schistosome female reproductive development

Parasitology Today, vol. 7, no. t I, 1991 303

29 Payne, D. (1988) Parasitology Today 4, 112-115 30 Macdonald, G. (1957) The Epidemiology and Control of Malaria,

Oxford University Press 31 Dietz, K. (1988) in Malaria: Principles and Practice of Malariology

(Wernsdorfer, W.H. and McGregor, I.A., eds), pp 1091-1133, Churchill Livingstone

32 Wernsdorfer, W.H. and Payne, D. (1991) Pharmacol. Ther. 50, 95-121

33 Warsarne, M. et al. (1990)J. Trap. Med. Hyg. 93, 284--289 34 Molineaux, L. (1988) :in Malaria: Principles and Practice of

Malariology (Wernsdorfer, W.H. and McGregor, I.A., eds), pp 913-998, Churchill Livingstone

35 World Health Organization (1990) Tech. Rep. Set. No. 805

36 Draper, C.C. et al. (1985)Bull. WHO 63, 10%118 37 Blanchy, S. and Benthein, F. (1989) Bull. Soc. Pathol. Exot. 82,

493--502 38 World Health Organization (1991) WHO Weekly Epidemiol. Rec.

66, 157-163 39 World Health Organization (1991) WHO Weekly Epidemiol. Rec.

66, 167-170

Note added in proof: n.b. Fu, S. and Xiao, S-H. (1991) Pyronaridine: A New Antimalarial Drug (this issue)

Schistosome Female Reproductive Development

P.T. LoVerde and L. Chen

Schistosome parasites have evolved to produce a number of unique features in t~eir life history; one of these is separate sexes. This has, in turn, led to a novel interplay between the male and female parasite that has been recognized for over 50years: the growth and reproductive development of the female parasite is in some way regulated by the male schistosome. Early classical and later experimental studies established that the presence of the male schistosome is necessary not only for the initiation of female development but also for the main- tenance of her mature state. The male parasite regulates the reproductive development of the female, partly by providing a stimulus that is necessary for the development of the vitelline gland. The cells of the vitelline gland provide nutrients and shell precursors for the egg. Also in this review by Philip LoVerde and Li-ly Chen, it is interesting to note that recent molecular studies have confirmed early work by showing that gene expression in the female parasite is developmentally regulated in a tissue-specific manner and that this gene expression is controlled by the presence of a male parasite.

The egg plays a central role in the biology of schistosomes. It is the primary agent of pathogenesis in humans and is responsible for dis- semination of the parasite. Because of its pivotal significance in pathogenesis, the egg and the development of the female reproductive system that produces the egg are potential targets for pharma- cological attack and/or vaccine development. In addition to their medical importance, the schistosomes represent an interesting developmental system in which the male parasite intimately controls and regulates the expression of a number of female genes by an as yet unknown mechanism. Surpris- ingly little is known about either the development,

Philip T. LoVerde is at the Department of Microbiology, State University of New York, Buffalo, NY 14214, USA and Li-ly Chen is at the Whitehead Institute for Biomedical Research, Cambridge, MA 02142, USA.

structure, and composition of eggs or the female reproductive machinery that produces them. How- ever, in the past five years a number of studies on the molecular mechanisms that are involved in the development and function of the female reproductive system and formation of the egg have been initiated.

Female development Schistosomes, unlike other trematodes (which

are, with the exception of the Didymozoidae, hermaphroditic), are unusual in that they have developed separate sexes. Sex is determined in the zygote by a chromosomal mechanism. The female schistosome (2n = 16) is ZW and the male is ZZ (Ref. 1). The zygote enclosed in the egg develops into the miracidium and the miracidium then trans- fers the germline from the human to the snail. Inside the snail the parasite undergoes asexual reproduction, resulting in an amplification of the genome, such that thousands of cercariae are produced. Thus, a single miracidium will give rise to a clonal population of cercariae that are all of the s a m e sex.

Male schistosomes undergo normal morphological development, whether isolated from single sex or bisex infection, although behavioral, physio- logical and antigenic differences between males from single, as opposed to bisex, infections have been reported 2-~.

