Proc. Nati. Acad. Sci. USAVol. 81, pp. 5662-5666, September 1984Biochemistry

Site-specific mutagenesis of the human fibroblast interferon gene(*-interferon/protein engineering)

D. F. MARK, S. D. Lu, A. A. CREASEY, R. YAMAMOTO, AND L. S. LINCetus Corp., 1400 Fifty-Third Street, Emeryville, CA 94608

Communicated by Joshua Lederberg, May 23, 1984

ABSTRACT Human fibroblast interferon has three cyste-ine residues, located at amino acid positions 17, 31, and 141.Using the technique of site-specific mutagenesis with a synthet-ic oligonucleotide primer, we changed the codon for cysteine-17 to a codon for serine. The resulting interferon, IFN-fi Ser-17, retains the antiviral, natural killer cell activation, and anti-proliferative activities of native fibroblast interferon. Thepurified IFN-j3 Ser-17 protein has an antiviral specific activityof 2 x 108 units/mg, similar to that of purified native fibro-blast interferon. In addition, the purified protein is stable tolong-term storage at -700C.

In this report we describe the site-specific mutagenesis ofthe cysteine residue to a serine residue at position 17 in theamino acid sequence of IFN-/3 (Fig. lA). The site-specificmutagenesis is induced by using the synthetic 17-nucleotideprimer G-C-A-A-T-T-T-T-C-A-G-A-G-T-C-A-G, which iscomplementary to 16 of the 17 nucleotides on the sensestrand of the IFN-p gene and includes the complementarybase triplet of the TGT codon 17 for cysteine. There is a one-base change at nucleotide 12 in the primer from a T to an Ato induce the mutation.

The human fibroblast interferon (IFN-j3) gene has beencloned and expressed to high levels in Escherichia coli (1-5).However, when the cloned IFN-,3 protein was purified fromextracts of E. coli, we found that its antiviral specific activitywas only 3 x 107 units/mg, about 1/10th that of the nativeglycosylated protein (6). In addition, we found most of theIFN-,3 protein existed as dimers and oligomers in E. coli.IFN-P has three cysteine residues, located at amino acid

positions 17, 31, and 141 (2). One or more of these cysteinescould be involved in intermolecular disulfide bridging, re-sulting in the formation of inactive dimers and oligomers. Inaddition, the three cysteines may interact randomly withineach molecule, resulting in three types of molecules in thecell, each with one of the three possible intramolecular disul-fide bridges. Only one of these forms may resemble the na-tive conformation and retain biological activity. Both ofthese possibilities could together result in the formation ofinactive monomers and oligomers within the cell.To investigate if the sulfhydryls are responsible for the

lower specific activity of the IFN-,B protein by these mecha-nisms, we sought to remove one of the three cysteine resi-dues by site-specific mutagenesis of the IFN-p gene, chang-ing one of the codons for cysteine to that for seine. Theresulting interferon protein has only two cysteine residues,and therefore can form only a unique intramolecular disul-fide bridge, leaving no free sulfhydryl group to form dimersor oligomers.

In leukocyte interferons (IFN-as), which contain four cys-teine residues, there are two -S-S- bonds; between Cys-29 and Cys-138, and between Cys-1 and Cys-98 (7). Cys-141of IFN-p8 is required for biological activity (8). By analogywith the IFN-as, the Cys-141 of IFN-,B could be involved inan-S-S- bond with Cys-31, leaving a free-SH group onCys-17. Therefore, Cys-17 was thought to be the best candi-date for substitution with a different amino acid, and such atransformation should provide some information as to thepossible involvement of the cysteine residue in biological ac-tivity. We chose to replace Cys-17 with a serine residue be-cause the two amino acids differ by only a single atom: thecysteine residue has a sulfur atom that is replaced by an oxy-gen atom in the serine residue.

