running title: characterization of the arabidopsis eif-5a ... · proteins (murzin, 1993), such as...

1

Running title: Characterization of the Arabidopsis eIF-5A-2 gene

Corresponding author:

Jianru Zuo

Mailing address: Institute of Genetics and Developmental Biology, Chinese Academy of Sciences,

Datun Road, Beijing 100101, China

Tel: (+8610)6486 3356; Fax: (+8610)6487 3428

E-mail: [email protected]

Research area: System Biology, Molecular Biology, and Gene Regulation

Total word count: 9,322

Total characters (including space): 60,497

Plant Physiology Preview. Published on May 18, 2007, as DOI:10.1104/pp.107.098079

Copyright 2007 by the American Society of Plant Biologists

www.plantphysiol.orgon July 23, 2020 - Published by Downloaded from Copyright © 2007 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

2

Functional characterization of the Arabidopsis eukaryotic translation

initiation factor 5A-2 (eIF-5A-2) that plays a crucial role in plant growth

and development by regulating cell division, cell growth and cell death1

Haizhong Feng, Qingguo Chen, Jian Feng, Jian Zhang, Xiaohui Yang and Jianru Zuo*

State Key Laboratory of Plant Genomics and National Center for Plant Gene Research (Beijing),

Institute of Genetics and Developmental Biology, Chinese Academy of Sciences, Datun Road,

Beijing 100101, China.



3

Footnotes:

1. This work was supported by grants from the National Natural Science Foundation of China

(NSFC; 30330360 and 30221002), the Ministry of Science and Technology of China

(2006AA10A112) and Chinese Academy of Sciences (KSCX2-YW-N-015). JZ is a recipient

of the Outstanding Young Investigator Award of NSFC (30125025).

The author responsible for distribution of materials integral to the findings presented in this

article in accordance with the policy described in the Instructions for Authors

(www.plantphysiol.org) is: Jianru Zuo ([email protected]).

*Corresponding author. Fax: (+8610)6487 3428; E-mail: [email protected]



4

ABSTRACT

The eukaryotic translation initiation factor 5A (eIF-5A) is a highly conserved protein found

in all eukaryotic organisms. Although originally identified as a translation initiation factor, recent

studies in mammalian and yeast cells suggest that eIF-5A is mainly involved in RNA metabolism

and trafficking, thereby regulating cell proliferation, cell growth and programmed cell death

(PCD). In higher plants, the physiological function of eIF-5A remains largely unknown. Here, we

report the identification and characterization of an Arabidopsis mutant fumonisin B1-resistant12

(fbr12). The fbr12 mutant shows an anti-apoptotic phenotype and has reduced dark-induced leaf

senescence. Moreover, fbr12 displays severe defects in plant growth and development. The fbr12

mutant plant is extreme dwarf with substantially reduced size and number of all adult organs.

During reproductive development, fbr12 causes abnormal development of floral organs and

defective sporogenesis, leading to the abortion of both female and male germline cells.

Microscopic studies revealed that these developmental defects are associated with abnormal cell

division and cell growth. Genetic and molecular analyses indicated that FBR12 encodes a putative

eIF-5A-2 protein. When expressed in a yeast mutant strain carrying a mutation in the eIF-5A gene,

an FBR12 cDNA is able to rescue the lethal phenotype of the yeast mutant, indicating that FBR12

is a functional eIF-5A. We propose that FBR12/eIF-5A-2 is fundamental for plant growth and

development by regulating cell division, cell growth and cell death.

Key words: Arabidopsis, eIF-5A, fumonisin B1, PCD, reproductive development



5

INTRODUCTION

The eukaryotic translation initiation factor 5A (eIF-5A) has been found in all eukaryotic

organisms, and is structurally and functionally conserved across different kingdoms. Biochemical

and molecular studies revealed that eIF-5A is synthesized as an inactive precursor that is activated

by a posttranslational modification mechanism. This modification is involved in a two-step

reaction to convert an absolutely conserved lysine into a hypusine. The first reaction, catalyzed by

deoxyhypusine synthase (DHS; EC 1.1.1.249), is to add a butylamine group derived from

spermidine to the conserved lysine to form a deoxyhypusine. Subsequently, the deoxyhypusine

residue is converted into a hypusine, catalyzed by deoxyhypusine hydroxylase (EC1.14.99.29)

(Park and Wolff, 1988; Wolff et al., 1990; Park et al., 1993; Park et al., 1997). The hypusination of

eIF-5A is essential for viability of yeast cells (Kang et al., 1993) and highly specific, as

demonstrated by the observation that a lysine-to-arginine mutation abolishes hypusination of eIF-

5A (Jin et al., 2003). In addition, this unusual modification thus far has only been found in eIF-5A

proteins (Park et al., 1997; Thompson et al., 2004). At the cellular level, hypusine-containing eIF-

5A has been shown to be involved in the control of cell proliferation and apoptosis (Park et al.,

1997; Tome and Gerner, 1997; Caraglia et al., 2001; Thompson et al., 2004). More recently, eIF-

5A was found to function as a regulator of p53 and p53-dependent apoptosis (Li et al., 2004).

The eIF-5A protein was initially identified as a translation initiation factor from rabbit

reticulocytes in an in vitro assay (Kemper et al., 1976). The eIF-5A function in protein translation

is partly supported by the observation that the putative translation initiation factor interacts with

the ribosomal protein L5 (Schatz et al., 1998) and the translating 80S ribosomal complex (Jao and

Chen, 2005). However, accumulating evidence suggests that eIF-5A is not required for protein

synthesis in vivo, owing to the lack of correlation between eIF5A and the general protein synthesis

(Park et al., 1993; Kang and Hershey, 1994; Park et al., 1997). Instead, hypusine-containing eIF-

5A has been shown to stabilize mRNA and transport of specific subsets of mRNA from the

nucleus to the cytoplasm (Bevec and Hauber, 1997; Zuk and Jacobson, 1998). In yeast, a

temperature sensitive mutant ts1159, which carries a mutation in the eIF-5A/TIF51A gene, causes

the accumulation of uncapped mRNAs at the non-permissive temperature, suggesting that eIF-5A

is critical for mRNA turnover, possibly acting downstream of decapping (Zuk and Jacobson,

1998). The involvement of eIF-5A in the translocation of RNA has also been documented (Bevec



6

and Hauber, 1997; Rosorius et al., 1999; Caraglia et al., 2001). In agreement with these

observations, the solved crystal structure of eIF5A is characteristics of some RNA binding

proteins (Murzin, 1993), such as cold shock protein CspA (Schindelin et al., 1994) and the E. coli

translation initiation factor IF1 (Sette et al., 1997). Moreover, binding of eIF-5A to RNA requires

hypusine on the protein and appears to be sequence-specific to two core motifs of the targets (Xu

and Chen, 2001). On the other hand, eIF5A was also found to interact with distinctive cellular

proteins, including the exportin protein CRM1 (Chromosome Region Maintenance 1) (Rosorius et

al., 1999), exportin 4 (Lipowsky et al., 2000), nucleoporins (Hofmann et al., 2001), tissue

transglutaminase II (Singh et al., 1998), syntenin (Li et al., 2004), deoxyhypusine synthase and

Lia1 (Ligand of eIF5A) (Thompson et al., 2003). On the basis of these observations, eIF5A was

proposed to function as a bimodular protein capable of binding to both RNA and proteins (Liu et

al., 1997; Jao and Chen, 2005), thus involved in multiple aspects of cellular signaling activities.