Female schistosomes from single sex infections do show distinct differences from those obtained from bisexual infections 6-1°. Such females are underdeveloped in that they are stunted and exhibit an immature reproductive system (Fig. 1) and although the ovary, ootype and uterus are seen 7'9, the vitellaria, whose cells produce the shell precursors and nutrients for the egg, are not developed. Likewise the Mehlis' gland that surrounds the ootype (where eggs are formed) is not fully formed (see Fig. 2). The physical and reproductive

199 I, Elsevier Science Publishers Ltd, (U,() 0169 4707/9 I /$0200

304 Parasitology Today, vot. 7, no. 11, t991

Fig. I. Female schistosomes, showing (a) an immature female from a single-sex infection and (b) a mature female from a bisexual infection. The vitellaria, the tissue whose development is regulated by a stimulus from the male schistosome, occupies approximately the posterior two- thirds of the mature female. However, it is not present in the immature female worm. Ovary (0); vitellaria (V); digestive tract (D). (Reproduced, with permission, from Ref. I0.)

I

a

0

b

maturation of female worms is dependent on the presence of mature male worms 2'7-11 but the stimuli for female growth and for reproductive development appear to be independent 2. This stimulus is independent of sperm transfer and ferti- lization, and is not species specific 2'9'11-13. Whether the male stimulus responsible for female sexual maturation involves a physical-tactile relation° ship 2'12 that may involve nutrition 14, a chemical transfer in which the male provides some hormone, nutrient or messenger (possibly a neuropeptide) to the female 4'8'~5-~7 or a combination of thigmotactic and chemotactic stimuli has yet to be determined. However, an intimate association between the male and female worm, achieved by the female residing within a ventral groove, ie. the gynaecophoric canal of the male, is necessary.

Sexual maturation of females is reported to be triggered by extracts of the male worm xs'~6. How- ever, these experiments only seem to work with a particular laboratory strain of Schistosoma mansoni in which immature females can undergo vitelline development in the absence of male extracts 6. Studies using transfected male worm pieces with intact immature female worms of the same species show that vitelline development occurs only in the region of contact with the male segment, and any

male segment that can clasp the female worm can stimulate development 12. Thus the male stimulus that requires contact is spatially distributed throughout the gynaecophoric canal. However, its effect on vitelline gland development is local.

The stimulus of the male worm is necessary not only for female worms to complete physical and reproductive development but also for the female to maintain her mature state. Initial studies by Clough 18, later confirmed by Popiel and col- leagues 12'19, have shown that egg-laying female schistosomes, containing stored sperm but without their male partners, that are surgically implanted into naive animals stop laying eggs and begin to regress physically and reproductively to the immature state. Adult worm pairs, similarly trans- planted, continue to produce viable eggs. When male worms are mated with the regressed mature female worms, normal reproductive activity resumes even after months of regression.

Egg formation Oocytes produced in the single ovary are released

into an oviduct and are fertilized in the seminal vesicle, which is formed by a dilitated region in the

NON-CI/IATED fITELLINE DUCT

SEMINAL CILIATED OV RECEPTACLE

CILIATED NON-CILIATE VITELLINE DUCT

CILIATED =LLO-OVIDUCT

MEHLIS GLAI "IEHLIS GLAND

S DOTYPE

UTERUS .UTERINE TEGUMENT

NUCLEATEI CYTOPLASf 2YTOPLASMIC

• / PROCESSES

~,'~"i'~ _ ' h i UTERINE GONOPORE ~ , . ~ ~ - ' -~ I ~ " ~ ~ . o~-~ TEGUMENT

I ~ EODY TEGUMENT

Fig. 2. Diagram of the female reproductive system of Schistosoma mansoni. See text for an explanation of egg formation. (Reproduced, with permission, from Ref 22.)

Parasitology Today, vol, 7, no. t I, 1991 305

oviduct (Fig. 2 and Refs 20-22). The fertilized egg < Z

moves down the oviduct to a region where it meets cr the vitelline duct, the vitello-oviduct, in which each -~ fertilized egg is surrounded by approximately 38 ~ 40 vitelline cells. This bolus of material moves into the ootype which is filled with mucus secretions pre- c, sumably from the Mehlis' gland. With the con- ~ ao traction of the ootype, which determines the shape of the egg, granules are released from the surround- x ing vitelline cells. The materials from the granules ~ 2o (vitelline droplets) begin to coalesce, presumably due to the action of a phenol oxidase enzyme(s), ~ o

tD 10 causing crosslinkage and the eggshell begins to -5 form. The role of the Mehlis' gland in this process remains a mystery. Some of the viteUine cells remain in the egg, presumably providing nutrients 0 and other unknown factors for embryo development. Ultimately, the egg is released into the uterus and eventually deposited by the female worm through the gonopore. Female S. mansoni produce approximately 300 eggs per day 23, however, only one egg can be observed in the ootype at any one time.

