single-allele analysis of transcription kinetics in …...3d-stacks of images from rnafish...
TRANSCRIPT
![Page 1: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/1.jpg)
nature | methods
Single-allele analysis of transcription kinetics in living mammalian cells Sharon Yunger, Liat Rosenfeld, Yuval Garini & Yaron Shav‐Tal
Supplementary figures and text:
Supplementary Figure 1 Inserting CCND1 into the Flp‐In system
Supplementary Figure 2 Generating a cell system expressing single CCND1‐MS2 alleles
Supplementary Figure 3 Detection of transcription sites and mRNPs in the stable clones
Supplementary Figure 4 Live‐cell imaging of CMVpr and CCND1pr driven transcription
Supplementary Figure 5 The CCND1pr cycles between “on” and “off” states
Supplementary Figure 6 Detection and quantification of mRNAs by RNA‐FISH
Supplementary Figure 7 Detection of replicated transcription sites
Supplementary Figure 8 Spatial localization of the active transcription sites
Supplementary Figure 9 The emerging of a second site in living cells
Supplementary Figure 10 Duplicated transcription sites in fixed and living cells
Supplementary Figure 11 RT‐PCR of reporter mRNA levels
Supplementary Table 1 Values of transcriptional kinetics extracted from the model.
Supplementary Table 2 Primers
Supplementary Discussion
Supplementary Note 1 The FRT system; The cyclin D1 gene; Extracting polymerase kinetics from FRAP data; Modeling the FRAP data
Note: Supplementary Videos 1–11 are available on the Nature Methods website.
1
Nature Methods: doi: 10.1038/nmeth.1482
![Page 2: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/2.jpg)
4
Supplementary Figure 1 Inserting CCND1 into the Flp-In system
(a) Schematic representation of the FRT recombination process. The HA-CCND1-MS2 gene (cyan
box, named cyclin D1) under the control of the promoter (CMV, green box) was cloned into the
Nature Methods: doi: 10.1038/nmeth.1482
![Page 3: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/3.jpg)
5
pCDNA5/FRT plasmid. Homologous recombination of the FRT sites (pink triangles) between the
above vector and the genomic site in the HEK 293-Flp-In cells (top, linear DNA), yields a
recombined genomic region in the HEK 293-Flp-In cells (bottom, linear recombined DNA)
containing a single copy of the gene of interest (cyclin D1, cyan box), an active hygromycin gene
(faint pink box), and an inactive lacZ-Zeocin gene (purple box). Flp-In cells contain Zeocin
resistance, while correct site-specific recombination yields the Zeocin gene inactive and in
conjunction induces hygromycin gene activity. For explanation on system see Supplementary
Note 1. We verified the loss of Zeocin resistance and the gain of hygromycin resistance after
recombination. This process was performed also for the CCND1 endogenous promoter.
(b) Sequencing of the genomic DNA region of recombination shows that the ATG start codon
(yellow) is in frame with the hygromycin gene (pink) driven by the SV40 promoter (cyan). FRT
site is in dark pink.
(c) PCR followed by sequencing of genomic shows that the cyclin D1 gene sequence (cyan) as
well as the BGH region (grey) were integrated upstream of the lacZ-Zeocin gene (purple).
Nature Methods: doi: 10.1038/nmeth.1482
![Page 4: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/4.jpg)
6
Supplementary Figure 2 Generating a cell system expressing single CCND1-MS2 alleles.
