting for Poa pratensis by 0.82 (applies only for General type seed blowers).

3.4.2.2 Determination of the equivalent air velocity

After a General type seed blower has been calibrated according to 3.4.2.1, the EAV of the air gate opening must be measured using an anemometer. The following procedure must be used:

1. Set the blower at the optimum blowing point, i.e. the air gate opening, obtained with the ISTA uniform calibration sample for the relevant species, e.g. Dactylis glomerata or Poa pratensis. Do not change that air gate opening.

2. Remove the sample cup from the cup holder, insert the anemometer with digital display facing up, and align the fan of the anemometer over the blower opening where the air flows from the chamber into the sample cup holder.

3. Turn on the anemometer and select metres per second (m/s), hold the anemometer in a steady position and then turn on the blower.



4. Read the air velocity value after the digital display of the anemometer reaches a steady reading (typically about 30 seconds after the blower was turned on). Example: If the anemometer indicates 2.3 m/s most frequently and fluctuates between 2.2 and 2.4 m/s, the EAV value of that specific air-gate opening would be recorded as 2.3 ± 0.1 m/s.

Once the optimum air velocity has been measured, the seed blower can be recalibrated using the anemometer, by adjusting the blower setting until the optimum air velocity for the blower and species or variety is reached. The EAV for one blower is not transferable to another blower.

The optimum blowing point must be verified using the ISTA uniform calibration sample after major servicing of the blower, such as changing parts of the motor or the glass column. In general, it is strongly recommended that the blowing point be verified annually using the ISTA uniform calibration sample.

Laboratories that can not, or do not, use the EAV to determine the blowing point must calibrate the blower with the ISTA uniform calibration sample.

Note: Frequent use of the ISTA uniform calibration sample can cause a shift in blowing point due to deterioration and monitoring the blowing point simply by air gate opening may be reliable in some blowers and not in others.

3.4.2.3 Anemometer type Any suitable anemometers can be used as long as the anemometer fits in the sample cup holder compartment of the blower and has a scale calibrated in metres per second for reading the air velocity value.

3.4.2.4 Calibration of the anemometer The anemometer should be calibrated at the set intervals set by the laboratory. In addition, the batteries should be replaced at least once a year.



3.5.2.5 Uniform blowing method This method is obligatory for Poa pratensis, Poa trivialis and Dactylis glomerata.

3.5.2.5 Poa pratensis, Poa trivialis and Dactylis glomerata For Poa pratensis, Poa trivialis and Dactylis glomerata, the uniform blowing method (see 3.4) is obligatory.

The working sample size is 1 g for Poa pratensis and Poa trivialis, and 3 g for Dactylis glomerata.

The blowing pressure is determined for Poa pratensis and Dactylis glomerata by means of a calibration sample issued under the authority of ISTA. The blowing pressure for the varieties of Poa pratensis listed in Table 3A with an average weight of 1000 seeds <0.35g is obtained by multiplying the blower setting for Poa pratensis by 0.82 (applies only for General Seed Blowers). The blowing pressure for Poa trivialis is obtained by multiplying the blower setting for Poa pratensis by 0.82 (applies only for General Seed Blowers). Prior to calibration, both the calibration and working samples must be exposed to room conditions.

The working sample size is 1 g for Poa pratensis and Poa trivialis, and 3 g for Dactylis glomerata.

The optimum blower settings for Poa pratensis and Dactylis glomerata are determined by means of a uniform calibration sample issued under the authority of ISTA (see 3.4.2.1). The optimum blower setting for the varieties of Poa pratensis listed in Table 3A, with an average thousand-seed weight less than 0.35 g, and for Poa trivialis is obtained by multiplying the value of the optimum blower setting setting for Poa pratensis by 0.82 (applies only for General type seed blowers). For those not having a General type seed blower, please contact the ISTA Secretariat.

3.5.2.5.1 Blowing

Set the blower at the blowing point obtained with the uniform calibration sample. Place the working sample into the cup and blow for exactly three minutes.

For blowing samples, set the seed blower to the optimum blower setting, obtained with the ISTA uniform calibration sample or the anemometer (see 3.4.2.1).

Place the working sample into the cup and blow for exactly 3 min.

Prior to blowing, the working sample must be exposed to room conditions to equilibrate with ambient conditions..




Chapter 5: The Germination Test C.5.1. Harmonisation on seedling evaluation in respect to the evaluation of the cotyledons (50% rule) Harmonisation between ISTA Rules and ISTA Handbook on Seedling Evaluation in respect to the evaluation of the cotyledons (50% rule) An appendix was added in 2009 into the ISTA Handbook on Seedling Evaluation, but changes have not been implemented in ISTA Rules. It is there proposed to harmonise rules regarding seedling evaluation to what has been described in the Handbook, in particular when there is a damage at the point of attachment of the cotyledons to the seedling axis. The following proposal is from the Germination Committee and approved by a vote.


5.2.6 The 50% rule

The 50% rule is used in the evaluation of cotyledons and primary leaves.

Cotyledon tissue:

– Seedlings are considered normal as long as half or more of the total cotyledon tissue is functional

– Seedlings are abnormal when more than half of the cotyledon tissue is missing, necrotic, decayed or discoloured.

5.2.6 The 50% rule

The 50% rule is used in the evaluation of cotyledons and primary leaves.

Cotyledon tissue:

– Seedlings are considered normal as long as half or more of the total cotyledon tissue is functional

– Seedlings are abnormal when more than half of the cotyledon tissue is missing, necrotic, decayed or discoloured.

Primary leaves:

…

The 50% rule does not apply if the tissue around the terminal bud or the terminal bud itself is necrotic or decayed; such seedlings are abnormal irrespective of the condition of the cotyledons or primary leaves.

Primary leaves:

…

The 50% rule does not apply if the two points of attachment of the cotyledons to the seedling axis or the terminal bud itself is necrotic or decayed; such seedlings are abnormal irrespective of the condition of the cotyledons or primary leaves. It does not apply also if one point of attachment of one cotyledon is necrotic or decayed and if the other cotyledon is not intact; such seedlings are also considered as abnormal.

Further details of how the 50% rule is applied can be found in the ISTA Handbook on Seedling Evaluation.

…

Further details of how the 50% rule is applied can be found in the ISTA Handbook on Seedling Evaluation.

…

5.2.8.1. Seedling abnormalities

…

3 Abnormalities of the cotyledons and primary leaves

…


…

3 Abnormalities of the cotyledons and primary leaves

…


Note: damage or decay of the cotyledons at the points of attachment to the seedling axis or near the terminal bud renders a seedling abnormal, irrespective of the 50% rule.

Note: damage or decay of the cotyledons at the two points of attachment of the cotyledons to the seedling axis or near the terminal bud renders a seedling abnormal, irrespective of the 50% rule. The 50% rule also does not apply if one point of attachment of one cotyledon is necrotic or decayed and the other cotyledon is not intact; such seedlings are also considered as abnormal.




C.5.2. Growing media for germination test.

Growing media for germination test. It is suggested to delete the sentence referring to the use of “moistened porous paper or absorbent cotton” in order to avoid confusion regarding the need to determine the water content and the water retention capacity of these substrates. The following proposal is from the Germination Committee and approved by a vote.


5.6.2.1 Growing media

5.6.2.1.1. Methods using paper

Top of paper (TP): the seeds are germinated on top of one or more layers of paper which are placed:

–…

– directly on trays in germination incubators. The relative humidity in the incubators must then be maintained at a level that prevents tests drying out.

Moistened porous paper or absorbent cotton can be used as a base for substrates.

5.6.2.1 Growing media

5.6.2.1.1. Methods using paper

Top of paper (TP): the seeds are germinated on top of one or more layers of paper which are placed:

–…

– directly on trays in germination incubators. The relative humidity in the incubators must then be maintained at a level that prevents tests drying out.

Moistened porous paper or absorbent cotton can be used as a base for substrates. The water content and the water retention capacity of substrates used as a base layer does not need to be determined.


C.5.2 0 GREEN MAJORITY WITHDRAWN


C.5.3. List of seedling abnormalities

List of seedling abnormalities Introduction of “trapped coleoptile” in the list of seedling abnormalities. This defect is mentioned several times in the ISTA Handbook for Seedling Evaluation but is not yet included in the list of seedling abnormalities. The following proposal is from the Germination Committee and approved by a vote.



…

4 Abnormalities of the coleoptiles and the primary leaf

41 The coleoptile

…


…

4 Abnormalities of the coleoptiles and the primary leaf

41 The coleoptile

…

41/12 is trapped under the lemma or the testa.

Note: a seedling with its coleoptile trapped under the lemma or seed coat is considered normal, if development is otherwise normal. If the growth of such a seedling is stunted, it must be evaluated as abnormal.




C.5.4. Change required due to moving genus Arachis from PSD 11 to PSD 21

Change in Germination Chapter following the proposal from the Purity Committee to move the genus Arachis from PSD 11 to PSD 21. The consequence of moving Arachis from PSD 11 to PSD 21 is that seeds in pods or seeds out of pods are defined as pure seed units. As pods may interfere with germination, it is suggested to make it clear that the pods must be removed before planting the seeds in a germination test. The following proposal is from the Germination Committee and approved by a vote.


5.6 Procedure

5.6.1 Working sample

…

Multigerm seed units are not broken up for the germination test but are tested as though they were single seeds.

5.6 Procedure

5.6.1 Working sample

…

Multigerm seed units, except for Arachis, are not broken up for the germination test but are tested as though they were single seeds.

For Arachis, although a pod is a pure seed unit, seed must be removed from the pod before use in a germination test.




C.5.5. Duration of germination test for certain grass species Duration of germination test for certain grass species A validation study on the duration of the germination test for Lolium perenne, Festuca rubra and Poa pratensis was carried out. Eight ISTA-accredited laboratories in seven countries on three continents participated. Four samples per species were germinated using different temperature regimes, and seedlings were evaluated at different times. The results show that repeatability and reproducibility were similar for the last two counts in all species, and were at acceptable levels. The different temperature regimes and shortening the duration of the germination test resulted in statistically significant differences of less than 3%. The variation caused by shortening the duration of the germination test is of the same magnitude as the variation caused by different temperature regimes. It is suggested that the duration of the germination test of the indicated Lolium species is reduced to 10 days, that of the Festuca species to 14 days and that of the Poa species to 21 days. The results can be extrapolated to other species of the same genus that have similar germination patterns, as they have already the same test conditions and test duration according to the Germination Committee members/experts. The following proposal is from the Germination Committee, approved by a vote, and supported by a validation study.

Table 5A Part 1 Agricultural and vegetable seeds PROPOSED VERSION

Species Substrate Temperature (°C) First count (d)

Final count (d)

Recommendations for breaking dormancy

1 2 3 4 5 6

Festuca filiformis

TP 20<=>30; 15<=>25 7 21 14 KNO3; prechill

Festuca heterophylla

TP 20<=>30; 15<=>25 7 21 14 KNO3; prechill

Festuca ovina TP 20<=>30; 15<=>25 7 21 14 KNO3; prechill

Festuca rubra TP 20<=>30; 15<=>25 7 21 14 KNO3; prechill

Festuca trachyphylla

TP 20<=>30; 15<=>25 7 14 KNO3; prechill

Lolium x hybridum

TP 20<=>30; 15<=>25; 20

5 14 10 KNO3; prechill

Lolium multiflorum

TP 20<=>30; 15<=>25; 20


Lolium perenne TP 20<=>30; 15<=>25; 20


Poa nemoralis TP 20<=>30; 15<=>25; 10 <=>30


Poa palustris TP 20<=>30; 15<=>25; 10 <=>30


Poa pratensis TP 20<=>30; 15<=>25; 10 <=>30



C.5.5 33 4 ACCEPTED


C.5.6. Modification to 5.6.4 to add clarity In addition to the above changes and to allow laboratories to continue with current practise for test durations for the species mentioned above section 5.6.4 has been modified. The changes are to make it clear how many days test extension for a germination test is now allowed for those species even after the prescribed periods are shortened. The following proposal is from the Rules Chair and Vice-Chair and is supported by the Germination Committee and approved by a vote.


5.6.4 Duration of the test

… If it seems advisable, when for example some seeds have just started to germinate, the prescribed test period may be extended by 7 days or up to half the prescribed period for the longer tests.

5.6.4 Duration of the test

… If it seems advisable, when for example some seeds have just started to germinate, the prescribed test period may be extended by:

a) 7 days; b) up to half the prescribed period; c) up to 21 days for Lolium spp.; d) up to 32 days for Festuca spp.

(except F. arundinacea and F. pratensis);

e) up to 42 days for Poa spp. (except P. bulbosa);

f) up to 54 days for Poa bulbosa. If, on the other hand, the maximum germination of the sample has been obtained before the end of the prescribed test period, a test may be terminated. At the request of the applicant the germination test may be terminated when the sample reaches a predetermined germination percentage. …

If, on the other hand, the maximum germination of the sample has been obtained before the end of the prescribed test period, a test may be terminated. At the request of the applicant the germination test may be terminated when the sample reaches a predetermined germination percentage. …




Chapter 6: Biochemical Test for Viability. The Topographical Tetrazolium Test. C.6.1. Amended explanation for testing Helianthus and Bracharia species . Helianthus During a discussion with Valerie Blouin it was realised that the explanation: “ ⅓ of distal end of cotyledons if pervading” is not included in the Table 6, or in the working sheet, but it is in the old TEZ handbook. There was also a validation study of Helianthus under the leadership of Augusto Martinelli, where this was a proposal for the rules in 2001. The Tetrazolium Committee does not know why this was not included in the current rules and consequently is now being added. Brachiaria Investigation by Augusto Martinelli discovered that the text for Bracharia testing methods was not carried forward from previous Rules editions to the current edition therefore a correction is proposed as shown. Note: Although these could be considered editorial corrections a vote is being asked for to provide transparency. This proposal is submitted by the Tetrazolium Committee and approved by vote.

Helianthus spp.

W/18 Remove pericarp and seed coats from the seed.

1 3 Cut longitudinally through the cotyledons and the radicle-hypocotyl axis. Observe both sides of the seed.

⅓ radicle measured from radicle tip, ⅓ of distal end of cotyledons if pervasive pervading, ½ of distal end of the cotyledons if superficial

Brachiaria spp.

BP/16; W/6

Remove glumes, cut transversely near embryo

1 18 Observe external embryo surface.

⅓ radicle

BP/16; W/6

Cut longitudinally through embryo and 3/4 of endosperm.

1 2 Observe cut surface. ⅓ radicle




Annex to Chapter 7: Seed Health Testing Methods C.7.1. Changes to existing seed health methods to provide a uniform approach These changes are a result of the regular review of existing SHC methods. If accepted the dates for approved date and review due dates will need to be updated in the tables listing the SHC methods in the Rules and Annexe. Although these changes could be considered as editorial it is better that they are formaly voted on as there are several that could be seen as technical changes to the method. This proposal is submitted by the Seed Health Committee and approved by vote. Editorial corrections: (following method reviews) Methods 7-001b and 7-002b:

· page 3 in Materials: Malt agar plates with streptomycin sulphate · page 6

o in table Preparation of Malt agar + streptomycin o in table: streptomycin sulphate 50 mg o 4. …50°C and add streptomycin sulphate dissolved in water.

Method 7-003:

· page 3 in Methods: 2. Plating…dish (bottom) and soak… Method 7-009: Change pathogen name to Gibberella circinata Nirenberg & O’Donnell Method 7-006:

· page 2 in Background: five years. Lesions on severely infected seeds may be either brown with whitish centres surrounded by a pale brown to dark brown area or reddish lesions of variable size (Fig.1). Direct inspection is not considered as a dependable method, as not all infected seeds bear symptoms and on dark-skinned varieties symptoms are more difficult to see.

· In Fig 1 legend: Lesions on severely infected seeds may be either brown with whitish centres surrounded by a pale brown to dark brown area or reddish lesions of variable size (Fig.1). Direct inspection is not considered as a dependable method, as not all infected seeds bear symptoms and on dark-skinned varieties symptoms are more difficult to see.

Methods 7-010, 11 and 12: (the same modifications for each method)

· page 3 in Methods o Media …(filter paper) Whatman No. 1 or equivalent o 2. Blotter On water-soaked blotters in Petri dishes. Place 25 seeds in each dish. Replace with: 2.1 Place three layers of 9.0 cm filter paper in each plate and soak with sterile distilled/de-ionised water. Drain away excess water. 2.2 Aseptically place 25 seeds, evenly spaced, on the surface of the filter paper in each dish. o 3. Incubation … If the filter paper dries out during incubation, add

an appropriate amount of sterile distilled/de-ionised water onto the paper, usually after 3 days of incubation. Avoid touching the seeds as adding water can cause cross contaminations.

Methods 7-014: to align with 7-022

· In 7-14 (top of the pages) and preface ii: Septoria Stagonospora nodorum …


· Page 3 in materials: … Agar containing 100ppm with streptomycin sulphate

· Page 3 in Methods: 2. Agar method Plating: Aseptically place a maximum of 10 seeds evenly spaced, onto the agar surface of each Malt agar or Potato Dextrose agar plate containing 100ppm streptomycin sulphate.

· Page 4 in preparation of media: o 2. Malt agar: 1 mg may be used between 50 and 100ppm,

depending on the level of saprophytic bacterial contamination commonly encountered. § 5. 50°C and add streptomycin sulphate dissolved in water

o 2. Potato dextrose agar: 1 mg may be used between 50 and 100ppm, depending on the level of saprophytic bacterial contamination commonly encountered § 5. 50°C and add streptomycin sulphate dissolved in water

Method 7-027: sample size: In any case, the minimum sample size should be 400 seeds. Addition of positive controls in all methods (Note methods 7-005, 7, 17, 18 are not modified yet as SHC reviews are in progress or new method modification are proposed)

Method 7-001a: · In Materials, reference material: the use of reference cultures or other

appropriate material is recommended · In method

o 2.1 o 2.2 Positive control (reference material): Aseptically place seeds

evenly spaced (CCP) onto the surface of the filter paper in enough an appropriate number of plates to obtain the reference culture, or plate a reference culture on media. The number of plates required will depend on the level of contamination of the positive control seed lot.

o 6. …Fig 1, bottom left). Compare with positive control. Record… Method 7-001b:

· In Materials, reference material: the use of reference cultures or other appropriate material is recommended

· In method o 1.1 o 1.2 Positive control (reference material): ): Aseptically place seeds

evenly spaced (CCP), onto the agar surface of enough an appropriate number of malt agar plates to obtain the reference culture, or plate a reference culture on one Malt agar plate. The number of plates required will depend on the level of contamination of the positive control seed lot.

o 4. …Fig 1, bottom left). Compare with positive control. Record…

Method 7-002a: · In Materials, reference material: the use of reference cultures or other



evenly spaced (CCP), onto the surface of the filter paper in enough plates to obtain the reference culture, or plate a reference culture on media.

o 6. …of conidia. Compare with positive control. Record… NOTE the same green text in 7-001a and 7-001b needs to be added as applicable to all of the following entries. This has not been shown to avoid page number changes for the voting process.


Method 7-002b: · In Materials, reference material: the use of reference cultures or other



evenly spaced (CCP), onto the agar surface of enough malt agar plates to obtain the reference culture, or plate a reference culture on one Malt agar plate.

o 4. …Fig 1). Compare with positive control. Record… Method 7-003:

· In Materials, reference material: the use of reference cultures or other appropriate material is recommended whenever possible

· In method o 2.1 o 2.2 Positive control (reference material): Aseptically place seeds in

enough plates to obtain the reference culture or plate a reference culture on media

o 4. …as infected. Compare with positive control. Examination… Method 7-004:




o 4. …as infected. Compare with positive control. Method 7-008:


· In method o 2.1 o 2.2 Positive control (reference material): Aseptically place seeds

pretreated in the same way as 1., in enough plates to obtain the reference culture or plate a reference culture on media

o 4. …Salt (1978). Compare with positive control. Method 7-009:


· In method o 3.1 o 3.2 Positive control (reference material): Aseptically place seeds

pretreated in the same way as 1., in enough containers to obtain the reference culture or plate a reference culture on media

o 5. … (1980). Compare with positive control. Method 7-010:




o 4. …rounded ends. Compare with positive control.


Method 7-011:




o 4. …-400. Compare with positive control. Method 7-012:




o 4. …after 7 days. Compare with positive control. Method 7-013a:

· In method 3. (fig 2). Compare with positive control (reference material). Method 7-013b:

· In method 14. 7-013a. Compare with positive control (reference material). · Page 4 method states “….one part glycerol to three parts ethanol…..” Correct to “….one part glycerol to two parts ethanol…..”

Method 7-014: · In Materials, reference material: the use of reference cultures or other

appropriate material is recommended whenever possible · In method

o 2.1 o 2.2 Positive control (reference material): Aseptically place seeds in


o 4. …with age. Compare with positive control. Method 7-015:

· In Materials, reference material: the use of reference cultures or other appropriate material (included in the test kit) is recommended

Method 7-016:




Method 7-022: · In Materials, reference material: the use of reference cultures or other



pretreated as in 1., evenly spaced (CCP), onto the agar surface of enough malt agar plates to obtain the reference culture, or plate a reference culture on one Malt agar or PDA plate.

o 5. …2005). Compare with positive control. Method 7-025:

· In Materials, reference material: reference cultures or other appropriate material

· In method o 3.2 …2004). Compare with positive control.

Method 7-027:

· In method 8. (Figs 1–3). Compare with positive control (reference material).

Editorial corrections: host common names added Method 7-001a, b and 7-002a , b : …carota (carrot) Method 7-015: …spp (fescue) Method 7-016: …max (soybean, soya bean) Method 7-020 : …carota (carrot) Method 7-021 and 7-023 : …vulgaris (bean) Method 7-024 : …sativum (pea) Method 7-027 : …vulgare (barley)




C.7.2. Modification to existing seed health method 7-028: Detection of infectious tobamoviruses on Solanum lycopersicum (tomato) by the local lesion assay (indexing) on Nicotiana tabacum plants Modification to 7-028 after comments and review by the authors and the SHC. This proposal is submitted by the Seed Health Committee and approved by vote. CURRENT VERSION PROPOSED VERSION

Improved phrasing.

