Cell Reports, Volume 7

Supplemental Information

Intrinsic Resistance to MEK Inhibition

in KRAS Mutant Lung and Colon Cancer

through Transcriptional Induction of ERBB3

Chong Sun, Sebastijan Hobor, Andrea Bertotti, Davide Zecchin, Sidong Huang,

Francesco Galimi, Francesca Cottino, Anirudh Prahallad, Wipawadee

Grernrum, Anna Tzani, Andreas Schlicker, Lodewyk F.A. Wessels, Egbert F.

Smit, Erik Thunnissen, Pasi Halonen, Cor Lieftink, Roderick L. Beijersbergen,

Federica Di Nicolantonio, Alberto Bardelli, Livio Trusolino, and Rene Bernards

SUPPLEMENTAL FIGURES AND LEGENDS

Figure S1. A synthetic lethal shRNA screen identified ERBB3 suppression confers

sensitivity to MEK inhibitor in KRAS mutant cancers

(A, B) Sensitivity of KRAS mutant cancer cell lines to selumetinib in large cell line panels.

IC50 data of selemetinib was collected from Sanger (the cancer cell line project) and CCLE

cell line encyclopedias. Sanger cell line panel in the chart covers 68 cell lines harboring KRAS

mutation, among which, 55 cell lines have an selumetinib IC50 value greater than or equal to

1 µM; CCLE encyclopedias includes 85 KRAS mutant cell lines and 65 cell lines of them

have an selumetinib IC50 value greater than or equal to 1 µM;

(C-E) Suppression of ERBB3 by shRNA enhances response to MEK inhibitor. H2030,

H2122 (KRAS mutant NSCLC), SW480 and SW837 cells (KRAS mutant, CRC) were

infected with two independent shRNAs targeting ERBB3 as indicated. pLKO.1 vector served

as control. After puromycin selection, (C) cells were cultured in the absence or presence of 1

µM selumetinib. The cells were fixed with 4% formaldehyde solution in PBS, stained with

0.1% crystal violet after 14-21 days and photographed. (D) Crystal violet was extracted from

stained cells by 10% acetic acid and quantified by measuring the absorbance at 600 nm. Error

bars represents standard deviation (SD). (E) The level of ERBB3 knockdown was determined

by Western blot analysis. HSP90 protein level served as a loading control.

(F) Cells infected with virus produced from shERBB3 or pLKO.1 vectors were cultured in

medium with or without 1µM selumetinib for 24 hours before the cell lysate were collected

for Western blot analysis of ERBB3, p-ERK and ERK levels.

(G) MEK inhibition induces ERBB3 activation and upregulation. SW837 cells were cultured

in the absence or presence of 1uM selumetinib and the cell lysate was collected at the

indicated time points. p-ERBB3, ERBB3, p-ERK, and p-p90RSK were determined by

Western blot analysis.

Figure S2. Simultaneous suppression of EGFR and ERBB2 sensitizes KRAS mutant

cancer cells to MEK inhibitor

(A) Concurrent targeting of EGFR and ERBB2 overcomes MEK inhibitor resistance in KRAS

mutant NSCLC and CRC cells. SW620 (KRAS mutant, CRC), H2030 and H2122 (KRAS

mutant, NSCLC) cells were cultured in increasing concentration of MEK inhibitor

selumetinib alone, EGFR inhibitor gefitinib alone, ERBB2 inhibitor CP724714 alone,

EGFR/ERBB2 dual inhibitor afatinib alone or their combination as indicated. Cells were

fixed, stained and photographed after 14-21 days.