In plants, genes encoding eIF-5A and DHS have been cloned from several species. Similar to

their mammalian and yeast counterparts, a tomato eIF-5A recombinant protein can be

deoxyhypusine-modified by a DHS recombinant protein (Wang et al., 2001). Whereas a direct

functional analysis of eIF-5A in planta has not been reported, suppression of DHS expression,

which presumably causes partial inactivation of eIF-5A, has gained important information on the

eIF-5A function. In Arabidopsis, constitutive overexpression of an antisense DHS cDNA causes

delayed senescence and resistance to drought stress (Wang et al., 2003). Similarly, in tomato,

overexpression of an antisense DHS construct results in delayed fruit softening and leaf

senescence (Wang et al., 2005). In addition, because expression of both DHS and eIF-5A appears

to be correlated with senescence or stress (Wang et al., 2001; Wang et al., 2003; Wang et al.,

2005), it has been proposed that different isoforms of eIF-5A may facilitate the translation of

mRNAs required for cell division and cell death, thereby regulating plant growth and development

(Thompson et al., 2004). In this study, we report functional characterization of an Arabidopsis

eIF-5A gene. A loss-of-function mutation in the eIF-5A-2 gene causes severely developmental

defects throughout the life cycle, characteristics of abnormal cell division, cell growth and cell

death. These results demonstrate the biological importance of eIF-5A in plant growth and

development.



7

RESULTS

Identification and genetic analysis of the fbr12 mutant

The fumonisin B1-resistant12 (fbr12) mutant was identified from a genetic screen of a

transferred DNA (T-DNA)-mutagenized population of approximate of 5,000 independent lines in

the pga22 mutant background (Sun et al., 2003; Sun et al., 2005). The pga22 mutant

(Wassilewskija or Ws accession) carries an estradiol-inducible T-DNA transcription activation tag

(Zuo et al., 2000) upstream from the isopentenyl transferase8 (AtIPT8/PGA22) gene. Expression

of AtIPT8/PGA22 gene is highly inducible by the chemical inducer estradiol, which causes the

overproduction of cytokinin in planta. However, the pga22 mutant shows a phenotype

indistinguishable from wild type (WT) plants in the absence of estradiol (Sun et al., 2003). We

have generated a T-DNA insertion population by transforming of pga22 mutant plants with a

second binary vector pTA231 (Sun et al., 2005). To screen fbr mutants, pooled T2 seeds (20 lines

per pool) were germinated on the MS medium (Murashige and Skoog, 1962) containing 0.8 µM

fumonisin B1 (FB1). The fbr12 mutant was identified from this screen, and showed strong

resistance to FB1 (Fig. 1A). The original mutant (T3) was backcrossed with WT (Ws) twice, and

the resulting F2 or F3 progenies that did not contain the pga22 mutation were used for all

experiments described below except for initial genetic analysis.

Because fbr12 was infertile (see below), we crossed putative fbr12/+ plants (in the pga22

background) with wild type (WT; Ws). In F2 progenies derived from self-pollinated F1 plants, the

FB1-resistant phenotype segregated in a 1:3 ratio (FB1 resistant:sensitive = 72:225; χ2 = 0.055,

p<0.01). When grown under normal growth conditions in the absence of FB1, fbr12 displayed

severe defects in plant growth and development (Fig. 1A; see below for details), and this

phenotype also segregated in a 1:3 ratio (fbr12:WT = 75:288; χ2 = 3.58, p<0.05). These results

indicate that the fbr12 mutation is recessive in a single nuclear locus. Because of lethality of the

mutation, fbr12 was maintained as heterozygous.

The fbr12 mutation alters FB1-mediated PCD

To investigate the cellular and molecular alterations induced by FB1 in fbr12, we first

compared the toxin-induced cell death by Trypan Blue staining. In WT leaves, FB1 induced

massive cell death. However, substantially reduced cell death was observed in fbr12 leaves (Fig.



8

1B). In some cases, no cell death was found in the mutant leaves treated by FB1 (data not shown).

We next examined nuclear DNA fragmentation, a molecular hallmark of apoptotic cells, in

protoplasts treated by FB1 using the TUNEL method. In untreated protoplasts derived from both

WT and fbr12, TUNEL positive signal was rarely detected. However, upon FB1 treatment,

whereas more than 90% of WT protoplasts showed TUNEL positive signals, less than 25% of

fbr12 protoplasts displayed distinctive positive signals under the identical assay conditions (Fig.

1C). At the molecular level, FB1 is known to induce the expression of PATHOGEN-RELATED

(PR) genes, and the induction is compromised in fbr1 and fbr2 mutants (Stone et al., 2000).

Similar to that of fbr1 and fbr2, FB1-induced expression of PR1 and PR5 was reduced in fbr12

(Fig. 1D). Collectively, data presented in Fig. 1 suggest that FB1-elicited PCD and/or defense

response is altered by the fbr12 mutation.

The fbr12 mutation causes pleiotropic phenotype during plant growth and development

The fbr12 mutant phenotype became apparent shortly after germination. Compared to WT,

fbr12 was substantially smaller and more slender, with significantly shorter roots. However, all

embryonic organs, including roots, hypocotyls and cotyledons, appeared to be well defined (Fig.

2A and 2B). The initiation of true leaves was substantially delayed in fbr12 (Fig. 2B). During later

growth stages, fbr12 displayed a stunted phenotype (Fig. 2C, 2E and 2F), producing less rosette

and cauline leaves that were smaller than those of WT (Fig. 2D and 2E). In addition, fbr12 plants

also had few flowers that were abnormally developed (Fig. 2F and 2G). Overall, fbr12 affected the

growth rate and organogenesis characteristics of dwarfism, a reduced leaf initiation rate and

reduced numbers of adult organs (Fig. 2H).

In fbr12, development of the floral organs was severely affected by the mutation. Compared

to WT, fbr12 plants produced fewer flowers (Fig. 2G and 2H), in which all floral organs displayed

various developmental defects. In general, all fbr12 floral organs were smaller than those of WT

(Fig. 3A). Compared to that of WT, sepals in fbr12 flowers were often misshapen, and

occasionally fused together. Petals in fbr12 flowers were smaller than that of WT (Fig. 3A).

Stamens and stigmas appeared to be morphologically normal. However, two lateral stamens were

usually absent in the mutant, and the gynoecium stigmatic papillae was shorter than that of WT

(see also below for more details on germline cell development). In WT Arabidopsis, a flower

consists of four sepals, four petals, six stamens and a carpel. Whereas a carpel was often found in

fbr12 flowers, other floral organ components had significantly reduced numbers in the mutant



9

compared to WT (Fig. 3C). In particular, the numbers of petals and stamens were altered more

dramatically by the fbr12 mutation, with less than 30% and 10% flowers producing correct

numbers of these organs, respectively (Fig. 3C). Approximately 50% of flowers form the correct

number (four) of sepals. As a result of these defects, fbr12 siliques were markedly shorter and did

not contain any seeds (Fig. 3B).

The fbr12 mutation affects cell proliferation and cell growth

To investigate the cellular basis of the fbr12 mutant phenotype, we analyzed the mutant by

microscopy. Light microscopy revealed that the structure of the shoot apical meristem (SAM) was

unaffected in fbr12, but SAM development was delayed compared to that of WT (Fig. 4A-4E).

Notably, nine-day-old fbr12 SAM appeared to be equivalent to that of six-day-old WT. A similar

observation was made by scanning electron microscopy (Fig. 4F-4J). These results suggest that the

fbr12 mutation may cause a slow division or growth rate of the meristem cells.

Transverse sections of stems revealed that fbr12, similar to that of WT, contained three

distinctive layers of cell files that include, from outside to inside, the epidermis, cortex and central

cylinder. Development of epidermal cells appeared to be unaffected in the fbr12 mutant. This

result suggests that the radial patterning remains relatively normal in fbr12. In the cortex, however,

cells were substantially enlarged in fbr12 compared to WT (Fig. 5A-5D). By contrast, the mutant

had smaller cells in the central cylinder than those of WT (Fig. 5A-5D). The central cylinder

contained the vascular bundles consisting of phloem and xylem. In xylem, fbr12 had an increased

number of cells that were smaller, presumably representing a group of incompletely differentiated

cells. Compared to that of WT, no distinctive cell layers were observed in the fbr12 phloem.

