spread of a distinct stx2- encoding phage prototype among...

0

JVI00986-12 revised 1

2

Spread of a distinct Stx2-encoding phage prototype among E. coli O104:H4 3

strains from outbreaks in Germany, Norway and Georgia 4

5

Lothar Beutin 1*, Jens Andre Hammerl 1*, Eckhard Strauch 1, Jochen Reetz 1, Ralf 6

Dieckmann 1, Ylanna Kelner-Burgos 1, Annett Martin 2, Angelika Miko 1, Nancy A. 7

Strockbine 3, Björn Arne Lindstedt 4, Detlef Horn 5, Hella Monse 5, Bruno Huettel 6, Ines 8

Müller 6, Kurt Stüber 6, and Richard Reinhardt 6 9

10

1 Federal Institute for Risk Assessment, Department of Biological Safety, Diedersdorfer 11

Weg 1, D-12277 Berlin, Germany 12

2 Federal Institute for Risk Assessment, Epidemiology, Biostatistics and Mathematical 13

Modelling, Scientific Services, Diedersdorfer Weg 1, D-12277 Berlin, Germany 14

3 Centers for Disease Control and Prevention, Escherichia and Shigella Reference Unit, 15

Atlanta, United States 16

4 Norwegian Institute of Public Health, Dept. of Foodborne Infections, Oslo, Norway 17

5 Chemisches und Veterinäruntersuchungsamt Rhein-Ruhr-Wupper, CVUA-RRW, Krefeld, 18

Germany 19

6 Max-Planck-Genomzentrum, Carl-von-Linné-Weg 10, D-50829 Köln, Germany 20

21

Running title: Stx2 phage of enteroaggregative E. coli O104:H4 22

23

Keywords: Shiga toxin, bacteriophage, STEC, EHEC, O104:H4, outbreak24

Copyright © 2012, American Society for Microbiology. All Rights Reserved.J. Virol. doi:10.1128/JVI.00986-12 JVI Accepts, published online ahead of print on 18 July 2012

on June 5, 2018 by guesthttp://jvi.asm

.org/D

ownloaded from

http://jvi.asm.org/

1

* Corresponding Authors: 25

Dr. Lothar Beutin, National Reference Laboratory for Escherichia coli, Federal Institute 26

for Risk Assessment (BfR), Diedersdorfer Weg 1, D-12277 Berlin, Germany 27

E-mail: [email protected] 28

Phone: +49 30 18412 2259 29

Fax: +49 30 18412 2983 30

31

Dr. Jens Andre Hammerl, Department of Biological Safety, Federal Institute for Risk 32

Assessment (BfR), Diedersdorfer Weg 1, D-12277 Berlin, Germany 33

E-mail: [email protected] 34

Phone: +49 30 18412 2057 35

Fax: +49 30 18412 2000 36

37


.org/D

ownloaded from

http://jvi.asm.org/

2

ABSTRACT 38

Shiga toxin 2 (Stx2)-producing Escherichia coli (STEC) O104:H4 caused one of the 39

worlds largest outbreaks of hemorrhagic colitis and hemolytic uremic syndrome in 40

Germany in 2011. These strains have evolved from enteroaggregative E. coli (EAEC) by 41

the acquisition of the Stx2 genes and have been designated as enteroaggregative 42

hemorrhagic E. coli. Nucleotide sequencing has shown that the Stx2 gene is carried by 43

prophages integrated into the chromosome of STEC O104:H4. We studied the properties 44

of Stx2-encoding bacteriophages which are responsible for the emergence of this new type 45

of E. coli pathogen. For this, we analyzed Stx bacteriophages from STEC O104:H4 strains 46

from Germany (in 2001 and 2011), Norway (2006) and the Republic of Georgia (2009). 47

Viable Stx2-encoding bacteriophages could be isolated from all STEC strains except for 48

the Norwegian strain. The Stx2 phages formed lysogens on E. coli K-12 by integration 49

into the wrbA locus resulting in Stx2 production. The nucleotide sequence of the Stx2 50

phage P13374 of a German STEC O104:H4 outbreak was determined. From the 51

bioinformatic analyses of the prophage sequence of 60,894 base pairs 79 open reading 52

frames were inferred. Interestingly, the Stx2 phages from the German 2001 and 2011 53

outbreak strains were found to be identical and closely related to the Stx2 phages from the 54

Georgian 2009 isolates. Major proteins of the virion particles were analysed by mass 55

spectrometry. Stx2 production in STEC O104:H4 strains was inducible by mitomycin C 56

and was compared to Stx2 production of E. coli K-12 lysogens. 57

58


.org/D

ownloaded from

http://jvi.asm.org/

3

INTRODUCTION 59

60

In Germany between May and July 2011, Shiga toxin-producing E. coli (STEC) 61

O104:H4 were identified as the cause of one of the world's largest outbreaks of STEC (19). 62

The outbreak spread to other European and non-European countries and finally accounted for 63

3,842 cases of human infections with a high percentage of patients developing the life-64

threatening hemolytic uremic syndrome (HUS) (17). Until 2011, O104:H4 was considered a 65

rare STEC serotype (8,47), with only a few sporadic cases of human STEC O104:H4 66

infection reported in some European and Asian countries (51). The first STEC O104:H4 67

strains were isolated in 2001 from the feces of siblings with hemorrhagic colitis (HC) and 68

HUS in Cologne, Germany (7,17). 69

The causative STEC O104:H4 strain recovered in the outbreak 2011 differs from 70

E. coli O157:H7 and other enterohemorrhagic E. coli (EHEC) strains because it is negative 71

for the EHEC virulence plasmid and for the genes encoding the attaching/effacing (A/E) 72

mechanism (7,51). On the genome level, STEC O104:H4 strains were shown to most similar 73

to the previously characterized enteroaggregative E. coli (EAEC) strain 55989 and were found 74

to carry typical virulence genes of EAEC strains. (7,46). Accordingly, the term 75

enteroaggregative hemorrhagic E. coli (EAHEC) was proposed for this new group of human 76

pathogenic E. coli (10). Interestingly, EAEC specific virulence genes were not found in all 77

STEC O104:H4 isolates collected before 2011 and significant differences in the EAEC 78

specific virulence genes and EAEC plasmids were found by comparing the German STEC 79

O104:H4 strains from 2001 and from 2011 (7,26). 80

Similar to many classical EHEC strains, the STEC O104:H4 outbreak isolate produces 81

the Shiga toxin 2a (Stx2a). This toxin type is associated with classical EHEC (16,38,46), in 82

particular with EHEC O157:H7 strains. The stx2a genes are located on the genome of 83

lambdoid bacteriophages integrated in the chromosome of their bacterial hosts (31,38,39). 84


.org/D

ownloaded from

http://jvi.asm.org/

4

Augmented colonization of the humans by STEC O104:H4 through aggregative adherence 85

fimbriae might result in high quantities of Stx2a delivered into the host intestine. This was 86

suggested as the causative mechanism leading to the high numbers of patients with severe 87

clinical illness in STEC O104:H4 infected humans (7). 88

Stx2a was previously shown to be associated with severe clinical illness in humans 89

(20,21) and the amount of Stx2a produced by EHEC O157:H7 strains was found to correlate 90

with the development of severe clinical illness in a gnotobiotic piglet model (3). The 91

production of Stx by STEC can be significantly enhanced by certain antimicrobial and by 92

DNA-damaging agents such as ciprofloxacin and mitomycin C, respectively (6,13,48). An 93

increase in Stx production caused by exposure to agents such as ciprofloxacin likely results 94

from induction of the prophage. Stx production was also found to be stimulated by 95

neutrophils and norepinephrine in the gastrointestinal tract indicating that the inducibility of 96

Stx might play a role for in vivo pathogenesis (14,54). The genetic composition of Stx-97

encoding bacteriophages could have an influence on bacterial host specificity and on Stx 98

production (13,48,55). A number of Stx2-encoding bacteriophages have been analysed for the 99

nucleotide sequence and significant differences in global nucleotide composition and in the 100

regulatory genes affecting Stx production were found (31,39,45,49). Genomic sequencing of 101

STEC O104:H4 strains revealed that these carry Stx2a-encoding prophages (40,43). 102

In this work we characterized the Stx2a-encoding short-tailed DNA bacteriophage 103

(podovirus) P13374 from the STEC O104:H4 strain CB13374 which was isolated in the 104

course of outbreak investigations from an opened package of retailed sprouted seeds from a 105

household of an infected patient (53). We analyzed P13374 for its genetic composition, 106

biological properties and bacterial host specificity. Genomic sequencing and analysis of 107

restriction endonuclease digestion patterns indicate that the bacteriophage P13374 is highly 108

similar to the Stx2a phages carried by STEC O104:H4 strains isolated from human patients in 109

Germany in 2001 and in 2011. Additionally, a comparison to phages which are present in 110


.org/D

ownloaded from

http://jvi.asm.org/

5

Stx2a producing STEC O104:H4 strains from Norway and Georgia revealed close 111

similarities. 112

113

MATERIALS AND METHODS 114

115

Bacteria and culture conditions. Bacterial strains used in this work were from the 116

collection of the National Reference Laboratory for Escherichia coli (NRL-E. coli, BfR, 117

Berlin, Germany). STEC O104:H4 strains were serotyped for the O and H antigens and 118

confirmed by Real Time PCR for the presence of stx2, aggR, terB, wzxO104 genes as previously 119

described (53). In order to discriminate between different virulotypes of STEC O104:H4, the 120

strains were additionally investigated for the EAEC heat stable enterotoxin (astA) and for 121

sequence encoding aggregative adherence fimbriae I (aggA) and III (agg3A) as described (7). 122

The strains used for induction and isolation of Stx2-encoding bacteriophages are listed in 123

Table 1. The STEC O104:H4 strain RKI 11-022027 (CB13344) was isolated from a female 124

patient with HUS at the onset of the STEC O104:H4 outbreak in May 2011 in northern 125

Germany (19). Strain CB13374 was isolated from an opened package of sprouted seeds from 126

the household of a patient infected with STEC O104:H4. The sprouts originated from the 127

farm incriminated as the food source of the STEC O104:H4 2011 outbreak strain (4,53). 128