The following controls were performed to verify that the CCND1-MS2 genes were integrated in
the correct FRT genomic location. (a) Loss of LacZ expression observed by X-gal staining (blue-
Flp-In cells, white- Flp-In/CCND1-MS2 cells). Scale bar, 10 µm. (b) PCR on genomic DNA showing
the correct integration of the gene in both clones compared to parental HEK-293 cells. Primers
spanned (top) the SV40pr - hygromycin region, (middle) the cyclin D1 – LacZ region, and
(bottom) control of genomic GAPDH. (c) RT-PCR showing hygromycin expression in CMVpr-
Nature Methods: doi: 10.1038/nmeth.1482
![Page 5: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/5.jpg)
7
CCND1-MS2 and CCND1pr-CCND1-MS2 cells versus control HEK-293 cells. (d) Anti-HA
immunofluorescence showing the expression of the HA-cyclin D1 protein in CCND1pr-CCND1-
MS2 and CMVpr-CCND1-MS2 cells. Hoechst in blue. (e) Semi-quantitative RT-PCR showing the
levels of endogenous CCND1 (Endo) and exogenous CCND1-MS2 (Exo) expression in CCND1pr-
CCND1-MS2 cells during serum starvation (48 hr) and after serum stimulation (8 hr).
Normalized with GAPDH. (f) Cell cycle analysis of the Flp-In cell lines. FACS analysis of the
parent cell line (HEK-293-Flp-In) and the two generated cell lines - CCND1pr-CCND1-MS2 and
CCMVpr-CCND1-MS2 cells, shows a similar cell cycle pattern. G1 - blue, S - green, G2 - orange.
Nature Methods: doi: 10.1038/nmeth.1482
![Page 6: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/6.jpg)
8
Supplementary Figure 3 Detection of transcription sites and mRNPs in the stable clones.
(a) RNA-FISH with a Cy3-labeled probe against the MS2 region showing transcription sites
(green arrows) and cytoplasmic mRNAs in CMVpr-CCND1-MS2 and CCND1pr-CCND1-MS2 cells.
Nature Methods: doi: 10.1038/nmeth.1482
![Page 7: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/7.jpg)
9
(b) RNA FISH with a Cy3-MS2 probe on the CMVpr-CCND1-MS2 (left) and CCND1pr-CCND1-MS2
(right) cell populations shows that active transcription sites were detected in 94% of the
CMVpr-CCND1-MS2 cells, while in CCND1pr-CCND1-MS2 cells only 43% of the population
showed active sites (histogram). Two independent experiments: CMVpr-CCND1-MS2 cells
n=400, CCND1pr-CCND1-MS2 cells n=425. Values are mean ± s.d.
(c) Frames from Supplementary Video 1 showing the release of an mRNP (red arrow) from a
transcription site in a CCND1pr-CCND1-MS2 cell. (d) Frames from Supplementary Video 1
showing an active transcription site and nucleolplasmic mRNPs in a CMVpr-CCND1-MS2 cell.
Scale bar = 5 µm.
Nature Methods: doi: 10.1038/nmeth.1482
![Page 8: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/8.jpg)
10
Supplementary Figure 4 Live-cell imaging of CMVpr and CCND1pr-driven transcription.
Cells were imaged at different acquisition frequencies and the intensity of mRNA transcription
at the active genes was measured over time (see Fig. 1). (a-c) CMVpr-CCND1-MS2 cells. Imaging
frequency: left: every 300 msec; middle: 1 min; right: 20 min. (d-f) CCND1pr-CCND1-MS2 cells.
Imaging frequency: left: 3 min; middle: 1 min; right: 1 min. Scale bar, 5 µm. Frames from live-
cell movies in a-c correspond to the intensity profile plots in Fig. 1c. Frames from live-cell
movies in d and f correspond to the intensity profile plots in Fig. 1d (left and middle plots,
respectively).
Nature Methods: doi: 10.1038/nmeth.1482
![Page 9: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/9.jpg)
11
Supplementary Figure 5 The CCND1 endogenous promoter cycles between “on” and “off”
states. Frames from Supplementary Movie 5 showing the cycling of the CCND1pr driven gene
Nature Methods: doi: 10.1038/nmeth.1482
![Page 10: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/10.jpg)
12
over a period of more than 6 hours. Arrowheads point to the active state of the transcription
site. Scale bar = 5 µm. Plot shows the expression levels at the transcription site during the
movie.