Moreover, both the number and the size of the phloem cells were greatly reduced (Fig. 5C and

5D). A quantative analysis also indicated that fbr12 had increased cell numbers in xylem and

parenchyma, but reduced cell numbers in phloem and cortex (Fig. 5E).

Scanning electron microscopy indicated that in fbr12 petals whereas the cell number remains

unaltered, the cell size is smaller than that of WT (Fig. 6A and 6B). A quantative analysis of cell

numbers in petals revealed that the total cell numbers remained nearly unaltered, but the cell size

was reduced in fbr12 (Fig. 6C), thus causing smaller petals. Collectively, these observations

indicate that the fbr12 mutation affects cell proliferation, cell growth and cell differentiation in

both vegetative and reproductive organs/tissues.



10

FBR12 is essential for male and female sporogenesis

The fbr12 mutant could grow and develop into matured plants with significantly smaller size,

which could not set any seeds. Reciprocal crosses between WT and fbr12 did not yield any F1

seeds, suggesting that the mutant was both male and female sterile. To reveal the cellular basis of

the sterile phenotype, we followed the entire reproductive developmental stages by light

microscopy and scanning electron microscopy.

During male germline cell development, no apparent defects were found in fbr12 before

stage 7 (anther development stages were defined according to Sanders et al., 1999). In WT, at this

stage, microspores are generated from pollen mother cells by meiosis, and are confined as tetrads

in a wall rich of callose, which, in turn, are contained in tapetum (Fig. 7A). In fbr12, tetrad cells

appeared to be correctly generated (Fig. 7D). At stage 8, a WT pollen sac contains three layers of

well-defined cell files, from outside to inside, epidermis, middle layer and the tapetum. Inside the

WT pollen sac, microspores are released from tetrads (Fig. 7B). At the same developmental stage,

the middle layer and tapetum of the fbr12 pollen sac became disorganized with excessive numbers

of cells that are irregularly shaped and stained darker compared to those in WT (Fig. 7B and 7E).

More severe defects were observed in later stages. In contrast to that of WT, no vacuole formation

was found in fbr12 microspores; instead, the microspores appeared to collapse, and eventually

formed dark-stained debris inside the disorganized tapetum (Fig. 7C and 7F). Consequently, in

mature anthers, no viable pollen grains were found in fbr12 by either toluidine blue O staining

(Fig. 7G and 7H) or scanning electron microscopy (Fig. 7I-7K).

During female gametophyte development, the fbr12 mutation also appears to express after

the meiosis, approximately at stage 2-III (ovule development stages are defined according to

Schneitz et al., 1995). In WT at this stage, meiosis is completed to give rise to four megaspores,

of which only one survives and undergoes three rounds of nuclear divisions to eventually form a

matured embryo sac. Meanwhile, the developing ovule grows toward the septum and the base of

the carpel, while both the inner and outer integuments are initiated (Fig. 8A and 8G). In fbr12, no

apparent defects were observed at this stage and a megaspore appeared to be normally formed in

the ovule (Fig. 8D and 8H). In WT, whereas the inner integument continues to grow

symmetrically, the outer integument starts an asymmetric growth throughout the development

(Fig. 8B), eventually leading to the formation of a hook-shaped, matured embryo sac (Fig. 8C and

8G). By contrast, both inner and outer integuments stopped further growth in fbr12 ovules (Fig. 8E

and 8H). Therefore, the ovule development was completely arrested at this stage.



11

We have also followed the entire reproductive development in fbr12/+ heterozygous plants.

An fbr12/+ plant should give rise to haploid germline cells carrying a mutant or a WT allele, with

approximately 50% of each genotype, respectively. On the other hand, the diploid sporophytic

tissues (e.g., tapetum and ovules) should be normally developed because of the recessive nature of

the mutation. No abnormally developed germline cells were observed in fbr12/+ plants, which

showed no difference in fertility compared to WT (data not shown). Moreover, in progenies

derived from self-pollinated fbr12/+ plants, the mutation was segregated in a 1:3 ratio

(mutant:WT; see above), characteristics of sporophytic mutations (Yang et al., 1999; McCormick,

2004). These results suggest that the fbr12 mutation only affects sporogenesis but not

gametogenesis. Similarly, no abnormality was observed in developing embryos of fbr12/+ plants.

Taken together, these results suggest that FBR12 is essential for sporophytic development but

dispensable for gametogenesis and embryogenesis, and that defective gametogenesis is likely

caused by abnormal development of sporophytic tissues in the fbr12 mutant.

Molecular cloning of the FBR12 gene

The fbr12 mutant was identified from a T-DNA-mutagenized population, and the mutant

genome appears to contain a single T-DNA insertion. We identified the genomic sequences

flanking the Left Border (LB) by Thermal Asymmetric Interlaced-Polymerase Chain Reaction

(TAIL-PCR) (Liu et al., 1995). DNA sequencing analysis indicated that the LB was inserted in the

coding sequence region of At1g26630, 9 base pairs (bp) upstream from the stop codon, whereas

the Right Border (RB) faced the 5’-end of the gene (Fig. 9A). A northern blot analysis did not

reveal any expression of At1g26630 in the mutant plants (Fig. 9B), suggesting that fbr12 is likely

a null mutation.

To verify the identity of FBR12, we carried out a molecular complementation experiment. A

2.5-kilobase pairs (Kb) WT genomic DNA fragment, which encompassed the promoter region, 5’-

UTR, the coding sequence and part of the 3’ UTR of At1g26630, was cloned into a binary vector

pER8 (Zuo et al., 2000). The resulting construct was then transformed into fbr12/+ heterozygous

plants via Agrobacterium tumefaciens-mediated transformation (Bechtold et al., 1993). Multiple

independent transgenic lines were obtained by double selection with BASTA (carried by the fbr12

mutant) and hygromycin (carried by pER8). In the tested 20 T2 lines, all hygromycin-resistant

plants displayed a normal phenotype. In T3 lines derived from BASTA- and hygromycin-resistant

T2 plants, we analyzed 4 families that did not show segregation of either the selective markers



12

(BASTA and hygromycin) or the fbr12 phenotype. PCR analysis revealed that all tested plants

(24) were homozygous for the T-DNA insertion at the At1g26630 locus. In these transgenic

plants, the transgene fully rescued the developmental defects (Fig. 9D and 9F), and restored the

sensitivity of the mutant to FB1 (Fig. 9E). These data suggest that the At1g26630 transgene was

able to fully complement the fbr12 mutant phenotype, thus representing FBR12.

FBR12 encodes a functional translation initiation factor 5A-2 (eIF 5A-2)

Database search identified a full-length FBR12 cDNA clone (accession number:

NM_102425). Comparison of the cDNA and genomic sequences revealed an open reading frame

(ORF) interrupted by four introns (Fig. 9A). The ORF encodes a polypeptide of 159 amino acid

residues, with a predicted molecular mass of 17.1 kilo Daltons and a pI of 5.8. Sequence

comparison revealed that FBR12 encodes a putative eukaryotic translation initiation factor eIF-5A-

1 (accession number: NP_173985; also annotated by The Arabidopsis Information Resources) or

eIF-5A-2 (accession number: Q93VP3 and BE039424) (Thompson et al., 2004). Hereafter, we

refer to this protein as FBR12 or eIF-5A-2 according to Thompson et al. (2004).

Consistent with the pleiotropic phenotype of fbr12, FBR12 appears to be ubiquitously

expressed in all examined tissues and organs (Fig. 9C). Members of the eIF-5A family are highly

conserved across different kingdoms of eukaryotic organisms cells (Jenkins et al., 2001). The

Arabidopsis genome contains two additional FBR12/eIF-5A-like genes, At1g69410 and

At1g13950, which encode proteins sharing 86% and 82% identity with FBR12, respectively. In

addition, FBR12 shares significant homology with representative eIF-5A proteins from other

species, including rice (79%; accession number: AAK1617679), mammals (human and mouse; 51-

54%), Drosophila (54%, accession number: AAG17032), C. elegans (55%, accession number:

NP_499152), S. cerevisiae (57%; accession number: NP_012581) and S. pombe (52%, accession

number: CAB16195).

