single nucleotide polymorphisms (snps ...inbios21/pdf/fall2009/ware11092009.pdf · single...

12
Genomics Genomics in Medicine, part II

Upload: others

Post on 22-Feb-2021

5 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Single Nucleotide Polymorphisms (SNPs ...inbios21/PDF/Fall2009/Ware11092009.pdf · Single Nucleotide Polymorphisms (SNPs) GATCTGTATGCCTACTAGAAGATCGAT GATCTGTATGCCTACGAGAAGATCGAT Individual’s

Genomics

Genomics in Medicine, part II

Page 2: Single Nucleotide Polymorphisms (SNPs ...inbios21/PDF/Fall2009/Ware11092009.pdf · Single Nucleotide Polymorphisms (SNPs) GATCTGTATGCCTACTAGAAGATCGAT GATCTGTATGCCTACGAGAAGATCGAT Individual’s

Overview

Impact of the Human Genome Project (HGP)

Molecular Basis of Disease

SNPs and Diagnostics

Drug design, drug efficacy, and adverse drug effects

Imatinib, part II

Page 3: Single Nucleotide Polymorphisms (SNPs ...inbios21/PDF/Fall2009/Ware11092009.pdf · Single Nucleotide Polymorphisms (SNPs) GATCTGTATGCCTACTAGAAGATCGAT GATCTGTATGCCTACGAGAAGATCGAT Individual’s

http://www.ncbi.nlm.nih.gov/projects/genome/guide/human/

Page 4: Single Nucleotide Polymorphisms (SNPs ...inbios21/PDF/Fall2009/Ware11092009.pdf · Single Nucleotide Polymorphisms (SNPs) GATCTGTATGCCTACTAGAAGATCGAT GATCTGTATGCCTACGAGAAGATCGAT Individual’s

Impact of the Human Genome Project:Opportunities to

• understand the molecular basis of disease (monogenic vs.polygenic basis of disease)

• understand biochemical pathways and metabolism

• design novel molecular diagnostics

• develop novel therapeutics (e.g., drug target discovery, gene therapy)

Page 5: Single Nucleotide Polymorphisms (SNPs ...inbios21/PDF/Fall2009/Ware11092009.pdf · Single Nucleotide Polymorphisms (SNPs) GATCTGTATGCCTACTAGAAGATCGAT GATCTGTATGCCTACGAGAAGATCGAT Individual’s

Molecular basis of disease

Chronic myeloid leukemia: Specific chromosomal abnormality called the Philadelphia (Ph) chromosome contained within affected cells.

Ph chromosome results from translocation (exchange of genetic material) between chromosomes 9 and 22 .

This exchange brings together two genes:the BCR (breakpoint cluster region) gene on chromosome 22 and the proto-oncogene ABL (Ablesonleukemia virus) on chromosome 9 to produce a hybrid gene called BCR-ABL.

Hybrid gene encodes a fusion protein with tyrosine kinase activity, which activates signal transductionpathways, leading to uncontrolled cell growth.

http://www.ncbi.nlm.nih.gov/books/bookres.fcgi/gnd/gnd.pdf

Page 6: Single Nucleotide Polymorphisms (SNPs ...inbios21/PDF/Fall2009/Ware11092009.pdf · Single Nucleotide Polymorphisms (SNPs) GATCTGTATGCCTACTAGAAGATCGAT GATCTGTATGCCTACGAGAAGATCGAT Individual’s

Monogenic basis of disease

Disease caused by modifications in a SINGLE gene

Three categories of monogenic diseases:Dominant (one bad copy disease)Recessive (both copies must be defective)X-linked (may be dominant or recessive;

expressed in both sexes, but more so in males due to presence of one X (vs. two X’s in females)

Examples: α and β thalassaemias are most common single genedisorders globally; fragile X syndrome, sickle cell anemia, cysticfibrosis, haemophilia)

Page 7: Single Nucleotide Polymorphisms (SNPs ...inbios21/PDF/Fall2009/Ware11092009.pdf · Single Nucleotide Polymorphisms (SNPs) GATCTGTATGCCTACTAGAAGATCGAT GATCTGTATGCCTACGAGAAGATCGAT Individual’s
Page 8: Single Nucleotide Polymorphisms (SNPs ...inbios21/PDF/Fall2009/Ware11092009.pdf · Single Nucleotide Polymorphisms (SNPs) GATCTGTATGCCTACTAGAAGATCGAT GATCTGTATGCCTACGAGAAGATCGAT Individual’s

Single Nucleotide Polymorphisms (SNPs)GATCTGTATGCCTACTAGAAGATCGATGATCTGTATGCCTACGAGAAGATCGAT

Individual’s genomes differ from each other by 0.1%.

There are at least 10 million polymorphic sites in the human genome.

SNPs can distinguish individuals from one another.

SNPs can be used to diagnose disease.

Page 9: Single Nucleotide Polymorphisms (SNPs ...inbios21/PDF/Fall2009/Ware11092009.pdf · Single Nucleotide Polymorphisms (SNPs) GATCTGTATGCCTACTAGAAGATCGAT GATCTGTATGCCTACGAGAAGATCGAT Individual’s

Single Nucleotide Polymorphisms (SNPs)

•Most SNPs have no known effect

•Rarely a single SNP is responsible for the disease state

•Some SNPs predispose an individual to disease

•Some SNPs can be used to determine drug efficacy

•Some SNPs can be used to determine adverse drug effects(want to choose the right medicine for the right patient)

Page 10: Single Nucleotide Polymorphisms (SNPs ...inbios21/PDF/Fall2009/Ware11092009.pdf · Single Nucleotide Polymorphisms (SNPs) GATCTGTATGCCTACTAGAAGATCGAT GATCTGTATGCCTACGAGAAGATCGAT Individual’s

SNPs can be used to diagnose disease

http://cmgm.stanford.edu/~brutlag/Presentations/Genomics_&_Medicine.pdf

Page 11: Single Nucleotide Polymorphisms (SNPs ...inbios21/PDF/Fall2009/Ware11092009.pdf · Single Nucleotide Polymorphisms (SNPs) GATCTGTATGCCTACTAGAAGATCGAT GATCTGTATGCCTACGAGAAGATCGAT Individual’s

http://cmgm.stanford.edu/~brutlag/Presentations/Genomics_&_Medicine.pdf