MATERIALS AND METHODSDNAs and Strains. Plasmids were grown in E. coli K-12

strain MM294 (9). Plasmid ptrp3 is derived from pBR322with the E. coli trp promoter inserted between the EcoRI andHindIII sites (unpublished results). Plasmid pBtrp was de-rived from ptrp3 with the mature human fibroblast interfer-on-coding sequence inserted between the HindIII and Bam-HI sites.The 17-base oligodeoxynucleotide 5' G-C-A-A-T-T-T-T-

C-A-G-A-G-T-C-A-G 3' was synthesized by the triestermethod (10).Enzymes. E. coli DNA polymerase (Klenow fragment), T4

polynucleotide kinase, and restriction enzymes HindIII,BamHI, and Hinfl were obtained from New England Bio-labs. T4 DNA ligase and restriction enzyme Xho II were pro-vided by D. Gelfand.

Interferon. Native human IFN-/3 was kindly provided byY. H. Tan (University of Calgary, Canada). The titer andspecific activity of this preparation was 1.3 x 106 units/mland 3 x 105 units/mg of protein as described (11).

Cells and Virus. Normal human diploid foreskin fibro-blasts (Hs27F) (Naval Biosciences Laboratory, Oakland,CA) and the human GM2504 cells (Cell Repository, Camden,NJ) trisomic for chromosome 21, and an RNA virus, vesicu-lar stomatitis virus (VSV), Indiana Strain (American TypeCulture Collection), were used to comparatively evaluate theantiviral activity of cloned IFN-,8 Ser-17 and native IFN-,83.The cells were cultured in Dulbecco's minimal essential(DME) medium with 10% fetal calf serum.

Determination of Antiviral Activity. Antiviral activity wasmeasured by the reduction of plaque formation (12) of VSVafter 24 hr of interferon treatment of Hs27F cells. Virusyields were expressed in plaque-forming units (pfu). Routineinterferon assays were performed using GM2504 cells andVSV in an inhibition of cytopathic effect assay (13). A Na-tional Institutes of Health (NIH) reference standard for fi-broblast interferon, catalog number G-023-902-527, was ob-tained. An in-house reference standard was generated bycalibration of native poly(I)-poly(C)-superinduced IFN-,f tothe NIH reference standard. The in-house standard was rou-tinely checked against the international reference standardobtained from NIH.

Abbreviations: IFN-,B, fibroblast interferon; RF, replicative form;VSV, vesicular stomatitis virus; ss, single-stranded.

5662

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Proc. NatL Acad Sci USA 81 (1984) 5663

A

B

FN-S

ATO AGC TAC AAC TTG CTT GOA TTC CTA CAA AGA AGC AGC AAT TTT CAG|;CAG AAG CTCmet G tyr sas N Wu gly phe Wu gi erg Ser W se phe gin gin lye lou1 5 10 15 20

FN-B Ser17

ATG AGC TAC AAC TTG CTT GGA TTC CTA CAA AGA AGC AGC AAT TTT CAGI;CAG AAG CTCmet tyr ean lu lu gly phe leu gi erg ser "r asn phe gin gin lys leu1 5 10 15 20

primer

5'-GCAATTTTCAG A.GTCAG-3'TCTTCGTCGTTAAAAGTCLA CAGTCTTCGAGGA(

GCAATTTTCAGTGTCAGCGTTAAAAGTCLACAGTC

Parent

' DNA polymerase I repairTX DNA ligase

I transform E. coil

KHit I

GCAATTTTCAG A GTCAGCGTTAAAAGTCTCAGTC

M13 (RF)

Mutant

FIG. 1. (A) Nucleotide andamino acid sequences of the first20 amino acids of IFN-f3 Cys-17and IFN-,8 Ser-17. The differencebetween the two sequences canbe found in codon 17 (boxed),where there is a single basechange in the coding sequence forIFN-.BSer-17 (T -- A), resultingin the substitution of a serine for acysteine residue. (B) Schematicdescribing the use of an oligonu-cleotide primer in the mutagenesisof IFN-,3 Cys-17 to IFN-f3 Ser-17(see Materials and Methods). RF,replicative form.

Determination of Antiproliferative Effect. The antiprolifer-ative activity was measured by counting the number ofDaudi cells (Naval Biosciences Laboratory, Oakland, CA).Briefly, 2 x 104 cells per 0.1 ml were dispensed into 96-wellmicrotiter plates (Falcon), interferon was added to the cells,and they were incubated at 370C for 3 days, at which timeviable cells were counted by trypan blue (0.1%) exclusion,using a hemocytometer.