Developmentally regulated expression To begin to understand female reproductive

development at a molecular level, a number of laboratories have isolated and started to characterize genes expressed only in reproductively active female worms. Three different female-specific genes have been studied19-22; the best-characterized is the p14 eggshell protein (chorion) gene of S. mansoni. This gene, like the other two (p48 eggshell protein gene and fs800, whose gene product has an unknown function), shows sex-, temporal- and tissue-specific expression during female development (L. Chen, PhD thesis, State University of New York, 1991 and Refs 24--28).

The messenger RNA (mRNA) encoding p14 (corresponding to pSMf 61-46 in Bobek et a / . 24) is present only in mature female worms and is not detectable in female schistosomes from single sex infection, in male worms from single sex or bisex infection, or in eggs (Fig. 3). Thus, expression (as determined by the detection of steady state mRNA)

Fig. 3. Determination of s~:age-specific expression of p14 eggshell protein mRNA. One microgram of total cellular RNA from adult males and females (MF), from mature M F females from bisexual infections (Fb), from immature females from unisexual infections (Fs), from males from bisexual infections F b (Mb), from males from unisexual infections (Ms) and from the egg stage (E) were applied F S to nitrocellulose in a dot-blot apparatus and probed with a complementary DNA (cDNA) M b clone (pSMf 61-46) that represents the p 14 mRNA (lane 2) or a cDNA clone (pSM 78- M S 105) that represents an unknown gene that is constitutively expressed (lane I). Relative to the mRNA represented by pSM 78-105, the E p14 mRNA is expressed in a stage-specific manner.

1 2

0

50-

2 6 2 8 3 0 3 5 3 7 4 0 4 5

Days post infection

Fig. 4. Expression of p 14. The number of molecules of p 14 transcript present in I ~g of total cellular RNA obtained from worms at different times post infection is shown.

of this gene is female specific. During normal bisexual infections, this mRNA is first detected 28 days post infection (the time of worm pairing), increases to a high level at 35-37 days post infection (coinciding with the start of egg production) and plateaus at 45 days post infection (not shown), a time when most of the female parasites are fully developed and when egg production is constant (Fig. 4). Thus the temporal expression of the gene is dependent upon a male stimulus (pairing).

As the male stimulus controls female vitelline development, it is not surprising that Koster et al. 28 found that p14 mRNA is expressed and translated in vitelline cells and the gene product is associated with the vitelline droplets (the proteinaceous granules that contain the eggshell precursor proteins). Chen (PhD thesis, State University of New York, 1991) has also observed this tissue-specific expression (Fig. 5); the transcripts of p14 and p48 are found in the cytoplasm of the same cells in the vitelline follicles, ie. each vitelline cell has the capacity to produce both p14 and p48 gene products. Both transcripts are also found in the mature vitelline cells in the vitelline duct and within the egg enclosed by an eggshell in the ootype. However, the transcripts of pI4 and p48 are undetectable in RNA obtained from eggs deposited within the liver of the vertebrate host (see Fig. 3; L. Chen, PhD thesis, State University of New York, 1991 and Refs 24, 26). Eggs found in the liver are usually embryo- nated and presumably the vitelline cells by this time are spent.

