school: 40 brewster avenue, yonkers, 10701 · 8:30am michael tenore & john barden sunday, june...
TRANSCRIPT
Church: 854 Midland Avenue, Yonkers, 10704 Phone: 914-965-1555 Fax: 914-965-0678 Email: [email protected] Webpage: www.stannsyonkers.org
School: 40 Brewster Avenue, Yonkers, 10701 Phone: 914-965-4333 Fax: 914-965-1778 Email: [email protected] Webpage: www.stannschoolyonkers.org
MASSES Saturday Evening: 5:00 PM Sunday: 8:00 AM, 10:00 AM Solemn Mass with adult & children’s choirs, 12:00 Noon Monday - Friday: 7:15AM and 8:30AM Saturdays: 8:30AM Holy Days: As Announced CONFESSIONS Saturdays from 4:00PM to 4:45PM in the Church except Holy Saturday DEVOTIONS • The Rosary is recited daily at 8:10AM before the 8:30AM Mass • Miraculous Medal Novena: every Monday after the 8:30AM Mass • Novena in honor of St. Ann: every Tuesday after the 8:30AM Mass
EXPOSITION OF THE BLESSED SACRAMENT Every Friday at 9:00 AM and ending with Benediction at 8:00 PM Nocturnal Adoration First Friday 9 AM—8 AM Saturday
CATHOLIC BIBLE STUDY Every Tuesday from 7:30-8:30 PM in Fr. Anthony Hall
SERVED BY Rev. Andrew P. Carrozza, Pastor
Rev. James Annor-Ohene, Parochial Vicar Mr. Michael P. Vicario, Principal/D.R.E.
Miss Nancy Piotrowski, Parish Secretary Mr. Paul Loman, Director of Music
PARISH ACTIVITIES Adult & Children’s Choir • Altar Servers
Bereavement Support Group • Bible Study Arise! Young Adult Group • Golden Agers
Homebound Visitation & Ministers Knights of Columbus
Lectors • Teen Club • Ushers ChristLife Evangelization Ministry
COMMITTEES Parish Council • Respect Life Committee
BAPTISM Baptisms are held on Sundays at 1:00 PM in the chapel. To arrange a baptism, please contact the Rectory.
MARRIAGE Arrangements should be made a minimum of six (6) months in advance. A marriage preparation program is required.
SERVICE TO THE SICK If someone is homebound or in the hospital, please call the Rectory. Arrangements will be made for the person to be visited and to receive the Sacraments.
R.C.I.A. Adults seeking to enter the Catholic Church or complete their Christian Initiation should contact the rectory.
PARISH MEMBERSHIP All new families are welcome to the parish, and every new family should be properly registered. If you move or change address, please notify the Rectory.
July 5, 2020 14th Sunday in Ordinary Time
PRIESTS’ SCHEDULE for next Sunday, July 12, 2020 15th Sunday in Ordinary Time
Saturday 5:00PM Fr. Thomas Sunday 8:00AM Fr. Annor 10:00AM Fr. Thomas 12:00PM Fr. Annor
Page 3 – 482
RRespect Life The Respect Life
Rose & Candle are offered this week for the protection of
all human life.
SUNDAY COLLECTION
Unavailable
due to early printing of the bulletin.
Thank you for your continued support!
St. Ann’s Parish 14th Sunday in Ordinary Time July 5, 2020
Please pray for our parishioners who are ill: So ia Rose Barile, Maria Cadacia, Joe Callahan, Esterina Calvi, Carole Chapyak, Josephine Cistica, Michael P. Coyle, Leonard Crispino, Gregory Crotty, Nikki DeLaurentis, Heide Dougherty, Sally Drooks, Josie Esposito, Rosie Fileen, Paul Freed, Jose Garcia, Paula Jones, Marilyn Laspina, Anne Leo-ne, Rose Madel, Tom Marinaccio, John McCain, Salvatore Moore, Susan Nagle, Jeff Niedzwiedz, Kathy Panella, Kevin Peters, Robert Peterson, Benny Rivera, Eva Rivera, Sgt. Ed-ward Ryan, Gisella Santana, Peter J. Sasso, Luigi Scarogni, Theresa Serra, Carmela Southwell, Sue Ann Steinman, Win-ifred Sullivan, Vicky Torres, John Carlo Treglia, Renata Val-entine, and for those who recently died, especially Nicho-las O’Connor, may they rest in peace.
Memorialize Your Loved Ones or commemorate a special occasion,
with a Rose & Candle $5, the Bread & Wine $25, the Sanctuary Lamp $25, the Altar Candles $25,
or Flowers $150.
All honors will receive recognition in the bulletin. Stop by the Rectory or call us at 914-965-1555.