Nature Methods: doi: 10.1038/nmeth.1482
![Page 11: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/11.jpg)
13
Supplementary Figure 6 Detection and quantification of mRNAs by RNA-FISH.
3D-stacks of images from RNA-FISH experiments (MS2-Cy3 probe, pseudo-colored green) were
collected and deconvolved. Transcription sites (cyan arrows) and cytoplasmic mRNAs were
identified (white spheres, middle image). DNA (Hoechst) is pseudo-colored red. The intensities
Nature Methods: doi: 10.1038/nmeth.1482
![Page 12: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/12.jpg)
14
in each volume were measured. Total cell volumes are shown for: (a) CMVpr-CCND1-MS2 cell,
(b) CCND1pr-CCND1-MS2 cell. Left- deconvolved RNA-FISH (green) and DNA. Middle- Detection
of total mRNA particles (white). Right- 3D projections of cell volumes: Top- particle
identification (blue spheres) seen on top of the original FISH signal (green). Bottom- the
measured mRNA volumes seen as the object surface of each mRNP. Scale bar, 5 μm.
(c) Schematic presentation of the increase in fluorescence from the MS2 region and onwards
during transcription. This shows: 1) the region on which mRNAs were quantified by RNA-FISH,
and 2) the region in which fluorescence recovery is measured during FRAP experiments.
Nature Methods: doi: 10.1038/nmeth.1482
![Page 13: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/13.jpg)
15
Supplementary Figure 7 Detection of replicated transcription sites.
(a) Two adjacent GFP-MS2 labeled transcription sites observed in living cells. Scale bar, 5 µm.
(b) FACS analysis showing synchronization of cells to G1/S by thymidine or to S phase after
etoposide treatment. G1 - blue, S - green, G2 - orange (n=4 repeats). (c) Synchronization to late-
S phase led to a 17% increase in cells showing two active transcription sites (n=300). Values are
mean ± s.d. (d) Frames from a time-lapse movie of mitosis (Supplemental Movie 7) showing
duplicated transcription sites before mitosis (left, and inset), the cell during metaphase with no
transcription sites (middle), and daughter cells with single transcription sites (right).
Nature Methods: doi: 10.1038/nmeth.1482
![Page 14: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/14.jpg)
16
Nature Methods: doi: 10.1038/nmeth.1482
![Page 15: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/15.jpg)
17
Supplementary Figure 8 Spatial localization of the active transcription sites.
(a) 3D time-projection of an active transcription site (red) in relation to the nuclear periphery
(green shell) shows that transcription sites usually had peripheral localization. Right– original
movie time projection (1 hr movie).
(b) Single or double active transcription sites (green) did not localize with nuclear speckles (red,
SC-35), or with (c) nucleoli (red, fibrillarin), or with Cajal bodies (arrow) detected with the
fibrillarin staining. Scale bar = 5 µm.
(d) Diffusion analysis portrays the dynamics of the mRNA associated with the transcription site
before and after duplication (n=16 and 12 for single and double sites, respectively). Colors
represent the time scale. The motion of actively transcribing single genes was diffusive
(diffusion coefficients measured were D=(2.3±1.7)*10-4 μm2/sec, similar to1) and after
duplication an increase in transcription site mobility was observed (D=(3.9±2.4)*10-4 μm2/sec).
Two tailed t-test (t= 2.739, (df=26), p-value=0.011). (Supplementary Video 8).
Nature Methods: doi: 10.1038/nmeth.1482
![Page 16: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/16.jpg)
18
Nature Methods: doi: 10.1038/nmeth.1482
![Page 17: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/17.jpg)
19
Supplementary Figure 9 The emerging of a second site in living cells.
(a) The kinetics of the transcriptional activation of the second site appearance in a CMVpr-
CCND1-MS2 cell (Supplementary Video 9, 49 min movie). Scale bar = 5 µm. Top – frames from
movie. Bottom – close up of the transcription sites (grey levels pseudo-colored using ImageJ
‘fire’ look-up table).
