SUPPLEMENTAL INFORMATION

Materials and Methods

Cell culture and reagents

PANC-1 cells were maintained in DMEM medium (10% FBS, 50 units/ml penicillin,

50µg/ml streptomycin sulfate). PANC10.05 were cultured in RPMI-1640 medium with

10 mM HEPES, 1 mM sodium pyruvate, 4.5 g/L glucose, 1.5 g/L sodium bicarbonate

(10% FBS, 0,01mg/ml bovine insulin (Sigma-Aldrich, Saint-Louis, MO, USA), 50

units/ml penicillin, 50µg/ml streptomycin sulfate). BxPC-3 cells were cultured in

RPMI-1640 medium with 10 mM HEPES, 1 mM sodium pyruvate, 4.5 g/L glucose,

1.5 g/L sodium bicarbonate (10% FBS, 50 units/ml penicillin, 50µg/ml streptomycin

sulfate) and HEK293FT cells were maintained in DMEM medium (10% FBS, 1%

nonessential amino acids, 1% geniticin, 50 units/ml penicillin, 50µg/ml streptomycin

sulfate). Human umbilical vein endothelial cells (HUVEC) were used for in vitro

angiogenesis assays. Cells were grown in EGM-2 medium (PromoCell, Heidelberg,

Germany) with 10% FBS, meanwhile EBM-2 medium (PromoCell, Heidelberg,

Germany) with 4% FBS were used during experiments. Passages lower than 10

were used through the experiments. All cell culture media and reagents were from

Gibco BRL (Gran Island, NY, USA) unless mentioned differently. All cell lines were

maintained at 37oC with 5% CO2.

MG-132 and BAY-117082 chemical inhibitors were purchased from Calbiochem

(Millipore, Billerica, MA, USA) and human recombinant TNFα was from Sigma

(Sigma-Aldrich, Saint-Louis, MO, USA). Human recombinant TNF-α was used at a

final concentration 20ng/ml.

Transfections

All transfections were performed using Lipofectamine 2000 (Invitrogen, Carlsbad,

CA, USA) according to manufacturer’s instructions. siRNAs targeting ANXA2, KRAS

and RELA, as well as the non-targeting control siRNA were purchased from Ambion

(Ambion, Austin, TX, USA). The second siRNA against ANXA2 gene (siANXA2#2)

was purchased from Dharmacon (Lafayette, CO, USA). For each gene, 2 individual

siRNAs were used (Supplementary Table S6). miRIDIAN miRNA mimics and the

1

negative control were obtained from Dharmacon (Lafayette, CO, USA). siRNAs and

miRNA mimics were used at a final concentration of 30nM.

Stable cell line construction using retroviral vectors

Human miR-206 gene was subcloned from pCMV-miR206 (Origene, MD, USA) into

the SgfI and MluI sites of pCR2.1 vector (Invitrogen, Carlsbad, CA, USA). MiR-206

gene was further shuttled into pBABE-puro retroviral vector using BamHI and XhoI

restriction enzymes. For the virus production, 2x106 HEK293FT cells were

transfected in 10cm plates with 3.5 μg of pBABE-empty or pBABE-miR206 vector

along with 3.5 μg of the gag-pol plasmid pHIT60 and 800ng of the envelope plasmid

pMD2.G using Lipofectamine2000 (Invitrogen, Carlsbad, CA, USA). Cells were

allowed to produce viruses for 48 hours before PANC10.05 cells were infected.

Transduced cells were selected in 2 μg/ml puromycin (Invitrogen, Carlsbad, CA,

USA).

Luciferase reporter assays

For the NF-κB luciferase reporter assay, HEK293FT (0.8x104 cells/well), PANC-1 and

PANC10.05 (1x104 cells/well) cells were transfected in 96-well plates with the miRNA

mimics, together with 100ng of the NF-κB reporter 3xKBL (kindly provided by Prof.

George Mosialos) and 20ng (in case of PANC-1 and PANC10.05) and 2.5ng (in case

of HEK293FT) of pMIR-REPORT β-gal vector (Ambion, Austin, TX, USA). 48h after

transfection cells were washed in PBS (Gibco, Gran Island, NY, USA) and lysed in

100μl lysis buffer (25mM TrisP04 pH=7.8, 1mM CDTA pH=7.8, 10% Glycerol, 1%

Tritin-X100, 10 ul of fresh 0.2M DTT/ml). Luciferase activity was determined using a

firefly luciferase assay reagent (40 mM Tricine, 2 mM ATP, 10 mM MgSO4, 0.5 mM

EDTA , 10 mM DTT, 1 mM Coenzyme A, 1 mM D-Luciferin) and β-galactosidase

activity which was used for normalization, was measured by beta-glo® Luminescent

Assay Kit (Promega, Madison, WI, USA). 50μl of the lysate were mixed with 50 µl of

firefly luciferase assay reagent and after an incubation time of 1 min, luminescence

intensity of each well was measured using the TECAN infinite200 microplate reader