Choriogenesis Each mature female S. mansoni with an average

life span of five years (but as long as 32 years 29) produces an average of 300 eggs per day 23. In order to maintain that level of reproductive activity, it has been estimated that the female converts nearly her

306 Parasitology Today, vol. 7, no. I, 1991

Fig. 5. Detection of tissue-specific expression of eggshell protein genes by hybridization in situ. Worm pair sections, for which p48 cRNA [3SS]UTP- labeled probe was used in the hybridization reaction, are shown (a). Deposited silver grains in female (F) sections (3 day exposure) represent the p48 messenger RNA over vitelline tissue. Male (M) sections lack silver ,grains and serve as an internal control. The asterisks identify the digestive

.3~ tract Scale bar = 500 ltm. A female worm section, for which a p14 [ S]UTP probe was used in a hybridization reaction, is shown (b). Arrows point to vitelline granules associated with mature vitelline cells. Note the absence of silver grains (hybridization) over the tegument (T). Scale bar = 250 pro.

own body weight into eggs every day 3°. The high demands of egg production dictate an active meta- bolic role for the vitelline gland. To maintain an output of one egg every 4.8rain, each female is calculated to produce 11000 mature vitelline cells per day 6'31.

In schistosomes, choriogenesis is continuous (but male dependent), involves at least two different genes (p14 and p48) that are each present in a few (five) copies on chromosome 3 (L. Chen, PhD thesis, State University of New York, 1991 and Ref. 32). DNA sequence analysis shows that there are no introns in these genes and thus the mRNA is not spliced. There is no evidence for gene amplification or rearrangement of eggshell protein genes during

24 33 schistosome development ' . Schistosomes deal with such a high rate of egg production by the continuous synthesis of a large number of vitelline ceils and a high amount ofpl4 and p48 transcripts: 42 × 10 s and 2.8 × 10 s molecules per ~tg of total RNA, respectively (L. Chen, PhD thesis, State University of New York, 1991), in each cell (see Fig. 4). These transcripts correspond to 5-10% (p14) 25 and 0.3-0.5% (p48) of the total mRNA of

mature female worms. Thus the high rate of gene expression in schistosomes seems to be due to the large number of vitelline cells produced each day rather than by either gene amplification or a large gene family.

In contrast, in Drosophila, choriogenesis occurs over a 5-6 h period and involves approximately 20 genes that are expressed in approximately 1000 follicle cells that surround each maturing oocyte. The high rate of chorion gene expression in Droso- phila is achieved by specific amplification of chorion genes and their flanking sequences during development (for review, see Refs 34, 35). In the silkmoth, choriogenesis occurs over a 55 h period and involves approximately 200 genes in three gene families that are clustered as tandem duplications in a giant locus that exceeds 106 base pairs. The very high rates of chorion gene expression required for eggshell synthesis are achieved by the redundancy of the chorion locus 35.

Co-ordinate gene expression As the stage, tissue and temporal patterns of gene

expression are the same for the p14, the p48 and the

Parasitology Today, vol. 7, no. //, 199 / 307

fs800 genes, one might expect the same transacting factors to bind to conserved cis-acting motifs (DNA sequences) in order to co-ordinately regulate transcription of a number of genes involved in female reproductive development in response to the male stimulus.

Indeed, for those genes where the 5' end of the female specific mRNA has been defined and the upstream regions characterized, a number of puta- tive cis-acting DNA elements have been identified 36. For example, in the p14 gene, a multiple TATA box is located at positions -23 to -31, and a CAAT sequence at -50 upstream of the eggshell protein transcription unit (Fig. 6 and Ref. 32).

As S. mansoni eggshell genes are like the chorion genes of Drosophila and silkmoth in that they are developmentally regulated, showing sex-, tissue- and temporal-specific expression, it is valuable to compare schistosome upstream sequences to those of silkmoth and Drosophila. The comparisons reveal several similarities. One such element, TCACGT, has been shown to be essential for activating the sex-, tissue- and temporal-specific gene expression in Drosophila and silkmoth 34'37. This element, with a reversed polarity, is found at -70 in the S. mansoni p14 eggshell protein gene 3z. A very similar element, of sequence TCACGCT, is located at -157 from the cap site (Fig. 6 and Ref. 32).

Both copies of this hexamer have been found in all the p14 genes (and p14 homologues in S. haema- tobium and S. japonicum) studied to date, the p48 gene, the fs800 gene and the chorion genes of Drosophila and silkmoths (P.T. LoVerde, unpublished; L. Chen, PhD thesis, State University of New York, 1991; Refs 32, 34, 37-42).