STEC strain CB8983 was isolated in 2001 from a five years old girl with hemorrhagic colitis 129

in Cologne, Germany. Subsequently, the girl developed HUS and was hospitalized. The 130

clinical case report reveals that the strain HUSEC 41 (STEC O104:H4) was isolated from the 131

same patient after she was hospitalized with HUS (7) (L. Beutin, unpublished data). STEC 132

O104:H4 strain 1106-3060-1 (CB13437) originated from a patient in Norway who became 133

infected in 2006. Two STEC O104:H4 strains, 2009EL-2050 (CB13771) and 2009EL-2071 134

(CB13772) were isolated in 2009 from patients with bloody diarrhea in the Republic of 135

Georgia (12). A collection of 31 enteroaggregative E. coli (EAEC) strains was used for 136


.org/D

ownloaded from

http://jvi.asm.org/

6

susceptibility tests to the STEC O104:H4 Stx2a phage (see Table S1 in the supplemental 137

material) and characterized for serotypes and for the presence of the aggR gene as indicator 138

for the presence of the aggregative adherence mechanism (24). Escherichia coli K-12 strain 139

C600 was used as recipient for propagation and lysogenization of Stx bacteriophages (50). 140

C600 derivative strains lysogenizated with different Stx phages and phage lambda were 141

described previously and are listed in Table 3. Media for cultivation of bacteria, preparation 142

of phage lysates and phage susceptibility were used as previously described (50). 143

Isolation, propagation, and purification of Stx2 phages from STEC O104:H4 144

strains. Single colonies of the respective E. coli strains were grown in Luria-Broth (LB) to 145

exponential growth. Induction of lysogenic bacteriophages was performed by adding 146

0.5 µg/ml mitomycin C to the growing bacterial cultures which were further incubated 147

overnight. Bacteriophages were isolated from single plaques grown on the E. coli K-12 strain 148

C600 as described previously (27). High titer phage lysates (109-1011 pfu/ml) were obtained 149

from E. coli C600 as described (50) and were used for isolation of phage DNA, 150

characterization of phage envelope proteins and for phage infection studies. 151

Lysogenization of the E. coli K-12 strain C600 with Stx2a-encoding bacteriophages 152

from STEC O104:H4 strains. Serial dilutions of phages released in mitomycin C induced 153

cultures of O104:H4 strains were spotted on a lawn of the stx-negative E. coli K-12 strain 154

C600. Isolation of lysogenic C600 (Stx phage) strains was performed as previously described 155

(50). The presence of the Stx phage in C600 was confirmed by stx2-specific PCR as described 156

(53) and by mitomycin C induction of viable Stx2 phages from C600 lysogens. 157

Susceptibility of enteroaggregative E. coli (EAEC) to the Stx2 phage from 158

CB13374. Cultures of 31 EAEC strains belonging to 22 different serotypes from the 159

collection of the NRL-E. coli (see Table S1 in the supplemental material) were grown 160

overnight at 37°C in LB-broth. 100 µl of the culture was added to 3 ml of molten LC-Top 161

agar and immediately poured onto LB-agar as described (50). 20 µl portions of P13374 162


.org/D

ownloaded from

http://jvi.asm.org/

7

lysates (1011 pfu/ml) and of freshly mitomycin C induced cultures of the STEC O104:H4 163

strain CB13374 were spotted on EAEC strains and the plates were incubated for 20-22 h at 164

37°C. Lysis of bacteria and plaque formation was monitored after overnight incubation. 165

Strains C600 and CB13374 were used as positive and negative control for plaque formation, 166

respectively. In order to investigate the possible transfer of the stx2 gene to EAEC strains by 167

transduction bacteria grown in zones spotted with P13374 were subcultured on LB-agar and 168

grown overnight at 37°C. DNA extracted from subcultured bacteria was investigated for the 169

presence of the stx2 gene by Real Time PCR as described (53). 170

Determination of Stx2 production. Stx production by bacteria was measured 171

semiquantitavely by the Ridascreen Verotoxin enzyme immunoassay (Ridascreen-EIA, R-172

biopharm Darmstadt, Germany). Bacterial samples for the Stx-EIA were grown at 37°C in 173

Tryptic Soy Broth (TSB) supplemented with or without 0.5 µg/ml mitomycin C under 174

aeration as described previously (5). Undiluted and serial dilutions of bacterial culture fluid 175

were tested from overnight cultures of bacteria showing titers of about 109 cfu/ml. The 176

Ridascreen EIA test results were recorded photometrically with a Dynatech MRX Microplate 177

reader at 450 nm with 630 nm reference wavelength. 178

Statistical analysis. Independent t-tests were used to test for a difference (mean value 179

OD450) between two independent groups (STEC wildtype strains grown in the presence or 180

absence of mitomycin C as well as C600 Stx phage lysogens grown in the presence or 181

absence of mitomycin C, respectively). All analyses were performed with PASW Statistics 182

(v18.0.2). The statistical analyses were 2-tailed, and p values <0.05 were considered 183

significant. 184

Morphology of isolated bacteriophages. To determine the morphological 185

characteristics of isolated phages by transmission electron microscopy (TEM), the negative-186

staining procedure was used. Briefly, Pioloform-carbon-coated, 400-mesh copper grids (Plano 187

GmbH, Wetzlar, Germany) were placed in drops from supernatants of samples collected and 188


.org/D

ownloaded from

http://jvi.asm.org/

8

primed for TEM for 10 min, fixed with a 2.5% aqueous glutaraldehyde (Taap Laboratories, 189

Aldermaston, U.K.) solution for 1 min and stained with 2% aqueous uranyl acetate (Merck, 190

Darmstadt, Germany) solution for 1 min. 191

In addition, the ultrathin sectioning method was performed for electron microscopic 192

investigations of the E. coli K-12 strain TPE2364 (C600) infected with phages lysates of the 193

sprouts strain CB13374. For these investigations infected and mitomycin C-induced bacterial 194

cell suspensions were concentrated by centrifugation. The culture supernatant was removed 195

and the bacterial pellet was suspended in a 2.5% aqueous glutaraldehyde (Taap Laboratories) 196

solution for 24 h and centrifuged at 8,000 rpm for 5 min. The supernatant was removed and 197

the pellet was mixed with a 3% aqueous low melting point agarose (MP Biomedicals, 198

Eschwege, Germany) solution, centrifuged shortly at 14,000 rpm for 5 s and immediately 199

refrigerated for 10 min. This agarose/bacteria cell pellet was cut into little cubes and soaked in 200

1% aqueous osmium tetroxide (Electron Microscopic Science, Hatfield, U.K.) solution before 201

embedding in Epon Resin (Agar Scientific, Stansted, U.K.) according to standard procedures. 202

Thereafter, ultrathin sections were cut, post-contrasted with 2% aqueous uranyl acetate 203

(Merck) solution for 20 min and 2.7% alkaline lead citrate (Serva, Heidelberg, Germany) 204

work solution for 15 min. The negative stained specimens and the ultrathin sections were 205

examined with a JEM-1010 electron microscope (Jeol, Tokyo, Japan) at 80 kV acceleration 206

voltages. Photographs and measurements were performed using a digital camera MegaView II 207

and a computer assisted analysis program (SIS Analysis, Olympus, Münster, Germany). 208

SDS-PAGE and in-gel digestion of P13374 proteins. Phage P13374 proteins were 209

extracted from concentrated phage particles, reduced with 10 mM DTT for 5 min at 95°C and 210

SH groups were subsequently alkylated with 50 mM iodoacetamide for 45 min in the dark at 211

room temperature. Samples were heated for 5 min in sample buffer at 95°C and subjected to 212

sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) according to the 213

procedure of Laemmli (29). Protein samples were electrophoresed on precast gradient gels 214


.org/D

ownloaded from

http://jvi.asm.org/

9

(Criterion Tris-HCl 4-20%, Biorad, Munich, Germany) in a Bio-Rad Protean II 215

electrophoresis system. Gels were washed with water and stained using BioSafe Coomassie 216

Stain (BioRad). Bands of interest were excised and cut into smaller pieces using a clean 217

scalpel. Gel pieces were washed one after another with water, 50% acetonitrile (ACN) and 218

20 mM NH4HCO3. Gel pieces were washed twice with 20 mM NH4HCO3/ ACN (50:50 v/v) 219

to destain the proteins, dehydrated with 100% ACN and dried. Tryptic in-gel digestion was 220

carried out overnight at 37°C using a 12.5 ng/ml solution of proteomics-grade recombinant 221

trypsin (Roche, Mannheim, Germany) in 25 mM NH4HCO3/ 10% ACN/ 5 mM CaCl2. Tryptic 222

peptides were extracted with 50% ACN in 5% trifluoroacetic acid (TFA) for 30 min. The 223

extracted peptides were dried, reconstituted with 0.3% TFA in 60% ACN and directly 224

subjected to MALDI TOF-TOF MS/MS analysis. Alternatively, dried peptides were 225

reconstituted in 0.1% TFA and purified using C18 Zip-Tip according to the manufacturers 226

instructions (Millipore, Schwalbach, Germany) and subjected to MALDI TOF-TOF MS/MS 227

analysis. 228

MALDI sample preparation and MALDI-TOF TOF MS-MS analysis. 1 µl of 229

extracted P13374 peptides was spotted on a MALDI stainless steel target plate and mixed 230

with 1 µl of matrix solution (5 mg/ml α-cyano-4-hydroxycinnamic acid in 0.3% TFA/ 60% 231

ACN). Zip-Tip purified samples were eluted with 5 µl 50% ACN in 0.1% TFA and 1 µl was 232

spotted onto a 800 µm AnchorChip Target plate and dried. Subsequently, 1 µl of matrix 233

solution was added (0.7 mg/ml α-cyano-4-hydroxycinnamic acid in 0.1% TFA/ 85% ACN/ 234

1 mM NH4H2PO4). For external calibration Peptide Calibration Standard II was used (Bruker 235

Daltonics, Bruker). MALDI-TOF TOF MS-MS analysis was performed on a Ultraflex II 236

TOF/TOF instrument (Bruker Daltonics) operated in the reflector mode for MALDI-TOF 237

peptide mass fingerprint (PMF) or LIFT mode for MALDI TOF-TOF analysis. PMF and 238

LIFT spectra were interpreted with the Mascot software (Matrix Science Ltd, London, UK). 239