(Tecan, Linz, Austria). 5 µl of lysate were subsequently used for normalization

measurement of β-galactosidase activity. 20 µl of β-galactosidase substrate β-Glo

(Promega, Madison, WI, USA) were added to each well by the injector; the reaction

2

was incubated for 10 min and luminescence intensity of each well was measured

using a plate reader. To validate direct targeting of miRNAs, psiCHECK2 vectors

(Promega, Madison, WI, USA), containing the respective 3’UTRs, were co-

transfected with mimic miRNAs in PANC-1 cells. 48h after transfection Renilla and

firefly luciferase activities were determined using the TECAN infinite200 microplate

reader (Tecan, Linz, Austria). Renilla luciferase activity was determined using a

Renilla luciferase reagent (10 mM DTT, 8 mM EDTA, 0.05 mM Coelenterazine).

Mutations within each of the predicted target sites of ANXA2 and KRAS 3’-UTRs

were generated by site-directed mutagenesis (Supplementary table S7).

Antibodies and immunoblotting

For Western Blotting, cells were lysed in ice cold M-PER lysis buffer (Pierce,

Rockford, IL, USA) containing protease inhibitor Complete Mini (Roche, Basel,

Switzerland) and anti-phosphatase PhosSTOP (Roche, Basel, Switzerland). Protein

concentrations were determined by BCA Protein Assay Reagent Kit (Pierce,

Rockford, IL, USA) and proteins were denatured with 4× Roti Load (Roth, Karlsruhe,

Germany) at 95°C for 5 minutes. Then, proteins (20µg) were separated by 12% SDS-

PAGE, blotted onto a PVDF membrane Immobilon-P (Millipore, Billerica, MA, USA)

and exposed to primary antibodies after blocking in 5% milk in TBS-T for 1h at room

temperature. The following antibodies were used in 5% milk/TBS-T: mouse

monoclonal anti-ANXA2 (610069) (BD Biosciences, Bedford, MA, USA), mouse

monoclonal anti-KRAS (ab55391) (Abcam, Cambridge, MA, USA), rabbit

polyclonal NF-κB p65 (A)(SC-372) (Santa Cruz Biotechnologies, California, CA,

USA) and rabbit monoclonal GAPDH (14C10) (CST#2118) (Cell Signaling

Technology, Danvers, MA, USA). Blots were probed with IRDye®680 or IRDye®800

conjugated antibodies (H+L) (LI-COR, Lincoln, NE, USA) and bands were visualized

using an Odyssey scanner (LI-COR, Lincoln, NE, USA). Primary antibodies were

used at a 1:1000 dilution (except for KRAS antibody which was used at a 1:200

dilution) and secondary antibodies at a 1:10.000 dilution.

3

Electrophoretic Shift Mobility Assay (EMSA)

For the EMSA experiments the LightShift Chemiluminescent EMSA kit (#20148,

Pierce, Rockford, IL, USA) was used, according to the manufacturer's instructions.

Briefly, nuclear extracts from transfected cells were prepared using the NE-PER kit

(Pierce, Rockford, IL, USA) according to the manufacturer’s instructions. Protease

and phosphatase inhibitors (Roche, Basel, Switzerland) were added to the buffers

contained in the kit. Protein concentration was determined using the BCA kit assay

(Pierce, Rockford, IL, USA) as described above. The oligonucleotide sequences that

contain the wild type or mutated binding site of NF-κB transcription factor in the

LMP1 promoter were previously described . The sequences to construct the double-

stranded oligos were the following:

WT: 5’ aggcccggGGGGATTTGCggggtct 3’

MUT: 5’ aggcccggGGGGAcccGCggggtct 3'

the capital letters correspond to the NF-κB binding site, and the red letters to

mutated nucleotides. The oligos were ordered from Sigma and were modified with

biotin at the 5’ end and were HPLC purified.

Annealed oligos (50 μM) were diluted using a 1:2000 dilution. 2 μl of the diluted

annealed oligos were incubated with 500ng of nuclear extract in binding buffer (1x

binding buffer provided with the kit, 0.05 μg/μl Poly (dldC), 5% glycerol, 0.1% NP-40,

5 mM MgCl2) for 20min at room temperature. DNA-protein complexes were resolved

by electrophoresis in a 5% polyacrylamide gel in 0.5xTBE at 100V. The transfer to a

positively charged nylon membrane (Amersham Biosciences, New Jersey, NJ, USA)

was performed at 380mA (~100V) for 1h at 4 oC in 0.5xTBE. When the transfer was

complete, the membrane was immediately crosslinked at 1200 μjoules with UV

crosslinker (Stratagene, Cambridge, MA, USA). The membrane was probed with

stabilized streptavidin-horseradish peroxidase-conjugate and the bands were

visualized by chemoluminescence (Amersham Biosciences, New Jersey, NJ, USA).