(b) The kinetics of the transcriptional activation of the second site appearance in a CCND1pr-
CCND1-MS2 cell (image sequence - 18 min).
(c) Time projection of the two sites from (a). At first one site is seen, later on the emergence of
the second site is detected (arrow). Right – 3D volume of the nucleus.
Nature Methods: doi: 10.1038/nmeth.1482
![Page 18: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/18.jpg)
20
Supplementary Figure 10 Duplicated transcription sites in fixed and living cells.
Imaging the appearance of a second transcription site in living cells CMVpr-CCND1-MS2 cells
were imaged (a) every 10 min, for a total time of 230 min; and (b) every 8 min, total 176 min.
Single transcription sites could be followed for up to 3 hours before the appearance of the
duplicated site. Scale bar = 5 µm. (c) Signal intensity of a replicated transcription site (two
arrows), a single transcription site (one arrow, and cellular mRNAs using RNA-FISH. Right –
enlargement of the transcription sites. Scale bar, 5 µm.
Nature Methods: doi: 10.1038/nmeth.1482
![Page 19: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/19.jpg)
21
Supplementary Figure 11 RT-PCR of reporter mRNA levels.
(a) Cells expressing the CCND1pr-driven CCND1-MS2 gene were synchronized to either G1/S (2
mM thymidine) or to late-S phase (1 mM etoposide). The different sub-populations are marked
in the plots. (b) Semi-quantitative RT-PCR of the CCND1-MS2 and endogenous CCND1 mRNA
levels in untreated, G1/S and late-S cells. The levels were normalized to GAPDH.
Nature Methods: doi: 10.1038/nmeth.1482
![Page 20: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/20.jpg)
22
Supplementary Table 1 Values of transcriptional kinetics extracted from the model.
Values of the transcriptional kinetics measured from actively transcribing single alleles as
extracted from the model (Supplementary Note).
CMVpr CCND1pr
mRNA per cell 114+40 41+30
mRNA per site 14+4 7+4
Polymerase spacing (nt) 237 335
Polymerase firing (sec) 22 52
Transcription rate (kb/min) 0.31-0.78
Nature Methods: doi: 10.1038/nmeth.1482
![Page 21: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/21.jpg)
23
Supplementary Table 2 Primer and adaptor list
Primers and adaptors used:
Adaptor 1 5’-GGCCTGACGCGTTCGCGAGAGCTCAACCGGT
CCTGCAGGATGTACCCATACGATGTTCCAGATT
ACGCTGCATGTACAAGCGGCCGCACTCGAGACCCGGGA-
3’
Adaptor 2 5’-AGCTGATAGGATCCAGCTAGCAGATCTTCATTCT
CCTTGTTGTTGGTTGTTTTTTCCTTTGCTCTTTCCGC
CTTCCATCTCTGAA-3’
Adaptor 3 5’-AATTCTGCAGATATCCAGCACAGTGGCCT
GACGCGTTCGCGAGAGCTCAAGATCTAAATAGGAT
CCGGTACCATAATAAAGCTTAAACCGGTCCTGCAGG-3’
D1-sense 5’-ATAGCGGCCGCATGGAACACCAGCTCCT-3’
D1-antisense 5’-TATCTCGAGGACGCCTCCTTTGTGTTAATGCC-3’
D1-3'UTR-sense 5’-GTCACCTAGCAAGCTGCCGAAC-3’
D1-3’UTR-antisense 5’-TATCTCGAGCCTCCGAGCACAGGATGAC-3’
Hygromycin-sense 5’-GACGTCTGTCGAGAAGTTTCTG-3’
Hygromycin-antisense 5’-CTGTTATGCGGCCATTGTCC-3’
SV40-promoter-sense 5’-CCAGTTCCGCCCATTCTCC-3’
Lac-Zeocin-antisense 5’-GTAACCGTGCATCTGCCAGTTTG-3’
Nature Methods: doi: 10.1038/nmeth.1482
![Page 22: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/22.jpg)
24
Supplementary Discussion
Gene active phases alternating between inactive periods as seen with the endogenous CCND1
promoter are termed transcriptional pulses or bursts. These have been described by
microscopy assays that typically examined the levels of the final protein product2-4 or by
counting of mRNAs in fixed cells5,6. Two live-cell studies have shown gene active periods to
range on the short minute range, 5-6 minutes in E.coli7 and the social amoeba Dictyostelium8. In
this study we show that a "transcriptional burst" in mammalian cells manifests on the long-