Two Drosophila transcription factors that bind to regions containing the TCACGT hexamer have recently been cloned: one is a zinc finger protein and the other is a member of the family of steroid hormone receptors 43. Two other elements, GTAGAAT and AGTGTATTC, that are thought to contribute to the regulation of chorion gene expression in Drosophila and silkmoths 3s are similar to those found in all p14!, p48, andfs800 genes (Fig. 6).

A number of other elements (identified as motifs I and I1) 37 that share a common core motif, TRRAAT (R = pyrimidine), are found in schistosome vitelline cell genes (p14, p48 and fs800), Drosophila chorion and silkmoth chorion genes. These elements haw. • been shown to bind nuclear proteins and control quantitative and qualitative changes in reporter gene expression in silkmoths 37.

It is interesting that DNA elements that function in choriogenesis and that are conserved through evolution between Drosophila and silkmoths (which diverged from each other over 250 million years ago) are also found in the upstream regions of the p14 and p48 eggshell precursor protein genes and the fs800 gene of schistosomes.

Future work aims to identify the trans-acting factors that regulate: gene expression of develop-

- 4 8 0 -460 - 4 4 0 CCCACTAGTGTCTCGTCTACTATCTTKATCAGTATTGTCATGGATGJ~ATATGAC~TATGGAGAATGGATTGTTGGCTG

- 4 0 0 -380 -360 C CA GA TA T C CCTTATTTAAGGT C ATTGCAA CATCG TCTATGAGCTGKKC.~t.GTT A/~TTTAKATA/kACGTTTATTTAA C C

- 3 2 0 - 3 0 0 - 2 8 0 TGTTTAGTTATAACTTGTATGTCCAGAGc A~CATCACTTGTC .&G. T GTTAT .CA S~AAGAGTTTCGTCTCATTCAaTGAAG

- 2 4 0 -220 - 2 0 0 ACTT&ATCAACAGTTTC G ATG&ACCACATGCT&ACGAATTCTAACC~..T .AG.~. TCA~TAG TGAGTAA~CGT G ~

-160 -140 -120 CTGTTTCATTGACATTTTTAACTA .TC .&C .GC .TCA&CTATC&TTAACGATTACACA~GACAGTTCGACAGTAGAGTGCAC

- 80 - 6 0 - 4 0 AAGC G T~TATG TATTTAATAATGATG .CACTTAGTGAGGCAC&ACTCTT~-'~-~TAT&ATCA&&AAC ~

I 20 40 ATAAATCACACTAGTCTACACATCATCACACCCAGTACKACAACACCKACAATTTGAAAA ATG AAA CAG TCA CTC

HET Lys GIn S e t Leu

Fig. 6. Upstream region of the p l4 eggshell protein gene of Schisto- soma mansoni. The start (cap-site) of the transcription unit (mRNA) is identified as position I. A multiple TATA box where the RNA polymerase II will bind to initiate transcription is boxed, as is the CAAAT sequence. Upstream elements that may play a role in regulating the expression of the p14 gene in a sex-, tissue- and temporal-specific manner are identified by dots. For example, the hexomer TCACGT in a reverse orientation starts at -70, a similar sequence TCACGCT in the correct orientation is at -149, GTAGAA T is at -207 and AGTGTTATC is at -288. All of these elements, some with slight variations, are found in all the female-specific genes that have been sequenced to date. These elements are known to activate the transcription of similar genes in Drosophila and silkmoths.

mentally regulated female-specific genes. Once the genes that encode these trans-acting factors are isolated and characterized, we will be one step closer to understanding how the male triggers vitelline development. Henkle et al. 41 have recently pre- sented preliminary data from a gel mobility shift exper- iment that indicates that proteins from female nuclear extracts bind to the 5' upstream region ofaS.japonicum eggshell protein gene; the DNA fragment in the gel shift assay contains the TCACGT hexamer.

More than one open reading frame A feature common to all the schistosome female-

specific genes (p14, p48 and fsSO0) characterized to date is the presence of more than one open reading frame (ORF) (P.T. LoVerde, unpublished; L. Chen, PhD thesis, State University of New York, 1991; Refs 24,27,33,38,39,41).