…The local lesion assay or indexing method is derived from a multilaboratory comparative test organised by the International Seed Health Initiative for Vegetables, ISF (ISHI-Veg). It is based on the detection of infectious virus by mechanical inoculation of resistant Nicotiana assay plants with tomato seed extract (Holmes 1929; Hadas 1999; Hadas et al., 2004). The use of resistant plants to tobamoviruses (Holmes 1938; Hammond-Kosack and Jones 1996; Erickson et al., 1999a; Whitham et al., 1994; Boovaraghan et al., 2007) such as Nicotiana tabacum ‘Xanthi NN’ (Stange et al., 2004; Diaz-Griffero et al., 2006) triggers the development of local lesions (Holmes 1938; Takahashi 1956; Dawson 1999) on the inoculated leaf surface as a hypersensitive reaction product (Ehrenfeld et al., 2008; Takahashi 1956; Erickson et al., 1999b; Whitham et al., 1994; Taliansky et al., 1994).…

The local lesion assay method is derived from a multilaboratory comparative test organised by the International Seed Health Initiative for Vegetables, ISF (ISHI-Veg). It is based on the detection of infectious virus by mechanical inoculation of resistant Nicotiana assay plants with tomato seed extract (Holmes 1929; Hadas 1999; Hadas et al., 2004). In tobacco plants carrying the N gene such as Nicotiana tabacum ‘Xanthi NN’ (Stange et al., 2004; Diaz-Griffero et al., 2006) resistance to tobamoviruses (Holmes 1938; Hammond-Kosack and Jones 1996; Erickson et al., 1999a; Whitham et al., 1994; Boovaraghan et al., 2007) is based on a hypersensitive reaction to virus infection (Ehrenfeld et al., 2008; Takahashi 1956; Erickson et al., 1999b; Whitham et al., 1994; Taliansky et al., 1994). which results in a local necrotic lesion (Holmes 1938; Takahashi 1956; Dawson 1999) preventing subsequent systemic spread of the virus….

……However, to increase test sensitivity, the ISHI comparative

……However, to increase test sensitivity, the ISHI-Veg comparative

Indexing replaced with local lesion assay. Greenhouse or growth room use clarified..

Materials:… Tobacco plants: resistant to all races of the pathogen for indexing (e.g. Nicotiana tabacum ‘Xanthi NN’) Greenhouse/Controlled Environment Room or cabinet (module)

Materials:… Tobacco plants: resistant to all races of the pathogen for local lesion assay (e.g. Nicotiana tabacum ‘Xanthi NN’) Controlled Greenhouse / Growth Chamber

70 % ethanol is not suitable for removing/disinfecting tobamoviruses. Sample preparation … This can be achieved by swabbing or spraying equipment and gloved hands with 70% ethanol or equivalent.

Sample preparation …This can be achieved by swabbing or spraying equipment and gloved hands with an alkaline soap or equivalent and then rinsing with water to remove residues.



Different buffer can be used but does not have to be defined by the antiserum supplier. Indexing replaced with assay.

1. Extraction of virus from the seed 1.1 Using a grinder, grind seeds of each sub-sample in the PBS seed extraction buffer (4 mL per 100 seeds) or as defined by the antisera provider if indexing is performed after ELISA pre-screening. 1.2 Process seed extracts within 4 h after grinding or store them at 4 °C when indexing is performed after ELISA pre-screening (CCP).

1. Extraction of virus from the seed 1.1 Using a grinder, grind seeds of each subsample in the PBS seed extraction buffer at a rate of (4 mL per 100 seeds) or in an alternative ELISA buffer if the assay is performed after ELISA pre-screening (CCP). 1.2 Process seed extracts within 4 h after grinding or store them at 4 °C when the assay is performed after ELISA pre-screening (CCP).

2. 2. Positive control (seeds or reference material)(CCP) … ii. grind flour of pea seeds mixed with ground TMV/ToMV/PMMoV-infected Nicotiana leaves in seed extraction buffer (5 mL per 5 g) or as defined by the ELISA antiserum provider (CCP) or

2. 2. Positive control (seeds or reference material)(CCP) … ii. grind flour of pea seeds mixed with ground TMV/ToMV/PMMoV-infected Nicotiana leaves in seed extraction buffer (5 mL per 5 g) or in an alternative ELISA buffer if the assay is performed after ELISA pre-screening (CCP) or

… iii. use liquid extract of TMV/ToMV/PMMoV-infected leaves of solanaceous hosts (CCP).

… iii. use liquid extract of TMV/ToMV/PMMoV-infected leaves of solanaceous hosts sufficiently diluted in PBS seed extraction buffer or in an alternative ELISA buffer if the assay is performed after ELISA pre-screening (CCP)

There should be some slight pressure applied during inoculation to facilitate virus penetration in the leaf. Indexing replaced with local lesion assay. 4. Indexing (mechanical inoculation of plants) … 4.2.1 Place a drop of inoculum (100 μL) onto the leaf. Smear the drop with fingers, wearing plastic gloves or plastic finger tips, on the leaf surface without applying pressure (CCP).

4. Local lesion assay (mechanical inoculation of plants) …. 4.2.1 Place a drop of inoculum (100 μL) onto the leaf. Smear the drop with fingers, wearing plastic gloves or plastic finger tips, on the leaf surface with constant but slight pressure (CCP).

Appropriate quantity of carborundum powder is the critical point of this step. Slight pressure is required.

Bioassay replaced with assay.

Critical control points [identified by CCP in the methods]

Critical control points [identified by CCP in the methods] – If the local lesion assay is performed after ELISA pre-screening, it has to be shown that local lesions can be obtained with the alternative buffer equivalent to PBS (Steps 1.1, 2.1.ii, 2.1.iii)



– If the local lesion assay is performed… If a laboratory routinely uses ELISA as a pre-screen, the correlation between ELISA responses and the number of lesions in the bioassay should be well established for the routinely used reference material. This will further establish whether the storage of samples has influenced the assay results. …

– If the local lesion assay is performed… If a laboratory routinely uses ELISA as a pre-screen, the correlation between ELISA responses and the number of lesions in the assay should be well established for the routinely used reference material. This will further establish whether the storage of samples has influenced the assay results. …

– Leaves should be dusted with the appropriate quantity of carborundum powder and with gentle movements to avoid leaf damage (Step 4.1.2) …

– Leaves should be dusted with the appropriate quantity of carborundum powder (Step 4.1.2) …

Smearing of the extract on the leaf surface should be performed with gentle finger movements with constant pressure but avoiding leaf damage. Inoculation of leaves should be performed by wearing gloves and/or plastic finger tips which should be changed between sub-samples. Hands should be cleaned thoroughly between samples with an alkaline soap or equivalent and then rinsed with water to remove soap residues (Step 4.2.1).

Smearing of the extract on the leaf surface should be performed with gentle finger movements with constant but slight pressure but avoiding leaf damage. Inoculation of leaves should be performed by wearing gloves and/or plastic finger tips which should be changed between subsamples. Hands should be cleaned thoroughly between samples with an alkaline soap or equivalent and then rinsed with water to remove soap residues (Step 4.2.1).


C.7.2. GREEN MAJORITY 0 ACCEPTED


C.7.3. Modification to existing seed health method 7-019b: Detection of Xanthomonas campestris pv. campestris on Brassica spp. disinfested/disinfected seed Note: If this method is accepted as 7-019b the existing method 7-019 needs to be renumbered to 7-019a. This proposal is submitted by the Seed Health Committee, approved by vote and is supported by a validation study.

Crop: Brassica spp. (broccoli, cabbage, calabrese, canola,

cauliflower, oilseed rape) Pathogen: Xanthomonas campestris pv. campestris (black rot) Authors: Asma M.1, Koenraadt H.M.S2and Politikou A.3 1BejoZaden B.V., P.O. Box 50, 1749 ZH Warmenhuizen,

The Netherlands. Email: [email protected] 2Naktuinbouw, P.O. Box 40, 2370 AA Roelofarendsveen,

The Netherlands. E-mail: [email protected] 3ISF, 7 Chemin du Reposoir, 1260 Nyon, Switzerland.

Email: [email protected] Revision History: Version 1.0. 1 January 2014.

Prepared by: International Seed Health Initiative-Vegetables, ISF (ISHI-Veg)

Background

The ISTA Rule 7-019 has been developed and validated for the detection of Xanthomonas campestris pv. campestris (Xcc) on Brassica spp. untreated seed. Hot water treatment (HWT) and related proprietary treatments against Xcc are a common practice to treat Brassica spp. seed lots found to be pathogen positive. To monitor the efficacy of such treatments the seed lots are retested for viable cells of Xcc. The ISTA Rule 7-019 involves only seed soaking for pathogen extraction. This relatively mild extraction of the pathogen from whole seeds does not allow for the detection of internally located X.campestris pv. campestris cells which might have survived the treatment. To facilitate detection, seed must be ground to extract the internally located cells that have a better chance of surviving the treatment than bacteria located on the seeds surface. A modification of the ISTA Rule 7-019 involving wet grinding of the disinfested/disinfected seed has been developed and validated in a comparative test between eight laboratories organised by the International Seed Health Initiative-Vegetables (ISHI-Veg). Wet grinding strongly enhances the extraction and detection of viable Xanthomonas campestris pv. campestris located internally in disinfested/disinfected seed. Other changes to theISTA Rule 7-019 consist of the use of buffered saline (PBS) rather than saline as well as a larger ratio of buffer to the seed. This avoids a reduction of the X. campestris pv. campestris recovery due to a suboptimal pH, especially with certain proprietary treatments (Koenraadt et al., 2007). Other changes include concentration of the seed extract by centrifugation, a longer incubation time of the plated extracts to increase the sensitivity of the assay, modifications of the semi-selective media mCS20ABN and FS, and modification of the pathogenicity test.

Validation Studies

Asma M., Koenraadt H. and Politikou A. (2012)


Copies are available by e-mail from [email protected], or by mail from the ISTA Secretariat.

Reproducibility: dispersion = 1

Repeatability: dispersion = 1

Detection limits: 1.5 cfu/mL (theroretical, P=0.95)

Safety Precautions

Ensure you are familiar with hazard data and take appropriate safety precautions, especially during preparation of media, autoclaving, and weighing out of ingredients. It is assumed that this procedure is being carried out in a microbiological laboratory by persons familiar with the principles of Good Laboratory Practice, Good Microbiological Practice, and aseptic technique. Dispose all waste materials in an appropriate way (e.g. autoclave, disinfect) and in accordance with local health, environmental and safety regulations.

Treated Seed

This test method is suitable for seed that has been treated using physical (hot water) or chemical (chlorine) or proprietary processes with the aim of disinfestation/disinfection, provided that any residue, if present, does not influence the reliability of the assay. This test method has not been validated for seed treated with protective chemicals or biological substances.

Sample and subsample size

The sample (total number of seeds tested) and subsample size to be tested depends on the desired tolerance standard (maximum acceptable percentage of seeds infested) and detection limit (theoretical minimum number of pathogen propagules per seed which can be detected).In any case, the recommended maximum subsample size is 10,000 seeds and the recommended minimum sample size is 30,000 seeds. A full discussion of these aspects can be found in Geng et al. (1987), Roberts et al. (1993) and Roberts (1999).

Materials

Reference material - Known strain of Xanthomonas campestris pv. campestris or standardised reference material.

Plates of FS medium - 9.0 cm Petri dishes (3 plates of each medium per subsample + controls).

Plates of mCS20ABN medium

- 9.0 cm Petri dishes (3 plates of each medium per subsample + controls).

Plates of YDC medium

- For subculture (at least 1 per subsample).

Conical flasks - With sterile PBS (0.05 M phosphate) plus Tween 20 (0.02% v/v) for soaking of seeds (25 mL per 1,000 seeds).

Orbital shaker

Grinder - e.g. Ultra Turrax with S25N-25G dispersion tool or equivalent.

Filter bags - e.g. Bag filter model P 400 mL (Interscience, France) or universal extraction bag model with synthetic intermediate layer (Bioreba, Switzerland) or filter extraction bags (Neogen Europe, Scotland) for filtering coarse particles from extracts.



Centrifuge - e.g. capable of providing centrifugal force of 5,000 g.

Dilution bottles - Containing 4.5 mL of sterile PBS (0.05 M phosphate) plus Tween 20 (0.02% v/v) (1 per subsample). Other volumes may be acceptable, see General Methods.

Automatic pipettes - Check accuracy and precision regularly.

Sterile pipette tips

Sterile bent glass rods

70% ethanol - For disinfection of surfaces, equipment.

Balance - Capable of weighing to the nearest 0.001 g.

pH meter - Capable of being read to the nearest 0.01 pH unit.

Incubator - Capable of operating at 28°C-30°C).

Brassica spp. seedlings

- Susceptible to all races of the pathogen for pathogenicity test (e.g. B. oleracea cv. Wirosa).

Sample Preparation

This can be done in advance of the assay.

It is vital to exclude any possibility of cross-contamination between seed samples, it is therefore essential to disinfect all surfaces, containers, hands, etc. both before and after handling each sample. This can be achieved by swabbing/spraying equipment and gloved hands with 70% ethanol.

Count the number of seeds in a known weight. Estimate the Thousand Seed Weight (TSW) as:

TSW = (weight of seeds / numbers of seeds) x 1000

Based on the estimated TSW, weigh out subsamples of the required size into new, clean polythene bags or containers.

Method

[Critical control points are indicated by CCP]

Extraction

Suspend seeds of each subsample in sterile PBS (0.05 M phosphate) plus Tween 20 (0.02% v/v) in a conical flask or equivalent container. The volume should be adjusted according to the number of seeds used (25 mL per 1,000 seeds) (CCP).

Shake for 2.5 h at room temperature (20-25°C) on an orbital shaker set at 100-125 rpm.

Grind the seeds with a grinder until all seeds are completely ground. This point should be reached in at most 2 min of grinding. If not, select alternative grinding equipment. Depending on the type of grinder used, disinfect properly between subsamples and samples to avoid any cross contamination (CCP).

1. Dilution and plating 1.1. Filter coarse particles from the seed extract, using a bag filter model

P 400 mL (InterScience, France), universal extraction bag model with synthetic intermediate layer (Bioreba, Switzerland) or filter extraction bags (Neogen Europe, Scotland) (Fig. 1).

1.2. Transfer 3.5 mL of the filtered seed extract to a tube and keep the samples on ice. This 3.5 mL sample must be used to prepare a


tenfold dilution (use 0.5 mL) and a tenfold concentration (use 2 mL). The remaining sample (1 mL) must be used to plate the undiluted seed extract.

1.3. Prepare a tenfold dilution (10-1 dilution) from the filtered seed extract. Pipette 0.5 mL of the extract into 4.5 mL of sterile PBS (0.05 M phosphate) plus Tween 20 (0.02% v/v) and vortex to mix (10-1

dilution) (see General Methods). 1.4. Prepare a tenfold concentrated extract (101 concentration) by

centrifugation of 2 mL sample for 5 min at 5,000 g. Carefully remove the supernatant and re-suspend the pellet in 200 μL of sterile PBS (0.05 M phosphate) plus Tween 20 (0.02% v/v).

1.5. Pipette 100 μL of the tenfold dilution (10-1 dilution) and then the undiluted seed extract onto one plate of each of the selective media (FS and mCS20ABN) and spread over the surface with a sterile bent glass rod (see General Methods).

1.6. Pipette 100 μL of the tenfold concentrated seed extract (101 concentration) onto one plate of each of the selective media (FS and mCS20ABN) and spread over the surface with a sterile bent glass rod (see General Methods).

1.7. Incubate plates at 28-30°C upside down and examine after 4-6 days (CCP).

2. Positive control (culture or reference material) 2.1. Prepare a suspension of a known strain of X. campestris pv.

campestris in sterile PBS (0.05 M phosphate) plus Tween 20 (0.02% v/v) or reconstitute standardised reference material according to the supplier’s instructions.

2.2. Dilute the suspension sufficiently to obtain dilutions containing approx. 102 to 104 cfu/mL. This may require up to seven ten-fold dilutions from a turbid suspension.

2.3. Pipette 100 μL of appropriate countable dilutions onto plates of each of the selective media (FS, mCS20ABN) and spread over the surface with a sterile bent glass rod.

2.4. Incubate plates with the sample plates. 3. Sterility check

3.1. Prepare a dilution series from a sample of the extraction medium (i.e. PBS plus Tween 20), containing no seeds, and plate on each of the media as for samples.

4. Examination of the plates 4.1. Examine sterility check and positive control plates (CCP). 4.2. Examine the sample plates for the presence of typical X. campestris

pv. campestris colonies by comparison with the positive control plates.

4.3. On FS after 4-6 d, X. campestris pv. campestris colonies are small, pale green, mucoid and surrounded by a zone of starch hydrolysis. This zone appears as a halo that may be easier to see with a black background (Fig. 2A).

4.4. After 4-6 d on mCS20ABN, X. campestris pv. campestris colonies are yellow, mucoid and surrounded by a zone of starch hydrolysis (Fig. 2B).

4.5. Record the number of suspect and other colonies (CCP) (see General Methods).

5. Confirmation/identification of suspect colonies 5.1. Subculture suspect colonies to sectored plates of YDC. To avoid the

potential for cross-contamination of isolates, use a new sectored plate for each subsample. The precise numbers of subcultured colonies will depend on the number and variability of suspect colonies on the plate: if present at least six suspect colonies should be subcultured per subsample (CCP).

5.2. Subculture the positive control isolate to a sectored plate for comparison.


5.3. Incubate sectored plates for 3-4 d at 28-30°C. 5.4. Compare appearance of growth with positive control. On YDC X.

campestris pv. campestris colonies are yellow and mucoid (Fig. 3). (CCP).

5.5. Confirm the identity of isolates by pathogenicity on Brassica seedlings of known susceptibility or by polymerase chain reaction (PCR) (CCP).

5.6. Record results for each colony subcultured. 6. Pathogenicity assay

6.1. Grow seedlings of a Brassica cultivar known to be susceptible to all races of X. campestris pv. campestris (e.g. Wirosa; see Vicente et al., 2001) at 20-30°C (± 2°C) in small pots or modules until at least 2-3 true leaf stage.

6.2. Scrape a small amount of bacterial growth directly from a 24-48 h YDC culture (e.g. sectored plate) with a sterile cocktail stick or insect pin.

6.3. Inoculate the secondary veins of the first two true leafs by stabbing with the cocktail stick or insect pin.

6.4. Inoculate 2-4 plants per isolate. 6.5. Inoculate seedlings with the positive control isolate and stab with a

sterile cocktail stick or insect pin as a negative control (CCP). 6.6. Grow on plants at 20-30°C. 6.7. Examine plants for the appearance of typical progressive V-shaped,

yellow/necrotic lesions with blackened veins after 10-14 days (See Fig. 4). Symptoms may be visible earlier depending on temperature and the aggressiveness of the isolate. Compare with positive control (CCP). It is important to discriminate between the progressive lesions caused by the vascular pathogen X. campestris pv. campestris and the limited dark necrotic lesions at the inoculation site caused by leaf spot Xanthomonas (classified as X. c. pv. raphani or X.c. pv. armoraciae (see Kamounvet al., 1992; Alvarez et al., 1994; Tamura et al., 1994; Vicente et al., 2001; Roberts et al., 2004).

7. PCR test (CCP) 7.1. Follow the PCR Option1 or the PCR Option 2 described in the ISTA

Rule 7-019 to confirm the suspect isolates.

Fig. 1. Extracts of ground cabbage seeds in a lateral filter bag. The lateral filter is used to remove coarse particles from the crude seed extract (see arrow).


Fig. 2. Plates of FS (A) and mCS20ABN (B) after 5 days of incubation at 28°C showing typical colonies of Xanthomonas campestris pv.campestris surrounded by zones of starch hydrolysis.

Fig.3. Typical yellow mucoid growth of isolates of Xanthomonas campestris pv. campestris on a sectored plate of YDC after 3 days at 28°C. Only suspect cultures are indicated by arrows.

Fig. 4. Cabbage leaves 7 days post inoculation with Xanthomonas campestris pv. campestris. Typical symptoms are black veins, wilting and chlorosis. The lower left leaf was used as a negative control.

A


General Methods (common to many test procedures)

Preparation of ten-fold dilution series

Each dilution should be prepared by pipetting 0.5 mL (± 5%) from a well-mixed seed extract or previous dilution into a universal bottle (screw-capped) or similar container containing 4.5 mL (± 2%) of sterile diluent and then vortexing to mix prior to the next dilution step. A new sterile pipette tip should be used for each dilution step. Pipettes should be checked regularly for accuracy and precision and re-calibrated as necessary. It is acceptable to prepare ten-fold dilutions using other volumes provided that the laboratory can demonstrate that the required accuracy and precision can be achieved.

Plating of dilutions.

This should be done as soon as possible after dilutions have been prepared and certainly within 30 min. Working from the highest (most dilute) dilution to the undiluted extract, 0.1 mL is pipetted onto the center of a surface-dry, labelled agar plate. The liquid should then be spread evenly over the entire surface of the medium with a bent glass rod. If care is taken to work from the highest to the lowest dilution (or undiluted extract) a single pipette tip and a single bent glass rod can be used for each sample. Ensure that all liquid has been absorbed by the agar before inverting and incubating plates. If necessary allow plates to dry under a sterile air-flow in a microbiological safety cabinet or laminar flow hood.

Recording of dilution plates

Record the results for all dilution plates. The most accurate estimate of bacterial numbers should be obtained from spread plates with total number between 30 and 300 colonies. However this may be further complicated depending on the relative numbers of suspect pathogen and other colonies. In order to minimise effort, start recording with the highest dilution (most dilute) and count the number of suspect and the number of other colonies. If the total number of colonies on a plate greatly exceeds 300 there is little value in trying to make a precise count if a more reliable count has already been obtained from a more dilute plate, in which case it is sufficient to record the number of colonies as ‘m’ (many) if they are still separate or ‘c’ (confluent) if they have run together.

Sectored Plates

Using a laboratory marker pen, draw lines on the base of a standard 9 cm plate (Petri dish) to divide it into six equal sectors. Subculture single colonies from dilution plates and make a single zigzagged streak within a single sector on the plate. Take care to leave sufficient space between each isolate to ensure the growth does not coalesce. Thus six suspect colonies can be subcultured to each sectored plate. Separate plates should be used for each sample/subsample. If the purity of subcultured isolates is doubtful, they should be further streaked out on whole plates.

Reporting Results

The result of a seed health test should indicate the scientific name of the pathogen and the test method used. When reported on an ISTA Certificate, results are entered under Other Determinations.

In the case of a negative result (pathogen not detected in any subsamples), the results should be reported in terms of the tolerance standard and detection limit. The tolerance standard depends on the total number of seeds tested, n, and is approximately 3/n (P=0.95) (see Roberts et al., 1993); the detection limit per subsample is equal to the detection limit per mL multiplied by the volume of extract.


In the case of a positive result, the report should indicate the mean number of colony forming units (cfu) of the pathogen per seed and either the number of positive subsamples out of the total number tested and the sample size or the maximum likelihood estimate of the proportion of infested seeds

Quality Assurance

General

A record should be kept of the date and results of pipette calibration checks.

It is essential that operators have received appropriate training and use automatic pipettes correctly.

Critical Control Points

[Identified by CCP in the methods]

Dry grinding of seed followed by the addition of an extraction buffer has found to be inadequate (Step 1.1).