minute range, within a time-window that permits the recruitment and gradual buildup of
several polymerases on the gene, per event of gene activation. This would result in the
downstream long-range buildup of protein as seen in the 5 hour oscillation period of the p53
product9. Our data show that several polymerases are recruited to the gene during a
transcriptional burst. Previous measurements using RNA-FISH to count polymerase numbers
and their spacing on genes have quantified 30 transcripts on the β-actin gene following serum-
induction (~170 bp spacing)10, 14 and 23 polymerases per highly active s36 and s38 chorion
genes in Drosophila (~100 bp spacing)11, and 11 polymerases on the Dictyostelium dscA gene
(~120 bp spacing)8. Our quantifications show that the CMV promoter and the endogenous
promoter have distinct recruitment capabilities, 7±4 mRNAs for CCND1pr-CCND1-MS2 and
14±4 mRNAs for CMVpr-CCND1-MS2 sites, which confirm the distinct variation in kinetics for
both promoters seen in the live-cell movies. This analysis also showed that the elongation rates
measured on our genes were ~0.8 kb/min, a value which is lower than the current
measurements from living cells (2-4 kb/min)12-14. The latter studies have used tandem arrays
containing many genes to perform these measurements, and thereby could extract elongation
Nature Methods: doi: 10.1038/nmeth.1482
![Page 23: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/23.jpg)
25
rates as well as pausing and termination values. This was possible since the polymerases on
some genes in the array were elongating whereas others were stalled. However, it is not
possible to distinguish between these processes using the single-gene approach since so few
polymerases are on the genes. Therefore, our value probably reflects a global number
encompassing elongation, pausing and termination.
Transcription was followed in real-time through the cell cycle. Surprisingly, a second
transcription site emerged from the “mother site” after replication. Transcriptional activity
from both sister chromatids persisted until cell division, yet promoter potency and polymerase
recruitment were drastically reduced as shown by mRNA quantification and FRAP experiments.
Still, these quantifications show that the combination of replicated alleles produced similar
amounts of transcripts as the one-allele state, hence indicating fine-tuning of mRNA levels
generated in concurrence with the cell cycle stage. The changes in promoter potency could be
due to alterations in chromatin structure and modifications following replication. The similar
transcriptional kinetics observed on both sister chromatids provide confirmation for the
inheritance of transcriptional potential during replication as suggested by McKnight and Miller
for replicated Drosophila sister chromatids15.
Nature Methods: doi: 10.1038/nmeth.1482
![Page 24: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/24.jpg)
26
Supplementary Notes
The FRT system
The Flp-In System (Invitrogen) streamlines the generation of stable mammalian expression cell
lines by taking advantage of an S. cerevisiae-derived DNA recombination system. The
recombination system uses a recombinase (Flp) and site-specific recombination to facilitate the
integration of a single gene of interest into a specific Flp Recombination Target (FRT) site in the
genome of mammalian cells. Since the integration site is identical, isogenic cell lines with
different inserted genes can be obtained. Using antibiotic resistance it is possible to screen for
positive cell clones. The obtained cell lines contain a single-copy of the integrated gene in the
same genomic locus, allowing direct comparison between different gene-constructs.