Database searches (NCBInr), through Mascot were performed via BioTools 3.0 software 240


.org/D

ownloaded from

http://jvi.asm.org/

10

(Bruker Daltonics) using combined PMF and MS/MS (peptide fragment fingerprinting) 241

datasets. The peptide sequences obtained were localised in the annotated P13374 genome 242

sequence using WU-blast 2.0 (Gish, W., http://www.proweb.org/). 243

Isolation, sequencing, and bioinformatic analysis of the CB13374 Stx prophage. 244

The Stx prophage sequence of P13374 was deduced from one contig of the whole genome 245

sequencing (WGS) project (unpublished data) of E. coli O104:H4 strain CB13374. Genomic 246

DNA of the bacteria was extracted and purified by the use of the RTP Bacteria DNA Mini Kit 247

(Stratec, Berlin, Germany). Determination of the CB13374 genomic sequence was performed 248

with the Roche 454 genome sequencer FLX system. Libraries for 454 sequencing were 249

prepared and sequenced according to Roche’s 454 protocols and as previously described (44). 250

Assembling of the reads resulted in several contigs with an average sequence coverage of 251

more than 30-fold per consensus base. The genome sequence of the prophage was confirmed 252

by partial nucleotide sequencing of DNA from isolated phage particles. From these data the 253

final P13374 genome sequence of 60,882 bp was identified and used for further analyses. 254

Protein-encoding open reading frames (ORFs) were predicted using the algorithms of 255

Accelrys Gene version 2.5 (Accelrys Inc.) and ORF-Finder (http://www.ncbi.nlm.nih.gov/) 256

with manual curation. For the ORF analysis, the presence of ATG, GTG, or TTG as a 257

potential start codon and a length of at least 25 encoded amino acids were stated. To compare 258

the gene products of the P13374 ORFs to the annotated proteins of the non redundant 259

GenBank database BLASTp-searches (http://www.ncbi.nlm.nih.gov/blast/) were performed at 260

the NCBI homepage. For gene products with low e-values (>0.001) or no sequence similarity, 261

the PSI-BLAST algorithm was used (1). Identification of putative tRNA genes was performed 262

using tRNAscan-SE (30). Putative Rho-independent transcription terminators were identified 263

using TRANSTERM (9,15). 264

Analysis of integration sites of Stx2 phages. STEC O104:H4 strains and C600 Stx2 265

phage lysogens were investigated for possible prophage insertion site with primers developed 266


.org/D

ownloaded from

http://jvi.asm.org/

11

previously (11) (Table 2). PCR amplification products obtained with STEC O104:H4 strains 267

and E. coli K-12 C600 phage lysogens were investigated by nucleotide sequencing. 268

Database submission: The complete nucleotide sequence of phage P13374 was submitted to 269

EMBL under accession number HE664024. The sequences of the left and right integration 270

sites of the investigated Stx2a phages in wildtype EAEHEC and in E. coli K-12 strains were 271

submitted (left site: accessions HE775132-41; right site: accessions HE775266-75). 272

Additionally, the phage attachment sites in the viral genomes were deposited with the 273

accession numbers HE775127-31 (see Table S2 in the supplemental material). 274

275

RESULTS 276

277

Isolation of Stx2-encoding bacteriophages from STEC O104:H4 strains. Six STEC 278

O104:H4 strains from Germany (isolated in 2001 and 2011), Norway (2006) and the Republic 279

of Georgia (2009) were used as source for isolation of temperate Stx2-encoding 280

bacteriophages (Table 1). All strains were found to be positive by PCR for stx2, aggR and 281

wzxO104 genes but were different in regard to the presence of astA, aggA and agg3A genes 282

(Table 1). 283

Induction of temperate bacteriophages using mitomycin C was successful for all 284

O104:H4 strains. Stx2a-encoding bacteriophages were isolated from the German (CB8983, 285

CB13344 and CB13374) and the Georgian (CB13771 and CB13772) STEC O104:H4 strains. 286

The Norwegian strain CB13437 released only bacteriophages which did not encode stx2 287

genes (see below). All phages formed pinhead-sized plaques on the lawn of strain C600. The 288

presence of the stx2a gene in the purified bacteriophage DNA was confirmed by PCR as 289

described (53). C600 lysogenic for Stx2 phages were isolated as described in Material and 290

Methods section. The bacteriophage released from CB13437 did not form lysogens on C600. 291


.org/D

ownloaded from

http://jvi.asm.org/

12

To study the relationship of the phages purified phage DNAs were subjected to 292

restriction enzyme digestion with PvuI, EcoNI and BsrBI. The Stx2a phages isolated from 293

strains CB8983 (Germany 2001) as well as CB13344 and CB13374 (both Germany 2011) 294

were identical for their restriction profiles with all enzymes tested (Fig. 1). Similar findings 295

were obtained with Stx2a phages from other STEC O104:H4 collected from human patients 296

in the 2011 outbreak in Germany (data not shown). The restriction profiles of the Stx2a 297

phages isolated from the Georgian strains CB13771 and CB13772 were highly similar to each 298

other but showed differences in their restriction patterns with all three enzymes tested when 299

compared to the Stx2a phages isolated from the German 2001 and 2011 isolates (Fig. 1). The 300

Norwegian O104:H4 strain CB13437 did not release Stx phages although the strain was 301

positive for Stx2a phage associated sequences at the attachment site in the wrbA locus. 302

Lysogenization of E. coli with Stx2 phages isolated from STEC O104:H4. Stx2a-303

encoding bacteriophages derived from the German and Georgian O104:H4 strains were found 304

to lysogenize C600 resulting in derivative strains TPE2364 (derived from phage P13374 305

released by strain CB13374), TPE2369 (phage P8983), TPE2381 (phage P13771), TPE2383 306

(phage P13772) and TPE2385 (phage P13344) (Table 3). The C600 lysogens were positive 307

for the stx2a gene and converted to Stx2 production as tested by Stx-EIA (Fig. 2). Induction of 308

lysogenic strains with mitomycin C resulted in release of Stx2a phages which were 309

morphologically similar to those of their wildtype host strains. The integration site of all 310

Stx2a phages in C600 was identical to those found in the STEC wildtype strains (see below). 311

Quantification of Shiga toxin production in cultures of STEC O104:H4 and C600 312

lysogens with and without mitomycin C treatment. Stx production was measured with 313

bacteria grown in TSB supplemented with and without mitomycin C. All six STEC O104:H4 314

strains listed in Table 1 produced significantly more (p=0.033) Stx in the presence of 315

mitomycin C compared to untreated cultures. For Stx production there were no significant 316

differences found (p=0.074) between the tested STEC O104:H4 strains and the results 317


.org/D

ownloaded from

http://jvi.asm.org/

13

obtained for the six strains are summarized in Fig. 2 A. In the presence of mitomycin C, Stx 318

was still detectable in culture fluid diluted between 1:400 and 1:600. In cultures without 319

mitomycin C treatment, Stx was not detectable in dilutions of 1:100 and higher. 320

C600 lysogens harboring Stx2 phages from STEC O104:H4 wildtype strains (TPE2364, 321

TPE2369, TPE2381, TPE2383 and TPE2385 from Table 3) produced significantly higher 322

amounts of Stx than the wildtype STEC O104:H4 strains when grown in the presence 323

(p=0.023) and without (p<0.001) mitomycin C (summarized in Fig. 2B). 324

In contrast to the STEC O104:H4 wildtype strains, there were no significant differences 325

for Stx production between the C600 lysogens when grown with or without mitomycin C 326

(p=0.397). In order to determine if this was due to an increasing spontaneous induction of Stx 327

phages in the P13374 K-12 lysogen we explored the differences in the spontaneous phage 328

release between TPE2364 (Table 3) and CB13374 over a 24 h bacterial growth period. This 329

was investigated in three independent experiments and different time intervals (6 h, 12 h and 330

24 h) by titration of cell-free supernatants of both strains on E. coli C600. In comparison to 331

the STEC strain CB13374 a higher level of one to two orders of magnitude of released phages 332

in cell-free supernatants of TPE2364 was observed (data not shown). These findings could 333

explain the relatively higher Stx2 levels found in the C600 lysogens. 334

The amounts of Stx2a produced by STEC wildtype strains were found similar to that 335

produced by an Stx2a EHEC O157:[H7] strain (CB6161, stx2a) in cultures with (p=0.605) and 336

without (p=0.81) mitomycin C (data not shown). 337

Morphology of phage particles. Negative staining shows that all investigated strains 338

except CB13437 (Table 1) release phages with a short tail and a hexagonal head (virus 339

family: Podoviridae). Phage tails were 12.7 nm (±1.4 nm; n = 20) in the width and their 340

length diversified up to 40 nm (on average approximately 26 nm). The diameters of the phage 341

heads were 68.5 nm (±2.3 nm) measured between the sides parallels, respectively 70.7 nm 342

(±1.4 nm) measured diagonal to the tail. The phages from all strains (CB8983, CB13344, 343


.org/D

ownloaded from

http://jvi.asm.org/

14

CB13374, CB13771 and CB13772) as well as from their C600 lysogens (Table 3) were 344

morphologically very similar to each other (Fig. 3) resembling the Stx2a phage 933W of 345

EHEC O157:H7 strain EDL933 which is also a podovirus (34,39,41,56). In ultrathin sections 346

of C600 infected with P13374, several stages of the phage development were observed (phage 347

attachment, propagation and liberation by bacteriolysis) (Fig. 4A and B). Upon mitomycin C 348

induction the Norwegian strain CB13437 yielded a morphologically different Stx-negative 349

phage of the virus family Myoviridae (Fig. 5). 350

Complete nucleotide sequencing and annotation of Stx2 prophage P13374. The 351

complete nucleotide sequence of the Stx2 prophage P13374 was deduced from the whole 352

genome sequence of the German E. coli O104:H4 outbreak strain CB13374 and confirmed by 353

partial sequencing of relevant regions of the phage DNA of virion particles. Based on this 354

analysis, a genomic sequence of 60,894 bp with a mean G+C content of 50.3% for the 355

temperate phage P13374 was inferred. The annotated prophage genome also includes the left 356

and right core sequences of the attachment sites (13 nt). From detailed bioinformatic analyses 357