In case an Ultra Turrax grinder is used to grind the seed, the grinder should be run in hot water and/or 70% ethanol and subsequently in sterile water to prevent any cross-contamination between subsamples. To achieve complete sterilization between samples the S25N-25G dispersion tool of the grinder has to be autoclaved or disassembled and the parts immersed in 70 % ethanol (Step 1.3).

The time between grinding and plating of the corresponding suspensions must be kept under 1 hour (Step 1.3).

Due to the exposure to harsh condition during the seed treatment the initial multiplication time of X. campestris pv. campestris cells is longer than for X. campestris pv. campestris cells from untreated seeds or cells of the positive control. To obtain a similar colony size therefore a longer incubation is required when testing treated seed (Step 2.7).

There should be no growth on dilution plates prepared as a sterility check (Step 5.1).

Dilution plates prepared from positive control isolate(s) or reference material, should give single colonies with typical morphology (Step 5.1).

Numbers of bacteria on dilution plates should be consistent with the dilution (i.e. should decrease approx. ten-fold in the 10-1 dilution) (Step 5.5.

Due to the potential for non-pathogenic isolates to be present in seed lots together with pathogenic isolates, it is essential to subculture (Step 6.1), if present, at least the minimum number of suspect colonies specified (six per subsample) and to test all Xanthomonas-like subcultured isolates for pathogenicity or in PCR test (Step 6.5).

The positive control isolate(s) or reference material should give colonies with typical morphology on YDC (Step 6.4).

Positive control isolates should be included in every pathogenicity test (Step 7.5).The positive control isolates should give typical symptoms in the pathogenicity test (Step 7.7).

The CCP of the PCR Option 1 and PCR Option 2 are described in ISTA Rule 7-019 (Step 8).

The source of starch used in the selective media is critical for observation of starch hydrolysis. Verify that each new batch of starch gives clear zones of hydrolysis with reference cultures of X. campestris pv. campestris (FS and mCS20ABN media).

The activity per gram (g) of some antibiotics may vary between batches. It may be necessary to adjust the weight or volume added to ensure that the


final number of units per litre of medium is consistent (FS and mCS20ABN media).

Prepare antibiotics stock solutions and other supplements in water, 50 or 70% ethanol. Antibiotics solutions and other supplements prepared in distilled water must be filter sterilized with a 0.2 mm bacterial filter. Alternatively it is possible to add the amount of powder to autoclaved distilled water. Solutions prepared in ethanol need no sterilization (FS and mCS20ABN media).

The activity of neomycin against some strains of X. campestris pv. campestris is known to be affected by pH. It is essential that the pH of the medium is less than 6.6 (mCS20ABN medium, Step 3).

References

Alvarez, A.M., Benedict, A.A., Mizumoto, C.Y., Hunter, J.E. and Gabriel, D.W. (1994). Serological, pathological, and genetic diversity among strains of Xanthomonas campestris pv. campestris infecting crucifers. Phytopathology 84, 1449-1457.

Asma, M.,Koenraadt, H.M.S. and Politikou, A. (2012).Proposal for a new detection method of Xanthomonas campestris pv. campestris on disinfested/ disinfected Brassica spp. seed lots. ISTA Method Validation reports 20XX.

Geng, S., Campbell, R.N., Carter, M. and Hills, M. (1987) Quality control programs for seedborne pathogens. Plant Disease 67, 236-242.

Kamoun, S., Kamdar, H.V., Tola, E. and Kado, C.I. (1992) Incompatible interactions between crucifers and Xanthomonas campestris involve a vascular hypersensitive response: role of the hrpXlocus. Molecular Plant-Microbe Interactions 5, 22-33.

Koenraadt, H., Borst, R. and van Vliet, A. (2007). Detection of Xanthomonas campestris pv. campestris in cabbage seeds after hot water treatment. Phytopathology 97, S59.

Roberts, S.J. (1999) Thresholds, standards, tests, transmission and risks. In: Proceedings of 3rd ISTA Seed Health Symposium, Ames, Iowa, USA, 16-19 August 1999. pp 20-24. ISTA, Zürich, Switzerland.

Roberts, S.J., Brough, J., Everett, B. and Redstone, S. (2004). Extraction methods for Xanthomonas campestris pv. campestris from Brassica seed. Seed Science and Technology 32, 439-453.

Roberts, S.J., Phelps, K., Taylor, J.D. and Ridout, M.S. (1993). Design and interpretation of seed health assays. In: Sheppard, J.W., (Ed.) Proceedings of the first ISTA Plant Disease Committee Symposium on Seed Health Testing, Ottawa, Canada. Agriculture Canada, Ottawa, Canada. pp 115–125.

Tamura, K., Takikawa, Y., Tsuyumu, S. and Goto, M. (1994). Bacterial spot of crucifers caused by Xanthomonas campestris pv. raphani. Annals of the Phytopathological Society of Japan 60, 281-287.

Vicente, J.G., Conway, J., Roberts, S.J. and Taylor, J.D. (2001). Identification and origin of Xanthomonas campestris pv. campestris races and related pathovars. Phytopathology 91, 492-499.

Preparation of PBS (0.05 M phosphate) with Tween 20 (0.02% v.v) (pH 7.2-7.4)

Compound g/L

Sodium chloride (NaCl) 8.0


Na2HPO4 5.75

KH2PO4 1.0

Tween 20 0.2 mL

Distilled/de-ionised water 1000 mL

Preparation

Weigh out all the ingredients into a suitable container.

Add 1000 mL of distilled/de-ionised water.

Dissolve and dispense into final containers.

Autoclave at 121°C, 15 psi for 15 min.

Add 0.2 mL of sterile Tween 20 per 1 L after autoclaving

Storage

Provided containers are tightly closed, may be stored for several months before use.

Preparation of mCS20ABN agar medium

Compound g/L

Soya Peptone 2.0

BactoTryptone 2.0

KH2PO4 2.8

(NH4)2HPO4 0.8

MgSO4.7H2O 0.4

L-Glutamine 6.0

L-Histidine 1.0

D-Glucose (Dextrose) 1.0

Soluble starch Merck 1252 (CCP) 25.0

Bacto Agar 18.0


Nystatina (10 mg/mL 50% EtOH) 35 mg (3.5 mL)

Neomycin sulphateb (20 mg/mL distilled water) 40 mg (2.0 mL)

Bacitracinc (50 mg/mL 50% EtOH) 100 mg (2.0 mL) a, b, c Added after autoclaving

Preparation

1. Weigh out all the ingredients except the antibiotics into a suitable container.

2. Add 1000 mL of distilled/de-ionised water.

3. Dissolve and check pH which should be 6.5, adjust if necessary (important CCP).

4. Autoclave at 121°C, 15 psi for 15 min.

5. Prepare antibiotic solutions and filter sterilise as appropriate.

6. Allow the medium to cool to approx. 50°C and add antibiotic solutions.


7. Mix thoroughly but gently by inversion/swirling to avoid air bubbles and pour plates (18 mL per 9.0 cm plate).

8. Leave plates to dry in a laminar flow bench or similar before use.

Antibiotics (amounts for guidance only, CCP) a Dissolve 100 mg nystatine in 10 mL 50% ethanol. Add 3.5 mL/L. b Dissolve 200 mg neomycin sulphate (770 U/mg)in 10 mL sterile distilled water. Add 2.0 mL/L. c Dissolve 500 mg bacitracin,(60 U/mg) in 10 mL 50% ethanol. Add 2.0 mL/L.

Storage

Store the prepared plates inverted in polythene bags at 4°C (± 2°C) and use within four weeks of preparation to ensure activity of antibiotics.

Depending on the source of starch, pre-storage in the refrigerator for several days before use may result in more easily visible zones of starch hydrolysis.

Preparation of FS agar medium

Compound g/L

K2HPO4 0.8

KH2PO4 0.8

KNO3 0.5

MgSO4.7H2O 0.1

Yeast extract 0.1

Methyl Green (1% aq.) 1.5 mL

Soluble starch Merck 1252 (CCP) 25.0

Bacto Agar 15.0

Distilled/de-ionisedwater 1000 mL

Nystatina (10 mg/mL in 50% ethanol) 35 mg (3.5 mL)

D-methionineb (1 mg/mL 50% EtOH) 3 mg (3.0 mL)

Pyridoxine-HClc(1 mg/mL 50% EtOH) 1 mg (1 mL)

Cephalexind(20 mg/mL 50% EtOH) 50 mg (2.5 mL)

Trimethoprime (10 mg/mL 70% EtOH) 30 mg (3 mL) a, b, c, d, e Added after autoclaving

Preparation

1. Weigh out all the ingredients except antibiotics, pyridoxine-HCl and D-methionine into a suitable container.

2. Add 1000 mL (or 500 mL) of distilled/de-ionised water.

3. Dissolve and check pH which should be 6.5, adjust if necessary (important CCP).

4. Autoclave at 121°C, 15 psi for 15 min.

5. Prepare the antibiotic, pyridoxine-HCl and D-methionine solutions and filter sterilise as appropriate.

6. Allow medium to cool to approx. 50°C before adding the antibiotics, pyridoxine-HCl and D-methionine solutions.


7. Mix the molten medium gently to avoid air bubbles and pour plates (18 mL per 9.0 cm plate).

8. Leave plates to dry in a laminar flow bench or similar before use.

Antibiotics (amounts for guidance only, CCP) a Dissolve 100 mg nystatine in 10 mL 50% ethanol. Add 3.5 mL/L (1.75 mL/500 mL). b Dissolve 10 mg D-methionine in 10 mL 50% ethanol. Add 3.0 mL/L (1.5 mL/500 mL). c Dissolve 10 mg pyridoxine-HCl in 10 mL 50% ethanol. Add 1 mL/L (0.5 mL/500 mL). d Dissolve 200 mg cephalexin in 10 mL 50% ethanol. Add 2.5 mL/L (1.25 mL/500 mL). e Dissolve 100 mg trimethoprim in 10 mL 70% ethanol. Add 3 mL/L (1.5 mL/500 mL).

Storage

Store the prepared plates inverted in polythene bags at 4°C (± 2°C) and use within four weeks of preparation to ensure activity of antibiotics.

Depending on the source of starch, pre-storage in the refrigerator for several days before use may result in more easily visible zones of starch hydrolysis.

Preparation of Yeast Dextrose Chalk (YDC) agar medium

Compound g/L

Bacto Agar 15.0

Yeast Extract 10.0

CaCO3 (light powder) 20.0

D-Glucose (Dextrose) 20.0


Preparation 1. Weigh out all the ingredients into a suitable oversize container (i.e. 250

mL of medium in a 500 mL bottle/flask) to allow swirling of the medium just before pouring.

2. Add 1000 mL (or 500 mL) of distilled/de-ionised water. 3. Steam to dissolve. 4. Autoclave at 121°C, 15 psi for 15 min. 5. Allow the medium to cool to approx. 50°C. 6. Swirl to ensure even distribution of CaCO3 and avoid air bubbles, and

pour plates (20 mL per 9.0 cm plate). 7. Leave the plates to dry in a laminar flow bench or similar before use. Storage Store the prepared plates inverted in polythene bags at 4°C (± 2°C).

Prepared plates can be stored for several months provided they do not dry out.




C.7.4. Modification to existing seed health method 7-021: Detection of Xanthomonas axonopodis pv. phaseoli and Xanthomonas axonopodis pv. phaseoli var. fuscans on Phaseolus vulgaris (Bean) seed Method now includes Xanthomonas axonopodis pv. phaseoli var. fuscans with the use of dfferent primer sets. This proposal is submitted by the Seed Health Committee, approved by vote and is supported by a validation study.

Only additions to 7-021 method are indicated Authors: Grimault V.1, Olivier V.2, Rolland M.3, Darrasse A.4 and Jacques M.A.4 1GEVES-SNES, rue Georges Morel, B.P.90024, 49071 Beaucouzé

Cedex, France. E-mail: [email protected] 2ANSES-Plant healthlaboratory,7 rue Jean Dixméras, 49044 Angers CEDEX 01, France E-mail: [email protected]

3BioGEVES,rue Georges Morel, B.P.90024, 49071 Beaucouzé Cedex, France. E-mail: [email protected]

4INRA, UMR1345 IRHS, SFR 149 Quasav, Bâtiment C, 42, rue Georges Morel, BP 60057, F-49071 Beaucouzécedex, France. E-mail: [email protected]

Prepared by: ISTA and International Seed Health Initiative for Vegetables, ISF (ISHI-Veg)

Revision History: Version 2.0, 1 January 2014.

Background This method is derived from the validation studies carried out by ISTA in 2003 and 2011,... text from previous version of method In 2010 in the USA and France conflicting data were obtained with the new ISTA method. Research in France (GEVES and INRA) and in the Netherlands (Naktuinbouw) showed that some isolates that were responsible for positive results were causing symptoms in the pathogenicity assay but were not identified as Xap based on molecular methods (genetic bacterial fingerprinting in the Netherlands and pathogen specific PCR’s in France). Therefore it was concluded that the pathogenicity assay used in the ISTA method, a crucial step in the Xap test, is not reliable enough. A new pathogenicity assay was developed at INRA to allow a reliable characterization of the aggressiveness of X. axonopodis pv. phaseoli wild type strains and mutants (Darsonval et al., 2009). A comparison study of the new pathogenicity test and primers specific for X. axonopodis pv. phaseoli fuscans and non fuscans isolates (Audy et al.,1994; Boureau et al., 2012) was carried out as a collaboration between ISTA, ANSES, INRA and ISHI-Veg. This study showed that the new pathogenicity test and Audy et al, (1994) primers were good confirmation tools and that Diaggene (Boureau et al., 2012) primers gave good results but their use did not improve sensitivity of the method. Two options are proposed for confirmation of suspect isolates: Option 1: Pathogenicity assay, for laboratories not equipped or experienced with PCR. In this case, CCP must be followed and target and non target controls added (X. vesicatoria, Xap, water). This option is also valuable and less time consuming when few suspect isolates have been detected but requires a growth chamber or greenhouse equipped for high relative humidity (RH). Option 2: PCR test with Audy et al, (1994) primers. This option can be used for laboratories experienced and equipped for PCR, when a short delay is needed for obtaining results and/or a high number of suspect isolates have been detected.

Validation Studies Grimault V., Olivier V., Rolland M., Darrasse A.. and Jacques M.A. (2012). Copies are available by e-mail from [email protected], or by mail from the ISTA Secretariat.



Safety Precautions text from previous version of method

Ethidium bromide Ethidium bromide is carcinogenic. Use ethidium bromide according to safety instructions. It is recommended to manipulate solution instead of powder. Some considerations are mentioned below.

– Consult the Material Safety Data Sheet on ethidium bromide before using the chemical.

– Always wear personal protective equipment when handling ethidium bromide. This includes wearing a lab coat, nitrile gloves and closed toe shoes.

– Leave lab coats, gloves, and other personal protective equipment in the lab once work is complete to prevent the spread of ethidium bromide or other chemicals outside the lab.

– All work with ethidium bromide is to be done in an "ethidium bromide" designated area in order to keep ethidium bromide contamination to a minimum.

■ UV light UV light must not be used without appropriate precautions. Ensure that UV protective eyewear is utilized when visualizing ethidium bromide.

Treated Seed

Sample and subsample size text from previous version of method

Materials text from previous version of method Reference material: A known strain of fuscans or non fuscans types of X. axonopodis pv. phaseoli (positive control) and of X. vesicatoria (negative control) or standardized reference material Growth chamber capable of operating at 28°C or greenhouse, with high humidity (95% RH), with quarantine status Milli Q and chemicals for PCR preparation Sterile microtubes (1.5 mL; 0.2 mL) Microliter pipettes (e.g. Gilson, Finn) with sterile filtered tips (1 µl – 1000 µl) Conventional thermocycler Electrophoresis equipment (1.5-2% agarose gels) DNA visualizing system (BET or analog reagent, UV imaging apparatus) PCR primers (Audy et al., 1994) - p7X4c: 5’ ggcaacacccgatccctaaacagg 3’ - p7X4e: 5’ cgccggaagcacgatcctcga ag 3’

Sample Preparation text from previous version of method

Method text from previous version of method

[Critical control points are indicated by CCP]

6.5...Confirm the identity of isolates by pathogenicity test on bean seedlings of known susceptibility (option 1) or by PCR (option 2)

6.6 text from previous version of method

7. Pathogenicity (CCP) (Darsonval et al., 2009): Option 1 7.1 Grow seedlings of a bean cultivar known to be highly susceptible to Xap (e.g. Flavert or Michelet) at 20-30°C in small pots until the first trifoliate leaf stage (approximately 16 days after sowing). 7.2 Make a 107 cfu/mL (CCP) suspension in distilled/deionized water of a culture obtained after growth (24 or 48 h), 28°C on YDC (i.e. sectored plate). 7.3 Inoculation: dip first trifoliate leaf for 30 s in a container containing inoculum (beaker) (Fig 4).


7.4 The number of plants which should be inoculated is 3 plants per suspect isolate. 7.5 Inoculate plants with one positive X. apisolate, and 2 negative controls: X. vesicatoria and distilled/deionized water 7.6 Incubate at 28°C 16 h light, 95% RH; 25°C 8 h dark, 95% RH (CCP) 7.7 Record symptoms from 5 to 11 days (depending on when symptoms begin) after inoculation. Compare with positive and negatives controls. Typical Xap symptoms are water-soaked spots. Necrosis of lesions can develop and in case of very aggressive isolates lead to death of tissues (Fig 5 a, b, c, d). No lesions occur on negative controls (Fig 6) 8.Polymerase Chain Reaction (PCR) Audy et al. (1994): Option 2 8.1 Make a slightly turbid cell suspension at 107 cfu/mL(OD600nm approximately 0.05) in 1.0 mL sterile distilled/deionized water from the suspect colonies cultured on YDC medium, and the positive and negative controls (CCP). Boil the suspension for 5 min at 95°C for DNA extraction. Store at -20°C until identification (CCP). 8.2 Use the following X. axonopodis pv. phaseoli specific pair of primers from Audy et al. (1994) that will give a product of 800bp: p7X4c: 5’ ggcaacacccgatccctaaacagg 3’ p7X4e: 5’ cgccggaagcac gat cctcgaag 3’ 8.3 Prepare the reaction mixture (page 7-021-X, adapted by INRA) (CCP). Carry out the PCR reactions in 0.2 mL thin walled PCR tubes in a final volume of 20 µl (16 µl reaction mixture + 4 µl boiled bacterial suspension). 8.4 PCR profile: An initial 3 min incubation at 94oC followed by 35 cycles of 1 min at 94oC, 2 min at 72oC. A final 10 min incubation at 72oC and infinity at 12oC (CCP).During each amplification run, in addition to the positive and negative controls extracted in 8.1, a PCR negative control (DNA extract replaced by molecular biology grade water) is added. 8.5 Fractionate 10 µl of the PCR products and water (negative PCR control) by gel electrophoresis in a 1.5% agarose gel in 1X Tris-Acetate EDTA (TAE Buffer) (CCP). Include a 100bp ladder. Stain with ethidium bromide in a bath and rinse in water. 8.6 Analyse the amplification products for a X. axonopodis pv. phaseoli specific product of 800bp (CCP)= positive identification of X. axonopodis pv. phaseoli, no band = negative identification (Fig 7). In case of a positive identification of X. axonopodis pv. phaseoli, as a low risk of false positive result is present (Audy et al. (1994) primers detect X. axonopodis pv. dieffenbachiae which are not supposed to be present on bean seeds), a pathogenicity test can be performed as complementary information.

General Methods (common to many test procedures) text from previous version of method Quality Assurance General text from previous version of method

Critical Control Points [Identified by CCP in the method]

text from previous version of method Due to the potential for non-pathogenic isolates to be present in seedlots together with pathogenic isolates, it is essential to subculture if present, at least the minimum number of suspect colonies specified (six per subsample) (Step 6.1), and to test all Xanthomonas-like subcultured isolates in pathogenicity or PCR test (Step 6.5). For pathogenicity assay, a concentration of 107 cfu/mL must be used as lower concentrations can lead to false negative results and higher concentrations to false positive results. The humidity during incubation must be very high (minimum 95%) to obtain water-soaked lesions. If the humidity is too low, necrotic lesions can develop without any visible water-soaked spot making more difficult the interpretation of the result. Positive and negative control isolates and negative PCR control should be included


in every PCR test (Step 8.1). DNA extracted by boiling cannot be stored for a very long time. If stored at -20°C, positive and negative controls stored in the same conditions as suspect isolates’ DNA must be used. The preparation of PCR mixture (Step 8.1, 8.4), and the preparation of agarose gel for electrophoresis (Step 8.5) should be adapted to available material and equipment of individual laboratories testing for of X. axonopodis pv. phaseoli under the condition that results will be validated on PCR controls.

Fig. 4. Inoculation by dipping first trifoliate leaf for 30 seconds in a beaker containing inoculum.

Fig 5a Fig 5b

Fig 5c Fig 5d


Fig. 5. Phaseolus vulgaris leaves 5-11 days after inoculation with typical Xap water-soaked spots (a), necrosis (b, c) and dead tissues (d).

Fig. 6. Phaseolus vulgaris leaves 5-11 days after inoculation with a negative control.

Fig. 7: Agarose gel showing Xap specific band at 800bp (Audy et al, (1994) primers)

Example of Reaction Mixture Preparation for PCR –Audy primers

Compound Initial concentration

Final concentration

Volume (µl) in 20 µl

Sterile water 10.02 Promega Go Taq Buffer * 5x 1x 4 dNTP 2.5 mM each 0.2 mM 1.6 p7X4c 20 µM 0.15 µM 0.15 p7X4e 20 µM 0.15 µM 0.15 Go TaqPolymerase 5 U/µl 0.02 U/µl 0.08 DNA 4

* Concentrated PCR reaction buffer (with MgCl2), from GoTaq DNA polymerase [Promega] (Laboratories using a buffer without MgCl2 will have to add this salt to a final concentration of 1.5 mM).


Example for visualization of PCR products

Preparation of Tris-Acetate EDTA (TAE) Buffer 1X Compound mL/L Tris-Acetate EDTA (TAE 50X) 20 Distilled/de-ionised water QSP 1000 mL

Preparation of 1.5% agarose gel for electrophoresis

Compound 1 agarose gel (25x15 cm)

1 litre

Tris-Acetate EDTA (TAE) 1x 300 mL 1000 mL Agarose 4.5 g 15.0 g

Preparation

1. Make sure that the gel tray is clean and dry before use. Use the gel caster. Place the gel comb(s) in position in the gel tray.

2. Weigh out the desired amount of agarose and place in an Erlenmeyer flask with a measured amount of electrophoresis buffer, e.g. for a 300 mL gel add 4.5 g of agarose and 300 mL of 1x TAE buffer to a 500 mL flask. The larger flask ensures the agarose will not boil over.