(B) MEK inhibitor-induced feedback activation of ERBB3 is mediated by both EGFR and

ERBB2. Cells were treated with selumetinib, gefitinib, CP724714, afatinib and their

combinations as indicated for 36 h. Biochemical responses of cells were examined by western

blot analysis. MEK inhibition by selumetinib leads to a strong activation of ERBB3. Neither

inhibition of EGFR by gefitinib nor inhibition of ERBB2 by CP724714 are able to shut down

ERBB3 signaling, whereas, both of the dual EGFR/ERBB2 inhibitor afatinib and the

combination of gefitinib and CP724714 can block ERBB3 activity. Furthermore, the

combination treatment including afatinib and selumetinib resulted in more complete

inhibition of p-ERK (compared to selumetinib treatment) and prevented AKT activation.

(C, D) Overexpression of ERBB2 and ERBB3 compromises the anti-tumor effect of MEK

inhibitor. ERBB2 and ERBB3 were introduced into H747 cells by lentiviral transduction

(PLX302-ERBB2, PLX304-ERBB3). PLX302-GFP served as a control. (C) Infected cells

were grown in regular medium or treated with increasing concentration of selumetinib as

indicated or 0.25 µM afatinib or their combinations for 28 days before collected for fixing,

staining and photographing. (D) Western blot analysis of ERBB2, ERBB3 and HSP90 levels.

HSP90 served as a loading control.

(E, F) Simultaneous suppression of EGFR and ERBB2 by shRNAs sensitizes H358 and

SW837 cells to MEK inhibitor, but not either shRNA alone. Cells were infected with the

lentiviral shRNAs as indicated and then cultured in the absence or in the presence of

increasing concentration of selumetinib for 21 days. pLKO.1 served as a control vector.

Levels of gene knockdown by each shRNA or their combination were determined by western

blot analysis.

Figure S3. MEK inhibition relieves a MYC-dependent transcriptional repression of

ERBB3

(A, B) MEK inhibition causes transcriptional upregulation of ERBB2 and ERBB3. Fold

induction of ERBB2 and ERBB3 in the cell lines as indicated was shown. Cells were treated

with 1 µM selumetinib for 48 h and analyzed by qRT-PCR. Error bars represent mean ± SD.

(C) cMYC depletion by shRNA upregulates ERBB2 and ERBB3 transcription. Cells were

infected with two independent shRNAs targeting cMYC. pLKO.1 vector served as control.

After puromycin selection, cells were subjected to qRT-PCR analysis of gene expression.

(D) MEK inhibitor only induces endogenous ERBB2 and ERBB3 upregulation. V5-tagged

ERBB2 and ERBB3 were introduced into H358 and H2030 cells by lentiviral transduction

(PLX302-ERBB2-V5, PLX302-ERBB3-V5). After puromycin selection, cells were cultured

in the absence or presence of 1 µM selumetinib for 36 hours before the harvest for Western

blot analysis of proteins as indicated.

(E) Induction of ERBB2 and ERBB3 in KRAS mutant patient-derived xenografts (PDX)

following in vivo treatment with selumetinib. The 7 cases (which showed ERBB2 and ERBB3

upregulation at mRNA level) were either untreated or treated with selumetinib (25 mg/kg

QD) for three or six weeks. Mice were sacrificed no later than 4 hours after the last drug

administration. Tumor samples were fresh frozen and subjected to western blot analysis of

proteins as indicated.

(F) MEK inhibitor-induced ERBB2 and ERBB3 upregulation is NOT dependent on CtBP1 or

CtBP2. shRNAs targets CtBP1 and CtBP2 were introduced into H2030 cells by lentiviral

transductions. After puromycin selection, cells were either treated with 1 µM selumetinib or

left untreated for 36 hours. Relative mRNA level of ERBB2, ERBB3, CTBP1 and CTBP2

were determined by qRT-PCT analysis. Error bars represent mean ± SD.

(G) Induction of ERBB2 and ERBB3 by MEK inhibitor is not through upregulation of

FOXD3. H358, SW837 and H2030 cells were treated with selumetinib or left untreated. Cell

lysate was harvested at the indicated time points and subjected to Western blot analysis.