Following is the order of steps for stable cell line generation and options of screening. Three
different vectors are used:
1) The pFRT/lacZeo target site vector was used to generate a Flp-In™293-FRT cell line
(Invitrogene). The vector contains a lacZ-Zeocin fusion gene that confers Zeocin antibiotic
resistance to the cells. An FRT site has been inserted just downstream of the ATG initiation
codon of lacZ-Zeocin. The FRT site serves as the binding and cleavage site for the Flp
recombinase.
2) The pcDNA5/FRT expression vector into which HA-CCND1-MS2 was cloned. The vector also
contains the hygromycin resistance gene with an FRT site embedded in the 5′ coding region.
However, the hygromycin gene lacks a promoter and the ATG initiation codon, and therefore
cannot express.
3) The pOG44 plasmid which constitutively expresses the Flp recombinase.
Nature Methods: doi: 10.1038/nmeth.1482
![Page 25: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/25.jpg)
27
Upon co-transfection of the pOG44 plasmid and the pcDNA5/FRT-HA-CCND1-MS2 vector, the
Flp recombinase mediates a homologous recombination event between the FRT sites such that
the pcDNA5/FRT construct is inserted into the genome of the HEK-293-Flp-In cells at the
integrated FRT site. This brings the SV40 promoter and the ATG initiation codon (from
pFRT/lacZeo) into proximity and frame with the hygromycin gene, and inactivates the lacZ-
Zeocin fusion gene. Thus, stable Flp-In expression cell lines can be selected for hygromycin
resistance, Zeocin sensitivity, lack of β-galactosidase activity, and expression of the
recombinant protein of interest (Supplementary Figs. 1 & 2).
The cyclin D1 gene
Cyclin D1 is a major player in the control of the cell cycle16,17. D-type cyclins control the passage
of cells through the G1 phase, ultimately allowing entry into S phase18. They function through
the activation of cdk4/6, which in turn causes the initial inactivation of Rb by
phospohorylation19. Given the central role of cyclin D1 in the cell cycle, its expression is
regulated at several levels, including mRNA transcription, mRNA stability, translational control
and protein turnover. Among the dozen known human cyclin genes, only CCND1 has been
convincingly implicated in oncogenesis20 and its overexpression was shown to cause mammary
cancer in transgenic mice21. The CCND1 mRNA contains a large 3’UTR that might be involved in
transcriptional regulation. A large number of transcription factor binding sites have been
identified in the promoter region17,22,23. For instance, a study that followed Pol II recruitment to
the D1 promoter in the presence of a mutated transcription factor showed by ChIP that Pol II
recruitment was modified along the gene when the mutated transcription factor was present24.
Nature Methods: doi: 10.1038/nmeth.1482
![Page 26: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/26.jpg)
28
Yet, the kinetics of CCND1 mRNA expression have not been analyzed as such, since most
attention has focused on cyclin D1 protein levels. In one study, CCND1 mRNA levels were
measured during the cell cycle using RNA-FISH, and concluded that CCND1 mRNA levels were
generally higher during G1 phase than during S and G2 phases25. This in agreement with our
quantifications of the number of mRNAs transcribed during different phases of the cell cycle
(Figs. 2 & 3). Interestingly in the above mentioned study, when a nuclear run-on assay was
performed on cells which were synchronized by serum starvation it was hard to detect any
major differences in CCND1 mRNA expression. This was seen also in RT-PCR (Supplementary
Fig. 11). This highlights the strength of single-cell analysis and quantification that can detect
differences in transcription on the single cell and single-allele level, versus biochemical
extractions of large cell populations that average out the differences within the cell
population26. In another study, RNA-FISH was used to analyze the percentage of cells with
active CCND1 transcription sites in cancerous cell lines27. This showed that only ~30% of cells
had active CCND1 transcription site similar to the data we present in Supplementary Fig. 3.
