supplemental materials and methods fungal culture€¦ · 2013-08-05 · kaido m, funatsu n, tsuno...
TRANSCRIPT
Supplemental Materials and Methods
Fungal culture
Colletotrichum gloeosporioides S9275 (Cg) was provided by Shigenobu Yoshida (National
Institute for Agro-Environmental Sciences, Japan). The C. orbiculare wild-type strain
104-T (MAFF240422) was a stock culture of the Laboratory of Plant Pathology, Graduated
School of Agriculture, Kyoto University. Cg was grown on 2.5% (w/v) potato dextrose
agar medium (PDA; Difco, Detroit, MI, USA) and placed at 24°C in a cycle of 16 h of
black light and 8 h of dark. Colletotrichum orbiculare was maintained on 3.9% (w/v) PDA
at 24°C in the dark. Conidia of C. gloeosporioides and C. orbiculare were obtained by
gentle pipetting of grown cultures and centrifugation for purification.
Plant lines, growth, and inoculation
The sid2-2 (eds16-1) and npr1-3 mutants were provided by Volker Lipka
(Georg-August-University, Germany). The coi1-21 and ein2-1 mutants were obtained from
the Arabidopsis Biological Resource Center. The GFP-h transgenic plants were provided by
Ikuko Hara-Nishimura (Kyoto University, Japan). Plants were sown on rockwool, treated at
4°C in the dark for 2 days, and grown at 25°C with 16 h of illumination per day in nutrient medium. For microscopic observation, conidial suspension (~5 × 105 conidia per ml) was
dropped on cotyledons of 7~14-day-old seedlings. The conidial suspension of Cg was
inoculated with or without 0.1% Glc. Colletotrichum orbiculare was inoculated without Glc. For the flg22 treatment, 2 µM flg22 solution was spotted on cotyledons on PDF–GFP
plants. Inoculated plants then were placed in a growth chamber at 25°C with a cycle of 16 h
of light and 8 h of dark, and maintained at 100% relative humidity. For plant transformation,
the vectors were transformed into Agrobacterium tumefaciens (strain GV3101), and
Arabidopsis plants were transformed using the floral-dip method using the transformed
Agrobacterium strains (Clough and Bent, 1998). Transgenic plants were selected by
kanamycin. After 2 weeks, transformants were transplanted to soil and allowed to set seeds.
Mutants and T-DNA insertion lines
Homozygous mutant plants of the transfer (T)-DNA insertion mutant (coi1-21 SALK lines)
were identified by PCR using corresponding gene-specific primers, forward primer 5ʹ′-TGGACCATATAAATTCATGCAGTC-3ʹ′ and reverse primer
5ʹ′-CTGCAGTGTGTAACGATGCTC-3ʹ′, and the T-DNA insertion-specific primer
5ʹ′-GCGTGGACCGCTTGCTGCAACT-3ʹ′. PCR was performed with two paired primers:
(i) forward primer and reverse primer, and (ii) LBb1 and reverse primer. The amplification
of PCR products by primer pair (i) represents the wild-type or heterozygous lines, and the
amplification of PCR products by primer pair (ii) represents homozygous or heterozygous
lines. The npr1-3 and ein2-1 mutations were checked by corresponding derived
cleaved-amplified polymorphic sequence (dCAPS) primers designed by using the dCAPS
Finder 2.0 (http://helix.wustl.edu/dcaps/dcaps.html): 5ʹ′-GGCCGACTATGTGTAGAAATACGATAT-3ʹ′ and
5ʹ′-CCATTGCAGCTTGTGCTTCCGTTGG-3ʹ′ for npr1-3 and
5ʹ′-GGATACTACGTCTGTTACTAGC-3ʹ′ and 5ʹ′-GTCTTCCTTAAGACTACTAACTC-3ʹ′
for ein2-1. Each type of PCR product (wild-type or mutant) was cleaved with the
corresponding enzyme (EcoRV for npr1-3, XhoI for ein2-1). The sid2-2 mutation was also
checked by the corresponding specific primers, 5ʹ′-TGCAGCTTCAATGCTTCATTTCTTG-3ʹ′ and
5ʹ′-TTACAAGAGAGACAACATTGCTTTC-3ʹ′.