Figure S4. Inhibition of EGFR/ERBB2 sensitizes KRAS mutant cancer cells/tumors to

MEK inhibitor.

(A) Afatinib improves trametinib (a second MEK inhibitor) efficacy in KRAS mutant cancer

cells. H358, H2122, H2030 and SW837 were cultured in increasing concentration of MEK

inhibitor trametinib alone, afatinib alone or their combination as indicated. Cells were

harvested for fixing, staining and photographing after 14-21 days.

(B, C) Effects of MEK inhibitor, dual EGFR/ERBB2 inhibitor or their combination on H2122

xenografts. The tumours derived from H2122 KRAS mutant NSCLC cells were either

untreated or treated with selumetinib (25 mg/kg QD), afatinib (12.5 mg/kg QD) or their

combination for 31 days in nude mice. Tumor samples were fresh-frozen, optimal cutting

temperature (OCT) compound-embedded and subjected to western blot analysis of proteins or

qRT-PCR analysis of mRNA afterwards. Error bars represent SD.

(D) Bodyweight of mice bearing H2122 xenografts. The body weight of mice from afatinib

and afatinib+trametinib treatment arms were measured on day 0 and day 29 (the treatments

started on day 0).

(E) High ERBB3 expression correlates with favorable response to the treatment containing

dual EGFR/ERBB2 inhibitor (afatinib) and MEK inhibitor (selumetinib). Sensitivity of each

cell line to the combination treatment was demonstrated as a synergy score that is calculated

based on a method of Lehar (2009).

(F, G) Combined inhibition of MEK and EGFR/ERBB2 is more effective than inhibition of

MEK alone in patient-derived CRC xenografts bearing KRAS mutation. Two representative

PDX models of KRAS mutant CRC (M136 and M146) were treated with afatinib (12.5 mg/kg,

5 days on, 2 days off), selumetinib (20 mg/kg, same schedule) or both drugs in combination

(Sel+Afa) for three weeks. The mean percent change in tumor volume +/- SEM (error bars) is

presented. Tumor volume at start of treatment is plotted as 0. n=5 animals for each treatment

arm.

(H-J) Effects of MEK inhibitor, dual EGFR/ERBB2 inhibitor or their combination on patient-

derived CRC xenografts bearing KRAS mutation. KRAS mutant CRC patient derived

xenografts were treated with selumetinib (25 mg/kg QD), afatinib (12.5 mg/kg QD) or their

combination for 20 days in nude mice. Tumor samples were fresh-frozen or stabilized with

RNAlater® and subjected to western blot analysis of proteins or qRT-PCR analysis of

mRNA. Error bars represent SD. Matched tumor materials from the same patients served as

the untreated control.

SUPPLEMENTAL TABLE

Rank TRC ID Gene symbol Ratio of Abundance (Selumetinib/Untreated)

1 TRCN0000121246 YES1 0.133787585

2 TRCN0000002004 PRKACB 0.223426287

3 TRCN0000040111 ERBB3 0.224084769

4 TRCN0000003260 RPS6KC1 0.230173495

5 TRCN0000010207 VRK2 0.251851898

6 TRCN0000045575 DHDDS 0.266845426

7 TRCN0000002378 CDKL3 0.267663479

8 TRCN0000006256 PRKDC 0.273742205

9 TRCN0000001066 RAF1 0.274019563

10 TRCN0000000936 MYLK 0.288296405

11 TRCN0000000621 ERBB3 0.292332762

Table S1. Top shRNA candidates list. shRNA candidates from the screen experiment were

filtered by the frequency of the reads (more than 1000 sequence reads in the untreated

sample), and ranked by the fold depletion by drug treatment. ERBB3 was identified as the top

“hit” (Bold) by two independent shRNAs targeting ERBB3.