Extracting polymerase kinetics from FRAP data
RNA polymerase II elongation kinetics measured by FRAP analysis were previously described in
two studies utilizing this in vivo elongation assay12,14. In this assay, the GFP-MS2 signal at the
active transcription sites is photobleached and the recovery is monitored over time
(fluorescence recovery after photobleaching, FRAP)28. The recovering signal at the transcription
site consists of mRNA synthesis and mRNA release from the site. Specifically, the fluorescence
recovery signifies the generation of new MS2 stem-loops in the nascent mRNAs and their
Nature Methods: doi: 10.1038/nmeth.1482
![Page 27: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/27.jpg)
29
binding by fluorescent GFP-MS2 proteins entering from the surrounding nucleoplasm. In other
words, the recovery rates are proportional to the rates of Pol II elongation as the polymerase
moves through the MS2 region. These numbers can then be extracted from the FRAP curves as
explained in Supplementary Note. It should be noted that in this assay the elongation kinetics
are being measured only throughout the MS2 region since this is the only region in which
fluorescent molecules are added sequentially to the nascent transcript (see Supplementary Fig.
6c).
Modeling the FRAP data
We used a model based on a rate-equation to describe the elongation of mRNA on the CCND1-
MS2 genes and the subsequent release of a complete transcript. The model is based on a few
basic assumptions and leads to a rather simple rate-equation:
dn/dt = ke-koffn
that describes the rate of change of the total number of nucleotides that contribute to the
buildup of fluorescence at the transcription site during active transcription. n is the number of
nucleotides to which GFP-MS2 proteins are attached (through the MS2 stem loops). ke is the
rate at which MS2-nucleotides are added to the transcript, and therefore it is also the rate at
which the fluorescence increases. koff is the average fraction of MS2-nucleotides that leave the
transcription site per time unit with the release of a mature transcript, and results in a
reduction in the fluorescence intensity. Therefore koffn is the number of MS2-nucleotides that
leaves the transcription site.
Nature Methods: doi: 10.1038/nmeth.1482
![Page 28: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/28.jpg)
30
Summarizing these two assumptions we find that the fluorescent intensity is determined by
two processes:
1. The synthesis of the MS2 region which adds nucleotides and leads to the increase in
the fluorescent signal on the site (Supplementary Fig. 5c). This is the term + ke in the
equation.
2. The release of complete fluorescent transcripts, which reduces the number of MS2-
nucleotides and hence reduces the fluorescent signal, - koffn.
The diffusion coefficient of released transcripts was previously found to be 0.04 µm2/sec 29,30
which means that a transcript will leave the FRAP spot size (r=0.3 µm) in approximately 375
msec and therefore does not affect time-lapse measurements which are performed at
significantly longer time scales.
The above equation has an analytical solution:
n(t) = (1-e-kofft)
Note that this solution is normalized, which means that it approaches the value n = 1 after a
long time. We fitted the solution to the normalized FRAP data (Fig. 1c) and extracted koff. We
extracted a value of 2.83*10-3 [sec-1] for the CMVpr-CCND1-MS2 cells and 1.44*10-3 [sec-1] for
the CCND1pr-CCND1-MS2 cells. We also tried to fit the data with a two-exponential model, but
it did not improve the results and gave similar residual values to those obtained with a single
exponential fit.
In the steady state case (dn/dt = 0) meaning that the number of nucleotide at the site
remains constant over time and therefore the rate equation becomes koffn = ke.
Nature Methods: doi: 10.1038/nmeth.1482
![Page 29: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/29.jpg)
31
The total number of MS2-nucleotides n at the transcription site depends on the total
number of polymerases moving through the MS2 region and onwards. Note that ke in the above
equation describes the addition rate of all MS2-nucleotides that are being transcribed by all the
polymerases that are moving through the MS2 region. This leads to ke = ke*·p = koff ·Σini where
ke* is the transcription rate of a single polymerase, p is the number of polymerases that are
currently transcribing the MS2 region, ni is the number of MS2-nucleotides on each polymerase,
and the sum is for all the polymerases at the transcription site.