Sunday, July 5, 2020 - 14th Sunday in Ordinary Time ALL MASSES LIVESTREAMED ON FACEBOOK: www.facebook.com/StAnnsChurch 5:00PM Felice, Antonia, Luisa, Mike, Nicola and Alex Ciccone 8:00 AM Deceased Members of the Castellano & Frankowski Families 10:00 AM For St. Ann’s Parishioners 12 Noon Nicholas and Eugenia Makar Monday, July 6, 2020 - Weekday 7:15AM Maria, Francesca, Giovanni & Adelina Brusco 8:30AM Maria Circosta Tuesday, July 7, 2020 - Weekday 7:15AM Giovanni Verbene 8:30AM Genevieve “Penny” Piotrowski Wednesday, July 8, 2020 – Weekday 7:15AM Maria Regasto 8:30AM Michael J. Panella Thursday, July 9, 2020 - Weekday 7:15AM Rosemary Travaglione 8:30AM Angelo Greco, Rosaria Cofone and Angela Cofone Friday, July 10, 2020 - Saint Thomas 7:15AM Margie Spinella 8:30AM Ida Caporale Saturday, July 11, 2020—St. Benedict 8:30AM Sr. Matilde DeSantis and Enrico, Anna, Fernando & Vincenzo Poggiogalle Sunday, July 12, 2020 - 15th Sunday in Ordinary Time ALL MASSES LIVESTREAMED ON FACEBOOK: www.facebook.com/StAnnsChurch 5:00PM Dominick Fickeria 8:00 AM Tommaso Derasmo 10:00 AM Mario, Gaspare, Antonio and Angela Fusco 12 Noon For St. Ann’s Parishioners
Page 333333333333333333333333333333333333
Page 3 – 482
Page 4 – 482
Page 5 – 482
Page 6 – 482
One question that pastors frequently are asked is what the Church teaches regarding cremation. In the past, the Church did not permit cremation because there were groups hostile to the Catholic Faith that deliberately practiced cremation so as to deny the resurrection of the body on the Last Day. Since this is no longer a worry, the Church now permits cremation, provided it is not being done so as to deny the resurrection of the body. Of course, every time a new permission is given there are inevitably abuses that take place. They are not usually deliberately intended as such, but Catholics, seeing practices that are done by other denominations of Christianity, other religions, and secular society, begin to practice them with their loved one’s remains without realizing that they are not in keeping with our Catholic beliefs regarding the proper treatment of cremated remains. The situation was serious enough to warrant a clarification from the Vatican. To summarize the directive, it is not permissible to scatter ashes or to keep them in an urn on a mantle or tabletop, nor to divide them up among family members or to place them in jewelry. All cremains must be placed in a grave, mausoleum, or columbarium. This directive is not merely a guideline but represents a mandate. We do not have the option to ignore it. If in the past you followed a course of action with your loved one’s cremains that is prohibited by this directive, if you were unaware that such a procedure was not a valid way to care for them, then you have not sinned. If it is possible to correct the situation then we should do so. For example, if you did not know that a loved one’s remains may not be placed on a mantle in your home and you currently have them there, then we should make sure they are buried in a manner consistent with the Church’s directive. If it is not possible, such as they were scattered somewhere, I recommend bringing it to the Lord in prayer and telling Him you did not realize at the time that this was not a dignified way to dispose of your loved one’s remains and ask Him to forgive you. The answer will of course be “yes!”
If you have any questions at all, please don’t hesitate to contact me. I will be happy to do whatever I can to help you make sure your loved one’s cremains are given a proper Catholic burial.
Page 7 – 482
St. Ann’s Parish 14th Sunday in Ordinary Time July 5, 2020
The Food Pantry at St. Brendan/St. Ann Par-ish is in desperate need of non-perishable food items such as rice, tomato sauce, non-sugary cereals and oatmeal, canned meat (chicken, tuna, sardines, spam), soup, canned vegetables, mayonnaise, oil, and ready-made desserts (i.e. cookies or Hostess cakes). If you have con-cerns, you may phone our Rectory at 914-965-
1555 to alert us to when you are dropping the food at our door, Monday-Friday 9pm-4pm, and we will bring your do-nation inside. Checks made out to St. Brendan’s/St. Ann’s are also appreciated. Thank you for your support!
SUPERMARKET GIFT CARDS are available for purchase in the Rectory week-days from 9am-4pm. 5% of the purchase price comes directly back to us! Choose ShopRite in $25 or $50 denominations, or Stop & Shop in $25, $50 or $100.
DON’T FORGET TO REGISTER!
Time-sensitive email or text updates from Fr. Car-rozza or the Archdiocese ONLY https://stannyonkers. locknote.com/
Parish database https://connectnow.parishsoft.com/newyork — please include email and phone number(s)!