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Cell lines, inhibitors and antibodies

H358, H2122, H1944, H2030, A549, H1792, H23, Calu-1, H23, SW620, SW480, SW837,

SW1116, H747, LS513, SKCO1, LoVo and SW1463 were purchased from American Type

Culture Collection (ATCC); SNU1033 and LIM1863 were from laboratory collection of A.

B.;IA-LM was purchased from RIKEN cell bank; RCM-1 was from Japanese Collection of

Research Bioresources.

Selumetinib (S1008), trametinib (S2673), gefitinib (S1025), CP-724714 (S1167), afatinib

(S1011) and dacomitinib (S2727) were purchased from Selleck Chemicals. Human genome-

wide shRNA collection (TRC-Hs1.0) was purchased from Open Biosystems (Huntsville AL,

USA). Further information is available at

http://www.broad.mit.edu/genome_bio/trc/rnai.html.

Antibodies against HSP90 (H-114), p-ERK (E-4), ERK1 (C-16), ERK2 (C-14), rabbit IgG

control and mouse IgG control were from Santa Cruz Biotechnology; for detection of total

ERK 1/2, a mixture of ERK1 and ERK2 antibodies was used; anti-EGFR (06-847), anti-

phospho-erbb2/HER-2 (Tyr1248) (06-229), anti-erbB-3/HER-3 (05-390), anti-erbB2

(OP15L) and p-p90RSK(04-419) antibodies were from Millipore; antibodies against p-

EGFR(Y1068) (ab5644) was from Abcam. Antibodies against pERBB3 (Y1197) (4561), p-

AKT (S473) (4060), AKT(2920), p90RSK(8408), MYC (5605), RSK1(8408), p-

BAD(S112)(5284), p-BAD(S136)(9295), p-BIM(S69) (4581), cleaved PARP(5625) and

BIM(2933) were from Cell Signaling; Antibody against V5 tag was from Invitrogen (R960-

25); antibody against BAD (610391) was from BD Transduction Laboratories. FOXD3 was

from BioLegend (San Diego CA).

Cell Culture and Viral Transduction

All the cell lines used in this study except HEK293T cells were cultured in RPMI

supplemented with 8% FBS, glutamine and penicillin/streptomycin (Gibco®). HEK293T

cells were cultured in DMEM with 8% FBS, glutamine and penicillin/streptomycin (Gibco®)

at 37 °C/ 5% CO2. Subclones of H2030 expressing the murine ecotropic receptor were

generated and used for MYC(S62) expression experiments shown. HEK293T cells were used

as producers of lentiviral supernatants as described at

http://www.broadinstitute.org/rnai/public/resources/protocols. The calcium phosphate

transfection method was used for the virus production in 293T cells. Infected cells were

selected by 2 µg/ml of puromycin.

Long-term cell proliferation assays

Cells were seeded into 6-well plates (0.5-3 * 104

cells per well) and cultured both in the

absence and presence of drugs as indicated. Within each cell line, cells cultured at different

conditions were fixed with 4% paraformaldehyde (in PBS) at the same time. Afterwards, cells

were stained with 0.1% crystal violet (in water).

Protein lysate preparation

Cell lysate

Cells were seeded in medium containing 8% fetal bovine serum (FBS) for 24 h, and then

washed with serum-free medium and refilled with medium containing 0.1% serum. After the

low serum incubation, cells were refreshed with medium containing 8% serum and drug(s) of

interest. After 24-48 h, the cells were lysed with RIPA buffer supplemented with protease

inhibitor (cOmplete, Roche) and Phosphatase Inhibitor Cocktails II and III (Sigma). All

lysates were freshly prepared and processed with Novex® NuPAGE® Gel Electrophoresis

Systems (Invitrogen).

Tumor lysate

Tumor blocks were homogenized using TissueLyzer LT (Qiagen) in T-PER Tissue Protein

Extraction Reagent (Thermo Scientific # 78510) according to the manufacturer’s instructions.