The nucleotide sequence of the p14 gene shows three ORFs, two on the coding strand and one on the complementary strand 24. One of the ORFs (designated ORF1) encodes a 16kDa polypeptide that shows strong homology with the eggshell (chorion) proteins of silkmoths 24. Antibodies made against a fusion protein representing ORF1 recognize vitelline droplets within mature vitelline cells in tissue sections of mature female worms 2s, and antibodies made against a peptide representing the carboxy terminus of ORF1 recognize a 14kDa polypeptide on a western blot of purified eggshell extract (P.T. LoVerde, unpublished).

The nucleic acid sequence of the p48 eggshell gene shows three ORFs: two on the coding strand and one on the complementary strand (L. Chen, PhD thesis, State University of New York, 1991 and Ref. 26). One ORF (designated ORF1) encodes a 50 kDa polypeptide that shows strong homology with chorion proteins of insects. Antibodies made

308 Parasitology Today, vol. 7. no. I I, 1991

Table I. Amino acid composition (%) of protein sequence from open reading frame one of the p14 and the p48 eggshell protein genes compared to purified egg shells

A m i n o acid p14 a p48 b Eggshell c Ala 2,82 0.75 4.02 Arg 0,00 0.97 2.02 Asn 5.08 2.66 /

1 5.4O ! Asp 5.65 13.77 s Cys 5.65 0.24 2.16 Gin 0.56 0.00 /

4.70 J Glu 0.56 5.80 Gly 43.50 14.98 37.00 His I. 13 6.04 5.20 lie 0.56 0.97 1.22 Leu 2.25 1.20 1.77 Lys 5.65 17.15 9.44 Met 0.56 0.24 0.95 Phe 1.69 0.24 1.92 Pro 1.69 0.24 3.37 Ser 6.78 5.80 6.63 Thr 3.39 1.69 3.05 Trp 0.00 0.00 0.0 I Tyr II .30 26.07 0.78 Val I. 13 1.20 0.59

See Ref. 24. bSee L. Chen, PhD thesis, See Ref. 44.

State University of New York, 1991.

against recombinantly produced ORF1 recognize a 50 kDa polypeptide in western blots using mature female extracts but not male or immature female extracts (L. Chen, PhD thesis, State University of New York, 1991). Thus ORF1 of both p14 and p48 genes encodes a biologically relevant gene product. However, whether the other ORFs in these genes are used is not known. The sum of the amino acid composition from the deduced peptide sequences of p14 and p48 gene products is in general agreement with the amino acid composition obtained from the hydrolysis of purified eggshells (Table 1 and Refs 44,45). The notable exception is tyrosine (Table 1), which presumably has resulted from its chemical alteration to dihydroxyphenylalanine (DOPA) during eggshell formation, where schistosome eggshells like those of other digenetic trematodes are thought to form by a process known as tanning 21'4s. The deduced amino acid sequences of p14 and p48 gene products suggest the possibility that they can exist as DOPA-containing proteins 45. This is consistent with a role for p14 and p48 in eggshell formation.

C o n c l u s i o n The biology of schistosome reproductive devel-

opment has intrigued parasitologists for more than half a century. Some of the early, now classical, morphological observations, such as the observation that female schistosomes do not complete reproductive development unless a male worm is present, have been confirmed at the molecular level: female- specific genes (p14, p48 and fs800) are expressed in a tissue-specific manner in response to worm pairing. The next set of questions will focus on the gene products that regulate the expression of vitelline cell

genes, and the answers will eventually lead to identification of the exact nature of the male stimulus that controls the development of the female schistosome.

Acknowledgements We thank Theresa Wnuk for outstanding secretarial service. This research was supported by NIAID grant AII27219.

References 1 Short, R.B. (1983)J. Parasitol. 69, 1-22 2 Armstrong, J.C. (1965)J. Parasitol. 51,605-615 3 Aronstein, W.S. and Strand, M. (1984)J. Parasitol. 70, 545-557 4 Cornford, E,M. and Fitzpatrick, A.M. (1985)Mol. Biochem. Para-

sitol. 17, 131-141 5 Den Hollander, J.E. and Erasmus, D.E. (1984) Parasitology 88,

463-476 6 Popiel, I. (1986) Parasitology Today 2, 10-15 7 Erasmus, D.A. (1973) Parasitology 67, 165-183 8 Moore, D.V., Yolles, T.K. and Meleney, H.E. (1954)J. Parasitol.