Quantitative reverse transcription-PCR analysis
Total RNA was isolated from three sets of eight cotyledons collected from four different
plants using the Qiagen RNeasy Plant Mini Kit and were treated with DNase (Promega
RQ1 RNase-free DNase) to remove DNA contamination. A TaKaRa PrimeScriptTM RT
reagent kit was used to obtain cDNA (TaKaRa Bio Inc., Shiga, Japan). The PCR products
were amplified with the TAKARA SYBR Premix Extaq and Thermal cycler Dice Real time
system TP800. The expression of Actin2 (At3g18780) was used as a control for normalizing
the amount of cDNA. The primers used for detection of the PDF1.2a–GFP transcript were forward primer 5ʹ′-TCCAGGAGCGCACCATCTTCTT-3ʹ′ and the reverse primer
5ʹ′-TTGTACTCCAGCTTGTGCCCCA-3ʹ′. The primers for detection of Actin2 transcript
were forward primer 5ʹ′-ACCTTGCTGGACGTGACCTTACTGAT-3ʹ′ and reverse primer
5ʹ′-GTTGTCTCGTGGATTCCAGCAGCTT-3ʹ′.
Microscopy
To investigate infection behavior of C. gloeosporioides expressing red fluorescent protein
(RFP) on Arabidopsis, plants were mounted in water under a cover slip with the inoculated
surface facing the objective lens (Hiruma et al., 2010). The invasion ratio (%) was
calculated by the following numerical formula: (the number of conidia with formation of invasive hypha) / (the number of conidia) × 100. At least 100 conidia were observed in
each experiment ~14 h after inoculation. Each line was tested in three independent
experiments. For plasmolysis assay, the inoculated cotyledons were treated with 0.8 M
mannitol solution for 15 min. Detection of GFP and RFP fluorescence was performed using
an Olympus Fluoview FV500 confocal microscope (Olympus, http://www.olympus-global.com), with a 40× or 60× PlanApo (1.4 numerical aperture)
oil-immersion objective (Nikon, http://www.nikon.com). The samples were excited with
the argon laser for GFP and HeNe laser for RFP. We used a diachronic mirror DM488/543,
beam splitter SDM560, and emission filter BA505-525 for GFP or BA5601F for RFP
fluorescence detection.
Plasmid constructs
Supplemental Table S1 provides the sequence information for the primers used for plasmid
construction in this study. For the construction of pBIC–NP–PDF1.2a–GFP (to generate the NP–PDF–GFP plants), we first amplified the sequence containing the native 5ʹ′ regulatory
PDF1.2a sequence, which is directly upstream from the start codon of PDF1.2a, and the
entire PDF1.2a gene sequence (named NP–PDF1.2a sequence) using primers FSaPDF and
RPDF. The GFP sequence was also amplified with primers FPDF–GFP and RGFP.
NP–PDF1.2a fused to the GFP sequence was then amplified by mixing the two PCR
products using FSaPDF and RGFP, which produced the NP–PDF1.2a–GFP sequence. After
digestion with SalI and EcoRI, the NP–PDF1.2a–GFP sequence was ligated into pBICP35
(Mori et al., 1991), which resulted in pBIC–NP–PDF1.2a–GFP. To construct
pBIC35S–NP–PDF1.2a–GFP to generate the PDF–GFP plants, we amplified the
NP-PDF1.2a sequence using primers FBaPDF and RPDF. The GFP sequence was also
amplified using primers FPDF–GFP and RGFP. The NP–PDF1.2a–GFP sequence was then
amplified by mixing the two PCR products using FBaPDF and RGFP. After digestion with
BamHI and EcoRI, the NP–PDF1.2a–GFP sequence was ligated into pBICP35, which
resulted in pBIC35S–NP–PDF1.2a–GFP. To construct pBIC35S–NP–SP–GFP to generate the SP–GFP plants, we amplified the 5ʹ′ regulatory sequence and the sequence encoding the
signal peptide (SP) of PDF1.2a using primers FBaPDF and RSP (NP–SP sequence). We
also amplified the GFP sequence using primers FSP-GFP and RGFP. The NP–SP–GFP
sequence was then amplified by mixing the two PCR products using primers FBaPDF and
RGFP. After digestion with BamHI and EcoRI, the NP–SP–GFP sequence was ligated into
pBICP35, which resulted in pBIC35S–NP–SP–GFP. To construct pBIC35S–PR1–GFP,
pBIC35S–PR3–GFP, and pBIC35S–PR4–GFP, we amplified the entire PR1, PR3, and PR4
sequences using the paired primers FStPR1 and RPR1 (for PR1), FStPR3 and RPR3 (for
PR3), and FStPR4 and RPR4 (for PR4), respectively. We also amplified the GFP sequence
using the paired primers FPR1–GFP and RGFP (for PR1), FPR3–GFP and RGFP (for PR3),
and FPR4–GFP and RGFP (for PR4). The PR1–GFP, PR3–GFP, and PR4–GFP sequences
were then amplified by mixing the two PCR products using the paired primers FStPR1 and
RGFP (for PR1), FStPR3 and RGFP (for PR3), and FStPR4 and RGFP (for PR4). After
digestion with StuI and EcoRI, each fragment was ligated into pBICP35, which resulted in
pBIC35S–PR1–GFP, pBIC35S–PR3–GFP, and pBIC35S–PR4–GFP.