Natural Killer Cell Activation. Lymphocytes isolated on aFicoll/Hypaque gradient were washed with DME mediumcontaining 10% fetal calf serum, resuspended at 3 x 106 cellsper ml, treated with the test interferon, and incubated over-night at 370C under 5% CO2. Lymphocytes were washed andresuspended in RPMI 1640 medium with 10% fetal calf se-rum. The target Daudi cells were labeled with 100 0Ci ofNa251CrO4 (250-500 MCi/mg of chromium; New EnglandNuclear; 1 Ci = 37 GBq) per 2 x 106 cells at 370C for 2 hr,washed four times with growth medium, and resuspended inmedium at 2 x 105 cells per ml. Aliquots of lymphocytes andtarget cells were mixed at a ratio of 50:1 in triplicate andincubated for 4 hr at 370C under 5% CO2. The plates werecentrifuged at 400 x g for 5 min, and an aliquot of the super-natants from control and test samples was analyzed with a ycounter.

Percent release or killing was calculated as [(test cpm -background cpm)/(total cpm - background cpm)] x 100.

Site-Specific Mutagenesis. The use of M13 phage vector asa source of single-stranded DNA template has been docu-mented (13-16). A HindIII/Xho II DNA fragment from plas-mid pptrp, containing the entire coding region of the nativeIFN-p, was inserted into the HindIII and BamHI sites of thephage M13mp8 (17), and single-stranded phage DNA (M13-,B) was used as template for site-specific mutagenesis (Fig.1B). Forty picomoles of the synthetic oligonucleotide G-C-A-A-T-T-T-T-C-A-G-A-G-T-C-A-G (primer) was treatedwith T4 polynucleotide kinase (9 units) in the presence of 0.1mM ATP/50 mM Tris HCl, pH 8.0/10 mM MgCl2/5 mM di-thiothreitol in 50 1ul at 370C for 1 hr. The treated primer (12pmol) was hybridized to 5 ,gg of single-stranded (ss) M13-PDNA in 50 ,ul of a mixture containing 50 mM NaCl, 10 mMTris-HCl at pH 8.0, 10 mM MgCl2, and 10 mM 2-mercapto-ethanol by heating at 670C for 5 min and then at 420C for 25min. The annealed mixture was chilled on ice and added to50 gl of a reaction mixture containing deoxynucleoside tri-phosphates at 0.5 mM each, 80 mM Tris HCl at pH 7.4, 8mM MgCl2, 100 mM NaCl, 9 units of DNA polymerase IKlenow fragment, 0.5 mM ATP, and 2 units of T4 DNA li-gase, and incubated at 370C for 3 hr and at 250C for 2 hr. The

Biochemistry: Mark et aL

Proc. Natl. Acad. Sci. USA 81 (1984)

reaction was terminated by extraction with phenol and pre-cipitation with ethanol. The DNA was dissolved in 10 mMTris-HCl, pH 8.0/10 mM EDTA/50% sucrose/0.05% bromo-phenol blue and electrophoresed on a 0.8% agarose gel in thepresence of ethidium bromide at 2 ,ug/ml. The DNA bandscorresponding to the RF forms of M13-,B were eluted fromgel slices by the perchlorate method (18). The eluted DNAwas used to transform competent JM103 cells. The trans-formed cells were grown overnight, and ss phage DNA wasisolated from the culture supernatant. This ss DNA was usedas template in a second cycle of primer extension and thenused to transform competent JM103 cells as describedabove.