40, 166-185 9 Shaw, J.R. (1977) Exp. Parasitol. 41, 54-65

10 Vogel, H. (1941) Zentralbl. Bakteriol. Parasitenk. I. Abt. Orig. 148, 78-96

11 Michaels, R.M. (1969)Exp. Parasitol. 25, 58-71 12 Popiel, I. and Basch, P.F. (1984)J. Exp. ZooL 232, 141-150 13 Basch, P.F. and Basch, N. (1984) Parasitology 89, 369-376 14 Basch, P.F. (1990) Parasitology Today 6, 160-163 15 Popiel, I. and Erasmus, D.A. (1981)J. HelmimhoL 55, 33-37 16 Shaw, J.R., Marshall, I. and Erasmus, D.A. (1977) Exp. Parasitol.

42, 14-20 17 Skuce, P.J. et al. (1990) Cell Tissue Res. 261,573-581 18 Clough, E.R. (1981)J. Parasitol. 67, 535-539 19 Popiel, E., Cioli, D. and Erasmus, D,A. (1984) Int .J . Parasitol. 14,

183-190 20 Nollen, P.M. (1983) Parasitology 86, 99-120 21 Smyth, J.D. and Clegg, J.A. (1959) Exp. Parasitol. 8,286-323 22 Spence, I.M. and Silk, M.H. (1971) S. Afr. J . Med. Sci. 36, 41-50 23 Moore, D.V. and Sandground, J.H. (1956)Am.J. Trap. Med. Hyg.

5,831-840 24 Bobek, L.A. et al. (1986) Proc. Natl Acad. Sci. USA 83,

5544-5549 25 Simpson, A.J.G. and Knight, M. (1986) Mol. Biochem. Parasitol.

18, 25-35 26 Johnson, K.S., Taylor, D.W. and Cordingley, J.S. (1987) Mol.

B iochem. Parasitol. 22, 8%100 27 Reis, M.G. et al. (1989) Mol. Biochem. Parasitol. 32, 113-120 28 Koster, B. et al. (1988) Mol. Biochem. Parasitol. 31, 183-198 29 Harris, A.C., Russell, R.J. and Charters, A.D. (1984) Trans. R.

Sac. Trap. Med. Hyg, 78, 385-388 30 Becker, W. (1977) Z. Parasitenkd. 52, 69-79 31 Erasmus, D.A. and Davies, T.W. (1979)Exp. Parasitol. 47, 91-106 32 Bobek, L.A., Rekosh, D.M. and LoVerde, P.T. (1988)Mol. Cell.

Biol. 8, 3008-3016 33 Bobek, L.A. et al. (1987) UCLA Syrup. Mol. Cell. Biol. New Series

42, 133-143 34 Orr-Weaver, T.L. (1991) BioEssays 13, 97-105 35 Kafatos, F.C. et al. (1987) in Development as an Evolutionary Process

(Raft, R. and Raft, G.C., eds), pp 161-178, Alan R. Liss 36 LoVerde, P.T., Rekosh, D.M. and Bobek, L.A. (1989) Exp.

Parasitol. 68, 116-120 37 Mitsialis, S.A., Veletza, S. and Kafatos, F.C. (1989)J. Mol. Evol.

29, 486-495 38 Bobek, L.A., LoVerde, P.T, and Rekosh, D.M. (1989) Exp.

Parasitol. 68, 17-30 39 Bobek, L.A., Rekosh, D.M. and LoVerde, P.T. (1991) Exp.

Parasitol. 72, 381-390 40 Kunz, W. et al. (1987) Nucleic Acids Res. 15, 5894 41 Henkel, K.J. et al. (1990) Mol. Biochem. Parasitol. 22, 8%100 42 Simpson, A.J.G. et al. (1987) Mol. Biochem. Parasitol. 22, 16%176 43 Shea, M.J. et al. (1990) Genes and Development 4, 1128-1140 44 Byram, J.E. and Senft, A.W. (1979) Am. J . Trap. Med. Hyg. 28,

539-547 45 Cordingley, J.S. (1987) Parasitology Today 3, 341-344

Note added in proof: A paper containing the information cited in L. Chen, PhD thesis, State University of New York, 1991 has been accepted by Mol. Biochem. Parasitol.

schistosome female reproductive development

Documents