RNA isolation and Quantitative Real-Time PCR

Total RNA and microRNA were isolated from cells using miRNeasy Mini kit (Qiagen,

Hilden, Germany) according to the manufacturer’s instructions. For mRNA, cDNA

synthesis was carried out with the Revert Aid H Minus First Strand cDNA Synthesis

Kit (Fermentas, St Leon-Rot, Germany). The qRT-PCR reactions for target genes

4

were performed using ABI Prism 7900HT Sequence Detection System (Applied

Biosystems, Weiterstadt, Germany), using probes from the Universal Probe Library

(Roche, Penzberg, Germany). The housekeeping genes HPRT1 and GAPDH were

used for normalization of mRNA analysis (Supplementray table S8). miRNA specific

primer sets for miR-206 and RNU48 (TaqMAN® MicroRNA Assays), TaqMAN® Fast

Universal PCR Master Mix (2x), and TaqMan® MicroRNA Reverse Transcription Kit

were purchased from Invitrogen (Invitrogen, Carlsbad, CA, USA). RNU48 was used

for normalization of miRNA analysis. The relative gene expression level of one gene

compared to control was given by the following equation: fold expression level =

2−ΔΔCt.

ELISA

Transfected PANC-1 and PANC10.05 cells were cultured in full growth medium for

48h. Then, IL-8, CXCL1 and VEGF-C secretion was determined in the supernatant

using the human IL-8 QuantiGlo Chemiluminescent and the human CXCL1 and

VEGF-C Quantikine ELISA kits (R&D Systems, Inc, Wiesbaden-Nordenstadt,

Germany) according to the manufacturers’ instructions. Measurements for

absorbance or luminescence were performed using the TECAN infinite200 plate-

reader (Tecan, Linz, Austria).

VEGFA was detected in supernatants of transfected PANC-1 and PANC10.05 cells

by fluorophore-linked immunosorbent assay (FLISA) using a modified version of the

ELISA kit provided by R&D Systems (Minneapolis, MN, USA). Cells were transfected

in 6-well plates as indicated above and incubated after transfection for 72h in full

growth medium. Supernatants were collected, cleared by centrifugation and stored at

-80°C prior to quantification of VEGFA. All incubations were performed at room

temperature and all washing steps were performed using 0.05% PBS-Twees20.

Standards of different concentrations ranging from 5 ng/ml to 39 pg/ml were prepared

in blocking buffer using recombinant human VEGF165 (293-VE, R&D Systems,

Minneapolis, MN, USA). Briefly, a high-binding 96-well micro-assay plate (Greiner

bio-one, Frickenhausen, Germany) was coated with 3µg/ml capture antibody (clone

26503, R&D Systems, Minneapolis, MN, USA) overnight, blocked using 1% BSA in

PBS for 2 hours and incubated with standards and samples for 2 hours. VEGFA was

detected using 200 ng/ml biotinylated detection antibody (BAF293, R&D Systems,

Minneapolis, MN, USA) for 2 hours followed by 0.4µg/ml Streptavidin, Alexa Fluor

680 conjugate (Molecular Probes, Invitrogen, Carlsbad, CA, USA). The plate was

5

scanned using as Odyssey Near-Infrared scanner (LI-COR Biosciences, Lincoln, NE,

USA). Intensities were retrieved using the GenePix software (Molecular Devices,

Biberach, Germany) and analyzed using MS Excel.

Cancer cell invasion and migration assays

PANC-1 and BxPC-3 cells were transfected with 30nM siRNAs or miRNAs as

described above. 24h later, cells were starved in 0.5% FBS medium for 24h. 1.5x105

cells were seeded in 0.5% FBS medium in the invasion 24-well plates (BD Biocoat,

Matrigel Invasion chamber, 8.0µm, BD Biosciences, Bedford, MA, USA). Full growth

medium was used as chemoattractant in the lower chamber. Cells were allowed to

invade for 24h in case of PANC-1 and 48h in case of BxPC-3 and the number of

invaded cells was determined by flow cytometry (FACSCalibur, BD Biosciences,

Bedford, MA, USA). For trans-well migration assays 1x105 cells were seeded in 0.5%

FBS medium in the 24-well boyden chambers (Corning, 8.0μm, Thermo Scientific,

Schwerte, Germany). PANC-1 and BxPC-3 cells were allowed to migrate for 24h.

The number of migrated cells was determined by flow cytometry (FACSCalibur, BD

Biosciences, Bedford, MA, USA).

For RTCA migration experiments, transfections were performed as described above.

Cells were then starved in 0.5% FBS medium for 24 h and seeded in RTCA Cim-16

plates (RTCA; xCELLigence Roche, Penzberg, Germany) in serum-free medium.

Cells were seed in 0.5% FBS medium. Full growth medium was used as a

chemoattractant in the lower chamber. Measurements were performed in a time-

resolved manner using the RTCA device (RTCA, xCELLigence Roche, Penzberg,

Germany).