3. Dissolve the agarose in a microwave oven. All the grains of agarose should be dissolved and the solution clear.

4. Allow the medium to cool down to approx. 60oC and pour the gel caster.

5. After the gel is completely set carefully remove the gel comb(s).

6. Remove the gels and place them in the electrophoresis unit.

7. The same electrophoresis buffer used in the gel must also be used for the running buffer.

Note: The amount of 1.5% agarose gel for electrophoresis to be prepared depends on the available electrophoresis apparatus of a laboratory.

References Audy P., Laroche A., Saindon G., Huang H.C. and Gilbertson R.L. (1994). Detection

of the bean common blight bacteria, Xanthomonas campestris pv. phaseoli and X.c. phaseoli var. fuscans, using the Polymerase Chain Reaction. Molecular Plant Pathology 84, 1185-1192.

Birch P.R.J., Hyman L.J., Taylor R., Opio A.F., Bragard C., and Toth I.K. (1997). RAPD PCR-based differentiation of Xanthomonas campestris pv. phaseoli from Xanthomonas campestris pv. phaseoli var. fuscans. European Journal of Plant Pathology 103, 809–814.

Boureau T., Chhel F., Hunault G., Kerkoud M., Lardeux F., Manceau C., Poussier S. and Saubion F. (2012). Procédé de dépistage de Xanthomonas axonopodis pv. Phaseoli. Patent. Publication 2970480, 20 July 2012.

Darsonval A., Darrasse A., Durand K., Bureau C., Cesbron S. and Jacques M.A. 2009. Adhesion and fitness in the bean phyllosphere and transmission to seeds of Xanthomonas fuscans subsp. fuscans. Molecular Plant-Microbes Interactions 22, 747-757.

Lopez, R., Asensio C., and Gilbertson R.L. (2006). Phenotypic and genetic diversity in strains of common blight bacteria (Xanthomonas campestris pv. phaseoli and X. campestris pv. phaseoli var. fuscans) in a secondary center of diversity of the common bean host suggests multiple introduction events. Phytopathology 96,1204–1213.

Mkandawire, A.B.C., Mabagala R.B., Guzman P., Gepts P., and Gilbertson R.L. (2004). Genetic diversity and pathogenic variation of common blight bacteria (Xanthomonas campestris pv. phaseoli and X. campestris pv. phaseoli var. fuscans) suggests pathogen coevolution with the common bean. Phytopathology 94, 593–603.

Schaad, N.W., Postnikova E., Lacy G.H., Sechler A., Agarkova I., Stromberg P.E., Stromberg V.K., and Vidaver A.K. (2006). Emended classification of xanthomonad pathogens on citrus. Systematic and Applied Microbiology 29, 690–695.


Simoes T.H.N., Gonçalves E.R., Rosato Y.B. and Mehta A. (2007).Differentiation of Xanthomonas species by PCR-RFLP of rpfB and atpDgenes.FeMS Microbiology Letters 271, 33-39.

Toth I.K., Hyman L.J., Talylor R. and Birch P.R.J. 1998. PCR-based detection of Xanthomonas campestris pv. phaseoli var. fuscans in plant material and it differentiation from X. c. pv. phaseoli. Journal of Applied Microbiology 85, 327–336.

Vauterin, L., Hoste B., Kersters K., and Swings J. 1995. Reclassification of Xanthomonas. International Journal of Systematic Bacteriology 45, 472–489.

Vauterin L., Rademaker J. and Swings J. 2000. Synopsis on the taxonomy of the genus Xanthomonas. Phytopathology 90, 677-682.




C.7.5. New seed health method 7-029: Detection of Pseudomonas syringae pv. pisi on Pisum sativum (Pea) seed New seed health method. This proposal is submitted by the Seed Health Committee, approved by vote and is supported by a validation study.

Crop: Pisum sativum (pea) Pathogen: Pseudomonas syringae pv. pisi (bacterial blight) Authors: V.Grimault1, R. Germain2 and A. Politikou3

1GEVES-SNES, rue Georges Morel, B.P.90024, 49071 Beaucouze Cedex, France Email: [email protected], 2Vilmorin Sa, Rue du manoir, 49250 La Menitre, France Email:[email protected] 3ISF, 7 Chemin du Reposoir, 1260 Nyon, Switzerland. Email: [email protected]

Prepared by: International Seed Health Initiative for Vegetables, ISF (ISHI-Veg) Revision History: Version 1.0. 1 January 2014. Background Pseudomonas syringae pv. pisi (P. syringae pv. pisi), causal organism of bacterial blight on pea seeds (Grondeau et al., 1993), is a seed-borne (Hollaway et al., 2007) and seed-transmitted (Grondeau et al., 1993; 1996; Roberts et al., 1992, 1996) bacterial pathogen. Several studies on the characterization of P. syringae pv. pisi (Grondeau et al., 1996; Elvira-Recuenco and Taylor 2001) and distinction between the pv. syringae and pv. pisi (Malandrin and Samson 1998) have been conducted for identification purposes and for the development of tests for the P. syringae pv. pisi detection on pea seed (Lyons and Taylor 1990; Fraaije et al., 1993). The serological assays can not provide information on the bacterium’s viability and pathogenicity (Schaad 1982). Therefore, the available methods in use by seed health laboratories are based on seed wash-dilution-plating assays on semi-selective media (Fraaije et al., 1993; Grondeau et al., 1993; Mohan and Schaad 1987) and confirmation of suspect colonies by a pathogenicity test (Grondeau et al., 1992; Malandrin and Samson 1998). This method for the detection of P. syringae pv. pisi on untreated pea seeds has been validated in a comparative test organised by the International Seed Health Initiative for Vegetables, ISF (ISHI-Veg) with results of seven laboratories. It includes a seed wash-dilution-plating on the KBBCA and SNAC semi-selective media, optional biochemical tests on suspect colonies and a pathogenicity test for their confirmation. The biochemical tests allow for a reduced number of P. syringae pv. pisi suspects to be confirmed and subsequently for reduced time and labour in the pathogenicity test. The two pathogenicity test methods provide the user with a higher flexibility to operate in different laboratory conditions.

Validation Studies V. Grimault, R. Germain and A. Politikou (2012) Copies are available by e-mail from [email protected], or by mail from the ISTA Secretariat.

Safety Precautions Ensure you are familiar with hazard data and take appropriate safety precautions, especially during preparation of media, autoclaving, and weighing out of ingredients. It is assumed that persons carrying out this procedure are in a laboratory suitable for carrying out microbiological procedures and familiar with the principles of Good Laboratory Practice, Good Microbiological Practice, and aseptic technique. Dispose all waste materials in an appropriate way (e.g. autoclave, disinfect) and in accordance with local health, environmental and safety regulations.



Treated seed Seed treatments may affect the performance of this test. This method was not validated on treated seed. (Definition of treatment: any process, physical, biological or chemical, to which a seed lot is subjected, including seed coatings. See 7.2.3.).

Sample and subsample size The sample (total number of seeds tested) and subsample size to be tested depends on the desired tolerance standard (maximum acceptable percentage of seeds infested) and detection limit (theoretical minimum number of pathogen propagules per seed which can be detected), in any case the minimum sample size should be 5 000 seeds and the maximum subsample size should be 1 000 seeds for vegetable (green) peas.

Materials Reference material - Known strain of Pseudomonas syringae pv. pisi or

standardised reference material Plates of KBBCA medium

- 9.0 cm Petri dishes (6 plates of each medium per subsample + controls)

Plates of SNAC medium - 9.0 cm Petri dishes (6 plates of each medium per subsample + controls)

Polythene bags or containers

- with sterile saline (0.85% NaCl) for soaking of seeds (2.5 mL per 1g of seed)

Cold room or refrigerator

- operating at 4°C.

Dilution bottles - containing 4.5 mL of sterile saline (2 per subsample). Other volumes may be acceptable, see General Methods

Automatic pipettes - check accuracy and precision regularly Sterile pipette tips Sterile bent glass rods 70% ethanol or equivalent disinfecting product

Balance - capable of weighing to the nearest 0.001 g Incubator - operating at 28°C (± 2°C) UV lamp (365 nm) to check fluorescence

-

Materials for Oxidase tests

- 1% aqueous N,N-dimethyl paraphenylene diamine oxalate solution or ready to use tests (e.g. Bactident Oxidase, Merck, 1.13300.0001)

Pea seedlings - susceptible to all races of the pathogen for pathogenicity test (e.g. cv. Kelvedon wonder)

Module/growth chamber - Capable of operating/maintaining temperature at 20oC (± 2°C)

Greenhouse - Capable of operating/maintaining temperature at 20-25oC

Sample preparation This can be done in advance of the assay. It is vital to exclude any possibility of cross-contamination between seed samples, it

is therefore essential to disinfect all surfaces, containers, hands, etc. both before and after handling each sample. This can be achieved by swabbing/spraying equipment and gloved hands with 70% ethanol.

Count the number of seeds in a known weight. Estimate the Thousand Seed Weight (TSW) as:

TSW = (weight of seeds / numbers of seeds) x 1000 Based on the estimated TSW, weigh out subsamples of the required size into new,

clean polythene bags or containers.

Method [Critical control points are indicated by CCP] 1. Extraction

1.1. Suspend seeds of each subsample in sterile saline in a polythene bag or container. The volume of the sterile saline should be adjusted according to the number of seeds used (2.5 mL per 1 g of seeds).

1.2. Soak the subsamples overnight (18-24 h) at 4°C under agitation.


2. Dilution and plating 2.1. Shake by hand the polythene bags or containers to obtain a homogenous

extract before dilution. 2.2. Prepare a two tenfold dilutions series from each seed extract. Pipette 0.5 mL

of the extract into 4.5 mL of sterile saline and vortex to mix (10-1 dilution). Pipette 0.5 mL of the 10-1 dilution into another 4.5 mL of sterile saline and vortex to mix (10-2 dilution) (see General Methods).

2.3. Pipette 100 mL of each dilution and the un-diluted seed extract onto two plates of each of the semi-selective media (KBBCA and SNAC) and spread over the surface with a sterile bent glass rod or equivalent (see General Methods).

2.4. Incubate inverted plates at 28°C (± 2°C) and examine after 4-5 days (see paragraph 5).

3. Positive control (culture or reference material) 3.1. Prepare a suspension of a known strain of Pseudomonas syringae pv. pisi in

sterile saline or reconstitute standardised reference material according to the supplier’s instructions.

3.2. Dilute the suspension sufficiently to obtain dilutions containing approximately 102 to 103 cfu/mL. This may require up to seven ten-fold dilutions from a turbid suspension.

3.3. Pipette 100 mL of appropriate countable dilutions onto plates of each of the semi-selective media (KBBCA, SNAC) and spread over the surface with a sterile bent glass rod or equivalent (see General Methods).

3.4. Incubate plates with the sample plates. 4. Sterility check

4.1. Plate a dilution series from a sample of the extraction medium (i.e., sterile saline), containing no seeds, and plate on each of the semi-selective media as for samples.

5. Examination of the plates 5.1. Examine sterility check and recovery of positive control on both semi-

selective media (KKBCA, SNAC) (CCP). 5.2. Examine the sample plates for the presence of typical P. syringae pv. pisi

colonies by comparison with the positive control plates. 5.3. On KBBCA after 4 days, P. syringae pv. pisi colonies are creamy and half-

translucent(Fig. 1). 5.4. On SNAC after 4 days P. syringae pv. pisi colonies are circular, white to

transparent, mucoid, dome shaped and levan positive. (Fig. 2). 6. Identification of suspect colonies

6.1. Pick up at least two suspect colonies, if present, per subsample grown on KBBCA medium and subculture on sectored plates of SNAC medium (CCP).

6.2. Pick up at least two suspect colonies, if present, per subsample grown on SNAC medium and subculture on sectored plates of KBBCA medium (CCP).

6.3. Repeat with the positive control colonies. Subculture on a sectored plate of SNAC medium two colonies grown on KBBCA and subculture on a sectored plate of KKBCA medium two colonies grown on SNAC.

6.4. Incubate sectored plates at 28°C (± 2°C) for 2-3 days. 6.5. Check colonies subcultured on SNAC medium for levan production. P.

syringae pv. pisi colonies are levan positive (Fig. 2). Compare with the positive control.

6.6. Check colonies subcultured on KBBCA medium for blue fluorescence, under UV light and/or for the typical morphology (Optional step; it can decrease the number of suspect colonies). There is a variation in the genus and some P. syringae pv. pisi produce a blue fluorescent pigment under UV light whereas others do not (Fig. 3). As both types of pathogen colonies may be present it is necessary to make a comparison with a positive control strain on the same media.

6.7. Identify suspect colonies subcultured on both media with an oxidase test (Optional step; it can decrease the number of suspect colonies). Use ready to use tests (e.g. Bactident Oxidase Merck, 1.13300.0001) or put a drop of 1% aqueous N, N-dimethyl paraphenylene diamine oxalate solution on a filter paper. Add quickly an oose of a suspect bacterial colony on the filter paper and make a bacterial emulsion. P. syringae pv. pisi colonies are oxidase negative (no cytochrome C oxidase): no red staining (Fig. 4). Compare to the positive control.


6.8. Record results for each subcultured colony. 6.9. All oxidase negative, typical fluorescent or non-fluorescent colonies on

KBBCA and all oxidase negative colonies that produce levane on SNAC are considered suspect colonies.

6.10. Confirm the identity of all the suspect colonies by a pathogenicity assay on pea seedlings of known susceptibility (CCP).

7. Pathogenicity assay (Option1) 7.1. Germinate seeds of a pea cultivar known to be susceptible to all races of P.

syringae pv. pisi (e.g. cv. Kelvedon wonder) in a wet blotter paper. Roll the paper with the seeds and place it in a plastic bag. Incubate the closed bag at room temperature (18oC-20oC) for 2-4 days to allow for seed germination. Make sure to germinate enough seeds for all the suspect colonies that will be tested.

7.2. Prepare a suspension in sterile demineralised water of 24-48 h suspect bacterial culture on KBBCA and SNAC and dilute to a concentration of 108 cfu/mL.

7.3. Repeat with a 24-48 h positive control culture to get a concentration of 108 cfu/mL (CCP).

7.4. Cut the root tips of 2 day-old germinated pea seeds and incubate 3 seeds in each bacterial suspension for 15 min.

7.5. Repeat with incubation of 3 pea seeds in sterile demineralised water to serve as negative control.

7.6. Remove seeds from bacterial suspension and sow them in a labelled potting substrate or equivalent. Incubate at 20°C (± 5oC) with 12 h light/12 h dark or 16 h light/8 h dark and 100% saturating humidity.

7.7. Examine seedlings for typical greasy lesions on stems and leaflets after 5-9 days (Fig. 5). Compare with positive and negative controls (CCP).

7.8. Record the suspect colonies as positive if greasy lesions are observed. 8. Pathogenicity assay (Option2)

8.1. Grow seedlings of a pea cultivar known to be susceptible to all races of P. syringae pv. pisi (e.g. cv. Kelvedon wonder) in small pots or container with potting soil at 20oC-25oC with sufficient light until 2 true leaf stage (approx. 8-10 days after sowing).

8.2. Prepare a suspension in sterile demineralised water of a 24-48 h suspect bacterial culture grown on KBBCA and SNAC and dilute to a concentration of 106 cfu/mL (CCP).

8.3. Repeat with a 24-48 h positive control culture to get a concentration of 106 cfu/mL (CCP).

8.4. Inject each bacterial suspension with a syringe and needle in the stem of at least 2 pea seedlings (2 seedlings per suspect colony).

8.5. Repeat injection with sterile demineralised water in the stem of 2 pea seedlings to serve as negative control.

8.6. Incubate the inoculated seedlings at 20oC (± 5oC) with saturating humidity. 8.7. Examine seedlings for extended greasy lesions from the point of inoculation

after 5-9 days. Compare with positive and negative controls (CCP). 8.8. Record the suspect colonies as positive if greasy lesions are observed.

Fig. 1. Plate of KBBCA medium after 4 days of incubation at 28°C (± 2°C) showing typical colonies of P. syringae pv. pisi.


Fig. 2. Plate of SNAC medium after 4 days of incubation at 28°C (± 2°C) showing typical colonies of P. syringae pv. pisi that are levan positive.

Fig. 3. Fluorescent and non-fluorescent P. syringae pv. pisi isolates under a UV light.

Fig. 4. Oxidase negative positive control isolate (A) and oxidase positive non P. syringae pv. pisi isolate (B).

Fig. 5. Typical greasy lesions on the stem of a pea seedling cv. Kelvedon, 9 days after inoculation following pathogenicity assay Option 1.

(A)

(B


General Methods (common to many test procedures) Preparation of ten-fold dilution series

Each dilution should be prepared by pipetting 0.5 mL (± 5%) from a well-mixed seed extract or previous dilution into a universal bottle (screw-capped) or similar container containing 4.5 mL (± 2%) of sterile diluent and then vortexing to mix prior to the next dilution step. A new sterile pipette tip should be used for each dilution step. Pipettes should be checked regularly for accuracy and precision and re-calibrated as necessary. It is acceptable to prepare ten-fold dilutions using other volumes provided that the laboratory can demonstrate that the required accuracy and precision can be achieved.

Plating of dilutions. This should be done as soon as possible after dilutions have been prepared and certainly within 30 min. Working from the highest (most dilute) dilution to the undiluted extract, 0.1 mL is pipetted onto the centre of a surface-dry, labelled agar plate. The liquid should then be spread evenly over the entire surface of the medium with a bent glass rod. If care is taken to work from the highest to the lowest dilution (or undiluted extract) a single pipette tip and a single bent glass rod can be used for each sample. Ensure that all liquid has been absorbed by the agar before inverting and incubating plates. If necessary allow plates to dry under a sterile air-flow in a microbiological safety cabinet or laminar flow hood.

Sectored Plates Using a laboratory marker pen draw lines on the base of a standard 9 cm plate (Petri dish) to divide it into six equal sectors. Subculture single colonies from dilution plates and make a single zigzagged streak within a single sector on the plate. Take care to leave sufficient space between each isolate to ensure the growth does not coalesce. Thus six suspect colonies can be subcultured to each sectored plate. Separate plates should be used for each sample/subsample. If the purity of subcultured isolates is doubtful, they should be further streaked out on whole plates.

Reporting Results The result of a seed health test should indicate the scientific name of the pathogen and the test method used. When reported on an ISTA Certificate, results are entered under Other Determinations. In the case of a negative result (pathogen not detected in any subsamples), the results should be reported in terms of the tolerance standard and detection limit. The tolerance standard depends on the total number of seeds tested, n, and is approximately 3/n (P=0.95) (see Roberts et al., 1993); the detection limit per subsample is equal to the detection limit per mL multiplied by the volume of extract. In the case of a positive result, the report should indicate the number of positive subsamples out of the total number tested and the sample size or the maximum likelihood estimate of the proportion of infested seeds.

Quality Assurance General A record should be kept of the date and results of pipette calibration checks. It is essential that operators have received appropriate training and use automatic pipettes correctly. Critical Control Points [Identified by CCP in the methods] Dilution plates prepared from positive control isolate(s) or reference material, should give single colonies with typical morphology (Step 5.1). The numbers of colonies on dilution plates prepared from the positive control isolate(s) or reference material should be similar on both media (Step 5.1). Numbers of bacteria on dilution plates should be consistent with the dilution (i.e. should decrease approx. tenfold with each dilution) (Step 5.1). There should be no growth on dilution plates prepared as a sterility check (Step 5.1). Due to the potential for non-pathogenic isolates to be present in seed lots together with pathogenic isolates, it is essential to subculture, if present, at least the minimum number of suspect colonies specified (two per subsample and per semi-selective medium) (Steps 6.1, 6.2) and to test all Pseudomonas-like subcultured isolates for pathogenicity (Step 6.10). In Pathogenicity Test Option 2, the bacterial suspension of suspect and positive control colonies must not have a concentration higher than 106 cfu/mL (Steps 8.2 and 8.3). If the concentration exceeds the 106 cfu/mL then the risk of not having typical


symptoms on seedlings increases and in this case the test will not be considered accurate. Positive control isolates (Steps 7.3 and 8.3) and inoculations with sterile demineralised water (Steps 7.5 and 8.5) should be included in every pathogenicity test. The positive control isolate should give typical symptoms (Steps 7.7 and 8.7) and the negative control should give no symptoms in the pathogenicity test. The activity units per gram of some antibiotics may vary between batches. It may be necessary to adjust the weight or volume added to ensure that the final number of units per litre of medium is consistent (KBBCA and SNAC media). References Elvira-Recuenco., M. and Taylor, J.D. (2001). Resistance to bacterial blight (Pseudomonas syringae pv. pisi) in Spanish pea (Pisum sativum) landraces. Euphytica 118, 305-311. Fraaije, B.A., Franken, A.A.J.M., van der Zouwen, P.S., Bino, R.J. and Langerak, C.J. (1993). Serological and conductimetric assays for the detection of Pseudomonas syringae pathovar pisi in pea seeds. Journal of Applied Microbiology 75, 409–415. Grondeau, C. (1992). La graisse bactérienne du pois proteagineux due à Pseudomonas syringae pv. pisi: identificaion, épidémiologie et méthodes de lutte. Thèse de l’Institut National Polytechnique de Toulouse, 146 pp. Grondeau, C., Saunier, M., Poutier, F. and Samson, R. (1992). Evaluation of physiological and serological profiles of Pseudomonas syringae pv. pisi for pea blight identification. Plant Pathology 41, 95–505. Grondeau, C., Olivier, V. and Samson, R. (1993). Détection de Pseudomonas syringae pv. pisi dans les semences de pois: Méthodes, limites et controverses. Phytoma 455, 45-47. Grondeau, C., Mabiala, A., Ait-Oumeziane., R. and Samson., R. (1996). Epiphytic life is the main characteristic of the life cycle of Pseudomonas syringae pv. pisi, pea bacterial blight agent. European Journal of Plant Pathology 102, 353-363. Hollaway, G. J. and Bretag T. W. (1997) Survival of Pseudomonas syringae pv. pisi in soil and on pea trash and their importance as a source of inoculum for a following field pea crop. Australian Journal of Experimental Agriculture 37, 369–375. Hollaway, G. J., Bretag, T. W. and Price, T. V. (2007). The epidemiology and management of bacterial blight (Pseudomonas syringae pv. pisi) of field pea (Pisum sativum) in Australia: a review. Australian Journal of Agricultural Research 58, 1086–1099. Lyons N.F. and Taylor J.D. (1990). Serological detection and identification of bacteria from plants by conjugated Staphylococcus aureus slide agglutination test. Plant Pathology 39, 584-590. Malandrin L. and Samson R. (1998). Isozyme analysis for the identification of Pseudomonas syringae pathovar pisi strains. Journal of Applied Microbiology 84: 895–902. Mohan, S.K. and Schaad, N.W. (1987). An improved agar plating assay for detecting Pseudomonas syringae pv. syringae and Pseudomonas syringae pv. phaseolicola in contaminated bean seeds. Phytopathology 77, 1390-1395. Roberts, S.J. (1992). Effect of soil moisture on the transmission of pea bacterial blight (Pseudomonas syringae pv. pisi) from seed to seedling. Plant Pathology 41, 136–140. Roberts, S.J., Ridout, M.S., Peach, L. and Brough, J. (1996). Transmission of pea bacterial blight (Pseudomonas syringae pv. pisi) from seed to seedling: effects of inoculum dose, inoculation method, temperature and soil moisture. Journal of Applied Microbiology 81, 65–72. Schaad, N.W. (1982). Detection of seedborne bacterial plant pathogens. Plant Disease 66, 885-890.

http://www.springerlink.com/content/?Author=M.+Elvira-Recuenco

http://www.springerlink.com/content/?Author=J.D.+Taylor

http://www.springerlink.com/content/w25465k011n16380/

http://www.springerlink.com/content/w25465k011n16380/

http://www.springerlink.com/content/?Author=Catherine+Grondeau

http://www.springerlink.com/content/?Author=Alexandre+Mabiala

http://www.springerlink.com/content/?Author=Rachid+Ait-Oumeziane

http://www.springerlink.com/content/?Author=R%c3%a9gine+Samson

http://www.springerlink.com/content/t614nr11l1557870/



http://www.springerlink.com/content/0929-1873/

http://www.springerlink.com/content/0929-1873/102/4/

http://onlinelibrary.wiley.com/doi/10.1111/ppa.1992.41.issue-2/issuetoc

http://onlinelibrary.wiley.com/doi/10.1111/jam.1996.81.issue-1/issuetoc


Preparation of sterile saline

Compound g/L Sodium chloride (NaCl) 8.5 Distilled/de-ionised water 1000 mL Preparation 1. Weigh out all ingredients into a suitable container. 2. Add 1000 mL of distilled/de-ionised water. 3. Dissolve and dispense into the final containers. 4. Autoclave at 121°C, 15 psi for 15 min.

