supporting information online -...
TRANSCRIPT
1
Supporting Information Online
Materials and Methods
Gene expression analysis by RT-PCR
RNA was extracted from spleen or blood obtained from mice as indicated in the text, using the RNeasy
Mini Kit (QIAGEN, Germany), and subsequently converted into cDNA by reverse transcriptase
(Promega, Israel). A total volume of 20μl containing 300ng of total RNA template and 10μl of Power
CYBR Green Master Mix (Applied Biosystems, Israel) was prepared. Reactions were run on a 7000 Real-
Time PCR system (Applied Biosystems). The amounts of target genes were determined from the
comparative threshold cycle (CT) method. The expression level of each gene was further quantified
against the house-keeping HPRT gene using the same treatment and expressed as 2–ΔCT (CT of target
gene–CT of HPRT). The primer sequences were as follows: for mouse IL1β forward,
GCAACTGTTCCTGAACTCAACT; reverse, ATCTTTTGGGGTCCGTCAACT; for mouse HPRT forward,
CGGCTTCCTCCTCAGACC; reverse, GGTTCATCATCGCTAATCACG. All experiments were performed in
triplicates.
MMP9 detection by gelatin zymography
Plasma obtained from mice 24 hours after they were treated with vehicle control as well as PTX and/or
Anakinra were evaluated for MMP9 activity as previously described (1). The samples were resolved on
10% acrylamide Ready Gel Zymogram Gels (Bio-rad, Israel) under non-reducing conditions. The gels
were incubated in 2.5% Triton X-100 for 1 hour and transferred to a solution containing 50mM Tris,
0.2M NaCl, 5mM CaCl2 at pH 7.6 for 16 hours at 37°C . Subsequently, gels were stained with 0.5%
Coomassie Blue for one hour and then destained in methanol/acetic acid/H2O (10:10:80). Intensities of
the bands were quantified by densitometry, using TotalLab Quant software (TotalLab, UK).
Scratch wound assay
Scratch wound assay was performed as previously described (1). Briefly, MDA-MB-231 cells were plated
onto a 60-mm dish (Corning, Corning, NY) to create a confluent monolayer. A p200 pipet tip was used to
scrape the cell monolayer in a straight line to create a "scratch". Cell debris was removed by washing the
plate with DMEM. The cells were then incubated in serum free DMEM supplemented with 10% plasma
obtained from non-tumor bearing BALB/c mice 24 hours after they were treated with PTX, Anakinra, the
2
combination of the two drugs, or vehicle control. Baseline images of the scratch were captured using a
phase-contrast setting on a Leica CTR 6000 microscope (Leica Microsystems) and the Leica Application
Suite Version 3 to create a reference point. Images of the cells that migrated into the ‘scratch’ area were
captured 24 hours later at the same reference points. Invaded area was calculated as the difference
between the initial and final wound area as measured by Image J software( (NIH, USA)). The experiment
was repeated 3 times.
Clodronate liposomes (clodrolip).
A mixture of soy phosphatidylcholine (Avanti polar lipids, Alabaster, AL) and cholesterol (Sigma, St.
Louis, MO), was dissolved in chloroform in a 24:11 molar ratio. Chloroform was removed by rotary
evaporation under a gentle stream of nitrogen, resulting in a thin lipid film. The lipid film was then
dispersed in phosphate buffered saline (PBS), pH=7.4, containing 30mg/ml clodronate (Sigma, St. Louis,
MO). Control “sham” liposomes were prepared similarly, by dispersion in PBS alone. The solution was
then extruded twice through 1 µm polycarbonate membranes (Osmonics Inc., Minnetonka, MN) using
LIPEX® (Northern Lipids, Burnaby, Canada) and ultra-centrifuged for 45 min at 150,000g to remove un-
encapsulated clodronate. The pellet was re-suspended in PBS, and clodronate encapsulation was
assessed. For quantification of clodronate encapsulation, liposome sample was diluted 1:10 with 0.1%
Triton X-100 in order to disrupt the phospholipid bilayer. One ml of the diluted sample was mixed with
2.25 ml of 3mM HNO3 and 2.25 ml of 4mM CuSO4 in DDW. The absorbance of the solution was
determined at 240nm in a quartz cuvette. The blank was prepared by treating non-loaded liposomes
similarly. Standard curve was created using clodronate in DDW at concentrations between 0.5 and 10
mM. The final clodronate concentration of the liposome formulation was within the 3 to 3.5 mg/mL
range. Mice were injected intraperitoneally with 0.15 mL of the Sham or Clodronate containing
liposomes (clodrolip) 48 hours before injection of PTX chemotherapy.