Taking the quantified number of mRNAs in each cell (Fig. 2c) and assuming that the
polymerases are equally distributed along the transcription unit, the total number of
polymerases can be determined. The mRNA number and the knowledge that the MS2 region in
each RNA is 1308 nucleotides long, leads to an estimation of the total number of transcripts
containing MS2-nucleotides at the site. Deploying the polymerases through the gene with a
constant spacing and considering the constraint from the above number, the transcription rate
for a single polymerase in each cell type could be extracted. Using statistical analysis (Matlab),
the range of transcription rates were determined and found to be 0.31-0.78 kb/min.
Nature Methods: doi: 10.1038/nmeth.1482
![Page 30: Single-allele analysis of transcription kinetics in …...3D-stacks of images from RNAFISH experiments (MS2- -Cy3 probe, pseudo-colored green) were collected and deconvolved. Transcription](https://reader034.vdocument.in/reader034/viewer/2022050412/5f88f829c075ce41544bb077/html5/thumbnails/30.jpg)
32
References
1. J. R. Chubb, S. Boyle, P. Perry, and W. A. Bickmore, Curr. Biol. 12, 439-445 (2002). 2. A. Sigal et al., Nature 444, 643-646 (2006). 3. J. Yu et al., Science 311, 1600-1603 (2006). 4. L. Cai, C. K. Dalal, and M. B. Elowitz, Nature 455, 485-490 (2008). 5. A. Raj et al., PLoS Biol 4, e309 (2006). 6. D. Zenklusen, D. R. Larson, and R. H. Singer, Nat Struct Mol Biol 15, 1263-1271 (2008). 7. I. Golding, J. Paulsson, S. M. Zawilski, and E. C. Cox, Cell 123, 1025-1036 (2005). 8. J. R. Chubb, T. Trcek, S. M. Shenoy, and R. H. Singer, Curr. Biol. 16, 1018-1025 (2006). 9. G. Lahav et al., Nat Genet 36, 147-150 (2004). 10. A. M. Femino, F. S. Fay, K. Fogarty, and R. H. Singer, Science 280, 585-590 (1998). 11. Y. N. Osheim, O. L. Miller, Jr., and A. L. Beyer, Cell 43, 143-151 (1985). 12. X. Darzacq et al., Nat Struct Mol Biol 14, 796-806 (2007). 13. Y. Ben-Ari et al., J. Cell Sci. 123, 1761-1774 (2010). 14. S. Boireau et al., J Cell Biol 179, 291-304 (2007). 15. S. L. McKnight and O. L. Miller, Jr., Cell 17, 551-563 (1979). 16. D. G. Johnson and C. L. Walker, Annu Rev Pharmacol Toxicol 39, 295-312 (1999). 17. R. G. Pestell et al., Endocr Rev 20, 501-534 (1999). 18. C. J. Sherr, Cell 79, 551-555 (1994). 19. R. A. Weinberg, Cell 81, 323-330 (1995). 20. S. Bates and G. Peters, Semin Cancer Biol 6, 73-82 (1995). 21. T. C. Wang et al., Nature 369, 669-671 (1994). 22. O. Coqueret, Gene 299, 35-55 (2002). 23. E. A. Klein and R. K. Assoian, J. Cell Sci. 121, 3853-3857 (2008). 24. G. Sanchez et al., Proc. Natl. Acad. Sci. U S A 105, 6004-6009 (2008). 25. Y. Guo, D. W. Stacey, and M. Hitomi, Oncogene 21, 7545-7556 (2002). 26. D. R. Larson, R. H. Singer, and D. Zenklusen, Trends Cell Biol. (2009). 27. S. Maier et al., J Cell Physiol 218, 638-642 (2009). 28. A. I. Lamond and J. R. Swedlow, Nat Struct Mol Biol 14, 788-790 (2007). 29. Y. Shav-Tal et al., Science 304, 1797-1800 (2004). 30. D. Y. Vargas et al., Proc. Natl. Acad. Sci. U S A 102, 17008-17013 (2005).
Nature Methods: doi: 10.1038/nmeth.1482