the canadian veterinary journal la revue vétérinaire … · cvj / vol 59 / january 2018 a acute...

$: The Canadian Veterinary Journal La Revue vétérinaire … · CVJ / VOL 59 / JANUARY 2018 a Acute surgical intervention for a depressed skull fracture causing a laceration to the$
CVJ / VOL 59 / JANUARY 2018 a

Acute surgical intervention for a depressed skull fracture causing a laceration to the brain parenchyma from a bite wound in a dog

Dietary imbalances in a large breed puppy, leading to compression fractures, vitamin D deficiency, and suspected nutritional secondary hyperparathyroidism

Can Ureaplasma diversum be transmitted from donor to recipient through the embryo? Two case reports outlining U. diversum losses in bovine embryo pregnancies

Hybrid surgical treatment for 2 feline cases of intrahepatic shunt

Babesia odocoilei as a cause of mortality in captive cervids in Canada

A clinical trial investigating the impact of in-feed flavophospholipol on Salmonella shedding and antimicrobial resistance in pigs

Comparison of hand-sewn and oversewn stapled jejunojejunal anastomoses in horses

Brucella canis: An update on research and clinical management

Acute sternal subluxation in an indoor cat

The Canadian Veterinary Journal La Revue vétérinaire canadienneThe Canadian Veterinary Journal La Revue vétérinaire canadienne

January/Janvier 2018 Vol. 59, No. 01 January/Janvier 2018 Volume 59, No. 01

FOR PERSONAL USE ONLY

http://g.adspeed.net/ad.php?do=clk&tokid=eNoljUsOwiAQhu8yexPmVWA4zYCNsmmitG6Md5fq8n9-bmLvYWzg_Qpl2GLASqRyCjTYoXRDReaIqnGaMrvHfj9zJgMK4uyrpxq0tqU51sRVGybOMXL6_czNWJ-vvt0ux9YffxROqjoLR1ehkDOUzxfC-iak

Formulated to promote a URINARY ENVIRONMENT that reduces the risk of struvite and calcium oxalate crystals

A vital part of a pet’s DAILY HEALTH regimen — helps maintain healthy digestion, healthy weight and shiny coats

SUPERIOR CLINICAL EFFICACY in reducing plaque and tartar buildup and the occurrence of gingivitis

VOHC seal is a US registered trademark owned by the Veterinary Oral Health Council. ©2017 Hill’s Pet Nutrition Canada, Inc. ®/™ Trademarks owned by Hill’s Pet Nutrition, Inc.

PRESCRIPTION DIET® t/d®

#1 VET-RECOMMENDED DENTAL PET FOOD FOR COMPLETE CARE

HillsVet.ca

DENTAL DISEASE

Works like a toothbrush,

dental floss and mouthwash

in one

Superior oral health nutrition you can feed every day


To learn more about NC NeuroCareTM and DISHAA, visit www.ProPlanVeterinaryDiets.ca

Purina trademarks are owned by Société des Produits Nestlé S.A.

IMPROVES SIGNSOF COGNITIVE

DYSFUNCTION SYNDROME

You can’t stop a dog from aging—but if your patient is showing signs of Cognitive Dysfunction Syndrome, there’s a new way to help. Introducing Purina® Pro Plan Veterinary Diets® NC NeuroCareTM, enhanced with a unique blend of nutrients and medium chain triglyceride oil to help nutritionally manage dogs with CDS. In a clinical study, dogs with CDS were fed a test diet containing a unique blend of nutrients and MCT oil; after 90 days, dogs significantly improved across all DISHAA categories (a tool for assessing CDS behaviour).

PPPVD NC NeuroCare CDS Print Ad CVJ EN FINAL.indd 1 2017-07-10 1:00 PM


http://g.adspeed.net/ad.php?do=clk&tokid=eNoljcEOwjAMQ_8ld6SkSbOSfU22ttDLJOjGBfHvdHC0_Wy7ib27sYG3DHM3NeAYgoZTkMEOczOKxDxRmsIwZbDHfj9zDgZSs6CmpJnXRRGj1lXQla_oS1T87YxOL89X226XY2uP_xWN1-gsnApSqT7QzxerbCbM