Quantitation and visualization of microvessel density and vessel perfusion
Tissue processing and immunohistochemistry were performed as described previously (2). Briefly, tumor
cryosections (10 μm) were used to analyze blood vessel perfusion by the DNA-binding dye Hoechst
33342 (40 mg/kg; Sigma-Aldrich). Vessels were immunostained with endothelial cell specific antibody
(anti-CD31, 1:200 ratio, BD Biosciences), and the number of vessel structures per field were counted and
plotted (5 fields/tumor; n > 20 fields per group). The quantification of perfusion was performed after
intravenous injection of 5mg 150KDa FITC-conjugated dextran by analyzing the number of positive pixels
3
from the total pixels in a micrograph using Photoshop CS2 Version 2 software (Adobe Systems). Tumor
sections were visualized under a Leica CTR 6000 microscope (Leica Microsystems) using Leica
Application Suite Version 3.
Supplemental Figures
Supplemental Figure 1: The impact of plasma from mice treated with paclitaxel, Anakinra or the
combination of the two drugs on tumor cell invasion and motility. (A-B) Eight-to-ten week old BALB/c
mice were treated with paclitaxel (PTX), Anakinra or a combination of the two drugs (n=5 mice/group).
After 24 hours, mice were sacrificed and plasma was collected and either (A) pooled for the evaluation
of IL-1β protein expression by ELISA, or (B) loaded on zymography gel to evaluate MMP9 activity
followed by densitometry analysis. The experiment was repeated three times. (UD- undetectable). (C)
BALB/c mice were treated with vehicle (Control) or PTX (n=4 mice/group) and organs such as lungs,
kidney, brain, liver, and bone marrow were removed at 0, 6, 12, 24, and 48 hours post-treatment for the
assessment of IL-1β expression by ELISA. (D) Relative IL-1β transcript levels were assessed in the spleens
of BALB/c and C57Bl/6 mice treated with the same drug combinations as above using quantitative RT-
PCR. HPRT served as the internal control (n=3 repeats /group). Error bars ±SD. (E) The invasion
properties of LLC and MDA-MB-231 cells were assessed in response to 10% FCS in the presence of
Anakinra in escalating doses as indicated in the figure (left panel), and in the presence of IL-1β-depleted
plasma from control or PTX-treated mice (right panel) (Magnification X100, scale bar = 200 μm). (F)
Plasma was extracted from 8-10 week old BALB/c mice 24 hours after treatment with PTX and/or
Anakinra. The plasma was used in a scratch wound assay performed on MDA-MB- 231 cells, as detailed
in Materials and Methods. Images of the initial and final wound area are presented accompanied by a
graph calculating the differences in the invaded area at the initial and final wound area. Error bars ±SD.
*, p<0.05 ; **, p<0.01 ; ***, p<0.001.
Supplemental Figure 2: The invasion properties of tumor cells expressing IL-1R-I in the presence or
absence of IL-1β. Eight-ten week-old BALB/c mice underwent macrophage depletion using Clodronate-
containing liposomes (clodrolip), as described in Materials and Methods. Sham liposome injection was
set as control (n=5 mice/group). Forty-eight hours later, the mice were treated with vehicle (Control) or
paclitaxel (PTX) chemotherapy. After 24 hours, mice were sacrificed and spleens and plasma were
obtained. (A) Spleens were prepared as single cell suspensions and were then evaluated for macrophage
4
depletion. Representative flow cytometry plots are provided. (B) The effect of the plasma samples on
the invasion properties of MDA-MB-231 cells was assessed by the modified Boyden chamber assay
(magnification X100, scale bar = 200 μm), and a summary of the number of cells per field is provided. (C)
The expression level of IL-1R in LLC and MDA-MB-231 cells were assessed was assessed by flow
cytometry. Histograms of flow cytometry data represent the expression of IL-1R (green line). Cells
incubated with secondary antibody were used as negative control for background staining (black line).
(D) The invasive properties of LLC and MDA-MB-231 cells were evaluated using the modified Boyden
chamber assay, with different concentrations of recombinant IL-1β with or without peritoneal
macrophages cultured in the lower chamber. Quantification of invading cells was performed using
Image-J software (NIH). Error bars ±SD. Not significant (ns); *, p<0.05 ; **, p<0.01 ; ***, p<0.001.