Plates containing mutagenized M13-,B plaques, as well astwo plates containing untreated M13-j3 phage plaques, werechilled to 40C, and plaques from each plate were transferredonto two nitrocellulose filter circles by layering a dry filteron the agar plate for 5 min for the first filter and 15 min forthe second filter. The filters were then placed on thick filterpapers soaked in 0.2 M NaOH/1.5 M NaCl/0.2% Triton X-100 for 5 min, and were neutralized by layering onto filterpapers soaked with 0.5 M Tris HCl, pH 7.5/1.5 M NaCl foranother 5 min. The filters were washed in a similar fashiontwice on filters soaked in 2x standard saline citrate (NaCl/Cit; lx NaCl/Cit = 0.15 m NaCl/0.015 M sodium citrate),dried, and then baked in a vacuum oven at 80°C for 2 hr. Theduplicate filters were incubated at 55°C for 4 hr with 10 mlper filter of DNA hybridization buffer (5 x NaCl/Cit) at pH7.0/4x Denhardt's solution (polyvinylpyrrolidone, Ficoll,and bovine serum albumin; lx = 0.02% of each)/0.1% Na-DodSO4/50 mM sodium phosphate buffer, pH 7.0/100 ,g ofdenatured salmon sperm DNA per ml. 32P-labeled probe was

prepared by treating the oligonucleotide primer with [y-2P]labeled ATP and polynucleotide kinase. The filters werehybridized with 3.5 x 105 cpm/ml of 32P-labeled primer in 5ml per filter of DNA hybridization buffer at 55°C for 24 hr.The filters were sequentially washed at 55°C for 30 min eachin buffers containing 0.1% NaDodSO4 and decreasing con-centrations of NaCl/Cit. The filters were washed initiallywith buffer containing 2 x NaCl/Cit and the control filterscontaining untreated M13-,B plaques were checked for thepresence of any radioactivity by using a Geiger counter. Theconcentration of NaCl/Cit was lowered in steps and the fil-ters were washed until no detectable radioactivity remainedon the control filters with the untreated M13-P plaques. Thelowest concentration of NaCl/Cit used was 0.1 x. The filterswere air dried and autoradiographed at -70°C for 2-3 days.One of the five mutated M13-,8 plaques (M13-SY2501) was

picked and inoculated into a culture of JM103. ss DNA wasprepared from the supernatant and RF DNA was preparedfrom the cell pellet. The ss DNA was used as a template forthe dideoxynucleotide sequencing of the clone, using theM13 universal primer (19). Analysis of the DNA sequenceconfirmed that an AGT serine codon has replaced the formerTGT cysteine codon and concomitantly generated a new

Hinfl recognition site (Fig. 1B).Recloning of Mutagenized Interferon Gene for Expression

in E. coli. RF DNA from M13-SY2501 was digested with re-

striction enzymes HindIll and Xho II, and the 520-base-pairinsert fragment was purified on a 1% agarose gel and insert-ed into the HindIll and BamHI sites of plasmid ptrp3, whichcontains the E. coli trp promoter. After transformation of E.coli K-12 strain MM294, DNA from ampicillin-resistanttransformants was digested with Hinfl to screen for the pres-

ence of the M13-SY2501 insert (Fig. 1B). One such clone wasdesignated as pSY1501.

Interferon Purification. E. coli cells containing the gene

coding for either IFN-p8 Cys-17 or IFN-,8 Ser-17 were puri-fied according to the following protocol. Thirteen grams ofE. coli cell paste was suspended in 100 ml of phosphate-buff-

ered saline, pH 7.4. The bacterial suspension was disruptedby sonication and clarified by centrifugation (20,000 x g for15 min). The supernatant was discarded and the particulatefraction was washed with 100 ml of phosphate-buffered sa-line and collected by centrifugation (20,000 x g for 15 min).The pellet was solubilized with 30 ml of 8 M guanidine hy-drochloride (Gdn HCl). The 8 M Gdn HCl solution was dilut-ed with phosphate-buffered saline/10 mM dithiothreitol to3.6 M, and the suspension was clarified by centrifugation(20,000 X g for 20 min). The Gdn HCl in the supernatant wasfurther diluted to 1.8 M with phosphate-buffered saline/10mM dithiothreitol and the fine precipitate containing the in-terferon activity was collected by centrifugation (40,000 x gfor 20 min). The pellet was dissolved in 1.7 M acetic acid, thesolution was cleared by centrifugation (20,000 x g for 15min), and the supernatant was applied to a Bio-Gel P-100column (Bio-Rad; 100-200 mesh, 2.6 cm x 100 cm) previous-ly equilibrated with 1.7 M acetic acid. The column was de-veloped with the same solvent at a flow rate of 60 ml/hr andthe fractions containing the interferon activity were pooled.Interferon was further purified by reversed-phase HPLC us-ing a Whatman Protesil 300 octyl column (4.6 mm x 250 mm)equilibrated with 0.1% trifluoroacetic acid. The column wasdeveloped with a linear gradient consisting of 0.1% trifluor-oacetic acid and acetonitrile containing 0.1% trifluoroaceticacid at a flow rate of 1 ml/min. Protein concentration of theeffluent was estimated by absorbance at 280 nm. Fractionswere collected and assayed for interferon activity as de-scribed above. Those fractions containing peak interferonactivity were pooled for biochemical and biological charac-terization.