To functionally characterize FBR12, we carried out a genetic complementation experiment in

a S. cerevisiae mutant strain ts1159. This strain carries a temperature-sensitive mutation in an eIF-

5A gene TIF51A that renders the mutant to grow only under the permissive temperature (24oC)

(Zuk and Jacobson, 1998). An FBR12 cDNA containing the entire ORF was cloned into a yeast

expression vector under the control of the GAL1 promoter that can be induced by galactose but

repressed by glucose. The resulting construct pYES2-FBR12 was transformed into ts1159. The

transformed ts1159 cells were able to grow at the nonpermissive temperature (36oC) in the



13

presence of the galactose inducer but not the glucose repressor (Fig. 10). Therefore, inducible

expression of an FBR12 cDNA is able to fully rescue the growth defects of ts1159 caused by a

mutation in the yeast eIF-5A gene. This result demonstrates that FBR12 is a functional eIF-5A.

The fbr12 mutation delays dark-induced leaf senescence

Previous studies showed that overexpression of antisense DHS in Arabidopsis and tomato

resulted in delayed leaf senescence. Because DHS is essential for hypusination of eIF5A proteins,

these transgenic phenotype was attributed to the inactivation of eIF5A proteins by knocking down

the DHS expression (Wang et al., 2003; Wang et al., 2005). To investigate the possible role of

FBR12/eIF5A-2 in regulating senescence, we compared the dark-induced leaf senescence in the

mutant and WT plants.

Fully expanded leaves detached from fbr12 and WT plants were placed in the dark, and their

senescence rates were analyzed. Under the assay conditions, leaves derived from WT plants

showed apparent dark-induced senescence syndrome at day 7 and became complete bleach at day

10. Under the identical assay conditions, leaves derived from fbr12 mutant plants displayed a

slower senescence rate (Fig. 11A). To quantatively analyze of the senescence rate, we measured

the chlorophyll levels in fully expanded leaves of WT and fbr12. Under normal growth

conditions, the chlorophyll level was slightly lower in fbr12 leaves compared to that of WT.

However, the dark treatment caused a greater loss of chlorophylls in WT leaves (37% at day, 47%

at day 7 and 80% at day 10) compared to that of fbr12 mutant leaves at the same stages (17% at

day 4, 33% at day 7 and 48% at day 10) (Fig. 11B). Taken together, these results suggest that

FBR12/eIF5A-2 is involved in the regulation of senescence-type PCD in Arabidopsis.

DISCUSSION

In this study, we present evidence showing that the Arabidopsis FBR12 gene encodes a

functional eIF5A that is involved in the regulation of cell proliferation, cell growth and cell death.

FBR12 shares significant homology with eIF-5A proteins characterized across different kingdoms.

Moreover, an FBR12 cDNA clone was able to fully complement the temperature-sensitive lethal



14

phenotype of yeast ts1159 cells carrying a mutation in the TIF51A/eIF-5A gene. These results

demonstrate that FBR12 is a functional eIF-5A.

The eIF-5A protein was originally characterized as a component of the translation initiation

complex. However, recent studies suggest that this class of highly conserved proteins is involved

in RNA metabolism and RNA trafficking (Bevec and Hauber, 1997; Zuk and Jacobson, 1998;

Thompson et al., 2004), although very limited evidence is available for the proposed biochemical

function of eIF-5A proteins. Nevertheless, because of its fundamental cellular function, eIF-5A

has been shown to be required for growth and development in several organisms. In both yeast and

mammalian cells, eIF-5A is essential for cell proliferation (Kang and Hershey, 1994; Park et al.,

1993; Park et al., 1994). In Caenorhabditis elegans, two copies of eIF-5A homologues, IFF-1 and

IFF-2, were identified. Knockout of iff-2 results in slow larval growth and disorganized somatic

gonadal structures in hermaphrodites, whereas the lack of IFF-1 activity causes sterility with an

under-proliferated germline cells. Double mutants of iff-1/iff-2 displayed a slightly stronger

phenotype than single mutants but did not affect the viability of the animal (Hanazawa et al.,

2004). In Arabidopsis, we found that a loss-of-function mutation in the FBR12/eIF-5A-2 gene

causes more severe defects, including an underdeveloped SAM, reduced sizes and numbers of all

adult organs, defective development of floral organs and abnormal sporogenesis. Nevertheless, the

loss of eIF-5A activity in both organisms shows some phenotypical similarities, characteristics of

slow growth and defects in reproductive development. On the other hand, we notice that

gametogenesis and embryogenesis appear to be unaffected by the fbr12 mutation, suggestive of

the presence of germline- and/or embryo-specific eIF-5A activities. A similar view is also shared

by Thompson et al. (2004), who proposed that different isoforms of eIF-5A function distinctively

in the regulation of cell divisions and cell death. This notion is reinforced by the observation that a

null mutation in an Arabidopsis homologous gene eIF-5A-3 (SALK_022515) does not have

substantial effects on plant growth and development (H. Feng, J. Feng and J. Zuo, unpublished

data). These results suggest that FBR12 represents a major eIF-5A-2 activity during plant growth

and development.

The extreme dwarf phenotype of the fbr12 mutant may be caused by a reduced cell division

and/or cell growth. Microscopic studies suggest that both cell division and cell growth are affected

by the fbr12 mutation. However, the regulatory roles of FBR12 in cellular activities appear to be

cell-type- or tissue-specific with distinctive mechanisms. In stem development, for example, no

apparent abnormality was observed in the epidermal cell layer, but various defects were found in



15

the cortex and the central cylinder. More strikingly, the FBR12 gene appears to function

differently, characteristics by inhibiting cell growth in the cortex but promoting cell growth in the

central cylinder. In a similar mode, the fbr12 mutation causes increased cell numbers in xylem and

parenchyma but reduced cell numbers in phloem and cortex. These observations suggest that

FBR12 regulates cell division and cell growth in a tissue- and development-specific manner. We

notice that fbr12 shows some phenotypic similarity with fbr6, whose WT allele encodes a

transcription activator AtSPL14 (Stone et al., 2005). In particular, both fbr6 and fbr12 affect

vascular tissue development, suggesting that they may act in a linear pathway. It will be interesting

to analyze the possible interaction of these two loci.

In addition to its role in cell division and cell growth, FBR12 also appears to play a role in

regulating cell death. Similar to other fbr mutants, fbr12 shows resistance to FB1 with substantially

reduced cell death induced by the toxin. Compared to WT, fbr12 protoplasts showed substantially

less DNA fragmentation induced by FB1, suggesting that FBR12/eIF-5A-2, similar to its

mammalian homologs, is likely involved in the regulation of apoptotic cell death. Because FB1 is

known to inhibit ceramide synthase, thereby perturbing sphingolipid metabolism (Wang et al.,

1991; Abbas et al., 1994; Gilchrist et al., 1994), FBR12 may be involved in the regulation of a

subset of RNA responsible for sphingolipid metabolism or signaling. In addition to the anti-

apoptotic phenotype induced by FB1, fbr12 also shows a delayed leaf senescence induced by dark,

another form of PCD in plant cells. This phenotype is consistent with two earlier observations

made in Arabidopsis (Wang et al., 2003) and tomato (Wang et al., 2005), in which antisense

suppression of DHS, that presumably inactivates eIF-5A by blocking hypusination, leads to

delayed senescence and tolerance to stresses. However, because fbr12 grows slower than WT

plants, we could not exclude the possibility that the delayed senescence in the mutant is partly

attributed to a slower initiation of the developmental program induced by dark. Nevertheless, in

parallel to these findings in plants, the hypusination activity on eIF-5A was significantly reduced

during senescence of IMR-90 human diploid fibroblasts (Chen and Chen, 1997). Taken together,

these observations suggest that FBR12 and/or other eIF-5A genes may be directly or indirectly

involved in the regulation of distinctive forms of cell death in plants.