Storage Provided containers are tightly closed, may be stored for several months before use.

Preparation of KBBCA medium

Compound g/L g/500 mL Proteose peptone (e.g.#3 Difco) 20.0 g 10.0 g Glycerol 10.0 g 5.0 g K2HPO4 1.5 g 0.75 g MgSO4 anhydrous 0.73 g 0.365 g H3BO3 1.5 g 0.75 g NaOH (1N) 2.0mL 1.0 mL Agar 15 g 7.5 g Distilled/de-ionised water 1000 mL 500 mL Cycloheximidea 100.0 mg 50.0 mg Cephalexin monohydrateb 40.0 mg 20.0 g a, b Added after autoclaving

Preparation

1. Weigh out all ingredients except the antibiotics into a suitable container. 2. Add 1000 mL (or 500 mL) of distilled/de-ionised water. 3. Stir to dissolve. 4. Autoclave at 121°C, 15 psi for 15 min. 5. Prepare the antibiotic solutions and filter sterilise as appropriate. 6. Allow the medium to cool to approximately 50°C before adding the antibiotic

solutions. 7. Mix the molten medium gently to avoid air bubbles and pour the plates (18

mL per 9.0 cm plate). 8. Leave the plates to dry in a laminar flow bench or similar before use.

Antibiotics (amounts for guidance only, CCP) a Dissolve 500 mg of cycloheximide in 10 mL 70% ethanol. Add 1 mL/L. b Dissolve 800 mg of cephalexin monohydrate in 10 mL 70% ethanol. Add 1 mL/L. (Filter sterilise when the antibiotics are dissolved in water rather than 70% ethanol) Note Nystatin could be used as an alternative for cycloheximide to control fungi. Dissolve 350 mg of nystatin in 10 mL 70% ethanol, add 1 mL to cool medium. Storage Store prepared plates inverted in polythene bags at 4-8°C and use within four weeks of preparation to ensure activity of antibiotics.


Preparation of SNAC medium Compound g/L g/ 500 mL Tryptone 5.0 g 2.5 g Peptone 3.0 g 1.5 g NaCl 5.0 g 2.5 g Sucrose 50.0 g 25 g H3BO3 10 mL (0.1g/mL) 5 mL Agar 15 g 7.5 g Distilled/de-ionised water 1000 mL 500 mL Cephalexin monohydratea 80.0 mg 40.0 mg Nystatinb 35.0 mg 17.5 mg

a, b Added after autoclaving Preparation

1. Weigh out all ingredients except the agar, antibiotics, skim milk powder and Tween 80 into a suitable container.

2. Add 1000 mL (or 500 mL) of distilled/de-ionised water. 3. Stir to dissolve. 4. Autoclave at 121°C, 15 psi for 15 min. 5. Prepare the antibiotic solutions. 6. Allow medium to cool to approximately 50°C and add the antibiotic

solutions. 7. Mix the molten medium gently to avoid air bubbles and pour the plates (18

mL per 9.0 cm plate). 8. Leave the plates to dry in a laminar flow bench or similar before use.

Antibiotics (amounts for guidance only, CCP) a Dissolve 800 mg of cephalexin monohydrate in 10 mL 70% ethanol. Add 1 mL/L. b Dissolve 350 mg of nystatin in 10 mL 70% ethanol. Add 1 mL/L. (Filter sterilise when antibiotics are dissolved in water rather than 70% ethanol) Storage Store prepared plates inverted in polythene bags at 8°C (± 2°C) and use within four weeks of preparation to ensure activity of antibiotics.




C.7.6. New seed health method 7-007: Detection of Alternaria linicola, Botrytis cinerea and Colletotrichum lini on Linum usitatissimum (Flax) seed New seed health method combining existing methods 7-007, 17 and 18. The old methods will be deleted and the new combined method numbered 7-007. This proposal is submitted by the Seed Health Committee, approved by vote and is supported by a validation study. Crop: Linum usitatissimum L. (flax, linseed)

Pathogens: Alternaria linicola J.W. Groves & Skolko, Botrytis cinerea Pers. (Teleomorph: Botryotinia fuckeliana (de Bary) Whetzel), and Colletotrichum lini (Westerd.) Tochinai, (= Colletotrichum linicola Pethybr. & Laff.)

Authors: V. Grimault1, I. Serandat1, C. Brochard1, R. Kohen2, S. Brière3 1GEVES-SNES rue Georges Morel- BP 90024--49071 BEAUCOUZE cedex, France. e-mail: [email protected] 2Official Seed Testing Laboratory; The Volcani Center A.R.O. Bet-Dagan 50520, Israël. e-mail: [email protected] 3Canadian Food Inspection Agency-3851 Fallowfield Road, Ottawa, Ontario, Canada. e-mail: [email protected]

Revision History: Replacement of methods 7-007, 7-017 and 7-018, Version November 2010. New version 2.0, 1 January 2014. Background Three ISTA methods (7-007, 7-017 and 7-018) were used to detect the three main pathogens of flax seeds, Botrytis cinerea, Alternaria linicola, Colletotrichum lini. The Seed Health Committee of ISTA decided to amalgamate these three methods in a simple one to detect the three pathogens. These three methods were compared and conditions which varied between these methods and also with the other ISTA existing ones were identified. A pretest was carried out in GEVES to compare the concentration of streptomycin, temperature, light and medium on four replicates of 100 seeds. All conditions tested allowed the detection of the three pathogens, and addition of streptomycin at 50 mg/L in the media allowed to avoid the development of bacteria and at the same time did not affect the detection of the three pathogens. A peer validation between the three participating laboratories was then carried out by comparing the five proposed conditions. Based on these results, a new method was proposed to detect the three pathogens of Linum with only one method. In this method, two media can be used: Potato Dextrose Agar or Malt Agar with streptomycin, seeds are incubated at 20°C, in darkness for 9 days and then under 12 h NUV/12 h dark to enhance sporulation if problem for pathogen identification occurs. The validation studies showed that this method allowed detection of Alternaria linicola, Botrytis cinerea, and Colletotrichum lini at a threshold of 1% with 100% specificity and a sensibility of 73, 77 and 100% for Botrytis cinerea, Colletotrichum lini and Alternaria linicola respectively. The comparative test has been organized by International Seed Testing Association Seed Health Committee.

Validation studies Grimault V., Serandat I., Brochard C., Kohen R., Brière S. (2010). Peer validation for detection of three fungal pathogens infecting Linum seeds by a single method. Grimault V., Serandat I., Brochard C. (2010). Validation study for the new proposed method to detect Botrytis cinerea, Alternaria linicola and Colletotrichum lini on Linum. Copies are available by e-mail from [email protected], or by mail from the ISTA Secretariat.






Safety Precautions Ensure you are familiar with hazard data and take appropriate safety precautions, especially during preparation of media, autoclaving and weighing out of ingredients. It is assumed that this procedure is being carried out in microbiological laboratory by persons familiar with the principles of Good Laboratory Practice, Good Microbiological Practice, and aseptic technique. Dispose of all waste materials in an appropriate way (e.g. autoclave, disinfect) and in accordance with local health, safety and environmental regulations.

Treated Seed This method has not been validated for the determination of Alternaria linicola, Botrytis cinerea and Colletotrichum lini on treated seed. Seed treatments may affect the performance of the method.

(Definition of treatment: any process, physical, biological or chemical, to which a seed lot is subjected, including seed coatings. See 7.2.3.).

Sample Size The sample (total number of seeds tested) or subsample size to be tested depends on the desired tolerance standard (maximum acceptable percentage of seeds infested) and detection limit (theoretical minimum number of pathogen propagules per seed which can be detected). In any case, the minimum sample size should be of 400 seeds. Materials Reference material: The use of reference cultures or other appropriate material is recommended. PDA or MA plates with streptomycin sulphate: 9.0 cm Petri dishes (one per 10 seeds) Incubator: capable of operating at 20 ± 2°C, equipped with timer-controlled near ultraviolet light (NUV, peak at 360 nm). Sample Preparation The test is carried out on a working sample as described in Section 7.4.1 of the International Rules for Seed Testing.

Method 1. Plating Aseptically place a maximum of 10 seeds per plate, evenly spaced, onto the agar surface of each PDA or MA plate. 2. Incubation Incubate plates for 9 days at 20°C in the dark. 3. Reference material Subculture a reference culture to a PDA or MA plate at the same time the seeds are plated and incubate with the test plates. 4. Examination After 9 days of incubation, examine plates for Alternaria linicola, Botrytis cinerea and Colletotrichum lini. Record the number of infected seeds in each plate, for each pathogen. 5. Prolongation of incubation If no sporulation is observed at 9 days, extend incubation at 20°C with alternating 12 h periods of darkness and NUV to obtain spores until 14 days after plating. Examine plates for Alternaria linicola, Botrytis cinerea and Colletotrichum lini. Record the number of infected seeds in each plate, for each pathogen. Identification criteria Alternaria linicola: Examine plates for dense olive grey colonies, 1.5-3 cm diameter. Some colonies of saprophytic Alternaria spp. can resemble those of A. linicola but the conidia of A.


linicola are diagnostic (Fig. 1). Colonies should therefore be examined under x50 – x100 magnification. Conidiophores are simple, occurring singly or in bundles, pale olivebrown, septate, and variable in length 5-8 μm. Conidia form singly, are smooth walled, olive-brown, obclavate with long, tapering occasionally branched beaks muriform 4-16 μm with transverse septa and occasionally 1-4 longitudinal septa, sometimes slightly constricted at the septa (Corlett and Corlett 1999; David 1991; Malone and Muskett 1997). Short red streaks and water soaked areas may be visible on the hypocotyls and cotyledons of some infected seedlings (Fig. 2).

Fig. 1. Olive-grey colonies of A. linicola and darker colonies of saprophytic A. alternata on malt agar.

Fig. 2. Reddish streaks on cotyledons and hypocotyls (arrows) caused by Alternaria


linicola (right) and conidia of A. linicola x600 (left). Botrytis cinerea: Examine for roots showing a soft rot and covered by abundant grey mycelium (Fig. 3) or just mycelium very flat, diffuse and not aerial, possibility of sclerotia producing (Fig. 4). Colonies on agar measure up to 5 cm in diameter after 5 days. Identification can be checked by high-power microscope (magnification x200). Mycelium of tape-like hyphae producing bunches of branching conidiophores with ovoid-hyaline one-celled conidia 8–11 × 6–19 μm (Fig. 5). When analysts are familiar with the fungus, naked eye examination is sufficient for identification (Muskett and Malone 1941; Tempe 1963; Malone and Muskett 1997; Ellis and Waller 1974).

Fig. 3. Seedling showing a soft rot (arrow) and abundant sporulated grey mycelium.


Fig. 4. Colonies of Botrytis cinerea spreading from diseased flax seed on malt agar after 9 days of incubation. Sclerotia are visible (right).

Fig. 5. Conidiophores and conidia of Botrytis cinerea and tapelike mycelium. x150.

Colletotrichum lini: C. lini is easily recognised by visual examination. Examine the plates for shell pink to


salmon coloured colonies (Fig. 6). Colonies of C. lini are a fine wooly-grey at the centre to salmon pink at the outer edge. Dark globose fuiting bodies (acervuli) may be scattered throughout the agar adjacent to the seed (Fig. 7). Characteristic long, black tapering hairs or setae 2-5 septate, 60-120 x 2-4 μm arise from the base of each acervulus. Bright orange conidial masses appear on the seed and agar adjacent to the seed. Conidia are hyaline; oblong to dumbell shaped, one celled, straight ends 9-15 x 3-4 μm (Malone and Muskett 1997; Kulshrestha et al., 1976). Record the number of infected seeds in each plate.

Fig. 6. Salmon colored colonies of Colletotrichum lini growing from flax seed on malt agar.


Fig. 7. Acervuli of Colletotrichum lini. on flax seedling

General Methods (common to many test procedures) 1. Checking tolerances

Tolerances provide a means of assessing whether or not the variation in results within or between tests are sufficiently wide as to raise doubts about the accuracy of the results. Suitable tolerances, which can be applied to most direct seed health tests, can be found in Tables 5B of Chapter 5 of the ISTA Rules, or in the Handbook of Tolerances and Measures of Precision for Seed Testing by S.R. Miles (Proceedings of the International Seed Testing Association 28 (1963) No3, p 644).

2. Reporting results The result of a seed health test should indicate the scientific name of the pathogen detected and the test method used. When reported on an ISTA International Seed Analysis Certificate, results are entered under Other Determinations. In the case of a negative result (pathogen not detected), the results should be reported in terms of the tolerance standard (for example infection level less than 1% with 95% probability). The tolerance standard depends on the total number of seeds tested, n, and is approximately 3/n (P=0.95) (see Roberts et al., 1993). In the case of a positive result, the report should indicate percentage of infected seeds.

Quality Assurance Specific Training This test should only be performed by persons who have been trained in fungal identification or under the direct supervision of someone who has. Critical Control Points [identified in the methods by “CCP”]. Preparation of PDA or MA plates: the source of agar may influence the results. The level of available nutrients may vary from manufacturer to manufacturer. Both PDA and MA can be bought as a powdered medium, or MA can be made up as per recipe. Suitable products used in the comparative test include PDA, Cristomalt, agar-agar and streptomycin. Any equivalent products should be suitable. Whenever a new batch of agar is used, a check on the quality should be made, using a reference lot with a known infection level, or a reference isolate and sustainability of isolate measured. Pay particular attention to the growth characteristics of reference isolates. Preparation of PDA + streptomycin

PDA (CCP i.e. Difco or equivalent): 39 g Distilled/de-ionized water: 1000 mL


Streptomycin sulphate*: 50 mg *added after autoclaving Preparation

1. Weigh out ingredients into a suitable autoclavable container. 2. Add 1000 mL of distilled/de-ionized water. 3. Dissolve powdered PDA in the water by stirring. 4. Autoclave at 121°C and 15 p.s.i. for 20 min. 5. Allow the agar to cool to approximately 50°C and add streptomycin sulphate dissolved in sterile distilled water. 6. Pour 18-20 mL of the molten agar into 9.0 cm Petri dishes and allow to solidify before use.

Streptomycin sulphate Streptomycin sulphate can be dissolved in sterile distilled water. Storage Prepared plates may be stored at 4°C for up to 6 weeks. Preparation of MA + streptomycin

Agar-agar: 20 g Malt: 10 g Distilled/de-ionized water: 1000 mL Streptomycin sulphate*: 50 mg *added after autoclaving If using a commercial preparation ensure that it contains 2% agar and 1% malt extract. Preparation

1. Weigh out ingredients into a suitable autoclavable container. 2. Add 1000 mL of distilled/de-ionized water. 3. Dissolve in the water by stirring. 4. Autoclave at 121°C and 15 p.s.i. for 20 min. 5. Allow the agar to cool to approximately 50°C and add streptomycin

sulphate dissolved in sterile distilled water. 6. Pour 18-20 mL of the molten agar into 9.0 cm Petri dishes and allow to

solidify before use. Streptomycin sulphate Streptomycin sulphate can be dissolved in sterile distilled water. Storage Prepared plates may be stored at 4°C for up to 6 weeks. References Anselme, C. and Champion, R. International Seed Testing Association (2012).

International rules for Seed Testing, annexe to Chapter 7 Seed Health Testing Methods, 7-007 - Linum usitatissimum; Botrytis cinerea, p.1-7.

Champion, R. (1997). Identifier les champignons transmis par les semences. INRA Editions, Paris, 398p.

Corlett, M. and Corlett, M. (1999). Fungi Canadensis No 341 Alternaria linicola. Canadian Journal of Plant Pathology 21, 55-57.

David, J.C. (1991). CMI Descriptions of Fungi and Bacteria No. 1075 Alternaria linicola. Mycopathologia 116, 53-54.

Ellis, M.B. and Waller J.M. (1974). C.M.I. Descriptions of pathogenic fungi and bacteria No. 431. Commonwealth Mycological Institute, Kew.

Kulshrestha, D.D., Mathur, S.B. and Neergaard, P. (1976). Identification of seed-borne species of Colletotrichum. Friesia 11, 116-125.

Malone, J.P. and Muskett, A.E. (1997). Seed-borne fungi. Description of 77 fungus species. Sheppard, J.W. (Ed.), 19-20. International Seed Testing Association, Zurich, Switzerland.

Miles, S.R. (1963). Handbook of Tolerances and Measures of Precision for Seed Testing. Proceedings of the International Seed Testing Association 28 (3).

Muskett, A.E. and Malone, J.P. (1941). The Ulster method for the examination of flax

https://www.seedtest.org/upload/cms/user/7-007.pdf


seed for the presence of seed-borne parasites. Annals of Applied Biology 28, 8-13.

Roberts, S.J., Phelps, K., Taylor, J.D. and Ridout, M.S. (1993). Design and interpretation of seed health assays. In: Sheppard, J.W., (Ed.) Proceedings of the First ISTA Plant Disease Committee Symposium on Seed Health Testing, Ottawa, Canada. pp. 115-125. Agriculture Canada, Ottawa, Canada.

Sheppard, J.W. International Seed Testing Association. (2012). International rules for Seed Testing, annexe to Chapter 7 Seed Health Testing Methods, 7-017 - Linum usitatissimum; Alternaria linicola, p.1-6.

Sheppard, J.W. International Seed Testing Association. (2012). International rules for Seed Testing, annexe to Chapter 7 Seed Health Testing Methods, 7-018 - Linum usitatissimum; Colletotrichum lini, p.1-6.

Tempe J. de (1963). Health testing of flax seed. Proceedings of the International Seed Testing Association28, 107-131.

Source of photographs Figures 1 and 2: International Seed Testing Association. (2012).International Rules for Seed testing, annexe to Chapter 7 Seed Health Testing Methods, 7-017- Linum usitatissimum, Alternaria linicola, p. 1-6. Figures 3 and 4: GEVES-SNES, rue Georges Morel- BP 90024--49071 BEAUCOUZE cedex, France. Figure 5: International Seed Testing Association. (2012). International Rules for Seed testing, annexe to Chapter 7 Seed Health Testing Methods, 7-007- Linum usitatissimum, Botrytis cinerea, p. 1-7. Figure 6 (left): International Seed Testing Association. (2012). International Rules for Seed Testing, annexe to Chapter 7 Seed Health Testing Methods, 7-018- Linum usitatissimum, Colletotrichum lini, p. 1-6. Figures 6 (right) and 7: GEVES-SNES, rue Georges Morel- BP 90024--49071 BEAUCOUZE cedex, France.








Chapter 8: Species and Variety Testing C.8.1. Editorial and Committee review of the whole of Chapter 8. Chapter 8 has been reviewed to make sure the Chapter is up to date. In addition editorial changes have been made to reflect the new Chapter 19 proposed on GMO testing. Note: if the vote on Chapter 19 results in any text modifications the following text for Chapter 8 may need to be editorially modified by the Rules Chair and Vice-Chair before publishing as the 2014 edition of the ISTA Rules. This proposal is submitted by the Variety Committee and approved by vote. CURRENT VERSION PROPOSED VERSION

Chapter 8: Species and Variety Testing 8.1 Objects

Chapter 8: Species and Variety Testing 8.1 Object

8.1.1 Verification of species and variety The object is to determine the extent that the submitted sample conforms to the species or variety as requested by the applicant, using methods not permissible in a purity test according to Chapter 3.

The object of species and variety verification is to determine the extent that the submitted sample conforms to the species or variety as requested by the applicant, using methods not permissible in a purity test according to Chapter 3.

8.1.2 Testing for the presence of specified traits The object is to test for the presence of traits in the submitted sample as specified by the applicant (for examples see 8.2.2) using methods not permissible in a purity test according to Chapter 3.

8.2 Definitions 8.2.1 Authentic standard sample An authentic standard sample is a valid seed sample of species or variety identity or a valid sample with presence of the specified traits.

8.2 Definitions 8.2.1 Authentic standard sample An authentic standard sample is a seed sample of a known species or variety or a sample with a known specific trait. It is recommended that this sample is of a known origin, e.g. a certified reference sample or a sample taken by an official or another person who can ensure vouch for the sample identity and characteristics. This sample will be used for obtaining enzymatic, protein or DNA profiles.



8.2.2 Standard reference A standard reference is a valid descriptive attribute of a species or variety, e.g. zygosity; isozyme, protein or DNA banding pattern produced by gel electrophoresis or similar techniques; allelic profile or nucleotide sequence.

8.2.2 Standard reference A standard reference is a valid descriptive attribute of a species or variety, e.g. zygosity, or an isozyme, protein or DNA banding pattern produced by gel electrophoresis or similar techniques, or an allelic profile or nucleotide sequence or a molecular weight standard (MWS) for protein or DNA. This descriptive attribute trait should be obtained by a n in-house validated or internationally validated methodology and should be from an authentic standard sample or obtained from a reliable source as for MWS.