(for details see Materials and Methods section) 79 open reading strands (ORFs) with good 358

coding potential were predicted. Furthermore, the investigated prophage genome comprises 359

fourteen putative Rho-independent transcription terminators and three transfer RNAs (tRNAs) 360

(see Table S3 in the supplemental material). The modular organization of the prophage and 361

the specific features of the bioinformatic analyses are summarized in Fig. 6. Further detailed 362

information is given in the supplemental material Table S3. Out of 79 gene products that have 363

been predicted for phage P13374, 62 gene products revealed values of identity ranging from 364

38-100% to annotated proteins of previously characterized Stx-encoding phages (Table S3). 365

According to the predicted function of the suggested gene products on P13374 the genome 366

can be divided into two parts (Fig. 6), left and right half. Moreover, the whole genome 367

organization of P13374 is strongly reminiscent to the Enterobacteria phage sequences TL-368

2011c (JQ011318.1) and VT2phi_272 (HQ424691.1) which originate from E. coli pathotypes 369


.org/D

ownloaded from

http://jvi.asm.org/

15

O103:H25 and O157:H7, respectively (28). The annotation of the P13374 genome was 370

arranged according to the organization of the prophage sequence starting with the putative 371

genes int (ORF01) and exc (ORF02) coding for a phage integrase and excisionase, 372

respectively. Both genes are closely related to their functional counterparts on a cryptic 373

prophage sequence of the E. coli O26:H11 strain 11368 (NC_013361.1) and previously 374

described Stx-encoding phages (933W, VT2-Sakai, Stx1-converting phage and Stx2-375

converting phage I & II). Further genes on the left half of the genome code for proteins 376

involved in regulatory circuits, anti-termination, replication, nucleotide metabolism, Shiga 377

toxin production, and host cell lysis. The core sequences of the genetic switch of P13374 378

show a similar organisation to Lambda-like phages but consist only of the two antagonistic 379

repressor genes cI and cro which code for the prophage repressor CI and the lytic repressor 380

Cro. Whereas the two repressor proteins could be identified due to their close relationships to 381

Lambda-like phage repressors, it was not possible to find operator-sites in the intergenic 382

region between these repressor genes. Furthermore, genes encoding proteins like CII and CIII 383

which are involved in the regulation of the genetic switch of Lambda-like phages could not be 384

identified on the genome of P13374. This finding suggests that P13374 carries a regulation 385

mechanism for the lysogenic / lytic cycle which is only distantly related to Lambda-like 386

phages. Further analyzes have to be performed to determine the specificity of the repressors 387

(Cro and CI) to its operator sequences. Downstream of the repressor genes cI and cro 388

functional counterparts of genes for a bacteriophage-related helicase and primase were 389

identified. Both gene products might be of key importance for the replication of the phage 390

genome. While helicases act on DNA to separate the double-stranded DNA into single-391

strands, primases catalyze the synthesis of a short RNA or ssDNA fragments to initiate 392

complementary strand synthesis. Downstream of the Shiga toxin subunits A and B encoding 393

genes the functional module for cell wall degradation and the lysis of the host cell was 394

identified. This module consists of the two essential genes which are typically transcribed 395


.org/D

ownloaded from

http://jvi.asm.org/

16

from adjacent ORFs and serve as functional counterparts to holins (Gp50) and endolysins 396

(Gp51). 397

The right half of the P13374 genome begins with the small and the large subunit of the 398

terminase genes (terS and terL, Fig. 6). Both putative proteins are closely related to their 399

functional counterparts on phage genomes 933W, VT2-Sakai and other Shiga toxin-400

converting phages (86, Stx1, Stx2-I and Stx2-II). Further genes of the right half of the P13374 401

genome might represent a cluster of structural proteins involved in virion morphology and 402

synthesis (Fig. 6). Almost all annotated P13374 gene products encoding proteins for the 403

phage morphology have functional counterparts to proteins of the virion structure module of 404

Stx-converting phages (Fig. 6). An unusual feature of the tail gene cluster (gp65, gp66 & 405

gp69) is the 2,043 bp open reading frame ORF65. The putative gene product of this ORF has 406

functional counterparts in characterized phages which are of key importance for the 407

adsorption specificity of a phage to its host cell. From the bioinformatic analyses it can be 408

suggested that the specificity of phage P13374 follows the presence of short (gp65) and distal 409

(gp66, gp69) tail fibers. Self-comparison analyses of the phage tail fiber protein (gp65) shows 410

a large insertion sequence which consists of several imperfect direct repeats (data not shown). 411

Some putative gene products of P13374 were confirmed by SDS-PAGE and mass 412

spectrometric analyses as the main structural proteins of the virion particle (see below). 413

Genetic similarity of phage P13374 with other E. coli phages. Overall the gene 414

content and the structural organization of several functional modules are similar to most of the 415

previously described Stx-converting phages. As summarized in Fig. 7 gene products of TL-416

2011c and VT2phi272 show the highest degree of similarity to the predicted P13374 proteins. 417

58 and 57 putative gene products of phage P13374 (79 gene products total) are related (51 to 418

100%) to TL-2011c and VT2phi272, respectively. The highest degree of similarity to 419

previously characterized Stx-converting phages was determined to 933W (AF125520), Min27 420

(NC_010237), VT2-Sakai (AP000422) and Stx1 & Stx2-converting bacteriophages 421


.org/D

ownloaded from

http://jvi.asm.org/

17

(AP005153 and AP0044202). The Enterobacteria phages HK97 (NC_002167) and Lambda 422

(J02459) and the Stx2c phage 2851 (FM180578) share only lower numbers of related proteins 423

with P13374 (see Table S3 in the supplemental material). 424

Except for three singular stretches (genome region: 5,250 to 6,750; 29,100 to 31,300 425

and 40,900 to 43,800) of the P13374 genome that exhibit no significant homology to known 426

Stx-encoding phages, the remaining P13374 DNA is 99-100% identical to E. coli phage TL-427

2011c (Fig. 7). On average, P13374 and TL-2011c DNAs are 90% identical. Interestingly, the 428

one major difference between the two phage genomes concerns the putative outer membrane 429

lipoprotein (Bor protein precursor) homolog whose coding sequence is present on TL-2011c 430

genome and which is widespread among a number of other lambdoid coliphages. A functional 431

counterpart of the TL-2011c Bor-like protein which might promote bacterial resistance to 432

serum complement killing could not be identified on P13374. Further differences were 433

identified in the tail gene clusters of P13374 and TL-2011c. In contrast to P13374 which 434

comprise the information for a long tail fiber adhesin (gp66) downstream of tail fiber protein 435

encoding ORF65, a related gene product on TL-2011c could not be identified. Therefore it 436

can be speculated that TL-2011c and P13374 form different types of tail fibers. Further 437

differences between the two phages are restricted to sequences for which no function can be 438

predicted. 439

Analysis of P13374 proteins. To verify the bioinformatic analysis of the phage 440

genome, major protein bands from phage preparations were excised from one-dimensional 441

SDS PAGE gels and subjected to tryptic in-gel digestion followed by tandem MALDI-TOF 442

mass spectrometry (MS/MS) identification. In this way four abundant proteins could be 443

assigned to putative coding regions (ORF58, 60, 61, 78) of the genome sequence of phage 444

P13374 (Fig. 6, Table 4). These ORFs most likely represent structural phage proteins. 445

The E. coli wrbA locus is the integration site of Stx2a phages from STEC O104:H4 446

strains. STEC O104:H4 strains and C600 Stx2 phage lysogens were investigated by PCR for 447


.org/D

ownloaded from

http://jvi.asm.org/

18

different known Stx phage insertion site as previously described (11), see Fig. 8. A 500 bp 448

product was obtained for all O104:H4 strains and C600 Stx2 phage lysogens (Table 3) with 449

primers ML1 and ML2 (Table 2) spanning the region between the E. coli wrbA gene and the 450

phage integrase gene, thus defining the left integration site of the prophage. Nucleotide 451

sequence analysis of the PCR fragments obtained with ML1+ML2 primers indicated that the 452

Stx2 prophages are integrated in the 5’-end of the coding region of the E. coli wrbA gene 453

(AP009048 in E. coli K-12 W3110). The core region for attachment in the bacterial genome 454

attB is a 13 bp long sequence GTTTCAATATGTC. Due to the insertion of the Stx2 phage the 455

coding region of the wrbA gene is altered. 456

Primer orf79 binding to the 3’-region of the P13374 prophage sequence and primer 457

wrbA-R8 (Table 2) were used to identify the right integration site of the prophage into the 458

interrupted wrbA gene. A 256 bp PCR-fragment was investigated for its nucleotide sequence. 459

PCR amplification of the phage DNA from P13374 virion particles using primers orf79 and 460

ML2 (int gene) yielded a PCR product of 473 bp and revealed the phage attachment site attP 461

GTTTCAACATGTC. The attachment sites attB and attP were found to be different in one 462

nucleotide position (underlined nucleotides, see also Fig. 8). 463

From lysates of phages P8983, P13344, P13374, P13771 and P13772 the same PCR 464

product of 473 bp was amplified, whereas no PCR product was obtained with the stx-negative 465

phage from strain CB13437 as template. Nucleotide sequencing showed that all phage 466

genomes in virion particles are closed between ORF79 (hypothetical protein) and the 467

integrase (ORF01) gene. Thus, the sequence analyses of phage DNAs revealed that the 468

prophage genomes between ORF79 and the integrase gene are joined which leads to circular 469

permuted genomes of the phage. 470

Immunity of C600 Stx phage lysogens to superinfection with Stx2a phages from 471

STEC O104:H4 strains. To investigate the immunity between the Stx2 phages from STEC 472

O104:H4 strains and other Stx-encoding bacteriophages plaque assays were performed. For 473


.org/D

ownloaded from

http://jvi.asm.org/

19

these examinations phage lysates originating from the German and Georgian STEC O104:H4 474

strains were used on different C600 Stx1- and Stx2-encoding phages lysogens (Table 3). 475

C600 was used as a phage negative control. The Stx2 phages from the German STEC 476

O104:H4 strains did not form plaques on C600 lysogens carrying the phages P8983, P13344 477

and P13374. On all other C600 derivates including strains TPE2381 and TPE2383 which 478

carry the Stx2a phages from the Georgian STEC O104:H4 strains a lytic phage activity was 479

determined. In contrast, the Stx2 phages from the Georgian O104:H4 strains (P13771 and 480