In conclusion, FBR12/eIF-5A-2 plays a critical role in plant growth and development by

regulating cell division, cell growth and cell death. The identification of the fbr12 mutant provides

unique materials to functionally characterize this class of highly conserved proteins in eukaryotic

organisms. Clearly, the identification and characterization of direct targets of FBR12/eIF-5A-2



16

will be critical to better understand its function.

MATERIALS AND METHODS

Plant materials, growth conditions and genetic screen for fbr mutants

The Wassilewskija (Ws) ecotype of Arabidopsis thaliana was used in this study unless

otherwise indicated. Plants were grown under a 16/8-hour light/dark cycle (white light; 120 µmol

m-2 s-1) at 22oC in soil or on an MS medium (1 X MS salts, 3% sucrose, 0.8% agar) as described

previously (Sun et al., 2003).

A T-DNA-mutagenized population of approximate 5,000 independent lines was generated in

the pga22 (Ws) background (Sun et al., 2003; Sun et al., 2005). These T-DNA insertion lines were

screened for FB1-resistant fbr mutants as described (Stone et al., 2000). T2 seeds were germinated

and grown on MS medium containing 0.8 µM FB1 (purchased from Sigma, Sigma Hong Kong

China) under continues white light for 1-2 weeks. Putative fbr mutants were identified and then

transferred onto a fresh MS medium without FB1. From this screen, two fbr mutants were

identified. The fbr12 mutant (originally named as p250) was out-crossed with wild type plants

(Ws) twice to segregate out the pga22 mutation, and F2 or F3 progenies in the Ws background

lacking the pga22 mutation were used in all experiments.

Protoplast preparation, detection nuclear DNA fragmentation and detection of cell death

Leaves were collected from 4-5-week-old seedlings, and protoplasts were prepared according

to Danon and Gallois (1998). In situ detection of nuclear DNA fragmentation was performed as

described (Danon and Gallois, 1998) with minor modifications. The TUNEL reaction was carried

out in an Eppendorf tube by using the In Situ Cell Death Detection Kit (Roche Diagnostics Hong

Kong) according to the manufacture’s instructions. Nuclear DNA was stained with Hoechst 33342

(Sigma; 5 mg/mL). After staining, the samples were mounted on a polylysine slide and visualized

using a fluorescent microscope.

Cell death was analyzed by Trypan Blue staining as described (Mou et al., 2000).

Light and electron microscopic analyses



17

Semithin sections were prepared and analyzed as described with minor modifications (Yang

et al., 1999). Briefly, samples were fixed in 2.5% glutaraldehyde, 0.2M sodium phosphate buffer,

pH 7.2 at 4°C overnight, and then post-fixed in 1% osmium tetroxide for 2 h at 4°C. After

dehydrated in an acetone and graduated ethanol series, the samples were embedded in Spurr’s

resin (Sigma, Sigma Hong Kong China). Semithin sections (2 µm) were stained with 0.1% (w/v)

toluidine blue O and observed under a light microscope. For differential interference contrast

observations, young flower buds were cleared with Herr’s solution (Herr, 1971), and then analyzed

under an inverted light microscope. Pollen grains were stained by 0.1% (w/v) toluidine blue O.

For scanning electron microscopic analysis, samples were fixed, post-fixed and dehydrated

as described above. After critical point dried in liquid CO2 and mounted, the samples were sputter-

coated with gold in an E-100 ion sputter (Mito City, Japan), and then observed under a scanning

electron microscope (Model S-570, Hitachi, Tokyo, Japan).

For comparison of cell size and numbers, the distal portion of the petal epidermis or stem

sections was analyzed as described (Mizukami and Ma, 1992; Mizukami and Fischer, 2000). For

statistical analysis, images were photographed with an Olympus digital camera, and then analyzed

using Image-Pro Plus 5.1. Statistical calculations were performed with Microsoft Excel.

Analysis of leaf senescence and measurement of chlorophylls

Fully expanded leaves collected from 4-week-old WT or fbr12 plants were used for the

analysis of dark-induced leaf senescence essentially as described (Guo and Crawford, 2005). Total

chlorophyll was extracted from dark-treated or not-treated leaves and analyzed as described

(Lichtenthaler, 1987).

Molecular complementation of the fbr12 mutant phenotype

The T-DNA tagged genomic sequence in the fbr12 genome was identified by TAIL-PCR as

previously described (Liu et al., 1995; Sun et al., 2003). For molecular complementation, a 2.5-Kb

FBR12 genomic clone was obtained by PCR using primer pairs (FBR12F1: 5’

CCTCGAGGTGGGGCCGCATGGAATGCA 3’ and FBR12B1: 5’

CACTAGTCACTCTTGAATCGTGCA 3’) and PWO DNA polymerase (Roche Diagnostics Hong

Kong, Hong Kong). The genomic clone included a 1.1-kb sequence upstream from the translation

start codon and 0.3 kb of the 3’-UTR sequence. The PCR fragment, digested with XhoI and SpeI,

was cloned into the same sites of pER8 (Zuo et al., 2000). The resulting construct was transformed



18

into A. tumefaciens strain GV3101, which was used for transformation of fbr12/+ heterozygous

plants by vacuum infiltration (Bechtold et al., 1993).

All other molecular manipulations were carried out according to standard methods

(Sambrook and Russell, 2001). RNA Northern blotting and real-time PCR analyses were carried

out as described previously (Sun et al., 2003; Feng et al., 2006). Semi-quantative RT-PCR was

performed as previously described (Sun et al., 2005). Actin 8 (At1g49240) was used as an internal

control in all assays. Primer pairs used in the RT-PCR analyses were (all sequences are from 5’end

to 3’end): AT1G11980F: GAGTTCTTCTTCTTCCTCCA and AT1G11980R:

GAAACCGGTCGAGCCAGTGA; AT3G59845F: GGTGAGGAATCTTTACTTGT and

AT3G59845R: GTAGCTGAGAGGAACATTGA; AT5G03840F: CCATGAGCTCTTTCCTTCT

and AT5G03840R: GTGTTGAAGTGATCTCTCGA; FBR12F:

TCAAAAACCGTCCCTGCAAGGT and FBR12R: CATTTGGCGTGACCGTGCTT; Actin8F:

TTGCAGACCGTATGAGCAAAGAGA and Actin8R: TGGTGCCACGACCTTAATCTTCA.

Genetic complementation in yeast cells

An FBR12 cDNA fragment was PCR-amplified using primer pairs (AT1G26630F2: 5’

CCCCGGGATGTCTGACGACGAGCACCA 3’ and AT1G26630B2: 5’

CACTAGTTGACGTCCGTTGTCAAACTGGT 3’), and then cloned into a pGEM-T Easy vector

(Promega, Madison, Wisconsin, USA). This cDNA fragment, containing the entire ORF of FBR12

and 32 bp of 3’-UTR, was verified by DNA sequencing. The insert was released by SmaI and PstI

digestion, and cloned into the same sites of a pQE-82L vector (Qiagen, Hilden, Germany). The

cDNA fragment released from pQE-FBR12 by SacI and SpeI was cloned into the SacI and XbaI of

a pYES2 vector (Invtriogen, Carlsbad, California, USA) under the control of a GAL1 promoter.

Therefore, the FBR12 expression in yeast cells is inducible by galactose and repressible by glucose

(West et al., 1984; Giniger et al., 1985). Culture and transformation of yeast cells were carried out

according to standard protocols (Ausubel et al., 1994).

ACKNOWLEDGMENTS

We would like to thank the Arabidopsis Biological Resources Center for providing seeds and



19

Dr. Allan Jacobson (University of Massachusetts Medical School, USA) for providing yeast

strains. We would like to thank Dr. Yongbiao Xue and Dr. De Ye for critically reading the

manuscript. We are grateful to Dr. Weicai Yang for valuable advice on microscopic studies.