Protein Determinations. The protein concentration of du-plicate samples during purification was routinely determinedby the method of Lowry et al. (20), using bovine serum albu-min (Bio-Rad, protein standard) as a reference standard. Theprotein concentration in purified interferon preparations wasalso confirmed by a quantitative amino acid analysis of du-plicate samples. The protein concentration of each samplewas calculated by averaging the values determined from 24-,48-, and 72-hr acid hydrolysates. Recoveries of amino acidswere calculated from an internal norleucine standard. Theprotein determination by either of these two methods has arelative standard deviation of 3%.

Determination of Specific Activity. Specific activity of theinterferon samples was determined by using a virus yield re-duction assay (12) using GM2504 cells and VSV. Our relativeintraassay standard deviation is 10-30%, while interassaystandard deviation is 20%.Long-Term Stability of Purified Interferons. Purified re-

combinant fibroblast interferons (IFN-,3 Ser-17 and IFN-13Cys-17) were diluted to approximately 5 x 106 units/ml inDME medium supplemented with 10% fetal calf serum. Thediluted interferons were put into vials containing 0.5 mleach, sealed, and frozen in liquid nitrogen before storage at-70°C. At the indicated time (Fig. 4), a vial of each interfer-on was thawed and the contents were assayed for interferonantiviral activity by the yield reduction method. All antiviralassays were performed in triplicate and standardized with anin-house interferon standard.Other Methods. Nucleic acid sequence analysis was per-

formed by using the method of Sanger et al. (19). Protein gelswere prepared as described by Laemmli (21).

RESULTS AND DISCUSSIONE. coli strains harboring either pSY2501 (IFN-13 Ser-17) orp,3trp (IFN-pB Cys-17) were grown to an OD at 600 nm of 1.0and lysed by sonication. The soluble and particulate frac-tions were separated by centrifugation (see Materials andMethods). When the particulate fractions were solubilizedfor analysis on NaDodSO4/polyacrylamide gels, a promi-

5664 Biochemistry: Mark et aL

Proc. Natl. Acad. Sci. USA 81 (1984) 5665

Mrx 10-3 M 1 2 3 M 4 5 6 M

94.0 - _67.0 _43.0 _ W _,

30.0

20.1 - ..*. - ai4m -

14.4 - mm

FIG. 2. NaDodSO4/polyacrylamide gel showing the purificationof IFN-,B Cys-17 and IFN-,3 Ser-17. Lane 1, extract (see text; 70 Mg)of E. coli harboring p(3trp (IFN-,8 Cys-17); lane 2, Bio-Gel P-100pool of IFN-,3 Cys-17 (13 pg); lane 3, purified cloned IFN-/3 Cys-17(2.5 pg); lanes M, protein molecular weight markers; lane 4, extract(70 Mg) ofE. coli harboring pSY2501 (IFN-,( Ser-17); lane 5, Bio-GelP-100 pool of IFN-p Ser-17 (13 pg); lane 6, purified cloned IFN-,BSer-17 (2.5 Mg). The proteins were visualized by Coomassie bluestaining.

nent protein band with an apparent molecular weight of18,000 was present in both extracts (Fig. 2, lanes 1 and 4).When similarly prepared extracts of each strain were frac-tionated as described in Materials and Methods, the interfer-on antiviral activity copurified with the Mr 18,000 protein(Fig. 2, lanes 2, 3, 5, and 6).