P13772) did not lyse C600 lysogen carrying the Stx2 phages from the German outbreak 481

strains (TPE2364, TPE2369 and TPE2385) nor from the Georgian O104:H4 strains (TPE2381 482

and TPE2383). 483

Investigation of enteroaggregative E. coli (EAEC) for susceptibility to the Stx2a-484

encoding bacteriophage P13374. To obtain information about the host range of the Stx2a 485

phage P13374, phage preparations with approx. 2 x 109 pfu were plated on enteroaggregative 486

E. coli strains. However, none of 31 EAEC strains belonging to 22 different O:H serotypes 487

(see Table S1 in the supplemental material) showed plaque formation or lysis. C600 was used 488

as phage sensitive control. Subcultures of bacteria grown in zones spotted with P13374 489

preparations were found negative for the stx2 gene by PCR indicating that lysogenization with 490

P13374 had not occurred. The 31 STEC strains were further investigated by PCR for the 491

presence of an intact wrbA gene which is the E. coli host integration site for P13374. All but 492

one of the EAEC strains (CB7373, O111:H10) yielded a 596 bp PCR product with primers 493

wrbA-F / wrbA-R which amplify the complete wrbA gene encompassing the bacterial 494

attachment site for P13374 integration. These results indicate that despite the presence of the 495

potential phage integration site, phage P13374 is restricted for its host range among E. coli 496

belonging to the EAEC group. 497

498


.org/D

ownloaded from

http://jvi.asm.org/

20

DISCUSSION 499

500

Enteroaggregative hemorrhagic E. coli (STEC) O104:H4 is a new type of emerging 501

pathogen which has been identified as the causative agent in one of the world’s largest 502

outbreaks of foodborne illness in humans resulting in 855 HUS and in 53 fatal cases (7,19). 503

There are several models for the evolution of the German STEC O104:H4 strains. STEC 504

O104:H4 could have evolved from an enteroaggregative E. coli (EAEC) ancestor by the 505

uptake of Stx2 phages into the chromosome of the bacterium (10,40). It is also possible that 506

an Stx2 O104:H4 strain was the progenitor of both, HUSEC41 (Germany 2001) and the 2011 507

outbreak strains (LB226692) as described by Mellmann et al. 2011 (32). The latter model 508

could explain our findings, that the the Stx2 phages found in CB8983 (Germany 2001) and 509

CB13344, CB13374 (Germany 2011) were highly similar to each other (this work). The 510

increased human virulence potential of the STEC O104:H4 strain compared to any EAEC 511

O104:H4 progenitor probably results from production of phage encoded Stx2a combined with 512

the efficient enteroaggregative colonization of the human intestine. These properties in 513

combination are believed to be the cause of maximum delivery of Stx into the human host 514

resulting in augmented numbers of cases with severe clinical illness (7). 515

The presence of Stx phages in EAEC strains is unusual and apart from EAEC 516

O104:H4 only a few other EAEC serotype strains were reported to carry stx2 genes (25,33). 517

In this work we were interested to explore the characteristics of the Stx phages present in 518

STEC O104:H4 strains isolated in the 2011 German outbreak and from earlier, 519

epidemiologically unrelated episodes of human infections with STEC O104:H4. 520

Contaminated sprouted seeds produced at a horticultural farm in northern Germany 521

were identified as the food source of the STEC O104:H4 2011 outbreak strain (4,18). We 522

determined the nucleotide sequence of the Stx2 phage present in the STEC O104:H4 strain 523

CB13374 isolated from sprouted seeds produced at this farm. As this strain is believed to be 524


.org/D

ownloaded from

http://jvi.asm.org/

21

the origin of the pandemic spread of STEC O104:H4 in May/June 2011 we compared its Stx2 525

phage to those present in STEC O104:H4 strains from human patients in Germany (2001 and 526

2011), Norway (2006) and Georgia (2009). Although all of the STEC O104:H4 strains carried 527

stx2 genes, Stx2 phages could only be isolated from the German and the Georgian O104:H4 528

strains. All of these phages were identified as podoviruses and were morphologically similar 529

to the Stx2 phage 933W carried by EHEC O157:H7 strain EDL933 (34). Similar to phage 530

933W, the Stx2a phages harbored by the German and the Georgian O104:H4 strains were 531

found to be integrated in the wrbA locus in the wildtype STEC O104:H4 and in E. coli K-12 532

phage lysogenic strains (37). Although we found evidence for the presence of a similar Stx2a 533

prophage in the Norwegian STEC O104:H4 strain CB13437, viable Stx phages could not be 534

isolated, instead a morphologically different bacteriophage of the Myoviridae family which 535

does not encode Stx was released from CB13437. Interestingly, myoviruses were not found in 536

mitomycin C induced cultures of the German and the Georgian O104:H4 strains. 537

Surprisingly, the Stx2 phages isolated from the 2011 German outbreak STEC 538

O104:H4 strains (sprouts and patients) were indistinguishable for their restriction 539

endonuclease profiles from the Stx2 phage harbored by the STEC O104:H4 strain CB8983 540

which was isolated in 2001 from the feces of a child with HC in Germany. Phage genome 541

sequencing of P8983 revealed >99.9% identity with the genome of P13374 (R. Reinhardt, 542

unpublished results). In contrast, Stx2 phages from STEC O104:H4 strains from two patients 543

in Georgia (2009) showed clearly altered endonuclease restriction profiles compared to the 544

German STEC O104:H4 strains. Differences between the German and the Georgian O104:H4 545

Stx2 phages were also found in their bacterial host range and superinfection susceptibility. 546

The phage encoded prophage repressor protein binds efficiently to specific sites in the 547

immunity region on the phage genome. This mechanism is highly specific as most of the 548

temperate phages only bind to its own DNA and not that from other closely related phages. 549


.org/D

ownloaded from

http://jvi.asm.org/

22

All Stx2 phages from STEC O104:H4 strains showed lysis and plaque formation on 550

E. coli K-12 strains harboring phage Lambda or different lambdoid Stx1 and Stx2 phages. 551

These observations suggest that the Stx phages from the STEC O104:H4 strains and 552

previously characterized Stx1- and Stx2-encoding phages from other STEC serotypes exhibit 553

different prophage repressor specificities. This is in strong concordance with the findings 554

obtained from the DNA sequence analysis of the primary immunity region of phage P13374. 555

No related Lambda-like or other Stx phage-like prophage repressor or Cro repressor binding 556

sites (operators) could be identified in the predicted immunity region (cI to cro) of P13374. 557

Differences between the German and the Georgian E. coli O104:H4 derived Stx2 558

phages were also found in their bacterial host range and superinfection susceptibility. The 559

Stx2 phages from the German O104:H4 strains possessed a more extended lysis spectrum 560

compared to the Stx2 phages from the Georgian O104:H4 strains pointing to possible 561

differences in their immunity regions. This needs to be confirmed by nucleotide analysis of 562

the Stx2 phages harbored by the Georgian STEC O104:H4 strains. 563

We therefore investigated EAEC strains of different serotypes for their susceptibility 564

to P13374 as a prototype of the highly virulent Stx2 phage from the German STEC O104:H4 565

strains and despite the presence of an undisrupted wrbA gene in most of the EAEC recipient 566

strains, these strains were found to be resistant to a high infective dose of P13374. We do not 567

know the mechanisms which confer resistance to the Stx2 phage but this observation might 568

indicate that the generation of STEC by uptake of Stx phages in nature is a rare event. 569

Nevertheless, under so far unknown conditions Stx phages are able to infect EAEC strains 570

thus pointing to an extended host range. Previous findings about the presence of Stx phages 571

and stx genes in Enterobacteriaceae other than E. coli also show this possibility (35,36,52). 572

It is remarkable that despite the genomic differences found between the German STEC 573

O104:H4 strains isolated in 2001 and in 2011 both harbor the same Stx2 phage. Strain 574


.org/D

ownloaded from

http://jvi.asm.org/

23

CB8983 from 2001 differs from the outbreak 2011 strains in the composition of its EAEC 575

plasmid, the presence of a plasmid encoding heat stable enterotoxins and the presence of 576

genes conferring antibiotic resistance (7). 577

The original source of human infections and outbreaks with STEC O104:H4 reported 578

from different countries has not been identified in any case. As EAEC and STEC strains were 579

not found associated with animals but only with humans, a human source is supposed as most 580

likely (4). Based on similarities found between STEC O104:H4 strains that caused the 2011 581

outbreak in Germany and a satellite outbreak in France in June of the same year, a batch of 582

fenugreek seeds imported from Egypt which served for sprout production in Germany and 583

France was suspected as the origin of the outbreaks in both countries (18). Analysis of SNPs 584

(single-nucleotide polymorphisms) of STEC O104:H4 strains isolated in Germany and in 585

France in 2011 revealed a higher diversity in the French strains than in the German isolates. 586

This is surprising as the French outbreak was confined to only 15 persons. This finding raises 587

questions about the analysis of the source of the STEC O104:H4 outbreak in Europe in 2011 588

(22). 589

The high similarity observed between the Stx2 phages present in STEC O104:H4 590

strains isolated in Germany in 2001 and 2011 is surprising in light of the Egyptian origin of 591

the suspect seeds, the amount of time between their isolation, the considerable genetic 592

heterogeneity generally seen among Stx phages in nature (23) and the finding that the phages 593

harbored by the Georgian isolates showed distinct differences to the German STEC O104:H4 594

phages. The sequence of the Norwegian Stx2 prophage in strain CB13437 has yet to be 595

determined. 596

It has previously been shown, that STEC O104:H4 can survive in a viable but non-597

culturable state (VBNC) over long periods of time (2). During and after the outbreak it has 598

also been shown that asymptomatic human carriers may serve as a natural reservoir for STEC 599


.org/D

ownloaded from

http://jvi.asm.org/

24

O104:H4 strains (4,42). Further research is needed on Stx2 phages present in other STEC 600

O104:H4 strains to determine their potential for long-term survival outside the bacterial host. 601