Plasmin production assay

PANC-1 cells were transfected in 6-well plates as described above. 24 h after

transfection, transfected cells were trypsinized and re-seeded on a 24-well plate

(100,000 cells/well) in full growth medium. The next day, the plasmin production was

measured. Cells were washed with 1xPBS and detached from the plate using 200 μl

per well of enzyme-free dissociation solution (Sigma-Aldrich, Saint-Louis, MO, USA).

The reaction was stopped using growth medium. The cells were centrifuged for 4 min

at 2,500 rpm and the cell pellet was washed with 1xPBS. To trigger plasmin (Pm)

6

production from plasminogen (Pg), tPA (Sigma-Aldrich, Saint-Louis, MO, USA) was

added to the cells diluted in 50 μl of PBS and to a final concentration of 1 μg/ml. The

cells were incubated on ice for 30 min. Then, the cells were washed with 1xPBS and

0.4 μM human glu-plasminogen (American Diagnostica, Pfungstadt, Germany) was

added in 100 μl of PBS together with 10 μl of Spectrozyme®PL (American

Diagnostica, Pfungstadt, Germany). The plasmin production was measured after

incubation for 40 min at 37 oC, by absorbance at 405nm, using a TECAN infinite200

plate-reader.

Cancer cell proliferation and cell cycle assays

Cell proliferation and viability was assessed by WST-1 assay (Roche, Penzberg,

Germany) according to the manufacturer’s instructions. 5000 cells/well were seeded

in 100 μl of growth medium into transparent 96-well plates and transfected as

described above. 10µl of WST-1 reagent was added to each well and absorbance at

450nm was measured using a TECAN infinite200 plate-reader (Tecan, Linz, Austria).

For 7-AAD assays, transfected cells were analyzed after growing either

asynchronously in full growth medium or synchronously. In order to succeed cell

cycle synchronization, transfected cells were grown for 48h until reaching 90%

confluency, Then, the cells were washed with 1xPBS and were subsequently

incubated in serum deprivation conditions (medium supplemented with 0.5%FBS) for

48h to cause G0 arrest. Then cells were re-seeded in 6-well plates and cultured in

full growth medium (supplemented with 10% FBS) to trigger cell cycle initiation for

24h. Asynchronous cells were analyzed 72h after transfection, in full growth medium

culturing conditions. Transfected cells were washed with 1xPBS and were trypsinized

at 37 oC and 5% CO2.The cells were fixed and permeabilized using 1 ml of ice cold

90% methanol while vortexing. The cells were incubated on ice for 30 min,

centrifuged at 1500rpm for 5min and resuspended in 500 μl of 7-AAD (Actinomycin

D, 7 Amino) staining solution (Sigma-Aldrich, Saint-Louis, MO, USA) diluted 1:200 in

PBS. Samples were incubated at 4 oC for 90 min and were then subjected to flow

cytometric analysis (FACSCalibur, BD Biosciences, Bedford, MA, USA).

In vitro angiogenesis assays

7

PANC-1 conditioned medium (0.5% FBS) was collected 48h after transfection with

the respective siRNAs and miRNAs.

Cell proliferation of HUVECs was measured with MTT (Sigma-Aldrich, Saint-Louis,

MO, USA) at 72 h after seeding 1x103 cells into 96 well-plates treated with mixture of

EBM-2 and 25% conditioned medium (n=6/group). Absorbance at 490 nm was

detected by spectrometer.

For capillary-like tube formation assay, 1x105 cells were incubated on Matrigel (BD

Biosciences, Bedford, MA, USA) in EBM-2 medium with mixture of EBM-2 and 25%

conditioned medium in 24 well-plates for 6 h (n=6 fields/group). Images were

photographed by light microscopy (Nikon, Danderyd, Sweden). Tube numbers were

analyzed by Adobe Photoshop CS5.

The motility of HUVEC cells responses to the tumor cell secreted factors were

assayed by using the modified Boyden chamber technique. Approximately 6 × 104

cells were added into each of the upper wells of the Boyden chamber (n=6/group),

which contained the mixture of EBM-2 and 25% conditioned medium in the lower

chamber. The cells were incubated over night at 37°C, after which the Boyden

chamber was disassembled and cells attached to the filter were fixed in methanol

and stained with a Giemsa solution (Sigma-Aldrich, Saint-Louis, MO, USA). Cells that

had migrated through the filter were counted using a light microscope (Nikon,

Danderyd, Sweden) and plotted as numbers of migrating cells per optic field.

All assays were performed at least three times and observed similar results.

Mouse Tumor Models

4 week-old SCID mice were used for tumor studies. Approximately 5 × 106 of PANC-

1 tumor cells or PANC10.05 cells were subcutaneously injected into the back along

the mid-dorsal line. Tumor volumes were measured two to three times per week and

were calculated according to the standard formula (volume = length × width × width ×

0.52). PANC-1 formed tumors were transfected in vivo weekly with a mixture of 10 μg

of mirVana miR-206 mimics or miRNA Negative control (Ambion, Austin, TX, USA)

and in vivo-jet PEI (Polyplus, NY, USA) in 0.015% collagenase II (Sigma-Aldrich,

Saint-Louis, MO, USA) solution intratumorally when tumor size reached at 0.2 cm3.