Microprojectile bombardment
A microprojectile bombardment assay was performed using a PDS1000 helium particle gun
(Bio-Rad, Richmond, CA, USA) following the conditions described in Tamai and Meshi
(2001) and Kaido et al. (2011). Three mg of gold particles were coated with 5 µg of
plasmid DNA ptd/MEB2 (Yamada et al., 2013). ptd/MEB2 carries Pro-35S:tdTom-MEB2,
which encode fusion proteins of tdTomato (tdTOM) (Shaner et al., 2004) with MEB2.
Eight-day-old seedlings of PDF–GFP plants were bombarded, then incubated at 24 °C for 1
day. Detection of GFP and tdTOM fluorescence was performed using an Olympus
Fluoview FV500 confocal microscope (Olympus). The samples were excited with the argon
laser for GFP and HeNe laser for tdTOM. We used a diachronic mirror DM488/543, beam
splitter SDM560, and emission filter BA505-525 for GFP or BA5601F for tdTOM
fluorescence detection.
Accession numbers
The GenBank accession numbers for the genes used in this study are shown in parentheses:
EDR1 (At1g08720), PDF1.2a (At5g44420), PR1 (At2g14610), PR3 (At3g12500), PR4
(At3g04720), SID2 (At1g74710), NPR1 (At1g64280), EIN2 (At5g03280), COI1
(At2g39940), ACTIN2 (At3g18780).
Supplemental References
Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated
transformation of Arabidopsis thaliana. Plant J 16: 735-743 Hiruma K, Onozawa-Komori M, Takahashi F, Asakura M, Bednarek P, Okuno T,
Schulze-Lefert P, Takano Y (2010) Entry mode-dependent function of an indole glucosinolate pathway in Arabidopsis for nonhost resistance against anthracnose pathogens. Plant Cell 22: 2429-2443
Kaido M, Funatsu N, Tsuno Y, Mise K, Okuno T. (2011) Viral cell-to-cell movement requires
formation of cortical punctate structures containing Red clover necrotic mosaic virus
movement protein. Virology 413:205–215 Mori M, Mise K, Kobayashi K, Okuno T, Furusawa I (1991) Infectivity of plasmids containing
brome mosaic virus cDNA linked to the cauliflower mosaic virus 35S RNA promoter. J Gen Virol 72 ( Pt 2): 243-246
Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY (2004)
Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma
sp. red fluorescent protein. Nat Biotechnol 22: 1567–1572
Tamai A, Meshi T (2001) Tobamoviral movement protein transiently expressed in a single
epidermal cell functions beyond multiple plasmodesmata and spreads multicellularly in an
infection-coupled manner. Mol Plant-Microbe Interact 14: 126–134. Yamada K, Nagano AJ, Nishina M, Hara-Nishimura I, Nishimura M (2013) Identification of
two novel endoplasmic reticulum body-specific integral membrane proteins. Plant Physiol
161: 108–12
Legends to Supplemental Figures
Supplemental Figure S1.
Quantitative reverse transcription-PCR analysis of the expression level of the
PDF1.2a–GFP fusion gene in generated transgenic lines. Expression of the PDF1.2a–GFP
gene was induced 9 h after Cg inoculation with Glc in the transgenic Arabidopsis line
designated NP–PDF–GFP expressing PDF1.2a–GFP under the putative PDF1.2a native
promoter; this is shown in comparison with before inoculation (0 h). The expression level
of the PDF1.2a–GFP gene was much higher in PDF–GFP plants than in NP–PDF–GFP
plants. The PDF1.2a–GFP gene was highly expressed in PDF–GFP plants before Cg
inoculation. The mean and standard deviation were calculated from three independent
experiments.
Supplemental Figure S2.
Partial recovery of nonhost resistance against Cg in the edr1 mutant after expression of
PDF1.2a–GFP. Nonhost resistance against Cg was partially recovered in the PDF–GFP
plants carrying the edr1 mutation compared with the original edr1 mutant. Cg with Glc was
inoculated on the tested plants. At 14 hpi, the invasion ratio was examined. At least 100
conidia were observed in each experiment. The mean and standard deviation were
calculated from three independent experiments.
Supplemental Figure S3.
Location of the fluorescence signal of GFP having HDEL in ER bodies even when ESPER
is activated. Cg with Glc was inoculated on cotyledons of the GFP-h plants expressing GFP
with an ER-retention signal (HDEL). As a control, Glc was also administered. At 16 hpi, fluorescence was detected in ER bodies in each treatment. Bar = 50 µm.
Supplemental Figure S4.