8.2.3 Performance approved methods Performance approved methods are evaluated, approved and implemented by the testing laboratory according to the principles of the performance based approach as laid down in the ISTA document Principles and Conditions for Laboratory Accreditation under the performance based approach. They are restricted to bio-molecular tests and bioassays for the object of testing for the presence of specified traits. Performance approved methods can only be applied when no standardised method is included in this chapter for the test required.

8.2.3 Performance approved methods Performance approved methods are evaluated, approved and implemented by the testing laboratory according to the principles of the performance based approach as laid down in the ISTA document Principles and Conditions for Laboratory Accreditation under the performance based approach.

8.3 General principles 8.3.1 Field of application 8.3.1.1 Verification of species and variety The determination is valid only if the species or variety is stated by the applicant, …

8.3 General principles 8.3.1 Field of application

The determination of a species or variety is valid only if the species or variety is stated by the applicant, ….

8.3.1.2 Testing for the presence of specified traits

(Deletion of section).

8.3.2 Testing principles The determination is carried out, depending on the species or variety or specified trait in question, on seeds, seedlings or more mature plants grown in a laboratory, a glasshouse, a growth chamber or a field plot.

8.3.2 Testing principles The determination is carried out, depending on the species or variety in question, on seeds, seedlings or more mature plants grown in a laboratory, a glasshouse, a growth chamber or a field plot.



When an authentic standard sample is available, the working sample is compared with the authentic standard sample. Whenever possible, the working sample and the authentic standard sample shall be handled in the same way, e.g. in field plots they shall be grown contemporaneously, near-by and in identical environmental conditions, and the evaluation shall be done at the same stage of development.

When an authentic standard sample is available, the working sample is compared with the authentic standard sample. Whenever possible, the working sample and the authentic standard sample must be handled in the same way, e.g. in field plots they must be grown contemporaneously, near each other and in identical environmental conditions, and the evaluation must be done at the same stage of development.

When a standard reference is available, the test is done by comparing the traits of the seeds, seedlings or plants of the working sample with the standard reference.

When a standard reference is used in a test, the interpretation of the result is done by comparing the traits descriptive attributes of the seeds, seedlings or plants of the working sample with the standard reference.

In the case of species or variety …

8.3.2.1 Principles for verification of species and variety

In the case of species or variety …

8.3.2.2 Principles for testing for the presence of specified traits (Deletion of section)

8.4 Personnel and equipment The determination shall be made by a specialist familiar with the morphological, physiological, biomolecular or other trait of seeds. …

8.4 Personnel and equipment Determinations must be made by a specialist familiar with the morphological, physiological, biomolecular or other traits of seeds. ….

Appropriate facilities and equipment must be available as specified in detail in 8.8 for testing the specified trait, and in general as follows: In the laboratory: … In glasshouses and growth chambers: …

Appropriate facilities and equipment must be available as specified in detail in 8.8 for testing species and variety as follows: In the laboratory: … In glasshouses and growth chambers: …

In field plots: climatic, soil and cultural conditions to permit normal development of the trait and sufficient protection against pests and diseases.

In field plots: climatic, soil and cultural conditions to permit normal development of the trait to be tested and sufficient protection against pests and diseases.

8.5 Procedures 8.5.1 Submitted sample … §2 Guiding values for the size of the submitted sample for tests covered by this chapter are as follows:

8.5 Procedures 8.5.1 Submitted sample … §2 The guiding values for the size of the submitted sample for tests covered by this chapter are as follows:

… (Table unchanged) … (Table unchanged)

Depending on the method and the degree of precision required, more seeds or less seeds than the amount listed above may be necessary.

Depending on the method and the degree of precision required, more seeds or fewer seeds than the amount listed above may be necessary.



8.5.2 Working sample §1… Preparation of the working sample and the replicates shall be done according to procedures described under 2.5.2.

8.5.2 Working sample §1 … Preparation of the working sample and the replicates must be done according to the procedures described under 2.5.2.

8.5.2.1 Working samples for testing for the presence of specified traits (Deletion of section)

8.5.3 Examination of seeds … §2 For testing chemical traits, the seeds shall be treated with the appropriate reagent, and the reaction of each seed noted.

…

8.5.3 Examination of seeds … §2 For testing chemical traits, the seeds be treated with the appropriate reagent, and the reaction of each seed must be noted.

…

8.5.6 Examination of plants in field plots §1 Each working sample shall be sown in at least two replicate plots. …

8.5.6 Examination of plants in field plots §1 When plants are tested in field plots, each working sample must be sown in at least two replicate plots. ….

§2 Observations shall be made during the whole growing period, but particularly at times indicated in 8.10. …

§2 Observations must be made during the whole growing period, but particularly at the times indicated in 8.10. …

8.6 Calculation and expression of results The calculation and expression of results depends on the object, the method used, the testing plan and whether a qualitative or quantitative result or a confidence probability for meeting a threshold is requested by the applicant. …

8.6 Calculation and expression of results The calculation and expression of results depends on the object, the method used, the testing plan and whether a qualitative or quantitative result is requested by the applicant. …

In the case of testing for the presence of specified traits the result shall be expressed as agreed with the applicant by: either reporting whether the trait is present or not, or calculating and expressing the proportion of the trait, or calculating and expressing the confidence probability that the true proportion of the trait meets or exceeds a specification on the basis of the test result.

8.6.1 Examination of individual seeds, seedlings or plants

8.6.1 Examination of individual seeds, seedlings or plants

§3… If the applicant requested a reporting in a different way, it shall be given in addition.

…

§3… If the applicant requests reporting in a different way, it must be in addition to the above..

…



8.6.2 Tests for traits of bulk samples Tests may be done by measuring traits of a bulk sample that do not allow a reference to individual seeds, seedlings or plants. There are various different principles for calculation and expression of test results of such measurements. The result shall be expressed as agreed with the applicant.

8.6.2 Tests for traits of bulk samples For bulk samples, tests may be done by measuring traits that do not allow a reference to individual seeds, seedlings or plants. There are various principles for calculation and expression of test results of such measurements. The result must be expressed as agreed with the applicant.

8.6.3 Calculation of the confidence probability that the seed lot meets or exceeds a specification (Deletion of section)

8.7 Reporting results The results must be reported under ‘Other determinations’, …

8.7 Reporting results Results must be reported under ‘Other determinations’, …

8.7.1 Reporting results of verification of species and variety 8.7.1.1 Results of examination of individual seeds or seedlings Suggested phrases for reporting divergent seeds or seedlings, depending upon the result are as follows: …

8.7.1 Reporting results of verification of species and variety 8.7.1.1 Examination of individual seeds or seedlings Suggested phrases for reporting divergent seeds or seedlings are as follows, depending upon the result: …

8.7.1.2 Results of a field plot examination The results must, whenever possible, be reported as a percentage of each other species, other variety or aberrant found. …

8.7.1.2 Field plot examinations The results of a field plot examination must, whenever possible, be reported as a percentage of each other species, other variety or aberrant found. …

8.7.2 Reporting test results of presence of specified traits (Deletion of section)

8.8 Standardized methods for examination of seeds 8.8.1 Cereals Morphological characters of grain can be observed by direct visual examination or with suitable magnification.

In Hordeum, the most useful characters are shape of grain, base of lemma, colour, ventral crease hairs, opening of ventral crease, rachilla hairs, dentation of lateral dorsal nerves, wrinkling of lemma and palea, shape and hairiness of lodicules.

In Avena a useful character is grain colour, which may be white, yellow grey or black.

…

8.8 Standardized methods 8.8.1 Cereals Morphological characters of cereal grains can be observed by direct visual examination or with suitable magnification.

In Hordeum, the most useful characters are shape of the grain, base of the lemma, colour, hairs in the ventral crease, opening of the ventral crease, rachilla hairs, dentation of the lateral dorsal nerves, wrinkling of the lemma and palea, and shape and hairiness of the lodicules.

In Avena a useful character is grain colour, which may be white, yellowish grey or black.

…



8.8.2 Fabaceae (Leguminosae) and Poaceae (Graminae) … In Lupinus spp., presence or absence of alkaloids is a diagnostic feature. Soak the seeds singly in water (2.5–5.0 ml each seed) for at least 2 h in transparent dishes or other suitable equipment. Scarify or pierce each seed with an appropriate tool (scalpel, needle, pliers) to remove hardseededness and to allow a release of alkaloids into the soaking water. Soak the seeds for a further 5–24 h in water. Add 1–3 drops of freshly prepared 1% Lugol’s solution (1.0 g iodine + 2.0 g potassium iodide, made up with water to 100 ml) to each seed. A distinct brown-red precipitate indicates presence of alkaloids. Cases of doubt can be solved easily by adding further drops of the Lugol’s solution. Evaluation can be done on either a white surface or a luminescent screen.

8.8.2 Fabaceae (Leguminosae) and Poaceae (Graminae) … In Lupinus spp., the presence or absence of alkaloids is a diagnostic feature. Soak the seeds singly in water (2.5–5.0 mL for each seed) for at least 2 h in transparent dishes or other suitable equipment. Scarify or pierce each seed with an appropriate tool (scalpel, needle, pliers) to remove hardseededness and to allow a release of alkaloids into the water. Soak the seeds for a further 5–24 h. Add 1–3 drops of freshly prepared 1% Lugol’s solution (1.0 g iodine + 2.0 g potassium iodide, made up with water to 100 mL) to each seed. A distinct brown-red precipitate indicates the presence of alkaloids. Doubtful cases can be easily resolved by adding further drops of the Lugol’s solution. Evaluation can be done on either a white surface or a luminescent screen.

8.8.3 Standard reference method for the verification of varieties of Triticum and Hordeum by Polyacrylamide Gel Electrophoresis (PAGE)

8.8.3 Hordeum (barley)

8.8.3.1 Principle The alcohol-soluble proteins (gliadins from Triticum, hordeins from Hordeum) are extracted from the seeds and separated by PAGE at pH 3.2. …

8.8.3.1 Principle The standard reference method for verifying varieties of Hordeum is by polyacrylamide gel electrophoresis (PAGE). The alcohol-soluble proteins (hordeins) are extracted from the seeds and separated by PAGE at pH 3.2…..

8.8.3.2 Apparatus and equipment 8.8.3.2.1 Apparatus The Pharmacia GE-2/4 electrophoresis apparatus and EPS 400/500 power supply have been successfully used, but any suitable vertical electrophoresis system should give comparable results.

8.8.3.2 Apparatus and equipment 8.8.3.2.1 Apparatus Any suitable vertical electrophoresis apparatus with a cooling system and power supply may be used.

8.8.3.3 Procedure 8.8.3.3.1 Extraction

8.8.3.3 Procedure 8.8.3.3.1 Protein extraction

…

To make 100 ml of gel medium, stock gel buffer (approx. 60 ml) is taken and acrylamide (10 g), bisacrylamide (0.4 g), urea (6 g), ascorbic acid (0.1 g), ferrous sulphate (0.005 g). The solution is stirred and made up to 100 ml with stock gel buffer solution. Freshly prepared 0.6% hydrogen peroxide solution (0.35 ml per 100 ml of gel medium) is added mixed quickly, and the gel poured.

…

To make 100 mL of gel medium, stock gel buffer (approx. 60 mL) is taken and acrylamide (10 g), bisacrylamide (0.4 g), urea (6 g), ascorbic acid (0.1 g), ferrous sulphate (0.005 g) are added. The solution is stirred and made up to 100 mL with stock gel buffer solution. Freshly prepared 0.6% hydrogen peroxide solution (0.35 mL per 100 mL of gel medium) is added and mixed quickly, and the gel poured.



8.8.4 Standard reference method for the verification of varieties of Pisum and Lolium by Polyacrylamide Gel Electrophoresis (PAGE)

8.8.4 Pisum and Lolium

8.8.4.1 Principle Seed proteins are extracted from individual Pisum seeds or from a meal of Lolium seeds of meals, treated with SDS and separated using a discontinuous SDS-PAGE procedure. …

8.8.4.1 Principle The standard reference method for the verifying varieties of Pisum and Lolium is by polyacrylamide gel electrophoresis (PAGE). Seed proteins are extracted from individual Pisum seeds or from a meal of Lolium seeds, treated with SDS and separated using a discontinuous SDS-PAGE procedure….

… If a comparison is being made with a standard value, sequential testing using batches of 50 seeds can be undertaken in order to minimize the workload. …

… If a comparison is made with a standard value, sequential testing using batches of 50 seeds can be undertaken in order to minimize the workload. …

8.8.4.2 Apparatus and equipment 8.8.4.2.1 Apparatus Any suitable vertical electrophoresis apparatus may be used (e.g. Pharmacia GE 2/4, Bio-rad ‘Protean’). It is recommended that a gel thickness of no more than 1.5 mm is used.


8.8.4.3 Procedure 8.8.4.3.1 Pisum … Diluted sample extraction buffer is prepared by diluting the stock sample extraction buffer (section 8.8.4.2.3e) in the following ratio 17 buffer : 3 mercaptoethanol : 40 distilled water (make up a volume of the diluted extractant sufficient to be used within a day).

8.8.4.3 Procedure 8.8.4.3.1 Pisum …. Diluted sample extraction buffer is prepared by diluting the stock sample extraction buffer (section 8.8.4.2.3e) in the ratio 17 buffer : 3 mercaptoethanol : 40 distilled water (make up only a volume of the diluted extractant sufficient to be used within a day).

8.8.4.3.2 Lolium … Diluted extraction buffer is prepared by diluting the stock sample extraction buffer (see 8.8.4.2.3e) in the following ratio 17 buffer : 6 mercaptoethanol : 10 dimethylformamide : 17 distilled water (Note: make only a volume of this extractant sufficient to be used within a day).

8.8.4.3.2 Lolium …. Diluted extraction buffer is prepared by diluting the stock sample extraction buffer (see 8.8.4.2.3e) in the ratio 17 buffer : 6 mercaptoethanol : 10 dimethylformamide : 17 distilled water (make up only a volume of this extractant sufficient to be used within a day).

8.8.4.3.3 Gel preparation … Note that if de-gassing of the gel mixture is a problem, it is possible to eliminate this step and use a 3-times higher concentration of APS (i.e. 3.75 ml of a 3% solution [0.3 g dissolved in 10 ml of distilled water]).

8.8.4.3.3 Gel preparation … Note that if de-gassing of the gel mixture is a problem, it is possible to eliminate this step and use a three times higher concentration of APS (i.e. 3.75 mL of a 3% solution [0.3 g dissolved in 10 mL of distilled water]).



8.8.4.3.3.2 Stacking gel … Again, de-gassing can be omitted if a higher concentration of APS is used. It is recommended that 3.0 ml of a 2% solution (0.2 g in 10 ml of distilled water) should be sufficient.

As an alternative polymerization system for the stacking gel, it is possible to use 0.008% riboflavin solution (freshly prepared), in place of APS. Polymerization should occur if the gels are left in the light, but it may be necessary to use a UV lamp. …

8.8.4.3.3.2 Stacking gel … Again, de-gassing can be omitted if a higher concentration of APS is used. A 3.0 mL of a 2% solution (0.2 g in 10 mL of distilled water) is sufficient.

As an alternative polymerization system for the stacking gel, it is possible to use a 0.008% riboflavin solution (freshly prepared), in place of APS. Polymerization should occur if the gels are left in the light, but it may be necessary to use an ultraviolet lamp. ….

8.8.4.3.4 Electrophoresis The electrophoresis tank buffer (or running buffer) comprises 3.0 g tris, 14.1 g glycine 1.0 g SDS made up to 1 l with distilled water (it may be necessary to warm the solution gently to dissolve the SDS). …

8.8.4.3.4 Electrophoresis The electrophoresis tank buffer (or running buffer) comprises 3.0 g tris, 14.1 g glycine and 1.0 g SDS made up to 1 L with distilled water (it may be necessary to warm the solution gently to dissolve the SDS). …

…The gel is placed in the tank and electrophoresis carried out at 25 mA per gel until the tracking dye has migrated through the stacking gel, and then at 45 mA per gel until the bromophenol blue is at the bottom of the gel….

…The gel is placed in the tank. Electrophoresis is carried out at 25 mA per gel until the tracking dye has migrated through the stacking gel, and then at 45 mA per gel until the bromophenol blue is at the bottom of the gel….

8.8.4.4 Evaluation of results The methods are mostly used in a comparative way i.e.: is the protein pattern of the sample identical to that of the authentic reference variety? …

8.8.4.4 Evaluation of results This method is mostly used in comparatively, i.e.: is the protein pattern of the sample identical to that of the authentic reference variety? …

8.8.5 Standard reference method for the measurement of hybrid purity and for the verification of varieties of Zea mays (maize)by by Ultrathin-layer Isoelectric Focusing (UTLIEF)

8.8.5 Zea mays (maize)

8.8.5.1 Principle The alcohol-soluble proteins (zeins) or water soluble proteins are extracted from individual maize seeds and separated by (IEF) in ultrathin-layer gels. …

8.8.5.1 Principle The standard reference method for the measuring hybrid purity and verifying varieties of Zea mays (maize) is by ultrathin-layer isoelectric focusing (UTLIEF). The alcohol-soluble proteins (zeins) or water soluble proteins are extracted from individual maize seeds and separated by isoelectric focusing (IEF) in ultrathin-layer gels. …

8.8.5.2 Apparatus and Equipment 8.8.5.2.1 Apparatus Any suitable horizontal electrophoresis apparatus with a cooling system (e.g. ‘Desaphor HF’, Desaga) and high voltage power supply (e.g. ‘Multidrive XL’, Pharmacia) may be used.

8.8.5.2 Apparatus and equipment 8.8.5.2.1 Apparatus Any suitable horizontal electrophoresis apparatus with a cooling system and high voltage power supply may be used.



8.8.5.3.1 Protein extraction …. Approximately 50 mg of the seed meal is extracted with 0.2 ml of extraction solution (8.8.5.2.3a) in a micro-titreplate plate or a microcentrifuge tube. The samples are left for about 1 h at 20 °C. After this time, the titreplate or microtube is treated with ultrasound for 30 seconds and then centrifuged at 2000 × g for 5 minutes. …

8.8.5.3.1 Protein extraction … Approximately 50 mg of the seed meal is extracted with 0.2 mL of extraction solution (8.8.5.2.3a) in a microtitre plate or a microcentrifuge tube. The samples are left for about 1 h at 20 °C. After this time, the microtitre plate or microtube is treated with ultrasound for 30 s and then centrifuged at 2000 × g for 5 min. …

8.8.5.3.2 Gel preparation …. The plates/sheets must be treated before use, …

8.8.5.3.2 Gel preparation …The plates or sheets must be treated before use, …

A gel thickness of 0.12 mm is recommended, which can be achieved by the use of tesafilm (or parafilm or defined thickness adhesive tape ) as a spacer.

A gel thickness of 0.12 mm is recommended, which can be achieved by the use of a defined thickness of adhesive tape as a spacer.

… For polymerization, APS (20% (w/v) solution freshly prepared) 0.35 mL

TEMED (full strength) 0.05 mL

are added carefully, to avoid introducing excessive amounts of air.

… For polymerization, 0.35 mL APS (20% (w/v) solution freshly prepared) and 0.05 mL TEMED (full strength) are added carefully, to avoid introducing excessive amounts of air.

…This will be sufficient for 10 gels of dimensions 240 × 180 × 0.12 mm. …

…This will be sufficient for 10 gels of the dimensions 240 × 180 × 0.12 mm. …

8.8.5.3.3 Electrophoresis … Samples (approx. 22 μl) are loaded in the applicator strip 0.5 cm below the bufferwick of the anode and focusing carried out at 2500 V, 15 mA, 40 W for about 1750 volt/hours (70 minutes) until completion (for one gel).

8.8.5.3.3 Electrophoresis … Samples (approx. 22 μL) are loaded in the applicator strip 0.5 cm below the bufferwick of the anode and focusing carried out at 2500 V, 15 mA, 40 W for about 70 min until completion (for one gel).

Notes: …

b) The precise conditions and times required for focusing will vary according to the dimensions of the gel, and the type of maize hybrid, inbred line etc., and may need to be determined empirically.

Notes: … b) The precise conditions and times required for focusing will vary depending on the dimensions of the gel, the type of maize hybrid, inbred line etc., and may need to be determined empirically.

8.8.5.4 Evaluation of results … …. Comparing the protein patterns of the female and male parents with the hybrid, one or more marker bands (present in the male only) need to be found in the hybrid (8.8.5.5, figure 1). … Seeds with a different pattern may also arise due to contamination with another variety.

8.8.5.4 Evaluation of results … …. When comparing the protein patterns of the female and male parents with the hybrid, one or more marker bands (present in the male only) need to be found in the hybrid (8.8.5.5, Figure 8.1). …. Seeds with a different pattern may also occur if there is contamination with another variety.



… figure 2 … … figure 3 … … figure 4 …

… Figure 8.2 … … Figure 8.3 … … Figure 8.4 …

…Normally it is suggested that 200 single seeds are analysed, as a compromise between precision of results and working time needed (see Chapter 4 in the, ISTA ‘Handbook of Variety Testing – Electrophoresis Testing’, 1992). ….

…. It is suggested that normally 200 single seeds are analysed, as a compromise between precision of results and working time needed (see Chapter 4, ISTA ‘Handbook of Variety Testing – Electrophoresis Testing’, 1992). …

8.8.6 Standard reference method for the verification of varieties of Avena sativa by Polyacrylamide Gel Electrophoresis (PAGE) 8.8.6.1 Principle The urea/ethylene glycol-soluble proteins …

8.8.6 Avena sativa (oats) 8.8.6.1 Principle The standard reference method for verifying varieties of Avena sativa (oat) is by polyacrylamide gel electrophoresis (PAGE). The urea/ethylene glycol-soluble proteins ….

8.8.6.2 Apparatus and equipment 8.8.6.2.1 Apparatus The Pharmacia GE-2/4 electrophoresis apparatus and EPS 400/500 power supply can be successfully used, but any suitable vertical electrophoresis system e.g. Desaga, Biorad, Biometra should give comparable results.


8.8.6.3.1 Extraction 8.8.6.3.1 Protein extraction 8.8.7 Standard reference method for the measurement of hybrid purity and for the verification of varieties of Helianthus annuus (sunflower)by Ultrathin-layer Isoelectric Focusing (UTLIEF) 8.8.7.1 Principle The alcohol-soluble proteins …

8.8.7 Helianthus annuus (sunflower) 8.8.7.1 Principle The standard reference method for the measuring hybrid purity and verifying varieties of Helianthus annuus (sunflower) is by ultrathin-layer isoelectric focusing (UTLIEF). The alcohol-soluble proteins …

8.8.7.2.1 Apparatus Any suitable horizontal electrophoresis apparatus with a cooling system (e.g. ‘Desaphor HF’, Desaga) and high voltage power supply (e.g. ‘Multidrive XL’, Pharmacia) may be used.

8.8.7.2.1 Apparatus Any suitable horizontal electrophoresis apparatus with a cooling system and high voltage power supply may be used.