Online giving www.parishgiving.org — Never look for your envelopes, cash or checkbook again! Choose credit card or checking account, amount and frequency.
482 St. Ann, Yonkers, NY (B) John Patrick Publishing Co., Inc. 1.800.333.3166 • www.jppc.net
STEVEN BELLANTESE, DDSThe Neighborhood Dentist
Family dentistry in a warm friendly environment
1082 Midland Avenue914-969-9700
Steven A. Francescone, M.D.Board Certified in Cardiovascular Disease
1010 North Broadway • Yonkers, NY 10701914-968-3535
FLOWERFUNERAL HOME INC.
714 YONKERS AVENUE www.FlowerFH.com1-800-A-FUNERAL
2-3863725
732 Yonkers Avenue • Yonkers, NY 10704(914) 375-1400 www.frswfh .com
Funerals | Cremations |Preplanning
JOSEPH A. MARRAJOSEPH A. MARRAAttorney-At-LawAttorney-At-Law
• Real Estate• Real Estate • Personal Injury • Personal Injury • Elder Law • Elder Law • Wills, Trusts, Estates • Wills, Trusts, Estates • Criminal • Criminal • Corporate • Corporate • Matrimonial • Matrimonial
ComplimentaryInitial Consultation
909 Midland Ave., Yonkers(Near St. Ann’s Church)
964-6806964-6806(Evening Hours By Appointment)
2016 Joseph A. Marra
PAUL D. RANIERIDC Ranieri Insurance Agency457 Palmer Road, Yonkers, NY 10701 | 914-376-2560 | [email protected]
John Cipollina, D.D.S.Child and Adult Orthodontics
Voted “Top Orthodontist” Westchester Magazine
687 Yonkers Ave.(914) 969-0303
Family Plots and Individual Plots
Also available:Chapel of Hope Mausoleum
Interest-Free Payments for 3 Years
Jackson Ave. & Saw Mill River Rd.Hastings-on-Hudson, N.Y.
Call or Visit Our Courteous Staff (914) 478-1855
www.MountHopeCemetery.com
Podiatrist/Foot Specialist909 Midland Avenue, Yonkers, New York 10704914-969-0231 | www.mariabrancadpm.com
No Closing Cost Fees or Commissions
We Can Buy Your House in 7 Days or Less
FOOT DOCTORDr. Mario E. Montoni ~ Podiatrist/Foot Specialist
In Bunions, Hammertoes, Heel Spurs, Ingrown Nails, Flat Feet, Corns, Calluses, Fungal Skin & Nail Infections
Accepts: Medicare, Oxford, Unions 655 Yonkers Ave.Pomco, PHCs, Aetna, GHI (914) 476-2562
Christopher Louis Christopher Louis SalonSalon
844 Midland Ave.Yonkers NY 10704
914-423-1626914-423-1627
www.saintjosephs.org
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg
y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis
cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfonfornfornfornfornfornfornformatimammmmmmammmmmm o
echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n
acturing - Chemical &&&&&&&&&&&l & l & l &l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens
dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans
ortation &&&&& & & & & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker
CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia
ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforforcforcforcforceement, Public Safety - O
To all those nforcement, Public Sanforcement, Public Sa
essentiallture - Energylture - EnergyWater aste TraWater aste Tra
workerscs - Public Wors - Public WorCommunicatioCommunicatio
keeping echnology Wochnology Woovernment Wovernment W
us safe,acturing Caterials Finanaterials Finan
yournicationnicationWorkerWorke
service isovernment Workovernment Workacturing Chemacturing Chem
invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar
ment, Public Safety - OSafety - Othan
k yo
u
g gyWatateatttatatatattaaaaaa rwaswaswawaswwaswwwwaswwaswwwwasswasawawaw ste -tettttttetttee Transportation & Log
cccscccccc - PPPPPPPPPPPPPPPubliubliubliubliublililublibubbliubuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrrkkkkrrk & - & -& -&& -&& -&&&&&&& --&&&& -&&& -&&& InfrInfInfrnfrInfInfrnfrII ffI ffInI fnfI fInfnfInnfnfn astructuCCoCoCoCoCoCoCCoCCoCCCCoooCCCCCCC mmunmmunmmmmmmunmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicaticacaticaticatcatcatcatcattcatcatcatcattcatcatcatccacatcccatcc ionsionsionsnsionononsonsiooionssonsonsonsionoonoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornfoforfnfnfornfornfornfornforfofornfornforrrrnnffforrrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmati
echhhhhhhhhnolonononoonnoloonolonnoln lonnolonooolonolonolonnnn on oonoo ggy Wgggg orkers - Community