Unlikely activation of ESPER when the pathogens try to enter through appressoria
pigmented with melanin. Each pathogen was inoculated on the PDF-GFP plant. At 16 hpi,
the fluorescence of PDF1.2a–GFP was investigated by confocal microscopy. Cg and C.
orbiculare (Co) were inoculated without Glc. In both inoculations, ESPER was not
detected, although the PDF1.2a–GFP signal occasionally exhibited focal accumulation underneath the melanized appressoria (represented by a white arrow). Bars = 50 µm.
0 h 9 h 0 h 9 h 0 h 9 hCol-0 NP-PDF-GFP PDF-GFP
Cg
Rel
ativ
e ge
ne e
xpre
ssio
n
Watanabe et al.Supplemental Fig. S1
100
10
1
0.1
0.01
Supplemental Figure S1.Quantitative reverse transcription-PCR analysis of the expression level of the PDF1.2a–GFP fusion gene in generated transgenic lines. Expression of the PDF1.2a–GFP gene was induced 9 h after Cg inoculation with Glc in the trans-genic Arabidopsis line designated NP–PDF–GFP expressing PDF1.2a–GFP under the putative PDF1.2a native promoter; this is shown in comparison with before inoculation (0 h). The expression level of the PDF1.2a–GFP gene was much higher in PDF–GFP plants than in NP–PDF–GFP plants. The PDF1.2a-GFP gene was highly expressed in PDF–GFP plants before Cg inoculation. The mean and standard deviation were calculated from three independent experiments.
Fung
al e
ntry
rate
(%)
Cg
with PDF-GFPedr1
Watanabe et al.Supplemental Fig. S2
edr1Col-0
30
25
20
15
10
5
0
Supplemental Figure S2.Partial recovery of nonhost resistance against Cg in the edr1 mutant after expres-sion of PDF1.2a–GFP. Nonhost resistance against Cg was partially recovered in the PDF–GFP plants carrying the edr1 mutation compared with the original edr1 mutant. Cg with Glc was inoculated on the tested plants. At 14 hpi, the invasion ratio was examined. At least 100 conidia were observed in each experiment. The mean and standard deviation were calculated from three independent experiments.
Cg with GlcGlc
Watanabe et al.Supplemental Fig. S3
Supplemental Figure S3.Location of the fluorescence signal of GFP having HDEL in ER bodies even when ESPER is activated. Cg with Glc was inoculated on cotyledons of the GFP-h plants expressing GFP with an ER-retention signal (HDEL). As a control, Glc was also administered. At 16 hpi, fluorescence was detected in ER bodies in each treat-ment. Bar = 50 μm.
Inoculation of Co Inoculation of Cg without Glc
Watanabe et al.Supplemental Fig. S4
Supplemental Figure S4.Unlikely activation of ESPER when the pathogens try to enter through appressoria pigmented with melanin. Each pathogen was inoculated on the PDF-GFP plant. At 16 hpi, the fluorescence of PDF1.2a–GFP was investigated by confocal micros-copy. Cg and C. orbiculare (Co) were inoculated without Glc. In both inocula-tions, ESPER was not detected, although the PDF1.2a–GFP signal occasionally exhibited focal accumulation underneath the melanized appressoria (represented by a white arrow). Bars = 50 μm.
Supplemental Table S1. The list of primers used for plasmid construction in this study
FSP-GFP GCGAGGGAGGTGGAGGTGGAATGGTGAGCAAGGGCGAGG
RGFP
FPR3-GFPCCATACGGAGGTGGAGGTGGAATGGTGAGCAAGGGCGAGGFPR1-GFP
RSP
RPR1GAAGGCCTAAGGAGATATAACAATGCCTCCACAAAAAGAAAACC
GAAGGCCTAAGGAGATATAACAATGAAGATCAGACTTAGC
FPR4-GFP CGCGTTGGAGGTGGAGGTGGAATGGTGAGCAAGGGCGAGG
FStPR4RPR3
TCCACCTCCACCTCCCTCGCACAACTTCTGTGC
TCCACCTCCACCTCCGTATGGCTTCTCGTTCACATAATTCC
Primer name Sequence
FSaPDF ACGCGTCGACCGACGTTGGACTGTTTCATCATATCCCFBaPDFRPDF
CGGGATCCCGACGTTGGACTGTTTCATCTCCACCTCCACCTCCACATGGGACGTAACAGATAC
RPR4FPDF-GFP
GAAGGCCTAAGGAGATATAACAATGAATTTTACTGGCTATTCTC
GCTATTGGAGGTGGAGGTGGAATGGTGAGCAAGGGCGAGG
CGGAATTCTTACTTGTACAGCTCGTCC
FStPR1
FStPR3TCCACCTCCACCTCCAATAGCAGCTTCGAGGAGGCCGTTAACG
TCCACCTCCACCTCCAACGCGATCAATGGCCGAAACAAGCCATGTGGAGGTGGAGGTGGAATGGTGAGCAAGGGCGAGG