8.8.7.3.2 Gel preparation … A gel thickness of 0.12 mm is recommended, which can be achieved by the use of tesafilm (or parafilm or defined thickness adhesive tape) as a spacer.

8.8.7.3.2 Gel preparation … A gel thickness of 0.12 mm is recommended, which can be achieved by the use of a defined thickness of adhesive tape as a spacer.

The following components are taken and mixed: … Ampholytes (pH 5–8) 2.90 ml This is the composition of the seed mix from SINUS pH 5–8/2–11 (4.40 mL) (pH 2–11) 1.50 ml

The following components are taken and mixed: … Ampholytes (pH 5–8) 2.90 mL (pH 2–11) 1.50 mL



8.8.7.3.3 Electrophoresis …Samples (approx. 4 μL) are loaded in the applicator strip 0.5 cm below the bufferwick of the anode and focusing carried out at 2500 V, 15 mA, 40 W for about 1750 volt/hours (70 minutes) until completion (for one gel).

8.8.7.3.3 Electrophoresis …Samples (approx. 4 μL) are loaded in the applicator strip 0.5 cm below the bufferwick of the anode and focusing carried out at 2500 V, 15 mA, 40 W for about 70 min until completion (for one gel).

8.8.7.4.2 …Comparing the protein patterns of the female and male parents with the hybrid, one or more marker bands (present in the male only) needs to be found in the hybrid (8.8.5, figure 1)….

8.8.7.4.2 … When comparing the protein patterns of the female and male parents with the hybrid, one or more marker bands (present in the male only) needs to be found in the hybrid (8.8.5.5, Figure 8.1).

…titerplates … …titre plates …

8.9 Examination of seedlings 8.9.2 Beta spp. …. After seven days examine the seedlings for hypocotyl colour. ….

8.9 Examination of seedlings 8.9.2 Beta spp. …. After seven days, the seedlings for hypocotyl colour are examined.

8.9.3 Brassica spp. … Germinate the seeds in darkness at 20–30 °C. After five days transfer the cotyledons to Petri dishes containing alcohol (85–96%) and placed on a white surface. After four hours determine the colour.

8.9.3 Brassica spp. … Germinate the seeds in darkness at 20<=>30 °C. After five days the cotyledons are transferred to Petri dishes containing alcohol (85–96%) and placed on a white surface. After four hours the colour is determined.




C.8.2. New improved A-PAGE method for the verification of Triticum The statistical analysis revealed that different methods give similar results to with the current ISTA method in the Rules. The scientists involved in this validation consider that each step (8.8.8.2–11 of this new method) is independent from the others. Thus, the proposed strategy consists of merging some solutions and procedures that were understood to go together. For this new method, laboratories will have options for some of the steps of the procedure. Where there are options given, the laboratories will have to select one of them, but not necessarily always the same one. For example, a laboratory may select option 1 for “Extraction”, option 1 also for “Gel preparation”, but may select option 2 for “Electrophoresis” and for “Fixing and Staining”. For ease of reading the text is presented without underline. This proposal is submitted by the Variety Committee and approved by a vote.

PROPOSED VERSION

8.8.8 Triticum (wheat)

8.8.8.1 Principle

The standard reference method for verifying varieties of Triticum is by acetic acid urea polyacrylamide gel electrophoresis (A-PAGE). The alcohol-soluble proteins (gliadins) are extracted from seeds and separated by A-PAGE at pH 3.2. The pattern of protein bands produced (electropherogram) is related to genetic constitution and can be considered as a ‘fingerprint’ of a variety. The ‘fingerprints’ can be used to identify unknown samples and mixtures, by single seed analysis.

8.8.8.2 Equipment – Any suitable vertical electrophoresis system – Cooling system – Power supply – Hood – Mixer – Centrifuge – Shaker – Transilluminator – Oven or drying equipment (gel dryer or glass plates and cellophane sheets)

8.8.8.3 Chemicals

All chemicals must be of ‘analytical reagent’ grade or better (acrylamide and bisacrylamide specially purified for electrophoresis).

8.8.8.4 Sample preparation

Seeds can be ground, crushed or halved with pliers or a razor blade and transferred to microcentrifuge tubes (1.5 mL) or microtitre plates (200 µL).


PROPOSED VERSION

8.8.8.5 Extraction 8.8.8.5.1 Extraction (option 1) 8.8.8.5.1.1 Solutions a) Extraction solution Ethanol: 70% prepared immediately before use Acetone: concentrated b) Sample buffer Glycerol: 30% w/v Urea: 6 M Acetic acid: 25 mM Pyronine G: 0.05% Add water to the final volume. Keep the solutions at room temperature. 8.8.8.5.1.2 Procedure

Add 70% ethanol at 200μL per seed or per 50–60 mg flour. When using microcentrifuge tubes, mix the samples with e.g. a vortex. With microtitre plates, mixing is not necessary. . Leave the sample in the dark at room temperature for 1 h. Centrifuge, recover the clarified supernatant in 1.5 mL tubes, then add 1 mL acetone stored at room temperature. Proteins will precipitate in a few minutes (keep at 4 °C if not used). Centrifuge, discard the acetone, dry the pellet under the hood for 5 min. Add 150 μL of sample buffer. The extraction is finished in about 2 h.

Extracts can be stored at 4 °C for some weeks.

8.8.8.5.2 Extraction (option 2)

8.8.8.5.2.1 Solution

2-Chlorethanol: 25–30%

Pyronine G or methyl green: 0.05%

Add water to the final volume.

Keep the solution cold (4 ºC).

8.8.8.5.2.2 Procedure

Add 150–200 µL extraction buffer. When using microcentrifuge tubes, mix the samples with e.g. a vortex. With microtitre plates, mixing is not necessary. Incubate the samples overnight at room temperature (approx. 20 °C).

If necessary, before loading the gel, centrifuge the samples at 13 000 r.p.m. for 15 min.

Extracts can be stored at 4 °C for some days.


PROPOSED VERSION

8.8.8.6 Gel preparation and buffer tank solutions

8.8.8.6.1 Gel preparation (option 1)

8.8.8.6.1.1 Gel mix

Acrylamide: 12% (from 40% solution)

Bisacrylamide: 0.4% (from 2% solution)

Acetic acid: 0.75%

Urea: 12%

Ferrous sulphate: 0.0014%

Ascorbic acid: 0.1%

Add water to final volume (for example 80 mL for 2 gels of 16 cm x 18 cm x 1.5 mm thick)

Mix until complete dissolution.

8.8.8.6.1.2 Polymerization starter

Hydrogen peroxide: 100 vol, 0.001% (v/v), final gel concentration.

Gel preparation should be done quickly because polymerization is very rapid. Cooling the cassettes to 4 °C before filling with the gel mix helps to delay the polymerization.

8.8.8.6.1.3 Buffer tank solutions

Upper tank buffer: 700 mL water + 1 mL acetic acid (0.143% v/v)

Lower tank buffer: 4000 mL water + 10 mL acetic acid (0.25% v/v)

8.8.8.6.2 Gel preparation (option 2)

8.8.8.6.2.1 Gel mix

Acrylamide: 10% final concentration (from solution or powder)

Bisacrylamide: 0.4% Final concentration (from solution or powder).

Or use a pre-prepared gel mix of acrylamide and bisacrylamide.

Note: The powder forms of acrylamide and bisacrylamide are much more readily inhaled, as they are very light and highly electrostatic, so the powder floats in the air as soon as the bottle is opened. Handle in a fume hood.

Urea: 6%

Ferrous sulphate: 0.005%

Ascorbic acid: 0.005– 0.1%

Add the following buffer: 0.1% glycine (w/v), 2% glacial acetic acid (v/v) and water to final volume.

Mix until complete dissolution.

8.8.8.6.2.2 Polymerization starter

Hydrogen peroxide: 100 vol, 0.002–0.003% (v/v), 30%, final gel concentration.

Gel preparation should be done quickly because polymerization is very rapid. Cooling the cassettes to 4 °C before filling with the gel mix helps to delay the polymerization.

8.8.8.6.2.3 Buffer tank solution

Only one buffer: 0.4% glacial acetic acid (v/v) + 0.04% glycine (w/v) + water to final volume


PROPOSED VERSION

8.8.8.7 Loading samples

5–20 µL, depending on the equipment used.

Loading can be performed using a syringe, a multichannel syringe, a pipette or a multichannel pipette.

8.8.8.8 Electrophoresis

8.8.8.8.1 Electrophoresis (option 1)

Constant voltage: 500 V for the chamber.

Water should be circulated through the buffer tank to maintain the buffer temperature at 18 °C.

Running time: 2 times the time required for the dye to leave the gel.

8.8.8.8.2 Electrophoresis (option 2)

Constant current: 40 mA for each gel.

Water should be circulated through the buffer tank to maintain the buffer temperature at 10–20 °C.

Running time: 2 times the time required for the dye to leave the gel.

8.8.8.9 Fixing and staining

8.8.8.9.1 One-step fixing and staining (option 1)

Stock Coomassie: Coomassie R 250 1g/100 mL ethanol. Store this solution at 4 ºC in a dark bottle.

Fixing and staining solution: 2.5% stock Coomassie Blue R250 (v/v) + 6.25% trichloroacetic acid (TCA) (w/v), water to 400 mL, or use a pre-prepared solution.

This solution is enough for 2 gels 16 x 18 cm x 1.5 mm thick.

Shake overnight with orbital shaker.

The solution can be used once only.

8.8.8.9.2 One-step fixing and staining (option 2)

Stock Coomassie: 0.25% (w/v) Coomassie Blue G250 + 0.75% (w/v) Coomassie Blue R250 + water to complete volume, or use a pre-prepared solution.

Fixing and staining solution: 8.3% (w/v) trichloroacetic acid (TCA) + 5.8 (v/v) acetic acid + 12.5 % (v/v) ethanol + 2% (v/v) stock Coomassie.

Staining is complete after 1 day, but at the earliest after 4 h.

The solution can be used six times.

8.8.8.9.3 Two-step fixing and staining (option 3)

Stock Coomassie: 0.25% (w/v) Coomassie blue G250 + 0.25% (w/v) Coomassie blue R250, complete volume with ethanol 100%, or use a pre-prepared solution. Store this the solution at 4 ºC in a dark bottle.

Fixing solution: 10% TCA. Store at room temperature under hood.

Staining solution: 20% stock Coomassie (v/v) + 8% acetic acid (v/v). Add water to complete volume. Store under hood at room temperature in a dark bottle.

1. Fix gels in TCA 10% for 1 h. Gels can be saved in this solution for few days.

2. Stain the gels for approx. 3 h or overnight.

The fixing and staining solutions can be used six times.


PROPOSED VERSION

8.8.8.10 Destaining

Destaining with tap water: rinse the gels 1–2 times (30 min each).

For slow destaining, use a 10% TCA solution.

8.8.8.11 Storage of the gels

Gels can be kept in either 10% TCA solution or in a glycerol solution (3%), and then dried between two cellophane sheets, or photographed or scanned.

In polyethylene bags gels can be stored at 4 ºC for months without deterioration. After drying they gels can be stored for years.




C.8.3. New SDS-PAGE method for the verification of Triticum and ×Triticosecale varieties A modification of the UPOV approved method using the SDS-PAGE technique in seed testing to confirm varietal identity of seed lots and species verification of Triticum spp. and related species such as ×Triticosecale has been tested and is to recommended to be added to the ISTA Rules. See the validation study for details. For ease of reading the text is presented in without underline. This proposal is submitted by the Variety Committee and approved by a vote.

PROPOSED VERSION

8.8.9 Triticum and ×Triticosecale (wheat and triticosecale)

8.8.9.1 Principle

The standard reference method for verifying varieties of Triticum and ×Triticosecale is by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). Seed proteins are extracted from individual seeds, treated with SDS and separated using a discontinuous SDS-PAGE procedure. The pattern of protein bands found on the gel is characteristic of a variety.

As a guideline, it is recommended that 100 individual seeds are used. Very precise estimates of varietal purity may require a larger sample. If a comparison is being made with a standard value, sequential testing using batches of 50 seeds can be undertaken in order to minimise the workload. A simple check on the identity of a single major constituent of a seed lot can be done using less than 50 seeds.

8.8.9.2 Equipment

Any suitable vertical electrophoresis system may be used.

8.8.9.3.Chemicals

All chemicals must be of ‘analytical reagent’ grade or better (acrylamide and bisacrylamide specially purified for electrophoresis).

– Acrylamide 40% solution – Bisacrylamide 2% solution – Urea – Glycine – Ammonium persulphate (APS) and TEMED – 2-Mercaptoethanol – Sodium dodecyl sulphate (SDS) (10% stock solution) – Tris – Pyronine G/bromophenol Blue – Coomassie Blue R-250 – Coomassie Blue G-250 – Purified water

8.8.9.4 Sample preparation

Single seeds crushed with pliers or alternatively 50–70 mg of flour are transferred to 1.5 mL polypropylene centrifuge tubes or microtitre plates.

8.8.9.5 Extraction

8.8.9.5.1 Extraction buffer

Urea: 4.5 M, 3% 2-Mercaptoethanol: 10 % SDS


PROPOSED VERSION

8.8.9.5.2 Extraction procedure

Add 150-500 mL (depending on the equipment used) of the extraction buffer and thoroughly mix the sample. Leave to stand overnight at room temperature. With microtitre plates, mixing is not necessary.

Heat the samples in a boiling water bath for 10 min and allow to cool. Before the gel is loaded, the tubes are centrifuged at 18 000 x g. With microtitre plates, heating is not necessary.

8.8.9.6 Gel preparation

Two gels, 16 x 18 cm, 1.5 mm thickness, depending on the equipment used.

8.8.9.6.1 Stacking gel

Stacking gel: acrylamide 3%, 0.125 M Tris-HCl, pH 6.8.

Acrylamide 40% solution: 1.5 mL

Bisacrylamide 2% solution: 0.43 mL


Tris-HCl 1 M pH 6,8: 2.5 mL

SDS 10%: 0.16 mL

Water: 14.87 mL

For polymerization:

APS 1%: 0.75 mL

TEMED: 20 mL

Add the reagents to a 19.46 mL of stacking gel solution.

8.8.9.6.2 Resolving gel

Resolving gel: acrylamide 10%, 0.375 M Tris-HCl, pH 8.8

Acrylamide 40% solution: 20 mL

Bisacrylamide 2% solution: 5.2 mL


Tris-HCl 1 M pH 8.8: 30 mL

SDS 10%: 0.8 mL

Water: 20.8 mL

For polymerization:

APS: 1% 2 mL

TEMED: 40 mL

Add the reagents to a 76.80 mL of resolving gel solution.

8.8.9.6.3 Tank buffer

Tank buffer stock solution: Tris 0.0250 M, glycine 0.187 M, SDS 1%, pH 8.3

Glycine: 141.1 g

Tris: 30.0 g

SDS: 10.0 g

Make up to 1000 mL with water. Dilute the stock solution 1:10 before use.


PROPOSED VERSION

8.8.9.7 Loading samples

10–15 µL, depending on the equipment used.

Loading can be performed using a syringe, a multichannel syringe, a pipette or a multichannel pipette.

8.8.9.8 Electrophoresis

Two gels, 16 x 18 cm, 1.5 mm thickness, depending on the equipment used.

Stacking gel: constant voltage at 100 V (about 40 mA)

Running gel: 80 mA (max. 400 mA)

Water should be circulated through the buffer tank to maintain the temperature at 15 to 20 °C.

Stop the run 40 min after the tracking dye has reached the bottom of the gel

8.8.9.9 Fixing and staining

Fixing: TCA 15%, approx. 30 min

Staining:

Sol A: Coomassie Blue G-250 0.25 g

Coomassie Blue R-250 0.75 g

Made up to 100 mL with water.

Or use a pre-prepared solution.

Sol B: TCA: 27.5 g

Acetic acid: 32.5 mL

Ethanol: 90 mL

Sol A: 12.5 mL

Water to 400 mL

Stain overnight at room temperature.

8.8.9.10 Destaining

Destaining with tap water: rinse the gels 1–2 times (30 min each).

For slow destaining, use a 10% TCA solution.

8.8.9.11 Storage of the gels

Gels can be stored in polythene bags at 4–6 °C for many months without deterioration.

Gels can be kept in either 10% TCA solution or in a glycerol solution (3%), and then dried between two cellophane sheets, photographed or scanned.

In polyethylene bags gels can be stored at 4 ºC for months without deterioration. After drying gels can be stored for years.




Chapter 11: Testing Coated Seeds C.11.1 Testing methods and reporting for the tetrazolium test for coated seeds Adding text for testing methods and reporting for the tetrazolium test for coated seed units, seed mats and seed tapes. Changes also needed to Chapter 1 if this is accepted. Proposal made by the Tetrazolium Committee and approved by a vote.

PROPOSED VERSION

11.6 The tetrazolium test

11.6.1 Object

The objects are the same as defined in 6.1.

11.6.2 Definitions

The definitions are the same as described in 6.2.

11.6.3 General principles

The general principles are the same as described in 6.3.

11.6.4 Reagents

The reagents are the same as prescribed in 6.4.

11.6.5 Procedure

Coated seed units (seed pellets, encrusted seeds or seed granules): Four replicates of 100 coated seed units are washed to remove the coating mass. Depending on the consistency of the coating mass, it may be necessary to agitate, whilst soaking, to release seeds from the coating. The duration of the washing should not take longer than the premoistening period prescribed in Table 6A. The number of seeds determined in each replicate of 100 coated seed units (of the species stated by the applicant) must be reported as an average of all four replicates. If there are more than 100 seeds in each replicate of coated seed units, only 100 seeds per replicate will be used for tetrazolium testing. Coated units without seeds (e.g. empty pellets) are deemed to be non-viable seeds. The test procedure of the washed, uncoated seeds then continues with the premoistening or, if the total premoistening time is achieved, with the preparation for the staining step as prescribed in Table 6A.

Seed tapes: The number of seeds (of the species stated by the applicant) per metre must be detected and reported. To complete the test, 400 seeds must be extracted from the seed tape. The test procedure then continues with the premoistening step as prescribed in Table 6A.

Seed mats: The number of seeds (of the species stated by the applicant) per seed mat must be determined and reported (in large seed mats the number of seeds per square metre). To complete the test, 400 seeds must be extracted from the seed mats. The test procedure then continues with the premoistening step as prescribed in Table 6A.

11.6.6 Calculation, expression of results and tolerances

The same criteria are valid as prescribed in 6.6.

11.6.7 Reporting results

The result of a tetrazolium test on coated seeds must be reported as follows:

- Following the species name, the words ‘seed pellets’, ‘encrusted seeds’, ‘seed granules’, ‘seed tapes’ or ‘seed mats’, as applicable, must be clearly entered.


PROPOSED VERSION

The following additional information must be reported under ‘Other determinations’:

- The statement ‘Number of seeds (of the species stated by the applicant) included in 100 seed pellets’ (or ‘encrusted seeds’, or ‘seed granules’);

- or the statement ‘Number of seeds (of the species stated by the applicant) included in one metre of seed tape’;

- or the statement ‘Number of seeds (of the species stated by the applicant) included in one seed mat or in one square metre of seed mat’.

- The statement ‘Tetrazolium test: …% were viable’ must be entered.

- In cases where the testing procedure deviates from that prescribed in Table 6A, any deviating procedure must also be reported. The only areas where variations from procedures given in Table 6A are permitted are for premoistening time, tetrazolium concentration, staining temperature and staining time. For precise guidance about the limitation of the variations permitted, see 6.5.

- If individual seeds are tested at the end of the germination test, the result must be reported in accordance with 5.9.

In addition, in the case of species of Fabaceae, one of the following, and only one, must be reported:

either (in cases where the percentage of the viability of hard seed is not determined) ‘Tetrazolium test: ...% of seeds were viable, ...% of hard seeds found in the test’

or (in cases where the percentage of the viability of hard seed is determined) ‘Tetrazolium test: ...% of seeds were viable, ...% of hard seeds included in the percentage of viable seed’

Changes also needed to Chapter 1. The same text as for 11.6.7 will be inserted at 1.5.2.8.1.

1.5.2.8.1 Tetrazolium test on coated seeds

Same text as for 11.6.7 above


C.11.1. AND C.1.1. GREEN MAJORITY 0 accepted


Chapter 18: Seed Mixtures C.18.1. Testing methods and reporting for the tetrazolium test for seed mixtures

Adding text for testing methods and reporting for the tetrazolium test for seed mixtures. Renumbering of sections also needed if this is accepted. Changes also needed to Chapter 1 if this is accepted. Proposal made by Tetrazolium Committee and approved by vote. PROPOSED VERSION

18.7 Tetrazolium test For species representing more than 5% of the seed mixture, four replicates of 100 seeds are tested from the pure seed of each component species. If insufficient seed is available from the pure seed fraction, the test will be carried out on (in order of priority) two replicates of 100 seeds, one replicate of 100 seeds or on all pure seed of the species in the pure seed fraction, depending on seed availability.

For species representing 5% or less of the mixture, a tetrazolium test will not be carried out except at the specific request of the customer applicant. In this case the tetrazolium test is carried out on two replicates of 100 seeds, one replicate of 100 seeds or on the all all the pure seeds of the species in the pure seed fraction, depending on seed availability.

18.9 Reporting results …

18.9.4 Tetrazolium test The tetrazolium results for each component species are reported under ‘Other determinations’. The results are reported as a percentage and the number of seeds tested is also reported.

When fewer than 100 seeds are tested, the number of viable seeds is reported together with the total number of seeds tested.

Changes also needed to Chapter 1. The same text as for 18.9.4 will be inserted at 1.5.2.19.4 and the numbering for the existing 1.5.2.19.4 updated to 1.5.2.19.5.

…

1.5.2.19.4 Tetrazolium test

Same text as for 18.9.4 above.

1.5.2.19.4.5 Weight determination


C.18.1. AND C.1.2. GREEN MAJORITY 0 ACCEPTED


Chapter 19: Testing for Seeds of Genetically Modified Organisms C.19.1. New Chapter for the ISTA Rules

Previously guidelines for testing adventitious presence of Genetically Modified Organism (Adventitious Presence of GMO) and/or GMO Trait Purity testing were include in Chapter 8: Variety testing. Now that ISTA has a Technical Committee for GMO testing it was felt that there should be a separate ISTA Rules Chapter for GMO testing. This initiative is supported by the Variety Committee. The GMO Committee has prepared and approved by vote the following new Chapter for inclusion in the ISTA Rules. Note: If this Chapter is approved it will require the editorial deletions of sections of Chapter 8: Varietal testing shown already but will not remove the allowance for testing of varital traits that are not GMO by the performance based approach. See proposal 8.1 for details. Note: as this a completely new Chapter it has not been shown as underlined text for ease of reading. Changes to Chapter 1 will also be required if this proposal is accepted and are shown following this proposal.