As with many STEC and EHEC strains, Stx production in STEC O104:H4 strains 602

could be increased with mitomycin C resulting in a significant enhancement of Stx2 603

production and delivery (5,48). Similar results were reported with ciprofloxacin as inducer for 604

stx2 transcription, Stx2 production as well as release of Stx phages from STEC O104:H4 605

strains (6). However, a basal level of of Stx2 production was still observed in the absence of 606

mitomycin C in STEC O104:H4 wildtype strains confirming previous findings made on other 607

STEC serotype strains harboring Stx2 encoding bacteriophages (13). In our study, the amount 608

of Stx2 produced by the STEC O104:H4 strains was not significantly different from that of an 609

Stx2a-producing EHEC O157:H7 strain. Similar results were reported when ciprofloxacin 610

was used as inducer to compare Stx2 production of STEC O104:H4 and O157:H7 strains (6). 611

These findings suggest that the augmented virulence of STEC O104:H4 is not related to 612

enhanced production of Stx2, but rather to the efficient colonization of the STEC strains 613

allowing sustained delivery of Stx2a into the host intestine. Genetic studies of additional Stx 614

prophages from STEC O104:H4 strains will allow us to determine if P13374 is a prototype 615

phage for the conversion of EAEC strains to Shiga toxin production. 616

617

ACKNOWLEDGMENTS 618

The authors are grateful to Sabine Haby, Antje Konietzny, Karin Pries, Katja Steege and 619

Maria-Margarida Vargas for technical assistance. J. A. Hammerl was supported by a grant of 620

the BMBF-funded project “SiLeBAT.” 621

622


.org/D

ownloaded from

http://jvi.asm.org/

25

Reference List 623

624

1. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and 625

D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein 626

database search programs. Nucleic Acids Res. 25:3389-3402. 627

2. Aurass, P., R. Prager, and A. Flieger. 2011. EHEC/EAEC O104:H4 strain linked with 628

the 2011 German outbreak of haemolytic uremic syndrome enters into the viable but 629

non-culturable state in response to various stresses and resuscitates upon stress relief. 630

Environ. Microbiol. 13:3139-3148. 631

3. Baker, D. R., R. A. Moxley, and D. H. Francis. 1997. Variation in virulence in the 632

gnotobiotic pig model of O157:H7 Escherichia coli strains of bovine and human 633

origin. Adv. Exp. Med. Biol. 412:53-58. 634

4. Beutin, L. and A. Martin. 2012. Outbreak of Shiga toxin-producing Escherichia coli 635

(STEC) O104:H4 infection in Germany causes a paradigm shift with regard to human 636

pathogenicity of STEC strains. J. Food Prot. 75:408-418. 637

5. Beutin, L., H. Steinruck, G. Krause, K. Steege, S. Haby, G. Hultsch, and B. Appel. 638

2007. Comparative evaluation of the Ridascreen(R) Verotoxin enzyme immunoassay 639

for detection of Shiga-toxin producing strains of Escherichia coli (STEC) from food 640

and other sources. J. Appl. Microbiol. 102:630-639. 641

6. Bielaszewska, M., E. A. Idelevich, W. Zhang, A. Bauwens, F. Schaumburg, A. 642

Mellmann, G. Peters, and H. Karch. 2012. Effects of Antibiotics on Shiga Toxin 2 643

Production and Bacteriophage Induction by Epidemic Escherichia coli O104:H4 644

Strain. Antimicrob. Agents Chemother. 56:3277-3282. 645

7. Bielaszewska, M., A. Mellmann, W. Zhang, R. Kock, A. Fruth, A. Bauwens, G. 646

Peters, and H. Karch. 2011. Characterisation of the Escherichia coli strain associated 647


.org/D

ownloaded from

http://jvi.asm.org/

26

with an outbreak of haemolytic uraemic syndrome in Germany, 2011: a 648

microbiological study. Lancet Infect Dis. 11:671-676. 649

8. Blanco, J., M. Blanco, J. Blanco, A. Mora, M. P. Alonso, E. A. Gonzalez, and M. I. 650

Bernardez. 2001. Epidemiology of Verocytotoxigenic Escherichia coli (VTEC) in 651

ruminants., p. 113-148. In: G. Duffy, P. Garvey, and D. A. McDowell (eds.), 652

Verocytotoxigenic E. coli. Food & Nutrition Press, Inc., Trumbull. 653

9. Brown, C. M., M. E. Dalphin, P. A. Stockwell, and W. P. Tate. 1993. The 654

translational termination signal database. Nucleic Acids Res. 21:3119-3123. 655

10. Brzuszkiewicz, E., A. Thurmer, J. Schuldes, A. Leimbach, H. Liesegang, F. D. 656

Meyer, J. Boelter, H. Petersen, G. Gottschalk, and R. Daniel. 2011. Genome 657

sequence analyses of two isolates from the recent Escherichia coli outbreak in 658

Germany reveal the emergence of a new pathotype: Entero-Aggregative-659

Haemorrhagic Escherichia coli (EAHEC). Arch. Microbiol. 193(12):883-91. 660

11. Bugarel, M., L. Beutin, F. Scheutz, E. Loukiadis, and P. Fach. 2011. Identification 661

of genetic markers for differentiation of Shiga toxin-producing, enteropathogenic and 662

avirulent strains of Escherichia coli O26. Appl. Environ. Microbiol. 77:2275-2281. 663

12. CDC. 2011. Investigation update: Outbreak of Shiga toxin-producing E. coli O104 664

(STEC O104:H4) infections associated with travel to Germany. Centers for Disease 665

Control and Prevention, Atlanta, USA http://www.cdc.gov/ecoli/2011/ecolio104/. 666

13. de Sablet, T., Y. Bertin, M. Vareille, J. P. Girardeau, A. Garrivier, A. P. Gobert, 667

and C. Martin. 2008. Differential expression of stx2 variants in Shiga toxin-668

producing Escherichia coli belonging to seropathotypes A and C. Microbiology 669

154:176-186. 670

14. Dowd, S. E. 2007. Escherichia coli O157:H7 gene expression in the presence of 671

catecholamine norepinephrine. FEMS Microbiol. Lett. 273:214-223. 672


.org/D

ownloaded from

http://jvi.asm.org/

27

15. Ermolaeva, M. D., H. G. Khalak, O. White, H. O. Smith, and S. L. Salzberg. 673

2000. Prediction of transcription terminators in bacterial genomes. J. Mol. Biol. 674

301:27-33. 675

16. Ethelberg, S., K. E. Olsen, F. Scheutz, C. Jensen, P. Schiellerup, J. Enberg, A. M. 676

Petersen, B. Olesen, P. Gerner-Smidt, and K. Molbak. 2004. Virulence factors for 677

hemolytic uremic syndrome, Denmark. Emerg. Infect. Dis. 10:842-847. 678

17. European Food Safety Authority. 2011. Shiga toxin-producing E. coli (STEC) 679

O104:H4 2011 outbreaks in Europe: Taking stock. EFSA Journal 9:2390. 680

18. European Food Safety Authority, EFSA. Tracing seeds, in particular fenugreek 681

(Trigonella foenum-graecum) seeds, in relation to the Shiga-toxin-producing E. coli 682

(STEC) O104:H4 2011 outbreaks in Germany and France. European Food Safety 683

Authority. 1-23. 5-7-2011. 684

19. Frank, C., M. Faber, M. Askar, H. Bernard, A. Fruth, A. Gilsdorf, M. Hohle, H. 685

Karch, G. Krause, R. Prager, A. Spode, K. Stark, and D. Werber. 2011. Large and 686

ongoing outbreak of haemolytic uraemic syndrome, Germany, May 2011. Euro. 687

Surveill. 16. 688

20. Friedrich, A. W., M. Bielaszewska, W. L. Zhang, M. Pulz, T. Kuczius, A. 689

Ammon, and H. Karch. 2002. Escherichia coli harboring Shiga toxin 2 gene 690

variants: frequency and association with clinical symptoms. J. Infect. Dis. 185:74-84. 691

21. Friedrich, A. W., J. Borell, M. Bielaszewska, A. Fruth, H. Tschape, and H. 692

Karch. 2003. Shiga toxin 1c-producing Escherichia coli strains: phenotypic and 693

genetic characterization and association with human disease. J. Clin. Microbiol. 694

41:2448-2453. 695

22. Grad, Y. H., M. Lipsitch, M. Feldgarden, H. M. Arachchi, G. C. Cerqueira, M. 696

Fitzgerald, P. Godfrey, B. J. Haas, C. I. Murphy, C. Russ, S. Sykes, B. J. Walker, 697

J. R. Wortman, S. Young, Q. Zeng, A. Abouelleil, J. Bochicchio, S. Chauvin, T. 698


.org/D

ownloaded from

http://jvi.asm.org/

28

Desmet, S. Gujja, C. McCowan, A. Montmayeur, S. Steelman, J. Frimodt-Moller, 699

A. M. Petersen, C. Struve, K. A. Krogfelt, E. Bingen, F. X. Weill, E. S. Lander, C. 700

Nusbaum, B. W. Birren, D. T. Hung, and W. P. Hanage. 2012. Genomic 701

epidemiology of the Escherichia coli O104:H4 outbreaks in Europe, 2011. Proc. Natl. 702

Acad. Sci. U.S.A. 109:3065-3070. 703

23. Herold, S., H. Karch, and H. Schmidt. 2004. Shiga toxin-encoding bacteriophages-704

genomes in motion. Int. J. Med. Microbiol. 294:115-121. 705

24. Huang, D. B., A. Mohanty, H. L. Dupont, P. C. Okhuysen, and T. Chiang. 2006. 706

A review of an emerging enteric pathogen: enteroaggregative Escherichia coli. J. Med. 707

Microbiol. 55:1303-1311. 708

25. Iyoda, S., K. Tamura, K. Itoh, H. Izumiya, N. Ueno, K. Nagata, M. Togo, J. 709

Terajima, and H. Watanabe. 2000. Inducible stx2 phages are lysogenized in the 710

enteroaggregative and other phenotypic Escherichia coli O86:HNM isolated from 711

patients. FEMS Microbiol. Lett. 191:7-10. 712

26. Kim, J., K. Oh, S. Jeon, S. Cho, D. Lee, S. Hong, S. Cho, M. Park, D. Jeon, and S. 713

Kim. 2011. Escherichia coli O104:H4 from 2011 European outbreak and strain from 714