Mice were sacrificed 7 days after the last intratumoral injection of miRNA mimics.

8

Animals were sacrificed using a lethal dose of CO2. All mouse studies were approved

by the Northern Stockholm Experimental Animal Ethical Committee.

Whole-Mount Staining

Immunohistochemical staining of whole-mount tissue samples was performed. Tumor

tissues were fixed with 4% PFA overnight and cut into small pieces. Tissues were

digested at room temperature with 20 mM proteinase K in 10 mM Tris buffer (pH 7.5)

for 5 min, followed by incubation in 100% methanol for 30 min. Tissues were washed

three times with PBS and incubated overnight at 4°C in PBS containing 3% skim milk

in 0.3% Triton X-100, followed by incubation with the indicated combinations of a rat

monoclonal anti-mouse CD31 (1:200; BD-Pharmingen, Bedford, MA, USA) and a

rabbit polyclonal anti-LYVE-1 (1:200; AngioBio, Del Mar, CA, USA). Samples were

thoroughly rinsed, and blood vessel and lymph vessel were detected using

fluorescently labeled secondary antibodies of Alexa Fluor 555-labeled goat anti-rat

(1:200; Invitrogen, Carlsbad, CA, USA), and Cy5-labeled goat anti-rabbit (1:200;

Millipore, Billerica, MA, USA). After washing, tissues were mounted using

Vectashield mounting medium (Vector Laboratories, Burlingame, CA, USA) and were

analyzed by confocal microscopy (Nikon C1 Confocal microscope, Nikon

Corporation, Japan).

Hematoxylin and eosin staining (H&E)

Tumor tissues were fixed with 4% paraformaldehyde overnight, and paraffin-

embedded tissues were cut in sections 5 mm thick, followed by staining with

hematoxylin–eosin (H&E) (Sigma-Aldrich, Saint-Louis, MO, USA). Images were

photographed by light microscope (Nikon, Danderyd, Sweden) and pictures were

overlapped using Adobe Photoshop CS software.

Microarray data

Publically available microarray data on matched miRNA and mRNA profiling of 25

PDAC tumors and 7 non-malignant pancreatic tissues (accession number:

GSE32688), as well as the data on 45 matched pairs of PDAC tumor tissue and their

adjacent healthy counterparts (accession number: GSE28735) were downloaded

9

from GEO database (http://www.ncbi.nlm.nih.gov/geo). Differential expression of

miRNAs between tumor and normal samples was assessed using bioconductor’s

limma R-package. miRNAs with a p-value<0.01 (Benjamini-Hochberg corrected)

were included into a heatmap visualization using euclidean distance with the ward

clustering method.

Statistical analysis

Data are presented as mean ± SD, unless indicated differently. Samples were

analyzed by unpaired two-tailed Student’s t-test, unless mentioned otherwise and p-

values <0.05 were considered as being statistically significant. p-values <0.05, <0.01

and <0.001 are indicated with one, two and three asterisks, respectively.

SUPPLEMENTARY TABLES

Supplementary Table S1. Average Ct and ΔCt values of miR-206 analyzed in normal and PDAC cell lines by TaqMan qRT-PCR run at standard mode.

Cell line Average Ct Average ΔCt Threshold

HPDE 35.60 11.09 0.2

HPNE 35.38 9.93 0.2

PANC10.05 35.95 12.52 0.2

PANC-1 36.42 12.03 0.2

CAPAN-1 35.81 11.61 0.2

MiaPaca-2 36.57 12.15 0.2

CFPAC-1 36.12 11.49 0.2

BXPC-3 35.71 10.76 0.2

Supplementary Table S2. Average Ct and ΔCt values of miR-206 analyzed in PANC-1 and PANC10.05 cell lines before and after miR-206 overexpression by TaqMan qRT-PCR run at standard mode.

Cell line Treatment Average Ct Average ΔCt Threshold

PANC-1 miR-control 34.85 10.36 0.2

10

(30nM)

PANC-1 miR-206 (5nM)

21.21 -3.4 0.2

PANC-1 miR-206 (30nM)

20.24 -4.58 0.2

PANC10.05 miR-control (30nM)

34.95 10.47 0.2

PANC10.05 miR-206 (5nM)

21.41 -3.13 0.2

PANC10.05 miR-206

(30nM)

19.93 -4.43 0.2

PANC-1_xenograft miR-control 30.48 0.07 0.2

PANC-1_xenograft miR-206 23.92 1.20 0.2

PANC10.05_pBABE-empty

- 35.15 10.6 0.2

PANC10.05_pBABE-miR-206

- 24.50 -1.49 0.2

Supplementary Table S3. Average Ct and ΔCt values of all genes analyzed before miR-206 mimic overexpression by TaqMan qRT-PCR run at standard mode.