PROPOSED VERSION

Chapter 19: Testing for Seeds of Genetically Modified Organisms

19.1 Object

The object of testing for seeds of genetically modified organisms (GMOs) is to give guidelines to detect, quantify or confirm the presence of GMO seeds in seed lots.

These guidelines can be applied to testing adventitious presence (AP) of genetically modified organisms (GMOs) and GMO trait purity testing.

19.2 Definitions

19.2.1 Adventitious presence

Adventitious presence (AP) in seeds refers to the unintentional and incidental presence of foreign material in a seed lot. This may happen during production, harvesting, storage or marketing.

19.2.2 Analyte

An analyte is a substance or chemical constituent that is of interest in an analytical procedure.

19.2.3 Certified reference material

Certified reference material is reference material which has been characterized metrologically for a specific property by an official body. Such material is accompanied by a document attesting to the value of that property, its associated uncertainty and its metrological traceability.

19.2.4 Genetically modified organism

A genetically modified organism (GMO) is any living organism that possesses a novel combination of genetic material obtained through the use of modern biotechnology.

19.2.5 GMO event

A GMO event is a single transformation act that results in the integration of a new trait at a unique site in the plant genome, giving rise to a transgenic plant and subsequently incorporated into new varieties.

http://en.wikipedia.org/wiki/Harvesting

http://en.wikipedia.org/wiki/Food_storage


PROPOSED VERSION

19.2.6 GMO trait

A GMO trait is a novel phenotypic character, added by genetic engineering to an organism and often derived from another species.

19.2.7 Limit of detection

The limit of detection is the smallest amount of target analyte that has been demonstrated to be detected with a given level of confidence. This limit must be verified by the laboratory.

19.2.8 Limit of quantification

The limit of quantification is the smallest amount of target analyte that has been demonstrated to be reliably measured with acceptable levels of accuracy and precision. This limit must be verified by the laboratory.

19.2.9 Performance-based approach

The performance-based approach (PBA) is an approach to testing in which individual laboratories can choose the test method, as long as the method has been validated as fit for purpose and complies to given performance standards.

19.2.10 Proficiency test

A proficiency test is a standardized test or series of tests that assesses the ability of a laboratory or an individual operator to carry out a particular method.

19.2.11 Seed bulk

The seed bulk is the whole working sample that is prepared at one time (e.g. grinding, DNA or protein extraction) and analysed (e.g. end-point PCR, ELISA, real-time PCR).

19.2.12 Seed group

A seed group is one of the portions of the working sample that is separately prepared (e.g. grinding, DNA or protein extraction) and analysed (e.g. end-point PCR, ELISA, real-time PCR) when using the group testing approach.

19.2.13 Transgenic

Transgenesis is the process of introducing a foreign genetic construct – called a transgene – into a living organism so that the organism will exhibit a new property and transmit that property to its offspring. The organisms and lines containing transgenes are referred to as transgenic. Cisgenesis occurs by the same process, but using genes from the same species.

19.2.14 Reference material

According to ISO Guide 30, reference material is: "material, sufficiently homogeneous and stable with respect to one or more specified properties, which has been established to be fit for its intended use in a measurement process”. It can also be classified according to its use, for instance "calibrants/calibrators" or "quality control materials".

19.3 General principles

The ISTA strategy regarding methods for the detection, identification and quantification of genetically modified seeds in conventional seed lots is available on the ISTA web site at:

https://www.seedtest.org/upload/cms/user/42Int-M-I200142ISTAPositionPaperonGMOapproved14112001-update1.pdf

http://en.wikipedia.org/wiki/Transgene

http://en.wikipedia.org/wiki/Living_organism

http://en.wikipedia.org/wiki/Offspring




PROPOSED VERSION

This chapter describes testing for adventitious presence of GM seeds and GMO trait purity. Currently there is no universal threshold for GM seeds in conventional seed lots, or of regulated GM seed in deregulated GM seed, or a specified level of GMO purity in a seed lot; the establishment of reliable methods for the detection, identification and quantification of GMO content is therefore very important. Different technologies, strategies and methods for GMO testing are continuously evolving and new methods being developed. The quality of these test results depends much more on methodology, equipment and training than in other classical seed testing methods. This makes the standardization of GMO testing very difficult. The ISTA approach has targeted the uniformity in GMO testing results, not by the uniformity in testing methodology, but by using a performance-based approach (PBA). The PBA requires that laboratories demonstrate that the GMO detection, identification or quantification methods that they are using on seed samples for reporting results on ISTA Certificates meet acceptable standards set by ISTA. These standards include, among others, sampling, testing and reporting. In order for a laboratory to be recognised as ISTA accredited for GMO testing, it will need to ensure that documented evidence of validation and reliability of the laboratory is available to the ISTA auditors. The evidence must include:

– performance data based on seed samples for the event and species for which the laboratory is seeking ISTA accreditation, and

– participation in an ISTA GMO proficiency test including the specific event and species, if available.

This requirement will ensure the reliability of the analysis and the final test result reported on the ISTA Certificate. The PBA gives seed testing laboratories the choice to use different technological approaches, e.g. bioassays, protein-based methods and DNA-based methods.

For further information, see the ISTA Principles and Conditions for Laboratory Accreditation under the Performance Based Approach (see http://www.seedtest.org/upload/cms/user/ISTAMethodValidationforSeedTesting-V1.01.pdf)

Generally, GMO tests that are used to assess GMO trait purity are identical to the tests used for testing for AP of GM seeds. However, there are differences in the testing steps as well as in the objectives. This chapter addresses these distinctions whenever they apply.

19.4 Procedure

Adventitious presence of GMO testing and GMO trait purity testing are “two sides of the same coin”; both applications make use of the same tests, and follow a very similar work flow (Figure 1). The expected results differ in the two applications. In GMO AP testing, most of the time the expected outcome is “not detected” or a low estimate of the proportion of GMO present. In GMO trait purity testing, the expected result is the quantification of a high percentage of presence of the specified trait.

The methods used for these analyses can be classified and characterized in a number of ways. According to the level at which the analysis occurs, tests can be conducted at the DNA level (19.5.1), protein level (19.5.2) or organism level, as in bioassays (19.5.3).


PROPOSED VERSION

The appropriate approach to GMO testing is chosen according to the question which the test is attempting to answer (see Figure 1). A qualitative question, e.g. “Is there any GM seed in the sample?” can be answered by applying a qualitative test (see 19.5.1.2 and 19.5.2.2), while a quantitative question, e.g. “How much GM seed is there in a seed lot?” can be answered by using either a quantitative test (see 19.5.1.3) or a group-testing approach (Remund et al., 2001), also known as the semi-quantitative method (which relies on qualitative tests of seed groups). Another classification that applies only to DNA-based methods is in relation to the specificity of the method, as described further in section 19.4.1.

Both AP GMO testing and GMO trait purity testing can be performed on individual seeds or on seed bulks, although each application will require a different sampling and testing scheme. Seed bulk testing is more common in AP GMO testing, where the detection target is a transgenic protein or a DNA segment. GMO trait purity tests are usually performed on a representative sample of individual seeds or seedlings, and target the GMO trait or, similarly, the protein or the DNA. However, when performed on seed bulks, the test is performed at the DNA level to detect the absence of transgenic DNA, and targets the uninterrupted insertion site (Battistini and Noli, 2009).

Figure 1. The different approaches to GMO testing and corresponding workflows.


PROPOSED VERSION

19.4.1 Sample size

Chapter 2: Sampling gives definitions of various sample types, including primary, composite, submitted and working samples, as well as guidelines for obtaining seed lot samples that represent the properties of the seed lot. These definitions and guidelines apply also to GMO testing. The working sample is the portion of the submitted sample that is actually tested by the testing method (as defined in Chapter 2). The size of the working sample depends on given threshold requirements, the method capability and the degree of required statistical confidence, and can be determined using appropriate statistical tools (e.g. SeedCalc (19.6.3)). The sample submitted to the laboratory must therefore be at least the size of the working sample, but more realistically larger than the working sample. For more information regarding sampling, see Chapter 2.

The sizes of seed bulks and groups must be consistent with the performance of the analytical method in terms of limit of detection, in order to allow the detection of even one GM seed. For quantitative methods, the size of the sample must be consistent with the limit of quantification, to allow the quantification of even one GM seed in the sample.

19.4.2 Personnel and equipment

Many of the procedures used for GMO testing are composed of several stages (e.g. seed planting or grinding, DNA or protein extraction, detection of the target analyte, and reporting of results) which can be carried out by different personnel in the laboratory (see Figure 1). The laboratory must show that personnel are adequately trained in the procedures that they are carrying out, and that they understand the overall workflow of the procedures and their contribution to that workflow. Each part of the workflow and the equipment must be adequately validated, verified or calibrated before use.

Appropriate equipment and facilities must be provided for the use of the chosen methods. For biomolecular assays (DNA and protein), apparatus for grinding and analyte extraction are necessary, as well as equipment dedicated to the detection of the target analyte.

For DNA-based detection, it is important to prevent contamination, and the use of separate rooms for certain manipulations is preferred.

For protein-based detection, care must be taken to avoid degradation of the matrix and the extracted analyte.

For bioassays, care must be taken to ensure the provision of controlled germination conditions adequate to allow the expression of the trait.

19.4.3 Test conditions

Tests must be carried out under conditions of the ISTA Accreditation Standard quality framework. This includes, but is not limited to the following:

– Analysts involved in this testing must have the documented skills and training in the corresponding procedures.

– All equipment must be appropriate to the techniques used. Scheduled maintenance, verification, and calibration of the instrumentation used must be carried out.

– The spatial arrangements and organization of the testing area must prevent contamination.

– Reagents of appropriate grade and certified reference materials (when available) must be used.

– Appropriate controls must be used to validate the testing results.


PROPOSED VERSION

19.5 Testing approaches

19.5.1 DNA-based methods

19.5.1.1 General principles of DNA-based testing

DNA-based testing requires a series of steps which can be carried out by different laboratory personnel and which should all show evidence of validation and being fit for purpose for the testing being carried out. The steps are the following:

– examination of the seed sample;

– grinding of the seed to produce a homogenous matrix;

– subsampling and DNA extraction;

– DNA amplification;

– detection of the amplified DNA.

Because of the amplification step, it is important that the laboratory ensures adequate protection against contamination by seed dust, extracted DNA or amplified DNA for each tested sample. Appropriate control samples (e.g. environmental, blank or negative controls) must be used. If available, it is recommended to use certified reference materials.

In the case of methods using the polymerase chain reaction (PCR), several types of testing can be done that will differ in the level of selectivity and specificity.

– In GMO screening, primers are chosen that amplify individual genetic elements frequently found in a number of different GMO events. The detection of such targets suggests the presence of GMO, but does not represent by itself conclusive evidence.

– In construct-specific PCR, the primers are chosen such that the amplification target spans genetic elements not usually combined in nature, providing a strong indication of the presence of a GMO event that includes that construct.

– In event-specific testing, the primers are designed to detect the unique integration site of a specific transformation event. Thus, a positive result is indicative of the presence of that particular event.

Whatever the type of method selected and its origin, internally developed or publicly available, its performance must be evaluated according to the PBA requirements and following the procedures as directed by the ISTA GMO Committee.

19.5.1.2 End-point qualitative PCR

In end-point PCR, the standard steps of PCR are carried out, with detection of PCR products at the end of the process. This detection step can be the electrophoresis of the amplified DNA molecules on gel or the measurement of fluorescence associated with the PCR reaction. With electrophoresis, the test is scored as positive if a band of the appropriate size is observed on the gel, and negative if no band is observed. With fluorescence detection, the test is scored by comparison to the fluorescence measurement of appropriate positive and negative control samples.

19.5.1.3 Real-time PCR

During real-time PCR, DNA amplification activates fluorochromes attached to the primers or probes. This activation can be measured in real time and can give an estimate of the number of DNA molecules being amplified in each cycle.

DNA amplification can also be measured by activation of intercalating fluorescent dyes. In this case, special attention to false-positive results must be paid, since the activation of intercalating dyes can be associated with amplification of non-specific PCR products.


PROPOSED VERSION

Real-time PCR can be qualitative or quantitative.

In qualitative real-time PCR tests, the test is scored positive if fluorescence above the defined baseline is detected before a given PCR cycle (usually set by amplification of a known GMO control DNA).

In quantitative real-time PCR tests, the assay is designed to quantify the target against a standard curve produced from reference material. The experimental set-up and reporting of results must follow accepted statistically sound methods such as those suggested in the GMO Handbook.

19.5.1.4 Other technologies

The descriptions in section 19.4.1.3 apply to technologies (primer and probe sets, methods and equipment used for amplification and detection as well as for quantification) that are widely used in laboratories carrying out GMO testing.

Other methods are currently being developed for use in GMO detection. Use of these methods can also be included in ISTA’s PBA as long as the laboratory develops and maintains adequate validation data for the methods used.

19.5.2 Protein-based methods

19.5.2.1 General principles of protein-based testing

In order to detect single proteins in seeds, the seeds need to be ground and extracted with a suitable buffer. The detection of proteins using an immunoassay in a complex mixture such as that obtained by extraction of seed powder requires a number of precautions. The detectable protein content may vary due to the protein itself, the extraction process and buffer and the type of seed used. Particular difficulties are well known (e.g. oil content of oilseed rape, gossypol in cotton seeds, varietal differences, seed maturity, seed moisture) and the laboratory should have validated the extraction and detection methods for each seed matrix by spike and recovery tests (see GMO Method Handbook). Proteins are generally rapidly degraded. The extraction should be carried out at room temperature, or below, and after extraction the mixture should be used quickly or stored at low temperature. When using commercial lateral flow strip tests (19.5.2.2) or ELISA kits (19.5.2.3), it is important to refer to the assay conditions as defined by the test kit suppliers. Moreover, these assay conditions must be internally validated in the laboratory conditions, systematically include positive and negative controls in each test and follow the ISTA Principles and Conditions for Laboratory Accreditation under the Performance Based Approach

(see http://www.seedtest.org/upload/cms/user/Acc-D-04-AccreditationunderthePBA1.pdf).

http://www.seedtest.org/upload/cms/user/ISTAMethodValidationforSeedTesting-V1.01.pdf

It is not recommended to use protein-based tests for quantification of GMO, as the variations in sample type (e.g. germplasm, seed maturity) and in extraction and detection methods can result in target protein content variation in the protein extract and cause difficulty in estimating the GMO content. Protein detection is not always event-specific, as several events may contain the same protein (e.g. NK603/MON88017; MON810/Bt11), but the careful use of multiple methods may allow a good indication of which event is being detected.


PROPOSED VERSION

19.5.2.2 Lateral flow strip test

The lateral flow strip test consists of an immunoassay in which globulins or antibodies are immobilized on a capillary paper. The strip is dipped into the protein extract. The presence of the target protein (the antigen) is represented by the appearance of at least two bands, a negative result only by a control band. The result can be scored only if the control band is visible. A maximum time of reading must be defined to avoid false-positive scoring, due to unspecific staining which can occur after a long reaction time.

19.5.2.3 Enzyme-linked immunosorbent assay

The enzyme-linked immunosorbent assay (ELISA) is a sensitive immunoassay that uses an enzyme linked to an antibody or antigen as a marker for the detection of the specific trait protein through a colorimetric reaction.

19.5.3 Bioassays

19.5.3.1 General principles of bioassays

Bioassays are tests based on visual assessment of phenotypic effects of treatments on seeds or seedlings. The most common use of bioassays is to determine the presence of seed which carries herbicide-resistance traits. In this case the seeds or seedlings are exposed to herbicide, and the expected effect on the plant is lack of normal development when the seeds do not contain the herbicide-resistance trait. All seeds or plants that continue to germinate or grow normally are scored as positive for the GMO trait. The appropriate concentration of herbicide must be determined per crop and growth stage. It is important to consider that bioassays determine the presence of a GMO trait, but cannot determine the presence of any specific event, as in many crops multiple events exist with the same herbicide-resistant phenotype. Therefore, in such cases herbicide bioassays can only be used to screen for the presence of GMO, but cannot detect the presence of a particular event.

19.5.3.2 Scoring of GMO presence

Standardized methods of scoring and analysing the results for the herbicide testing should be in place. This should include statistical considerations of the numbers of seeds used and scored.

The result must take into consideration the germination percentage.

19.6 Calculation and expression of results

19.6.1 Consideration of the testing objective

The applicant must clearly state the specific testing objective, as this is critical in defining the testing approach and in calculating and expressing results. Possible testing objectives include:

– reporting the presence or absence of a GMO in the seed lot;

– estimating the proportion of the GMO present in the seed lot with the associated measurement uncertainty.

The methods described in 19.5 produce either qualitative, i.e., detected (GM trait observed) or not detected (GM trait not observed), or quantitative results. Both types of results can be statistically analysed to meet the testing objective, but the data analysis methods and associated calculation tools differ.

To assess for the presence of two or more stacked events in the same seed, testing individual seed is the appropriate approach. When seed are tested in bulk, the presence of stacked events cannot be demonstrated. However, some statistical tools such as the one proposed by ISTA in SeedCalc Stack9 can estimate the percentage of seeds that could have two or three stacked events.


PROPOSED VERSION

19.6.2 Units of measurement

The calculation and expression of results depend on the testing objectives, testing methods and the associated units of measurement. The aim or request of the applicant will need to be carefully considered. In order to cope with the different objectives and circumstances where quantification of seeds with GMO traits is required, and in concordance with the PBA, it is acceptable to report quantitative test results using any one of the following units:

a) % in number of seeds: the estimate of the percentage of GM seeds in the seed lot. In addition to individual testing, the percentage in number of seeds is the unit to be used when a group testing approach is chosen; e.g. with SeedCalc (see 19.6.3).

b) % in mass of seeds: the estimate of the percentage of GMO content by mass. This unit should be used when a standard curve is prepared using certified reference material certified by % mass (g/kg).

c) % DNA copies: the estimate of the percentage of GMO content by number of copies. This unit should be used when a standard curve is prepared using certified reference material certified by % DNA copies.

All these three units are acceptable for preparing ISTA Certificates for reporting results by accredited laboratories. The acceptance of more than one unit can avoid raising the difficult question of converting factors. A simple mechanical conversion between units is complex or even impossible.

Whatever the unit used to express results, the resulting GM estimate should be methodologically meaningful, that is, a laboratory using quantitative real-time PCR should not report a value that is lower than its validated limit of quantification.

Moreover, in quantitative real-time PCR, results should be biologically meaningful. The lab should pay attention to results that are lower than 1 divided by the size of the working sample.

19.6.3 ISTA tools for calculation of results

Remund et al. (2001) and Laffont et al. (2005) provided statistical tools for qualitative and quantitative testing methods which are implemented in the SeedCalc MS Excel workbook (available on the ISTA web site).


The result of a genetically modified organism test must be reported under ‘Other determinations’ as follows:

– the request of the applicant;

– the name and scope (with reference to the target) of the method(s) used;

– a description of the working sample (e.g. pure seed fraction, inert matter present, other seeds present, washed seed);

– the number of seeds in the working sample;

– a description and the source of the reference material used (e.g. certified reference material, provider);

– the limit of detection of the method (when testing seed groups or seed bulk);

– the limit of quantification of the method (when testing seed bulk with a quantitative method)


PROPOSED VERSION

19.7.1 Qualitative test results

Suggested phrases for reporting the detection of test targets depending upon the result are as follows:

a) If the test target(s) was(were) not detected: ‘ The test target was not detected.’

b) If the test target(s) was (were) detected: ‘The test target was detected.’

19.7.2 Quantitative results obtained by multiple qualitative tests of individuals or groups of seeds or seedlings

Results should be reported relative to the percentage of seeds or seedlings showing the test target specified by the applicant. The total number of seeds tested, the number of groups, and the number of seeds per group must be reported. Suggested phrases for reporting such results depending upon the result are as follows:

a) If the test target(s) was (were) not detected: ‘The test target(s) was (were) not detected.’

b) If the test target(s) was (were) detected: ‘The % of seeds in the lot with the test target(s) was determined to be …%, with a 95% confidence interval of […%, …%].’ or ‘For the test target(s) specified by the applicant, the seed lot meets the specification of ...% (maximum or minimum) with …% confidence.’

If the results do not show evidence that the seed lot meets a given specification with some confidence, then the applicant will report the point estimate with the 95% confidence intervaI.

19.7.3 Quantitative measurements of GMO in bulk samples

Results should be reported relative to the percentage of the test target specified by the applicant by mass or number of DNA copies. The testing plan (e.g. number of replicate seed samples, number of replicate flour samples per seed sample, number of extracts per flour sample, number of replicate measurements per extract) must be indicated.

Required phrases for reporting depending upon the results are as follows:

a) If the test target was not detected (no signal or below the limit of detection): ‘The test target was not detected at a level above the limit of detection.’

b) If the test target was detected at a level above the limit of detection and below the limit of quantification: ‘The test target was detected at a level below the limit of quantification of the method used.’

c) If seeds showing the test target were found at a level above the limit of quantification: ‘The test target(s) percentage in the seed lot was determined to be …% by mass or number of copies, with a 95% confidence interval of […%,…%]‘ or ‘For the test target(s) specified by the applicant, the seed lot meets the specification of ...% (maximum or minimum) by mass or number of copies with …% confidence.’

If the results do not show evidence that the seed lot meets a given specification with some confidence, then the applicant will report the point estimate with the 95% confidence intervaI.


PROPOSED VERSION

19.8 References

Battistini E. and Noli E. (2009) Real-time quantification of wild-type contaminants in glyphosate tolerant soybean. BMC Biotechnology 9, 16.

Laffont J-L., Remund, K.M., Wright, D.L., Simpson R.D., Gregoire S. (2005) Testing for adventitious presence of transgenic material in conventional seed or grain lots using quantitative laboratory methods: statistical procedures and their implementation. Seed Science Research 15, 197-204.

Remund, K.M., Dixon D.A., Wright D.L. and Holden L.R. (2001) Statistical considerations in seed purity testing for transgenic traits. Seed Science Research 11, 101-119.

SeedCalc: http://seedtest.org/en/stats-tool-box-_content---1--1143.html (last verified 2013-02-15)

Changes also needed to Chapter 1. The same text as for 19.7 and 19.7.1-19.7.3 will be inserted at 1.5.2.20 and the existing 1.5.2.20 renumbered to 1.5.2.21.

….

1.5.2.20 Genetically Modified Organism test

Same text as for 19.7 and 19.7.1-19.7.3 above.

1.5.2.201 Reporting of results of tests not covered by the Rules

Update reference for 1.5.2.20 1.3

…..

c)

…ISTA Certificate (see 1.5.2.201).


C.19.1. AND C.1.3. GREEN MAJORITY 0 ACCEPTED

http://seedtest.org/en/stats-tool-box-_content---1--1143.html

rules proposals for the international rules for seed ... · c.5.1. harmonisation on seedling...

Documents