South Korea. Emerg. Infect. Dis. 17:1755-1756. 715

27. Koch, C., S. Hertwig, R. Lurz, B. Appel, and L. Beutin. 2001. Isolation of a 716

lysogenic bacteriophage carrying the stx(1(OX3)) gene, which is closely associated with 717

Shiga toxin-producing Escherichia coli strains from sheep and humans. J. Clin. 718

Microbiol. 39:3992-3998. 719

28. L'abee-Lund, T. M., H. J. Jorgensen, K. O'Sullivan, J. Bohlin, G. Ligard, P. E. 720

Granum, and T. Lindback. 2012. The highly virulent 2006 Norwegian EHEC 721

O103:H25 outbreak strain is related to the 2011 German O104:H4 outbreak strain. 722

PLoS One 7:e31413. 723


.org/D

ownloaded from

http://jvi.asm.org/

29

29. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head 724

of bacteriophage T4. Nature 227:680-685. 725

30. Lowe, T. M. and S. R. Eddy. 1997. tRNAscan-SE: a program for improved detection 726

of transfer RNA genes in genomic sequence. Nucleic Acids Res. 25:955-964. 727

31. Makino, K., K. Yokoyama, Y. Kubota, C. H. Yutsudo, S. Kimura, K. Kurokawa, 728

K. Ishii, M. Hattori, I. Tatsuno, H. Abe, T. Iida, K. Yamamoto, M. Onishi, T. 729

Hayashi, T. Yasunaga, T. Honda, C. Sasakawa, and H. Shinagawa. 1999. 730

Complete nucleotide sequence of the prophage VT2-Sakai carrying the verotoxin 2 731

genes of the enterohemorrhagic Escherichia coli O157:H7 derived from the Sakai 732

outbreak. Genes Genet. Syst. 74:227-239. 733

32. Mellmann, A., D. Harmsen, C. A. Cummings, E. B. Zentz, S. R. Leopold, A. Rico, 734

K. Prior, R. Szczepanowski, Y. Ji, W. Zhang, S. F. McLaughlin, J. K. Henkhaus, 735

B. Leopold, M. Bielaszewska, R. Prager, P. M. Brzoska, R. L. Moore, S. 736

Guenther, J. M. Rothberg, and H. Karch. 2011. Prospective genomic 737

characterization of the German enterohemorrhagic Escherichia coli O104:H4 outbreak 738

by rapid next generation sequencing technology. PLoS One 6:e22751. 739

33. Morabito, S., H. Karch, P. Mariani-Kurkdjian, H. Schmidt, F. Minelli, E. Bingen, 740

and A. Caprioli. 1998. Enteroaggregative, Shiga toxin-producing Escherichia coli 741

O111:H2 associated with an outbreak of hemolytic-uremic syndrome. J. Clin. 742

Microbiol. 36:840-842. 743

34. O'Brien, A. D., L. R. Marques, C. F. Kerry, J. W. Newland, and R. K. Holmes. 744

1989. Shiga-like toxin converting phage of enterohemorrhagic Escherichia coli strain 745

933. Microb. Pathog. 6:381-390. 746

35. Ooka, T., K. Seto, K. Kawano, H. Kobayashi, Y. Etoh, S. Ichihara, A. Kaneko, J. 747

Isobe, K. Yamaguchi, K. Horikawa, T. A. Gomes, A. Linden, M. Bardiau, J. G. 748


.org/D

ownloaded from

http://jvi.asm.org/

30

Mainil, L. Beutin, Y. Ogura, and T. Hayashi. 2012. Clinical Significance of 749

Escherichia albertii. Emerg. Infect. Dis. 18:488-492. 750

36. Paton, A. W. and J. C. Paton. 1996. Enterobacter cloacae producing a Shiga-like 751

toxin II-related cytotoxin associated with a case of hemolytic-uremic syndrome. J. 752

Clin. Microbiol. 34:463-465. 753

37. Perna, N. T., G. Plunkett, III, V. Burland, B. Mau, J. D. Glasner, D. J. Rose, G. F. 754

Mayhew, P. S. Evans, J. Gregor, H. A. Kirkpatrick, G. Posfai, J. Hackett, S. 755

Klink, A. Boutin, Y. Shao, L. Miller, E. J. Grotbeck, N. W. Davis, A. Lim, E. T. 756

Dimalanta, K. D. Potamousis, J. Apodaca, T. S. Anantharaman, J. Lin, G. Yen, 757

D. C. Schwartz, R. A. Welch, and F. R. Blattner. 2001. Genome sequence of 758

enterohaemorrhagic Escherichia coli O157:H7. Nature 409:529-533. 759

38. Persson, S., K. E. Olsen, S. Ethelberg, and F. Scheutz. 2007. Subtyping method for 760

Escherichia coli Shiga toxin (verocytotoxin) 2 variants and correlations to clinical 761

manifestations. J. Clin. Microbiol. 45:2020-2024. 762

39. Plunkett III, G., D. J. Rose, T. J. Durfee, and F. R. Blattner. 1999. Sequence of 763

Shiga toxin 2 phage 933W from Escherichia coli O157:H7: Shiga toxin as a phage 764

late-gene product. J. Bacteriol. 181:1767-1778. 765

40. Rasko, D. A., D. R. Webster, J. W. Sahl, A. Bashir, N. Boisen, F. Scheutz, E. E. 766

Paxinos, R. Sebra, C. S. Chin, D. Iliopoulos, A. Klammer, P. Peluso, L. Lee, A. O. 767

Kislyuk, J. Bullard, A. Kasarskis, S. Wang, J. Eid, D. Rank, J. C. Redman, S. R. 768

Steyert, J. Frimodt-Moller, C. Struve, A. M. Petersen, K. A. Krogfelt, J. P. 769

Nataro, E. E. Schadt, and M. K. Waldor. 2011. Origins of the E. coli strain causing 770

an outbreak of hemolytic-uremic syndrome in Germany. N. Engl. J. Med. 365:709-771

717. 772


.org/D

ownloaded from

http://jvi.asm.org/

31

41. Rietra, P. J., G. A. Willshaw, H. R. Smith, A. M. Field, S. M. Scotland, and B. 773

Rowe. 1989. Comparison of Vero-cytotoxin-encoding phages from Escherichia coli of 774

human and bovine origin. J. Gen. Microbiol. 135:2307-2318. 775

42. Robert Koch Institut. Abschließende Darstellung und Bewertung der 776

epidemiologischen Erkenntnisse im EHEC O104:H4 Ausbruch. Deutschland 2011. 777

pp. 1-43. 1-9-2011. Berlin, Robert Koch Institut. 778

43. Rohde, H., J. Qin, Y. Cui, D. Li, N. J. Loman, M. Hentschke, W. Chen, F. Pu, Y. 779

Peng, J. Li, F. Xi, S. Li, Y. Li, Z. Zhang, X. Yang, M. Zhao, P. Wang, Y. Guan, Z. 780

Cen, X. Zhao, M. Christner, R. Kobbe, S. Loos, J. Oh, L. Yang, A. Danchin, G. F. 781

Gao, Y. Song, Y. Li, H. Yang, J. Wang, J. Xu, M. J. Pallen, J. Wang, M. 782

Aepfelbacher, and R. Yang. 2011. Open-source genomic analysis of Shiga toxin-783

producing E. coli O104:H4. N. Engl. J. Med. 365:718-724. 784

44. Roschanski, N., S. Klages, R. Reinhardt, M. Linscheid, and E. Strauch. 2011. 785

Identification of genes essential for prey-independent growth of Bdellovibrio 786

bacteriovorus HD100. J. Bacteriol. 193:1745-1756. 787

45. Sato, T., T. Shimizu, M. Watarai, M. Kobayashi, S. Kano, T. Hamabata, Y. 788

Takeda, and S. Yamasaki. 2003. Distinctiveness of the genomic sequence of Shiga 789

toxin 2-converting phage isolated from Escherichia coli O157:H7 Okayama strain as 790

compared to other Shiga toxin 2-converting phages. Gene 309:35-48. 791

46. Scheutz, F., N. E. Moller, J. Frimodt-Moller, N. Boisen, S. Morabito, R. Tozzoli, 792

J. Nataro, and A. Caprioli. 2011. Characteristics of the enteroaggregative Shiga 793

toxin/verotoxin-producing Escherichia coli O104:H4 strain causing the outbreak of 794

haemolytic uraemic syndrome in Germany, May to June 2011. Euro. Surveill. 16. 795

47. Scheutz, F. and N. A. Strockbine. 2005. Genus I. Escherichia, p. 607-624. In: G. M. 796

Garrity, D. J. Brenner, N. R. Krieg, and J. T. Staley (eds.), Bergey's Manual of 797

Systematic Bacteriology. 2nd ed. Springer. 798


.org/D

ownloaded from

http://jvi.asm.org/

32

48. Shimizu, T., Y. Ohta, and M. Noda. 2009. Shiga toxin 2 is specifically released from 799

bacterial cells by two different mechanisms. Infect. Immun. 77:2813-2823. 800

49. Strauch, E., J. A. Hammerl, A. Konietzny, S. Schneiker-Bekel, W. Arnold, A. 801

Goesmann, A. Puhler, and L. Beutin. 2008. Bacteriophage 2851 is a prototype 802

phage for dissemination of the Shiga toxin variant gene 2c in Escherichia coli 803

O157:H7. Infect. Immun. 76:5466-5477. 804

50. Strauch, E., R. Lurz, and L. Beutin. 2001. Characterization of a Shiga toxin-805

encoding temperate bacteriophage of Shigella sonnei. Infect. Immun. 69:7588-7595. 806

51. Takkinen, J., Struelens, M., Niskanen, T., Makela, P., Rizzi, V., Caprioli, A., and 807

Scheutz, F. 2011. Shiga toxin/verotoxin-producing Escherichia coli in humans, food 808

and animals in the EU/EEA, with special reference to the German outbreak strain 809

STEC O104. pp. 1-18. 1-6-2011. Stockholm, ECDC & EFSA. 810

52. Tschape, H., R. Prager, W. Streckel, A. Fruth, E. Tietze, and G. Bohme. 1995. 811

Verotoxinogenic Citrobacter freundii associated with severe gastroenteritis and cases 812

of haemolytic uraemic syndrome in a nursery school: green butter as the infection 813

source. Epidemiol. Infect. 114:441-450. 814

53. Tzschoppe, M., A. Martin, and L. Beutin. 2012. A rapid procedure for the detection 815

and isolation of enterohaemorrhagic Escherichia coli (EHEC) serogroup O26, O103, 816