Supplemental Figure 3: Tumor cell invasion and metastasis in IL-1β-deprived mice following treatment
with paclitaxel. (A) An illustration of the experimental plan using lethally irradiated C57Bl/6 mice that
were transplanted with bone marrow cells from either WT or IL-1β-/- donor mice to generate WT BM WT
or WT BM IL-1β-/- mice. After bone marrow reconstitution, the mice were used either for tail vein injection
of LLC-GFP+ cells in an experimental lung metastasis, or for subcutaneous LLC tumors implanted in the
flanks. (B) Confirmation of IL-1β depletion in bone marrow cells obtained from eight-week-old donor
C57Bl/6 WT and C57Bl/6 IL-1β-/- mice (n=6 mice/group). The bone marrow cells were transplanted by
tail vein injection into lethally irradiated C57Bl/6 WT recipients (1000 rad). After bone marrow cell
reconstitution, recipient mice were bled from the orbital sinus to evaluate bone marrow transplantation
efficiency using RT- PCR for the detection of relative IL-1β transcript levels. Analysis of HPRT served as
the internal control. (C) Eight-to-ten week old C57Bl/6 mice were implanted with LLC-GFP+ cells. When
tumors reached a size of 500mm3, the mice were treated with PTX. A day later, tumors were removed
and prepared as single cell suspension. Tumor cells (GFP+) were sorted by FACS, and an equal protein
amount of tumor cell lysates was analyzed for IL-1β expression using ELISA. (D) Chimeric mice
transplanted with either WT IL-1β or IL-1β -/- bone marrow cells (n=4-5 mice/group) were treated with
PTX, 24 hours prior to intravenous injection of LLC cells. A Kaplan Meier survival curve is presented
(p>0.05). (E) In a different experiment, plasma from non-tumor bearing chimeric mice treated with PTX
was used to test LLC and MDA-MB-231 cell invasion as evaluated by the Boyden chamber assay, and
quantifications of the number of cells invaded to the lower compartment are presented in the graph. In
a separate set of experiments, LLC and 4T1 tumor bearing mice (n=7mice/group) were treated with
paclitaxel (PTX), Anakinra or PTX+Anakinra. Anakinra was injected intraperitoneally for 3 sequential days
5
starting one day prior to chemotherapy administration. Control mice received the relevant vehicles. (F)
Tumors were measured regularly using Vernier calipers, and tumor growth (volume) was evaluated.
Tumor growth curves were not statistically different. (G) At end point, lungs were removed for the
evaluation and quantification of metastatic lesions and presented as metastasis number/field.
Representative image of 4T1 metastasis lesions in lung sections (H&E staining)(magnification x50, scale
bar = 500µm) are also presented. Error bars ±SD. **, p<0.01 ; ***, p<0.001.
Supplemental Figure 4: The relative perfusion area of 4T1 tumors, and the phenotype analysis of M1
and M2 macrophages. (A) 4T1 tumor bearing mice (n=7mice/group) were treated with paclitaxel (PTX),
Anakinra or the combination of the two drugs. Anakinra was injected intraperitoneally starting one day
prior to chemotherapy administration following daily administrations to the experiment’s end point in a
long-term experiment setting. When tumors reached 500mm3, the tumors were removed and evaluated
for vessel perfusion (green) using fluorescein isothiocyanate (FITC)-conjugated dextran as described in
Materials and Methods (magnification x100, scale bar=200 μm). (B) Percentage of perfusion was
calculated. “(C) Flow cytometry dot plots of the percentage of gated M1 (F4/80+/CD11c+/CD206-) and
M2 (F4/80+/CD11c-/CD206+)-like macrophages colonizing tumors from mice treated with PTX or
PTX+Anakinra. The number of macrophages was calculated as a percentage per total 106 cells acquired
by flow cytometry. Error bars ±SD* *, p<0.01; * * *, p<0.001.
6
REFERENCES 1. Gingis-Velitski S, Loven D, Benayoun L, Munster M, Bril R, Voloshin T, et al. Host response to short-term, single-agent chemotherapy induces matrix metalloproteinase-9 expression and accelerates metastasis in mice. Cancer Res. 2011;71:6986-96. 2. Shaked Y, Henke E, Roodhart JM, Mancuso P, Langenberg MH, Colleoni M, et al. Rapid chemotherapy-induced acute endothelial progenitor cell mobilization: implications for antiangiogenic drugs as chemosensitizing agents. Cancer cell. 2008;14:263-73.
Supplemental Figure 1
A
D BALB/c C57Bl/6
B
C
Control Anakinra PTXPTX +
Anakinra
0
50000
100000
150000
200000
Control Anakinra PTX PTX+Anakinra
Intensity
(Arbitrary un
its) Pro‐MMP9
Active‐MMP9
0100200300400500600700800
IL‐1β (pg/ml)
Time (Hours)
Lung
0
50
100
150
200
250
300
IL‐β (p
g/ml)
Time (Hours)
0
20
40
60
80
100
IL‐1β (pg/ml)
Time (Hours)
Kidney Brain
0100200300400500600700800900
1000
IL‐β (p
g/ml)
Time (Hours)
0510152025303540
IL‐β (p
g/ml)
Time (Hours)
Liver Bone marrow
Pro‐MMP9Active‐MMP9