Characterization of IFN-,B Ser-17. The cloned IFN-P Cys-17 and IFN-,B Ser-17 were purified to homogeneity (Fig. 2,lanes 1 and 4, respectively). The presence of an additionalserine residue and the loss of a cysteine residue in clonedIFN-,B Ser-17 was confirmed by amino acid analysis andNH2-terminal sequence analysis of the purified protein (un-published data). The purified cloned IFN-13 Cys-17 has aspecific antiviral activity of 3 x 107 units/mg. In contrast,the purified cloned IFN-,B Ser-17 has a specific antiviral ac-tivity of 2 x 108 units/mg, comparable to that of purifiednative IFN-,f (5). The specific activities were obtained bydetermining the antiviral titer of at least five different batch-es of each ofthe purified E. coli-produced interferons. In ourhands, the relative intraassay reproducibility of the VSVyield reduction is 10-30o and the interassay standard devi-ation is 20%.

Since the Cys-17 to Ser-17 mutation did not affect the anti-viral activity of the interferon, we set out to examine if itsother biological activities were affected by this mutation.Therefore, the purified cloned IFN-,B Ser-17 protein wascharacterized further by comparing its various interferon

Qj -.0

4-5 r.= 0r. u4) 4.4= 0

9e,04

1 10IFN, units/ml

' 100

80

c 60- 0

40

20

biological activities with those of native interferon; inhibitingthe replication ofVSV in foreskin fibroblasts (Hs27F), inhib-iting the proliferation of lymphoblastoid cells (Daudi), andactivation of natural killer cells, using Daudi cells as targets.Fig. 3 shows that, per antiviral unit, cloned IFN-,8 Ser-17 isas active as native fibroblast interferon in the examined bio-logical activities, indicating that the Cys-17 to Ser-17 muta-tion has no detrimental effect on the biological activities ofinterferon.To determine if the cloned IFN-,3 Ser-17 is immunological-

ly related to the native IFN-,8, we performed neutralizationstudies of both interferons with antiserum raised against thenative IFN-,3. The neutralization curves for the native IFN-.3and the cloned IFN-/3 Ser-17 were indistinguishable (data notshown), indicating that both interferons share common anti-genic determinants that are recognized by the antiserumequally well. Thus, the two interferons are immunologicallyrelated, and the single amino acid substitution in clonedIFN-f3 Ser-17 did not cause any major alteration in the struc-ture of the protein.

Fig. 4 illustrates the stability of purified cloned IFN-,3Cys-17 and IFN-/3 Ser-17 to storage at -70'C. The clonedIFN-,8 Ser-17 is stable over a period of 150 days, while thecloned IFN-P Cys-17 has lost a significant amount of its anti-viral activity in 75 days. In addition, when aliquots of theseinterferon preparations were visualized on a nonreducinggel, a significant amount of dimers and oligomers could bedetected in the IFN-,8 Cys-17 preparation, but not in theIFN-,B Ser-17 preparation (data not shown). These resultshave been confirmed with other preparations of both IFN-,8Cys-17 and IFN-,8 Ser-17, and therefore they cannot becaused by fortuitous contamination of this IFN-,3 Cys-17preparation. Since IFN-/3 Cys-17 differs from IFN-.8 Ser-17only by the presence of an additional cysteine residue, it ishighly likely that this free cysteine is responsible for the for-mation of the dimers and oligomers upon storage, leading toa loss in biological activity.Our results clearly show that Cys-17 in IFN-/3 is not neces-

sary for maintaining biological activity. Furthermore, thecloned IFN-/3 Ser-17 protein has a specific activity signifi-cantly higher than that of the cloned IFN-,8 Cys-17 proteinand similar to that of native IFN-fB. We believe that this isthe direct result of the removal of the Cys residue at position17, thereby preventing the formation of incorrect disulfidebonds and allowing mainly the formation of the correct disul-fide bond between Cys-31 and Cys-141. It is unclear why theIFN-, Cys-17 protein will not fold correctly into the nativeconformation and form the correct disulfide bond in E. coli,since when synthesized in mammalian cells the native IFN-,3folds correctly even though Cys-17 is present. It is possiblethat the sugar moiety on the native IFN-f3 acts as a nucle-