Tumor xenograft experiments

All procedures were approved by the Ethical Committee for Animal Experimentation of the

Institute for Cancer Research and Treatment at Candiolo, and by the Italian Ministry of

Health. H2122 NSCLC cells (5 millions/mouse) were injected subcutaneously in the right

posterior flank of 7-week old female nude mice and grown as tumor xenografts. Treatment

with afatinib (12.5 mg/Kg), trametinib (1 mg/kg) or their combination (at the same dose as

monotherapy) was started when tumor volume reached approximately 250-300 mm3. For in

vivo dosing, trametinib was resuspended in 0.5% hydroxypropylmethylcellulose (Sigma) and

0.2% Tween-80 in distilled water pH 8.0. Afatinib was dissolved in 1.8% hydroxypropyl-b-

cyclodextrin (Sigma-Aldrich), 5% of a 10% acetic acid stock and aqueous natrosol (0.5%).

Both agents were administered by daily gavage.

Patient derived CRC xenografts

Tumor samples were obtained from patients treated by liver metastasectomy at the Institute

for Cancer Research and Treatment (Candiolo, Torino), Mauriziano Umberto I (Torino) and

San Giovanni Battista (Torino). All patients provided informed consent, and samples were

procured and the study was conducted under the approval of the review boards of the

institutions.

Tumor material not required for histopathologic analysis was collected and placed in medium

199 supplemented with 200 U/ml penicillin, 200 mg/ml streptomycin and 100 mg/ml

levofloxacin. Each sample was cut into 25- to 30-mm3 pieces. Fragments were coated in

matrigel (BD Biosciences) and implanted in a subcutaneous pocket in the right posterior flank

of six-week-old NOD/SCID mice. After mass formation, tumors were passaged for two

generations until production of treatment cohorts. Established tumors (average volume 300

mm3) were treated with afatinib (12.5 mg/kg, 5 days on, 2 days off), selumetinib (20 mg/kg,

same schedule) or a combination of both drugs for three weeks. For in vivo dosing,

selumetinib was resuspended in 0.5% hydroxypropylmethylcellulose (Sigma) and 0.4%

Tween-80 in distilled water. Afatinib was dissolved as specified above. Both agents were

administered by gavage. Tumor volumes were evaluated once weekly by caliper

measurements and the approximate volume of the mass was calculated using the formula

4/3p(d/2)2.D/2, where d is the minor tumor axis and D is the major tumor axis. End-of-

treatment tumor material was incubated in RNAlater® and then frozen at -80°C for nucleic

acid extraction or snap-frozen in liquid nitrogen for protein analysis.

RNA Isolation

Cell line

Cells were harvested with TRIzol® reagent (Invitrogen) following the manufacture’s

instruction. cDNA synthesis was performed using Maxima Universal First Strand cDNA

Synthesis Kit (# K1661, Thermo scientific).

Xenografts

Tumor blocks were homogenized using TissueLyzer LT (Qiagen) in buffer RLT (RNeasy

mini kit, Qiagen) and RNA extraction were performed according to the manual of

abovementioned kit.

Patient Tumor FFPE Materials

RNA isolation from FFPE samples was performed using the High Pure RNA paraffin kit

(Roche) as previously described (Huang et al., 2012; Mittempergher et al., 2011).

Plasmids

MYC(S62D) was subcloned from FM-1-MYC(S62D) vector to pBabe vector between

(BamH1 and SalI). FM-1-MYC (S62D) is a kind gift from Dr. Sarki Abdulkadir, which

serves as a template to generate MYC(S62D) insert by PCR using the following primers:

TTCCGCGGCCGCTATGGCCGACGTCGACttacgcacaagagttccgta

CGCGGATCCatgcccctcaacgttagcttc

The following plasmids were purchased from Addgene to generate PLX302-ERBB2-V5,

PLX302-ERBB3-V5 and PLX304-ERBB3 constructs by Gataway cloning (Yang et al., 2011)

(Johannessen et al., 2010).