Cell line Gene Average Ct Average ΔCt Threshold

PANC-1 ANXA2 19.97 -1.66 0.1

PANC-1 KRAS 32.95 11.24 0.1

PANC-1 CCL2 22.24 0.60 0.1

PANC-1 IL8 28.51 7.54 0.1

PANC-1 CXCL1 26.08 4.43 0.1

PANC-1 CSF2 33.84 12.20 0.1

PANC-1 VEGFA 32.32 11.38 0.1

11

PANC-1 VEGFC 24.87 3.22 0.1

PANC-1 MMP9 33.88 11.07 0.1

PANC10.05 ANXA2 18.56 -2.30 0.1

PANC10.05 KRAS 29.53 8.11 0.1

PANC10.05 CCL2 28.70 7.83 0.1

PANC10.05 IL8 29.16 8.30 0.1

PANC10.05 CXCL1 27.68 6.81 0.1

PANC10.05 CSF2 26.55 5.68 0.1

PANC10.05 VEGFA 33.05 12.19 0.1

PANC10.05 VEGFC 26.40 5.53 0.1

PANC10.05 MMP9 34.85 14.28 0.1

Supplementary Table S4. Average Ct and ΔCt values of all genes analyzed after miR-206 mimic overexpression by TaqMan qRT-PCR run at standard mode.

Cell line Gene Average Ct Average ΔCt Threshold

PANC-1 ANXA2 22.21 0.26 0.1

PANC-1 KRAS 33.83 12.01 0.1

PANC-1 CCL2 24.54 2.59 0.1

PANC-1 IL8 29.38 8.56 0.1

PANC-1 CXCL1 28.46 6.52 0.1

PANC-1 CSF2 36.59 14.64 0.1

PANC-1 VEGFA 33.12 11.81 0.1

PANC-1 VEGFC 26.22 4.28 0.1

PANC-1 MMP9 35.49 14.83 0.1

PANC10.05 ANXA2 19.84 -1.25 0.1

PANC10.05 KRAS 31.02 8.90 0.1

PANC10.05 CCL2 29.56 9.72 0.1

PANC10.05 IL8 29.92 8.33 0.1

12

PANC10.05 CXCL1 29.18 7.99 0.1

PANC10.05 CSF2 29.13 7.08 0.1

PANC10.05 VEGFA 34.04 12.57 0.1

PANC10.05 VEGFC 27.86 6.16 0.1

PANC10.05 MMP9 36.27 14.79 0.1

Supplementary Table S5. Average Ct and ΔCt values of KRAS and ANXA2 genes analyzed in PANC-1 and PANC10.05 cell lines by TaqMan qRT-PCR run at standard mode, upon gene knockdowns.

Cell line Treatment Gene Average Ct Average ΔCt Threshold

PANC-1 siControl KRAS 31.76 10.58 0.1

PANC-1 siKRAS#1 KRAS 35.70 13.72 0.1

PANC-1 siKRAS#2 KRAS 35.89 13.89 0.1

PANC-1 siControl ANXA2 18.95 -1.62 0.1

PANC-1 siANXA#1 ANXA2 24.86 3.61 0.1

PANC-1 siANXA#2 ANXA2 24.09 2.65 0.1

PANC10.05 siControl KRAS 30.43 9.36 0.1

PANC10.05 siKRAS#1 KRAS 32.74 11.32 0.1

PANC10.05 siKRAS#2 KRAS 32.79 11.28 0.1

PANC10.05 siControl ANXA2 19.43 -1.89 0.1

PANC10.05 siANXA#1 ANXA2 22.31 1.03 0.1

PANC10.05 siANXA#2 ANXA2 22.35 1.08 0.1

BxPC-3 siControl ANXA2 19.87 -1.09 0.1

BxPC-3 siANXA#1 ANXA2 22.52 1.32 0.1

13

Supplementary Table S6. Sequences of siRNAs used.

Gene Company siRNA no. SequenceANXA2#1 Ambion s1385 GAACUUGCAUCAGCACUGATT ANXA2#2 Dharmacon Custom designed AGACCAAAGGUGUGGAUGAUU KRAS#1 Ambion s7939 CUAUGGUCCUAGUAGGAAATT KRAS#2 Ambion s7940 GCCUUGACGAUACAGCUAATTRELA Ambion s11914 CCCUUUACGUCAUCCCUGATT

Supplementary Table S7. Sequences of PCR primers used for cloning and mutagenesis of ANXA2 and KRAS 3’-UTR.