I I IB

--

10 100 1000 10,000IFN, units/ml

(A._

-00

._~

la0

1000500 100 50 10IFN, units/ml

FIG. 3. Comparison of the biological activities of native IFN-13 (v) and IFN-,B Ser-17 (o). (A) Antiviral activity; (B) antiproliferative activity;and (C) activation of natural killer cells.

Biochemistry: Mark et aL

Proc. NatL. Acad. Sci. USA 81 (1984)

7.47.27.0-6.8

_ 6.6E 6.4

.a6.2-IZ ,

0

0

C)4)tou

IFN-/3 Ser-17

* -:: :. 0 * -i-T1::*0 .0

.0 0 0

5 0 '.~~

00

0 30 60 90 120 150

7.4- IFN-p Cys-177.2-7.0- *6.8-6.6- .6.4--6.2-6.0- l I6.n an an all 1 1n 1au M) bu 9u IlU 15U

Time, days

FIG. 4. Stability of IFN-,8 Ser-17 and IFN-,8 Cys-17 to storage at-70'C. At the indicated times, a vial containing approximately 5 x

106 units/ml of cloned interferon was thawed and the antiviral activi-ty was determined. Each point represents an average of three as-

says.

ation site for the correct folding of the protein or that thesugars sterically hinder the formation of incorrect disulfidebonds, whereas in bacteria the IFN-3 is unglycosylated andtherefore is free to form disulfide bonds randomly. Whenpurified cloned IFN-,3 Cys-17 was reduced and reoxidizedunder a number of different conditions, the specific activityof the protein did not increase, and peptide mapping of thereoxidized protein detected the presence of only the two in-correctly disulfide-bridged peptides (R. Drummond, person-al communication), indicating that if the protein was allowedto fold randomly, it may even preferentially form the wrongdisulfide bridges. Another possibility is that in mammaliancells the leader peptide present in the precursor protein in-fluences the folding of the native IFN-,8 protein in a way thatprevents Cys-17 from forming disulfide linkages with othercysteines in the mature protein. Since we are expressingonly the mature protein without the leader sequence in E.coli, incorrect disulfide bridges could be formed.Shepard et al. (8) have shown that the IFN-,3 Cys-141

Tyr-141 variant is biologically inactive and that the structureof the variant IFN-p8 is altered in such a way that it no longerbinds to antibodies raised against native fibroblast interferonnor competes with native IFN-,f for receptors on the targetcells. Our results show that the cloned IFN-,8 Ser-17 proteinhas the full spectrum of biological activity (antiviral, antipro-liferative, and natural killer cell activation) and is neutralizedby antibodies against fibroblast interferon. Both results tak-en together seem to indicate that Cys-17 is not necessary forbiological activity, and Cys-31 and Cys-141 may be involvedin a disulfide bridge that is necessary for full biological activ-ity.On the other hand, mouse IFN-P (22) has only a single

cysteine residue, located at a position on the protein similarto that of Cys-17 in human IFN-f3, suggesting that a disulfidebridge may not be necessary for activity. In addition, sincewe have demonstrated that Cys-17 is not necessary for activ-ity, it is possible that an interferon with no cysteine residuesmay still be biologically active.

The results presented here demonstrate the power of site-specific mutation in studying the structure and function of aprotein, as well as in engineering proteins for improved prop-erties. In addition, this technique can be applied to the studyof biochemical and biophysical phenomena such as the re-ceptor binding site of biologically active proteins and the ac-tive site of enzymes (i.e., identifying the domains involved inthe interaction with receptors) and enables the modificationof binding specificity by site-specific alterations of thegenes.