Plasmid 25896: pLX302

Plasmid 25890: pLX304

Plasmid 25899: pDONR221_EGFP

Plasmid 23935: pDONR223-EGFR

Plasmid 23888: pDONR223-ERBB2

Plasmid 23874: pDONR223-ERBB3

Individual shRNA vectors used were collected from the TRC library.

EGFR:

shEGFR-1:TRCN0000121067_GCTGCTCTGAAATCTCCTTTA;

shEGFR-2:TRCN0000039633_GCTGAGAATGTGGAATACCTA;

ERBB2:

shERBB2-1:TRCN0000039878_TGTCAGTATCCAGGCTTTGTA;

shERBB2-2:TRCN0000039880_CAGCTCTTTGAGGACAACTAT;

ERBB3:

shERBB3-1: TRCN0000000619_GCTCTTATGTGTGCCTTTGTT;

shERBB3-8: TRCN0000040111_GCGACTAGACATCAAGCATAA;

MYC:

shMYC-1:TRCN0000010390_AATGTCAAGAGGCGAACACA;

shMYC-2:TRCN0000010391_CAACCTTGGCTGAGTCTTGAG;

shMYC-4:TRCN0000039639_CCCAAGGTAGTTATCCTTAAA;

shMYC-3:TRCN0000039642_CCTGAGACAGATCAGCAACAA;

shMYC-5: TRCN0000174055_CCTGAGACAGATCAGCAACAA;

CTBP1

shCTBP1-1: TRCN0000013738_ GCAGAAGAAGTCAGTAGTTAT;

shCTBP1-2: TRCN0000013739_ ACCGTCAAGCAGATGAGACAA;

CTBP2

shCTBP2-3: TRCN0000013745_ CACTGCAATCTCAACGAACAT;

shCTBP2-4: TRCN0000013746_ CCTGAGAGTGATCGTGCGGAT

qRT-PCR

qRT-PCR assays were performed using 7500 Fast Real-Time PCR System (Applied

Biosystems) as described (Kortlever et al., 2006). Relative mRNA levels of genes shown

were normalized to the mRNA level of GAPDH (housekeeping gene). The primer sequences

for assays using SYBR Green master mix (Roche) are as follows: GAPDH_Forward,

AAGGTGAAGGTCGGAGTCAA; GAPDH_Reverse, AATGAAGGGGTCATTGATGG;

ERBB2 forward, AGCATGTCCAGGTGGGTCT; ERBB2 reverse,

CTCCTCCTCGCCCTCTTG; ERBB3 forward, GGGGAGTCTTGCCAGGAG; ERBB3

reverse, CATTGGGTGTAGAGAGACTGGAC; MYC forward,

CACCGAGTCGTAGTCGAGGT; MYC reverse, TTTCGGGTAGTGGAAAACCA. CTBP1

forward, ATCCAGCAATGCCACCAG; CTBP1 reverse, GCTCGCACTTGCTCAACA;

CTBP2 forward, GATCTGGGGGCGGATACT; CTBP2 reverse,

CTCACCGTACGAGAAGGTGG. Gene expression analysis of tumor samples from patient

derived xenograft and patients were carried out using TaqMan® Probe-Based Gene

Expression assay (Applied Biosystems). The probes used are as follows: EGFR (Cat. #

Hs01076078_m1); ERBB2 (Cat. # Hs01001580_m1); ERBB3 (Cat. # Hs00176538_m1);

GAPDH (Cat. # Hs03929097_g1).

Synergy score calculation

Cells were seeded in 384-well plate and treated with 7 * 7 (matrix) pairs of serially diluted

(two folds dilution) two drugs combination for 7 days. The highest concentration of each drug

used for individual cell lines is 2*IC50. The Dose-matrix data were obtained by testing cell

viability after the treatment using CellTiter-Blue® assay according to the manual provided by

the manufacturer.