20

LITERATURES CITED

Abbas HK, Tanaka T, Duke SO, Porter JK, Wray EM, Hodges L, Sessions AE, Wang E,

Merrill Jr AH, Riley RT (1994) Fumonisin- and AAL-toxin-induced disruption of

sphingolipid metabolism with accumulation of free sphingoid bases. Plant Physiol. 106:

1085-1093

Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1994)

Current Protocols in Molecular Biology. Greene Publishing Associates and Wiley-

Interscience, New York

Bechtold N, Ellis J, Pelletier G (1993) In planta Agrobacterium-mediated gene transfer by

infiltration of adult Arabidopsis thaliana plants. C R Acad Sci Ser III Sci Vie 316: 1194-

1199

Bevec D, Hauber J (1997) Eukaryotic initiation factor 5A activity and HIV-1 Rev function. Biol

Signals: 124-133

Caraglia M, Marra M, Giuberti G, D'Alessandro AM, Budillon A, del Prete S, Lentini A,

Beninati S, Abbruzzese A (2001) The role of eukaryotic initiation factor 5A in the control

of cell proliferation and apoptosis. Amino Acids 20: 91-104

Chen ZP, Chen KY (1997) Dramatic attenuation of hypusine formation on eukaryotic initiation

factor 5A during senescence of IMR-90 human diploid fibroblasts. J Cell Physiol 170: 248-

254

Danon A, Gallois P (1998) UV-C radiation induces apoptotic-like changes in Arabidopsis

thaliana. FEBS Lett 437: 131-136

Feng H, An F, Zhang S, Ji Z, Ling H-Q, Zuo J (2006) Light-regulated, tissue-specific, and cell

differentiation-specific expression of the Arabidopsis Fe(III)-chelate reductase gene AtFRO6.

Plant Physiol. 140: 1345-1354

Gilchrist DG, Wang H, Bostock RM (1994) Sphingosine-related mycotoxins in plant and animal

diseases. Can J Bot 73: S459-S467

Giniger E, Barnum SM, Ptashne M (1985) Specific DNA binding of GAL4, a positive

regulatory protein of yeast. Cell 40



21

Guo F-Q, Crawford NM (2005) Arabidopsis nitric oxide synthase1 is targeted to mitochondria

and protects against oxidative damage and dark-induced senescence. Plant Cell 17: 3436-

3450

Hanazawa M, Kawasaki I, Kunitomo H, Gengyo-Ando K, Bennett KL, Mitani S, Iino Y

(2004) The Caenorhabditis elegans eukaryotic initiation factor 5A homologue, IFF-1, is

required for germ cell proliferation, gametogenesis and localization of the P-granule

component PGL-1. Mech Dev 121: 213-224

Herr JM (1971) A new clearing-squash technique for the study of ovule development in

angiosperms. Am J Bot 58: 785-790

Hofmann W, Reichart B, Ewald A, Muller E, Schmitt I, Stauber RH, Lottspeich F, Jockusch

BM, Scheer U, Hauber J, Dabauvalle MC (2001) Cofactor requirements for nuclear export

of Rev response element (RRE)- and constitutive transport element (CTE)-containing

retroviral RNAs. An unexpected role for actin. J Cell Biol 152: 895-910

Jao DL-E, Chen KY (2005) Tandem affinity purification revealed the hypusine-dependent

binding of eukaryotic initiation factor 5A to the translating 80S ribosomal complex. J Cell

Biochem: in press

Jin BF, He K, Wang HX, Wang J, Zhou T, Lan Y, Hu MR, Wei KH, Yang SC, Shen BF,

Zhang XM (2003) Proteomic analysis of ubiquitin-proteasome effects: insight into the

function of eukaryotic initiation factor 5A. Oncogene 22: 4819-4830

Kang HA, Hershey JW (1994) Effect of initiation factor eIF-5A depletion on protein synthesis

and proliferation of Saccharomyces cerevisiae. J. Biol. Chem. 269: 3934-3940

Kang HA, Schwelberger HG, Hershey JW (1993) Translation initiation factor eIF-5A, the

hypusine-containing protein, is phosphorylated on serine in Saccharomyces cerevisiae. J.

Biol. Chem. 268: 14750-14756

Kemper WM, Berry KW, Merrick WC (1976) Purification and properties of rabbit reticulocyte

protein synthesis initiation factors M2Bα and M2Bβ. J. Biol. Chem. 251: 5551-5557

Li A-L, Li H-Y, Jin B-F, Ye Q-N, Zhou T, Yu X-D, Pan X, Man J-H, He K, Yu M, Hu M-R,

Wang J, Yang S-C, Shen B-F, Zhang X-M (2004) A novel eIF5A complex functions as a

regulator of p53 and p53-dependent apoptosis. J. Biol. Chem. 279: 49251-49258

Lichtenthaler HK (1987) Chlorophylls and carotenoids—Pigments of photosynthetic

biomembranes. Methods Enzymol 148: 350-382



22

Lipowsky G, Bischoff FR, Schwarzmaier P, Kraft R, Kostka S, Hartmann E, Kutay U,

Gorlich D (2000) Exportin 4: A mediator of a novel nuclear export pathway in higher

eukaryotes. EMBO J 19: 4362-4371

Liu YG, Mitsukawa N, Oosumi T, Whittier RF (1995) Efficient isolation and mapping of

Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR. Plant J

8: 457-463

Liu YP, Nemeroff M, Yan YP, Chen KY (1997) Interaction of eukaryotic initiation factor 5A

with the human immunodeficiency virus type 1 Rev response element RNA and U6 snRNA

requires deoxyhypusine or hypusine modification. Biol Signals 6: 166-174

McCormick S (2004) Control of male gametophyte development. Plant Cell 16: S142-S153

Mizukami Y, Fischer RL (2000) Plant organ size control: AINTEGUMENTA regulates growth

and cell numbers during organogenesis. Proc Nat Acad Sci USA 97: 942-947

Mizukami Y, Ma H (1992) Ectopic expression of the floral homeotic gene AGAMOUS in

transgenic Arabidopsis plants alters floral organ identity. Cell 71: 119-131

Mou Z, He Y, Dai Y, Liu X, Li J (2000) Deficiency in fatty acid synthase leads to premature cell

death and dramatic alterations in plant morphology. Plant Cell 12: 405-418

Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco

tissue culture. Physiol Plant 15: 473-497

Murzin AG (1993) OB (oligonucleotide/oligosaccharide binding)-fold: Common structural and

functional solution for non-homologous sequences. EMBO J 12: 861-867

Park MH, Lee YB, Joe YA (1997) Hypusine is essential for eukaryotic cell proliferation. Biol

Signals 6: 115-123

Park MH, Wolff EC (1988) Cell-free synthesis of deoxyhypusine. Separation of protein substrate

and enzyme and identification of 1,3-diaminopropane as a product of spermidine cleavage. J.