The authors express their appreciation to K. Mullis for synthesisof oligonucleotides; M. Innis and M. Williams for nucleotide se-quence analysis; C. Tan for providing partially purified native IFN-,3 and rabbit antiserum against native IFN-,3; C. Vitt, L. Doyle, andC. Herst for performing the biological assays; J. Geigert for statisti-cal analysis of the stability data; D. Gelfand for providing the en-zymes; S. Chang, R. Drummond, D. Gelfand, B. Khosrovi, M. Kon-rad, and T. White for their support and encouragement; and E. Jar-vis and E. Ladner for their help 'in preparing the manuscript. Thiswork was partially funded by a joint program between Cetus Corpo-ration and Shell Oil Corporation.

1. Taniguchi, T., Sakai, M., Fujii-Kuriyama, Y., Muramatsu, M.,Kobayashi, S. & Sudo, T. (1979) Proc. Jpn. Acad. 55, 464-469.

2. Taniguchi, T., Ohno, S., Fujii-Kuriyama, Y. & Muramatsu, M.(1980) Gene 10, 11-15.

3. Taniguchi, T., Guarente, L., Roberts, T., Kimelman, D., Dou-han, J., III, & Ptashne, M. (1980) Proc. Natl. Acad. Sci. USA77, 5230-5233.

4. Goeddel, D. V., Shepard, H. M., Yelverton, E., Leung, D.,Crea, R., Sloma, A. & Pestka, S. (1980) Nucleic Acids Res. 8,4057-4074.

5. Derynick, R., Remaut, E., Saman, E., Stranssens, P., DeClercq, E., Content, J. & Fiers, W. (1980) Nature (London)287, 193-197.

6. Friesen, H. J., Stein, S., Evinger, M., Familletti, P. C., Mo-chera, J., Meienhofer, J., Shively, J. & Pestka, S. (1981) Arch.Biochem. Biophys. 206, 432-450.

7. Wetzel, R., Perry, L. J., Estell, D. A., Lin, N., Levine, H. L.,Slinker, B., Fields, F., Ross, M. J. & Shively, J. (1981) J. In-terferon Res. 1, 381-390.

8. Shepard, H. M., Leung, D., Stebbing, N. & Goeddel, D. V.(i981) Nature (London) 294, 563-565.

9. Meselson, M. & Yuan, R. (1968) Nature (London) 217, 1110-1114.

10. Itakura, K., Katagiri, N., Narang, S. A., Bahl, C. P., Marians,K. J. & Wu, R. (1975) J. Biol. Chem. 250, 4592-4600.

11. Tan, Y. H., Barakat, F., Berthold, W.,'Smith-Johannsen, H.& Tan, C. (1979) J. Biol. Chem. 254, 8067-8073.

12. Weigent, D. A., Stanton, G. J., Langford, M. P., Lloyd, R. E.& Baron, S. (1981) Methods Enzymol. 78, 346-351.

13. Temple, G. F., Dozy, A. M., Roy, K. L. & Kan, Y. W. (1982)Nature (London) 296, 537-540.

14. Gillam, S. & Smith, M. (1979) Gene 8, 81-97.15. Gillam, S. & Smith, M. (1979) Gene 8, 99-106.16. Winter, G., Fersht, A. R., Wilkinson, A. J., Zoller, M. &

Smith, M. (1982) Nature (London) 299, 756-758.17. Messing, J. (1981) in Third Cleveland Symposium on Macro-

molecules: Recombinant DNA, ed. Walton, A. (Elsevier, Am-sterdam), pp. 143-153.

18. Davis, R. W., Botstein, D. & Roth, J. R. (1980) AdvancedBacterial Genetics (Cold Spring Harbor Laboratory, ColdSpring Harbor, NY), pp. 178-179.

19. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl.Acad. Sci. USA 74, 5463-5467.

20. Lowry, 0. H., Rosebrough, N. J., Farr, A. L. & Randall,R. J. (1951) J. Biol. Chem. 193, 265-275.

21. Laemmli, U. K. (1970) Nature (London) 227, 680-685.22. Higashi, Y., Sokawa, Y., Watanabe, Y., Kawade, Y., Ohno,

S., Takaoka, C. & Taniguchi, T. (1983) J. Biol. Chem. 258,9522-9529.

5666 Biochemistry: Mark et aL

-;-