Measurements are normalized using Normalized Percentage Inhibition (Boutros, 2006).

Values are transformed to values between 0 and 1 using the formule y = (x-p) /(n – p) . In

this formule x is the experimental value, n is the mean of the negative control and p is the

mean of the postive control. The effect level is then calculated as:

(1 - normalized value.) * 100 percent.

A second matrix, called loewe matrix, is created containing the expected effect levels in case

of additivity of the two drugs. The expected values are calculated using the formula of

Loewe: D1/Dx1 + D2/Dx2 = 1. D1 and D2 are the dose of respectively drug 1 and drug 2 in

the combination. Dx1 is the dose you would need from only drug1 in order to have the same

effect x as the combination. Dx2 is that for drug 2. Dx1 and Dx2 are determined using a

fitted dose effect curve. For fitting the median effect approach from Chou is used, in which

log(dose) is plotted against log(fraction affected/ fraction unaffected) and a linear fit is then

done. The additive effect is determined in an iterative process. Starting with the level of effect

of the most effective of the two, the loewe score is calculated. The search process stops if the

loewe score is 1 or the max level of 100 is reached.

The synergy score is calculated as the total of the positive values in the matrix divided by

100. The sum is multiplied with a correction factor for the dilution: ln(fx) * ln(fy) , in which

fx and fy are the respective dilution factors (Boutros et al., 2006; Chou, 2010; Lehar et al.,

2009).

KRAS mutant NSCLC Patient samples

Permission was granted by the VUMC medical ethical committee to take biopsies from a

KRAS mutant NSCLC patient before and after trametinib treatment for 7 days.

SUPPLEMENTAL REFERENCES

Boutros, M., Bras, L.P., and Huber, W. (2006). Analysis of cell-based RNAi screens. Genome

Biol 7, R66.

Chou, T.C. (2010). Drug combination studies and their synergy quantification using the

Chou-Talalay method. Cancer Res 70, 440-446.

Huang, S., Holzel, M., Knijnenburg, T., Schlicker, A., Roepman, P., McDermott, U., Garnett,

M., Grernrum, W., Sun, C., Prahallad, A., et al. (2012). MED12 Controls the Response to

Multiple Cancer Drugs through Regulation of TGF-beta Receptor Signaling. Cell 151, 937-

950.

Johannessen, C.M., Boehm, J.S., Kim, S.Y., Thomas, S.R., Wardwell, L., Johnson, L.A.,

Emery, C.M., Stransky, N., Cogdill, A.P., Barretina, J., et al. (2010). COT drives resistance to

RAF inhibition through MAP kinase pathway reactivation. Nature 468, 968-972.

Kortlever, R.M., Higgins, P.J., and Bernards, R. (2006). Plasminogen activator inhibitor-1 is a

critical downstream target of p53 in the induction of replicative senescence. Nat Cell Biol 8,

877-884.

Lehar, J., Krueger, A.S., Avery, W., Heilbut, A.M., Johansen, L.M., Price, E.R., Rickles, R.J.,

Short, G.F., 3rd, Staunton, J.E., Jin, X., et al. (2009). Synergistic drug combinations tend to

improve therapeutically relevant selectivity. Nat Biotechnol 27, 659-666.

Mittempergher, L., de Ronde, J.J., Nieuwland, M., Kerkhoven, R.M., Simon, I., Rutgers, E.J.,

Wessels, L.F., and Van't Veer, L.J. (2011). Gene expression profiles from formalin fixed

paraffin embedded breast cancer tissue are largely comparable to fresh frozen matched tissue.

PLoS One 6, e17163.

Yang, X., Boehm, J.S., Salehi-Ashtiani, K., Hao, T., Shen, Y., Lubonja, R., Thomas, S.R.,

Alkan, O., Bhimdi, T., Green, T.M., et al. (2011). A public genome-scale lentiviral

expression library of human ORFs. Nature methods 8, 659-661.