Biol. Chem. 263: 15264-15269

Park MH, Wolff EC, Folk JE (1993) Hypusine: its post-translational formation in eukaryotic

initiation factor 5A and its potential role in cellular regulation. Biofactors 4: 95-104

Rosorius O, Reichart B, Kratzer F, Heger P, Dabauvalle MC, Hauber J (1999) Nuclear pore

localization and nucleocytoplasmic transport of eIF-5A: evidence for direct interaction with

the export receptor CRM1. J Cell Sci 112: 2369-2380

Sambrook J, Russell DW (2001) Molecular cloning: A Laboratory Manual. Cold Spring Harbor

Laboratory Press, Cold Spring Harbor, NY



23

Sanders PM, Bui AQ, Weterings K, McIntire KN, Hsu Y-C, Lee PY, Truong MT, Beals TP,

Goldberg RB (1999) Anther developmental defects in Arabidopsis thaliana male-sterile

mutants. Sex Plant Reprod 11: 297-322

Schatz O, Oft M, Dascher C, Schebesta M, Rosorius O, Jaksche H, Dobrovnik M, Bevec D,

Hauber J (1998) Interaction of the HIV-1 Rev cofactor eukaryotic initiation factor 5A with

ribosomal protein L5. Proc Nat Acad Sci USA 95: 1607-1612

Schindelin H, Jiang W, Inouye M, Heinemann U (1994) Crystal structure of CspA, the major

cold shock protein of Escherichia coli. Proc Nat Acad Sci USA 91: 5119-5123

Schneitz K, Hülskamp M, Pruitt RE (1995) Wild-type ovule development in Arabidopsis

thaliana: a light microscope study of cleared whole-mount tissue. Plant J 7: 731-749

Sette M, van Tilborg P, Spurio R, Kaptein R, Paci M, Gualerzi CO, Boelens R (1997) The

structure of the translational initiation factor IF1 from E. coli contains an oligomer-binding

motif. EMBO J 16: 1436-1443

Singh US, Li Q, Cerione R (1998) Identification of the eukaryotic initiation factor 5A as a

retinoic acid-stimulated cellular binding partner for tissue transglutaminase II. J Biol Chem

273: 1946-1950

Stone JM, Heard JE, Asai T, Ausubel FM (2000) Simulation of fungal-mediated cell death by

fumonisin B1 and selection of fumonisin B1-resistant (fbr) Arabidopsis mutants. Plant Cell

12: 1811-1822

Stone JM, Liang X, Nekl ER, Stiers JJ (2005) Arabidopsis AtSPL14, a plant-specific SBP-

domain transcription factor, participates in plant development and sensitivity to fumonisin

B1. Plant J 41: 744-754

Sun J, Hirose N, Wang X, Wen P, Xue L, Sakakibara H, Zuo J (2005) Arabidopsis

SOI33/AtENT8 gene encodes a putative equilibrative nucleoside transporter that is involved

in cytokinin transport in planta. J Integrative Plant Biol 47: 588-603

Sun J, Niu Q-W, Tarkowski P, Zheng B, Tarkowska D, Sandberg G, Chua N-H, Zuo J

(2003) The Arabidopsis AtIPT8/PGA22 gene encodes an isopentenyl transferase that is

involved in de novo cytokinin biosynthesis. Plant Physiol 131: 167-176

Thompson GM, Cano VS, Valentini SR (2003) Mapping eIF5A binding sites for Dys1 and Lia1:

In vivo evidence for regulation of eIF5A hypusination. FEBS Lett 555: 464-468



24

Thompson JE, Hopkins MT, Taylor C, Wang TW (2004) Regulation of senescence by

eukaryotic translation initiation factor 5A: implications for plant growth and development.

Trend Plant Sci. 9: 174-179

Tome ME, Gerner EW (1997) Cellular eukaryotic initiation factor 5A content as a mediator of

polyamine effects on growth and apoptosis. Biol Signals 6: 150-156

Wang E, Norred WP, Bacon CW, Riley, R.T., Merrill AHJ (1991) Inhibition of sphingolipid

biosynthesis by fumonisins. Implications for diseases associated with Fusarium moniliforme.

J Biol Chem 266: 14486-14490

Wang T-W, Lu L, Wang D, Thompson JE (2001) Isolation and characterization of senescence-

induced cDNAs encoding deoxyhypusine synthase and eucaryotic translation initiation factor

5A from tomato. J. Biol. Chem. 276: 17541-17549

Wang T-W, Lu L, Zhang C-G, Taylor C, Thompson JE (2003) Pleiotropic effects of

suppressing deoxyhypusine synthase expression in Arabidopsis thaliana Plant Mol Biol 52:

1223-1235

Wang T-W, Zhang C-G, Wu W, Nowack LM, Madey E, Thompson JE (2005) Antisense

suppression of deoxyhypusine synthase in tomato delays fruit softening and alters growth

and development. Plant Physiol. 138: 1372-1382

West RWJ, Yocum RR, Ptashne M (1984) Saccharomyces cerevisiae GAL1-GAL10 divergent

promoter region: location and function of the Upstream Activator Sequence UASG. Mol. Cell

Biol. 4: 2467-2478

Wolff EC, Park MH, Folk JE (1990) Cleavage of spermidine as the first step in deoxyhypusine

synthesis. The role of NAD. J. Biol. Chem. 265: 4793-4799

Xu A, Chen KY (2001) Hypusine is required for a sequence-specific interaction of eukaryotic

initiation factor 5A with postsystematic evolution of ligands by exponential enrichment

RNA. J. Biol. Chem. 276: 2555-2561

Yang W-C, Ye D, Xu J, Sundaresan V (1999) The SPOROCYTELESS gene of Arabidopsis is

required for initiation of sporogenesis and encodes a novel nuclear protein. Genes & Dev.

13: 2108-2117

Zuk D, Jacobson A (1998) A single amino acid substitution in yeast eIF-5A results in mRNA

stabilization. EMBO J 17: 2914-2925

Zuo J, Niu QW, Chua NH (2000) An estrogen receptor-based transactivator XVE mediates

highly inducible gene expression in transgenic plants. Plant J 24: 265-273



25

FIGURE LEGENDS

Fig. 1 The fbr12 mutant shows an FB1-resistant phenotype and reduced PR gene expression

(A) Two-week-old seedlings of WT (Ws) and fbr12 germinated and grown in MS medium in the

absence or presence of 0.8 µM of FB1. Bar, 5 mm.

(B) Cell death induced by FB1 in WT and fbr12 plants. Three-week-old seedlings were treated

with DMSO (0.05%; control) or 2 µM FB1 for 24 hours. Leaves were collected and stained

with Trypan blue. Black staining represents dead or dying cells.

(C) Nuclear DNA fragmentation induced by FB1 in WT and fbr12. Protoplasts prepared from WT

and fbr12 leaves were treated with DMSO (0.002%; control) or 50 nM FB1 for 12 hours, and

then analyzed by the TUNEL staining as described in Materials and Methods. TUNEL

positive cells were counted under a fluorescent microscope (n>1,000 in each experiment).

Data presented were mean values of three independent experiments. Bars represent standard

errors.

(D) FB1-induced expression of PR1 and PR5 genes. Total RNA was prepared from three-week-old

seedlings treated with 3 µM FB1 for various times as indicated, and used for Northern blot

analysis. Each lane contains 15 µg of RNA. The blot was hybridized with a full-length PR1 or

PR5 cDNA probe, respectively.

Fig. 2 Defective growth and development in fbr12

(A) Four-day-old seedlings of WT (Ws; left) and fbr12 (right) germinated and grown in MS

medium under continuous white light. No substantial difference between WT and fbr12 is

observed at this stage. Bar, 1 mm.

(B) Ten-day-old seedlings of WT (Ws; left) and fbr12 (right) germinated and grown in MS

medium under continuous white light. Bar, 5 mm.

(C) Four-week-old plants of WT (Ws; left) and fbr12 (right) germinated and grown in soil under

continuous white light. Bar, 5 mm.

(D) Rosette leaves collected from four-week-old plants of WT (Ws; top) and fbr12 (bottom)

germinated and grown in soil under continuous white light. Bar, 5 mm.



26

(E) Seven-week-old plants of WT (Ws; left) and fbr12 (right) germinated and grown in soil under

continuous white light. Bar, 2 cm.

(F) An enlarged view of an fbr12 plant shown in (E). The plant was germinated and grown in soil

under continuous white light for approximate seven weeks. Bar, 2 cm.

(G) A comparison of WT (left) and fbr12 (right) floral inflorescences derived from six-week-old

plants germinated and grown in soil under continuous white light. Bar, 2 mm.