Name Sequence (5'->3')ANXA2 FW_XhoI CAGTTCTCGAGGAAAGCGCTGCTGTACCTGTGTGGANXA2 RV_NotI GTCAAGCGGCCGCGCGACACTTGGATAGGGGCAACANXA2 FW_mut CAAAGAAATGAAGTCCCCAAGGAGTTGGAANXA2 RV_mut GACTTCACTTCCAACTCCTTGGTTACTTCATTTCKRAS FW_XhoI GCGCGCCTCGAGCAATCCATTAGCGACAGTAGGKRAS RV_NotI GCGCGCGCGGCCGCGCAAACAGTTCAAATTTCATGAKRAS FW_mut CTCCTGGTAACAGTAATACTAAGCATTGTTTTAGTAACCAGKRAS RV_mut CTGGTTACTAAAACAATGCTTAGTATTACTGTTACCAGGAG

Supplementary Table S8. Sequences and Universal Probe Library (UPL) probe numbers for genes quantified by TaqMan qRT-PCR.

Name Sequence (5'->3') UPL ProbeANXA2_L CCTGCTCAGTATGACGCTTCT #23ANXA2_R TCTGGAGCAGATGATCTCAATG #23CCL2_L AGTCTCTGCCGCCCTTCT #40CCL2_R GTGACTGGGGCATTGATTG #40COX2_L CGCTTCAAGGTCAATGTGAA #72COX2_R GGCTCTGCTTGGTCAGGA #72CSF2_L TCTCAGAAATGTTTGACCTCCA #1CSF2_R GCCCTTGAGCTTGGTGAG #1CXCL1_L TCCTGCATCCCCCATAGTTA #52CXCL1_R CTTCAGGAACAGCCACCAGT #52GAPDH_L AGCCACATCGCTCAGACAC #60GAPDH_R GCCCAATACGACCAAATCC #60HPRT-1_L TGACCTTGATTTATTTTGCATACC #73HPRT-1_R CGAGCAAGACGTTCAGTCCT #73

IL8_L AGACAGCAGAGCACACAAGC #72IL8_R ATGGTTCCTTCCGGTGGT #72

KRAS_L TGGACGAATATGATCCAACAAT #88KRAS_R TCCCTCATTGCACTGTACTCC #88MMP9_L GAACCAATCTCACCGACAGG #53MMP9_R GCCACCCGAGTGTAACCATA #53VEGFA_L CGCAAGAAATCCCGGTATAA #1

14

VEGFA_R AAATGCTTTCTCCGCTCTGA #1VEGFC_L TGCCAGCAACACTACCACAG #27VEGFC_R GTGATTATTCCACATGTAATTGGTG #27

Supplementary Figure Legends

Supplementary figure S1. a) Cell viability was assessed in PDAC cell lines 72 hours after transfection with miR-206 or mimic control, using a WST-assay. Experiments were performed with 6 replicates and data are shown as mean±SD (**p<0.01, ***p<0.001; Unpaired two-tailed t-test). b) Cell-cycle distribution of synchronized PANC-1 or PANC10.05 cells, previously transfected with miR-206 mimic or miR-control, was measured by 7-AAD staining and quantified by flow cytometry. Experiments were performed with 3 replicates and data are shown as mean±SD (**p<0.01, ***p<0.001; Unpaired two-tailed t-test). c) Basal NF-κB activity was determined in HEK293FT cells transfected with miR-206 mimic or negative control. 30nM of mimics, 100 ng of 3xKBL vector and 20 ng of pMIR-β-gal were co-transfected in 96-well plate format. 48h later, NF-κB luciferase activity was determined and normalized to the β-galactosidase activity. Experiments were performed in 6 replicates and data are shown as mean ± SD (**p<0.01, ***p<0.001; Unpaired two-tailed t-test).

Supplementary figure S2. a) RelA/p65 total protein levels in PANC-1 cells 48 hours after transfection with siRNAs were determined by Western blot, using total cell lysates. GAPDH was used as loading control. b) Cell viability of PANC-1 cells was determined 72 hours after transfection with siRNAs or treatment with 10 μΜ of NF-κB chemical inhibitors (MG-132, BAY-117082) or vehicle (DMSO), using WST-assay. Experiments were performed in 6 replicates and data are shown as mean±SD. c) Cell cycle analysis of PANC-1 cells previously transfected with siRELA or negative control, was performed using a 7-AAD assay. Cell phase proportions were quantified by flow cytometry. Experiments were performed in 3 replicates and data are shown as mean±SD. d) RTCA migration assay of PANC-1 cells treated with 10 μΜ of MG-132, BAY-117082 or vehicle (DMSO) and of transfected PANC-1 cells with 30nM siRELA or control. Experiments were performed with 4 replicates and data are shown as mean±SD. Data were analyzed by unpaired two-tailed t-test; ***p<0.001.