O111, O118, O121, O145 and O157 strains and the aggregative EHEC O104:H4 strain 817

from ready-to-eat vegetables. Int. J. Food Microbiol. 152:19-30. 818

54. Wagner, P. L., D. W. Acheson, and M. K. Waldor. 2001. Human neutrophils and 819

their products induce Shiga toxin production by enterohemorrhagic Escherichia coli. 820

Infect. Immun. 69:1934-1937. 821

55. Wagner, P. L., J. Livny, M. N. Neely, D. W. Acheson, D. I. Friedman, and M. K. 822

Waldor. 2002. Bacteriophage control of Shiga toxin 1 production and release by 823

Escherichia coli. Mol. Microbiol. 44:957-970. 824


.org/D

ownloaded from

http://jvi.asm.org/

33

56. Willshaw, G. A., H. R. Smith, S. M. Scotland, A. M. Field, and B. Rowe. 1987. 825

Heterogeneity of Escherichia coli phages encoding Vero cytotoxins: comparison of 826

cloned sequences determining VT1 and VT2 and development of specific gene probes. 827

J. Gen. Microbiol. 133:1309-1317. 828

829


.org/D

ownloaded from

http://jvi.asm.org/

34

Figure legends 830

831

Fig. 1. Restriction endonuclease digestion of Stx bacteriophage DNA. Restriction nuclease 832

digested bacteriophage DNA separated on 0.7% agarose digested with EcoNI (lanes 1-5), 833

BsrBI (lanes 6-10) and PvuI (lanes 11-15). Lanes: 1, 6, 11 phage P8983; lanes 2, 7, 12 phage 834

P13344; lanes 3, 8, 13 phage P13374; lanes 4, 9, 14 phage P13771 and lanes 5, 10, 15 phage 835

P13772. M = molecular weight standard (range 10-0.2 kb) 836

837

Fig. 2. Stx production of STEC O104:H4 wildtype strains and C600 phage lysogens. 838

Extinction values (OD450) obtained by measuring serial dilutions of the six STEC O104:H4 839

wildtype strains (Table 1) and five E. coli K-12 lysogens (Table 3) by the Stx-EIA. (A) , 840

STEC wildtype strains from Table 1 grown in the presence of mitomycin C; , STEC 841

wildtype strains grown without mitomycin C induction. (B) , C600 Stx phage lysogens 842

grown in the presence of mitomycin C, , C600 Stx phage lysogens grown without 843

mitomycin C. 844

845

Fig. 3. TEM-micrographs of Stx phages from STEC O104:H4 strains. Negatively stained 846

phages with a short tail (arrowheads) and hexagonal head isolated from E. coli K-12 (C600) 847

after infection with phage lysates of (A) strain CB8983, (B) strain CB13344, (C) strain 848

CB13771, and (D) strain CB13374 (bars = 50 nm). 849

850

Fig. 4. TEM micrographs of P13374 induction from lysogenic strain TPE2364. Ultrathin 851

sections of two bacterial cells (TPE2364) with maturating virion particles within the 852

cytoplasm indicated by arrows (bars = 500 nm). The cells showing signs of bacteriolysis (loss 853

of cytoplasm (A) and damaged cell wall as well as the formation of vesicles or opaque clumps 854

(B). (C) TEM micrograph of CsCl purified, negatively stained P13374 particles released by 855


.org/D

ownloaded from

http://jvi.asm.org/

35

strain TPE2364 (bar = 100 nm). Four phages with a short tail (arrows) and a hexagonal head. 856

In the upper part two phages with tail to tail interactions are shown. 857

858

Fig. 5. TEM-micrographs of myovirus phages isolated from the Norwegian STEC 859

O104:H4 strain CB13437. Negatively stained phages comprise a hexagonal head, contractile 860

tail and kinked tail fibers (Myoviridae). The phages were propagated on E. coli K-12 strain 861

C600 using phage lysates of the Norwegian strain CB13437. (A) Myovirus with non-862

contracted tail, (B) Myovirus with contracted tail (bars = 100 nm). 863

864

Fig. 6. Genome organization of prophage P13374. Putative genes are colored according to 865

the predicted functions of their products. The positions of putative Rho-independent 866

transcription terminators and transfer RNAs (tRNAs) are indicated. Further detailed 867

informations to the structural components of P13374 are given in the Supplemental material 868

Table S3. P13374 virion proteins which were identified by SDS-PAGE and mass 869

spectrometry are marked by asterisks (*). 870

871

Fig. 7. Relationship of P13374 to Stx phages and phage Lambda. The circular synthetic 872

plot shows the P13374 genome organization and the similarity of predicted gene products to 873

proteins of related Stx phages. The two outermost circles represent the + and – strand of 874

P13374 genome, respectively (colouring according to Fig. 6). Inward circles: phage TL-2011c 875

(accession JQ011318), phage VT2phi272 (HQ424691), phage 933W (AF125520), Phage 876

VT1-Sakai (AP000400), phage VT2-Sakai (AP000422), Stx1-converting phage (AP005153), 877

Stx2-converting phage (AP0044202), phage 2851 (FM180578) and Lambda (J02459). 878

879

Fig. 8. Integration of Stx phage P13374 into E. coli K-12 C600. (A) Integration of phage 880

P13374 into the wrbA gene of E. coli C600. Selected genes and the attachment site of the 881


.org/D

ownloaded from

http://jvi.asm.org/

36

bacteria (attB) and the phage (attP) are indicated. (B) Sequences flanking the attachment sites 882

in E. coli strain C600, phage P13374, and the left (attL) and right (attR) core sequences in 883

lysogenic C600 strains. wrbA* indicates a putative modified wrbA gene. 884

885


.org/D

ownloaded from

http://jvi.asm.org/

37

Table 1. STEC O104:H4 strains used for isolation of lysogenic Stx-encoding bacteriophages

. presence of virulence genes

Strain

no.

original

designation

source, origin,

year of isolation, disease

stx2 aggR wzxO104 aggA agg3A astA

CB13344 RKI 11-02027 a human, Germany, 2011, HUS + + + + - -

CB13374 - sprouted seeds, Germany. 2011 + + + + - -

CB8983 - human, Germany, 2001, HC + + + - + +

CB13437 1106-3060-1 b human, Norway, 2006, diarrhea + + + - + +

CB13771 2009EL-2050 c human, Georgia, 2009, HC + + + + - -

CB13372 2009EL-2071 c human, Georgia, 2009, HC + + + + - -

a) provided by the Robert Koch-Institute, Berlin, Germany,

b) from the collection of the Norwegian Institute of Public Health,

c) from the collection of the Centers for Disease Control and Prevention (CDC), USA


.org/D

ownloaded from

http://jvi.asm.org/

38

Table 2. PCR primers for detection of the wrbA gene, the Stx2 phage integration site into wrbA and of circular phage DNA

DNA-target GenBank Accession

position in sequence Primer nucleotide sequence (5’ – 3’) Tm (°C)

PCR product (bp)

wrbA – (ORF01) integrase prophage

P13374

AE005174 1,330,538-1,330,556

1,331,037-1,331,016

ML1

ML2

GTGGAACTAAAGACGCTCG

ATTTATTGCATCACAGATGGGG

55.0 500

prophage P13374 (ORF79) – wrbA HE664024

AP009048

60,619-60,638

1,068,130-1,068,108

orf79

wrbA-R

ACGGTAAATACCCTACCCAG

ATGGCTAAAGTTCTGGTGCTTTA

50.8 314

wrbA AP009048 1,067,534-1,067,550

1,068,130-1,068,108

wrbA-F

wrbA-R

TTAGCCGTTAAGTTTAACTGCC

ATGGCTAAAGTTCTGGTGCTTTA

57 596

prophage P13374 (ORF79) –

integrase prophage P13374 (ORF01)

HE664024 60,619-60,638

190-210

orf79

ML2

ACGGTAAATACCCTACCCAG

ATTTATTGCATCACAGATGGGG

50.8 474


.org/D

ownloaded from

http://jvi.asm.org/

39

Table 3. E. coli K-12 (C600) Stx phage lysogenic derivative strains

sensitivity to

strain lysogenic

for phage

phage source strain

(reference)

Shiga toxin P8983,

P13344,

P13374

P13371,

P13372

C600 - (49) - + +

TPE2385 P13344 CB13344 (53) Stx2a - -

TPE2364 P13374 CB13374 (53) Stx2a - -

TPE2369 P8983 CB8983 (this work) Stx2a - -

TPE2381 P13771 CB13771 (this work) Stx2a + -

TPE2383 P13772 CB13772 (this work) Stx2a + -

TPE1923 P933w EDL933 (49) Stx2a + +

TPE1914 PH19-B H19 (50) Stx1 + +

TPE1916 Lambda - - + +

TPE1841 P6220 CB6220 (27) Stx1c + +

TPE1874 CB2851 CB2851 (49) Stx2c + +


.org/D

ownloaded from

http://jvi.asm.org/

40

Table 4. Peptide identification by peptide mass fingerprinting (PMF) and peptide fragment fingerprinting (PFF) using tandem MALDI-

TOF mass spectrometry (MS/MS) and MASCOT database searching on tryptic digests of P13374 proteins

ORF

P13374

nucleotide

position

calculated

MW (kDa)

estimated MW

(kDa)a

peptides

found

Genbank

accession (GI)

Function, name

58 34,002 -

36,146

81.030 70-90 11 (PMF) 340730675 putative portal protein [Escherichia

coli O104:H4 str. 01-09591]

60 37,335 –

38,549

44.877 46-50 28 (PMF)

5 (PFF)

9632520

hypothetical protein 933Wp54

[Enterobacteria phage 933W]

61 38,605 –

38,994

13.496 <14 7 (PMF)

2 (PFF)

9632521 hypothetical protein 933Wp55


78 51,952 –

60,372

309.315 >250 3 (PFF) 9632538

hypothetical protein 933Wp72


a) from SDS-PAGE


.org/D

ownloaded from

http://jvi.asm.org/


.org/D

ownloaded from

http://jvi.asm.org/

spread of a distinct stx2- encoding phage prototype among...

Documents