(H) Analysis of growth rates of adult organs of WT and fbr12 plants germinated and grown in soil

under continuous white light. Leaf initiation rate was calculated as the numbers of new leaves

produced per day between the second and the seventh true leaves. Total number of leaves

refers to rosette leaves 40 days after germination. Total number of flowers refers to flowers at

stage 12 and above (flower development stages are defined according to Sanders et al., 1999).

At least 30 plants were analyzed in each experiment and average values were shown. Bars

denote standard errors.

Fig. 3 Developmental defects in the fbr12 floral organs

(A) A comparison of WT and fbr12 flowers at different development stages. Bar, 5 mm.

(B) A comparison of WT and fbr12 siliques. Bar, 5 mm.

(C) Reduced numbers of floral organs in the fbr12 mutant. The X axis indicates the distribution of

the floral organ numbers in the examined fbr12 flowers (n=105). Floral organ numbers of WT

flowers are marked by asterisks above corresponding bars.

Fig. 4 Delayed development of the shoot apical meristem in fbr12

(A) through (E) Light microscopy of longitude sections of WT and fbr12 seedlings.

(A) A four-day-old WT seedling.

(B) A six-day-old WT seedling.

(C) A four-day-old fbr12 seedling. The dome-structured SAM is smaller than that of WT in the

same stage shown in (A), although apparent morphological alterations are not observed at this

stage (see also Fig. 2A).

(D) A six-day-old fbr12 seedling. Compared to WT at the same developmental stage shown in (B),

a delayed initiation of true leaf projections is observed.

(E) A nine-day-old fbr12 seedling showing a development stage equivalent to that of 6-day-old

WT seedlings shown in (B).



27

(F) through (J) Scanning electron microscopy of the shoot apical meristems of WT and fbr12.

(F) A four-day-old WT seedling.

(G) A six-day-old WT seedling.

(H) A four-day-old fbr12 seedling.

(I) A six-day-old fbr12 seedling showing a phenotype similar to that of four-day-old WT in (F).

(J) A nine-day-old fbr12 seedling that appears to be in a development stage equivalent to that six-

day-old WT seedlings shown in (G).

Bar, 20 µm (A-E) and 50 µm (F-J).

Fig. 5 Cellular defects in the fbr12 mutant

(A) through (D) Light microscopy of transverse sections of WT (A and C) and fbr12 (B and D)

stems. (C) and (D) are enlarged views of (A) and (B), respectively. X: xylem; P: phloem; C;

cortex: E: epidermis. Bar, 100 µm (A and B) and 30 µm (C and D).

(E) Analysis of cell numbers (Y-axis) in different tissues of WT and fbr12 stems. The data

presented were average values obtained from 10 sections derived from different plants. Bars

denote standard errors.

Fig. 6 Reduced Cell numbers in fbr12 petals

(A) and (B) Scanning electron microscopy of WT (A) and fbr12 (B) petals. Compared to that of

WT, the fbr12 petals have smaller cells. Bar, 100 µm.

(C) Defective cell growth in fbr12 petals. In each panel, the average values of WT (obtained by

analyzing of 20 petals derived from 9 flowers) were set as 100%, and the values of fbr12 relative

to those of WT were given in the histogram. Bars denote standard errors.

Fig. 7 The male sterile phenotype of the fbr12 mutant

(A) through (F): light microscopy of cross sections of pollen sacs derived from WT (A-C) and

fbr12 (D-F) anthers. The images show anthers at different developmental stages (anther

development stages are defined according to Sanders et al., 1999): stage 7 (A and D), stage 8 (B

and E) and stage 9 (C and F). At stage 7, no apparent developmental abnormality was observed in

pollen sacs of fbr12 (D) compared to that of WT (A). After entering stage 8, the tapetum of fbr12

has excessive of cell layers that encompassed degenerated pollen grains (E and F). E, epidermis;



28

En, endothecium; ML, middle layer; MSp, microspores; T, tapetum; Tds, tetrads. Bar, 10 µm.

(G) and (H): anthers of WT (G) and fbr12 (H) plants stained by toluidine blue O. Matured pollen

grains are stained as dark blue. Bar, 2 mm.

(I) through (K): Scanning electron microscopy of anthers of WT (I) and fbr12 (J and K). Note the

empty pollen sacs in fbr12 anthers. Bar, 40 µm.

Fig. 8 Ovule development of the fbr12 mutant plants

(A) through (E): Scanning electron microscopy of wild-type and fbr12 ovules.

(A) WT ovules at stage 2-III (ovule development stages are defined according to Schneitz et al.,

1995). The nucellus (nu), funiculus (fu), and inner (ii) and outer (oi) integument primordia are

visible.

(B) WT ovules at stage 3-I. The outer integument encompassed most of the inner integument and

nucellus.

(C) WT ovules at stage 4-I. The outer integument completely covers the inner integument and

nucellus.

(D) The fbr12 ovules at stage 2-III. Compared to WT, no apparent abnormality is observed.

(E) The fbr12 ovules at stage 3-I. The outer integument and the inner integument stop

development.

(F) through (H): Differential interference contrast observations of embryo sacs prepared from WT

(F and G) and fbr12 (H) flower buds. The preparations were cleared by the Herr’s solution (Herr,

1971).

(F) A WT ovule at stage 2-III.

(G) A WT ovule at stage 4-I.

(F) An fbr12 ovule 2-III.

fu: funiculus; ii inner integument; iip: inner integument primordium; nu: nucellus; oi: outer

integument; oip: outer integument primordium; ov: ovule.

Bar, 100 µm (A-E) and 10 µm (F-I).

Fig. 9 Molecular characterization of the FBR12 gene

(A) A schematic map showing the T-DNA insertion site in the fbr12 mutant genome. Filled boxes

denote exons, and lines indicate untranslated sequences and introns.



29

(B) Northern blot analysis of the FBR12 expression in WT and fbr12 plants. Fifteen µg of total

RNA prepared from three-week-old plants was used for northern blot analysis using an FBR12

cDNA probe.

(C) Quantative analysis of the FBR12 expression in different tissues/organs by real-time RT-PCR.

Bars indicate standard errors.

(D) Ten-day-old seedlings germinated and grown on MS medium. From left to right: WT, fbr12

and fbr12 carrying an FBR12 transgene. Bar, 5 mm.

(E) Fourteen-day-old seedlings germinated and grown on MS medium containing 0.8 µM of FB1.

From left to right: WT, fbr12 and fbr12 carrying an FBR12 transgene. Bar, 5 mm.

(F) Seven-week-old plants germinated and grown in soil. From left to right: WT, fbr12 and fbr12

carrying an FBR12 transgene. Bar, 2 cm.

Fig. 10 FBR12 is a functional eIF-5A protein

An FBR12 cDNA fragment containing the entire ORF was placed under the control of the yeast

GAL1 promoter in a pYES2 vector. The resulting construct pYES-FBR12 was transformed into

the yeast mutant strain ts1159, which carries a temperature-sensitive mutation in the TIF51A/eIF-

5A gene (Zuk and Jacobson, 1998). A wild type yeast strain SS330 (TIF51A) was used as a

positive control, and an empty pYES2 vector (vector) served as a negative control. The

transformed cells were serially diluted and then inculcated on YPD medium containing 2% (w/v)

of glucose (Glu) or 2% (w/v) of galactose (Gal). The plates were incubated at 24oC or 36oC for 2

(24oC) or 4 (36oC) days, respectively.

Fig. 11 Reduced dark-induced leaf senescence in fbr12

(A) Fully expanded leaves detached from four-week-old seedlings of WT and fbr12 were kept at

22oC in the dark for different time (days) as indicated at the bottom of the panel. Leaves were

collected from 10-15 seedlings for each sample, and the experiment was repeated for three

times.

(B) Measurement of the chlorophyll contents in fully expanded leaves that were treated as

described in Panel A. Data presented were mean values from three independent experiments.

Bars denote standard errors.



running title: characterization of the arabidopsis eif-5a ... · proteins (murzin, 1993), such as...

Documents