Supplementary figure S3. mRNA expression of known NF-κB target genes in PANC-1 and PANC10.05 cells was determined after RNAi-induced knockdown of RELA (a) or TNF-α stimulation of non-transfected PANC-1 cells (b) by qPCR. c) mRNA expression of VEGFC in PANC-1 and PANC10.05 cells was assessed after inhibition of non-canonical NF-κB signaling using simultaneously siRNAs against RELB and NFKB2 genes. d) Knockdown efficiency of RELB and NFKB2 genes was determined by qRT-PCR. e) mRNA expression levels of CXCL1, COX2, VEGFC, and IL8 were determined in PANC-1 cells transfected with miR-206 or negative control together with 500ng of pCMV-p65 or empty vector in 6-well plates, as analyzed by qRT-PCR 48h after transfection. f) End-point trans-well migration assay of PANC-1 cells transfected with microRNA mimics or miR-206 along with 500ng of pCMV-p65 or empty vector. Transfected cells were seeded in 0.5% FCS medium and allowed to migrate for 24h using full-growth medium as chemoattractant. The number of

15

migrated cells was quantified by flow cytometry. g) Overexpression of p65 in PANC-1 cells, transfected with 500ng of pCMV-p65 in 6-well plates, was verified in total cell lysates by Western Blot. All experiments were performed in triplicates and data are shown as mean±SD (*p<0.05; **p<0.01; ***p<0.001; Unpaired two-tailed t-test). .

Supplementary figure S4. mRNA expression of ANXA2 (a) and KRAS (b) was analyzed in 45 matched normal-tumor pairs of PDAC patients (GEO accesion no. GSE28735). ***p<0.001; Paired two-tailed t-test. c) The efficacy of miR-206 mimic overexpression in PANC-1 and PANC10.05 was determined by qRT-PCR. Data are shown as mean±SD (***p<0.001; Unpaired two-tailed t-test). d) Cell viability was assessed in PDAC cell lines 72 hours after transfection with different concentrations of miR-206 or mimic control, using a WST-assay. Experiments were performed with 6 replicates and data are shown as mean±SD (***p<0.001; Unpaired two-tailed t-test). e) mRNA expression of known NF-κB target genes in PANC-1 and PANC10.05 cells was determined 48h after transfection with 5nM of miR-206 mimic or negative control. Experiments were performed with 3 replicates and data are shown as mean±SD (**p<0.01, ***p<0.001; Unpaired two-tailed t-test).

Supplementary figure S5. Knockdown efficiency of two individual siRNAs against either KRAS or ANXA2 genes was verified by analyzing total mRNA (a) and protein (b) levels of the respective genes and proteins in PANC-1 cells transfected with either negative control, siANXA2#1, siANXA#2, siKRAS#1 or siKRAS#2. Relative mRNA expression was determined by qRT-PCR and changes at the protein level by Western blot analysis. Experiments were performed with 3 replicates and data are shown as mean±SD (***p<0.001; Unpaired two-tailed t-test). c) Basal NF-κB activity was determined in PANC-1 cells transfected with 2 individual siRNAs against KRAS or non-targeting control. NF-κB luciferase activity was normalized to the β-galactosidase activity. The experiment was performed with 6 replicates and data are shown as mean±SD (***p<0.001; Unpaired two-tailed t-test).

Supplementary figure S6. a) Gross pathology images of excised PANC-1 tumors from SCID mice injected intratumorally with miR-206 mimics showing necrotic and hemorrhaging phenotype compared to the control tumors. b) Histological images of PANC-1 tumors by H&E staining to visualize the tumor necrotic and hemorrhagic area (red-braun). Representative images are shown from an analysis of 2 sections per animal from a minimum of 4 mice per group. Scale bar, 250 μm. c) mRNA expression levels of ANXA2 and KRAS in dissected fresh frozen tumors from PANC-1 xenografts following in vivo transfection of miR-206 mimcs (n=2) or negative control (n=3), as determined by qRT-PCR. Data are shown as mean±SD (*p<0.05, ***p<0.001; Unpaired two-tailed t-test).

Supplementary figure S7. Alterations in the secreted amounts of VEGFA after miR-206 overexpression were determined in PANC-1 and PANC10.05 cell supernatants by FLISA, 48 hours after transfection. Experiments were performed with three replicates and data are shown as mean±SD (**p<0.01, ***p<0.001; Unpaired two-tailed t-test).

16

Supplementary figure S8. a) Total cell lysates of PANC-1 or PANC10.05 were analyzed for KRAS protein levels 48 hours after transfection with miR-206 mimic or control by Western blot. b) mRNA expression levels of KRAS, HRAS and NRAS in PANC-1 and PANC10.05 cells 48h following transfection with miR-206 mimics or negative control. c) Endogenous mRNA expression levels of KRAS, HRAS and NRAS in PANC-1 and PANC10.05 cells are shown as ΔCt values normalized to the average Ct value of HPRT1 and GAPDH. Experiments were performed with three replicates and data are shown as mean±SD (*p<0.05, ***p<0.001; Unpaired two-tailed t-test).

Supplemental references:

1. Demetriades C, Mosialos G (2009) The LMP1 promoter can be transactivated directly by NF-kappaB. Journal of virology 83: 5269-5277.

17