CVJ / VOL 59 / JANUARY 2018 3

SCIENTIFIC RUBRIQUE SCIENTIFIQUE

CASE REPORTS RAPPORTS DE CAS

31 Acute surgical intervention for a depressed skull fracture causing a laceration to the brain parenchyma from a bite wound in a dogNatasha Hodgson, Andrea Walters, Corinne Lawson, Devon Hague, Stephen Joslyn, Maureen McMichael

36 Dietary imbalances in a large breed puppy, leading to compression fractures, vitamin D deficiency, and suspected nutritional secondary hyperparathyroidismMoran Tal, Jacqueline M. Parr, Shawn MacKenzie, Adronie Verbrugghe

43 Can Ureaplasma diversum be transmitted from donor to recipient through the embryo? Two case reports outlining U. diversum losses in bovine embryo pregnanciesM. Bronwyn Crane, Colleen A. Hughes

47 Hybrid surgical treatment for 2 feline cases of intrahepatic shunt Akiko Uemura, Telma Mary Nakata, Ryou Tanaka

ARTICLES

52 Babesia odocoilei as a cause of mortality in captive cervids in CanadaAmélie Mathieu, Adriana R. Pastor, Charlene N. Berkvens, Carolyn Gara-Boivin, Michel Hébert, Alexandre N. Léveillé, John R. Barta, Dale A. Smith

59 A clinical trial investigating the impact of in-feed flavophospholipol on Salmonella shedding and antimicrobial resistance in pigsSaranya Nair, Abdolvahab Farzan, Terri L. O’Sullivan, Robert M. Friendship

67 Comparison of hand-sewn and oversewn stapled jejunojejunal anastomoses in horsesJosé L. Bracamonte, Ian Devick, Keri L. Thomas, Steven Hendrick

REVIEW ARTICLE COMPTE RENDU

74 Brucella canis: An update on research and clinical managementKevin L. Cosford

STUDENT PAPER COMMUNICATION ÉTUDIANTE

82 Acute sternal subluxation in an indoor catLouise Lam

19 QUIZ CORNER TEST ÉCLAIR

Contents Table des matières

JANUARY/JANVIER 2018


INSURANCE PROGRAM

CVMA

866-860-CVMA (2862)www.cvmainsurance.com

Join now and save 10% on yourCommercial Insurance or Employee Benefits!

PROFESSIONAL LIABILITY

EMPLOYEE BENEFITS

COMMERCIAL INSURANCE

INSURANCE TAILORED FOR THE VETERINARY INDUSTRY

Available exclusively to members of the Canadian Veterinary Medical Association, the CVMA Insurance Program offers the most comprehensive and cost-effective insurance protection for you, your practice and your employees.


http://g.adspeed.net/ad.php?do=clk&tokid=eNoljUsOwjAMRO_iPRL21AlxTuOSFLKpBGnZIO5OCsv5PrfJ3t1g5K1Q7haMoFwiIR6CjTbKzVgZiMKchjmN7r7djxxitCSfsbBAgxQtrJerY2aNAWf1oL-fsen1-Wrr7bSv7fFH8aCqY0IqsUZopfz5Aq-AJq8,


Contents Table des matièresFEATURES RUBRIQUES SPÉCIALES

JANUARY/JANVIER 2018

LETTER TO THE EDITOR COURRIER DES LECTURES

9 Food Animal Abuse Not WidespreadDennis Will

PRESIDENT’S MESSAGE LE MOT DE LA PRÉSIDENTE

13 Update on CVMA activities to support responsible and prudent use of antimicrobial drugs/Mise à jour sur les activités de l’ACMV pour appuyer une utilisation responsable et prudente des médicaments antimicrobiensTroye McPherson

17 VETERINARY MEDICAL ETHICS DÉONTOLOGIE VÉTÉRINAIRE

VETERINARY DERMATOLOGY DERMATOLOGIE VÉTÉRINAIRE

85 Developments in small animal veterinary dermatologyKinga Gortel

VETERINARY PRACTICE MANAGEMENT GESTION D’UNE CLINIQUE VÉTÉRINAIRE

89 Managing your purchases? Get out your calculator!/Vous gérez vos achats? Sortez votre calculatrice!Darren Osborne

COMMENTARY COMMENTAIRE

93 Seroconversion does not a reservoir host make: No scientific proof to date that dogs are a reservoir for Zika virusKenneth Kim

BOOK REVIEWS COMPTES RENDUS DE LIVRES

58 Zoonotic Tuberculosis: Mycobacterium bovis and Other Pathogenic Mycobacteria, 3rd editionJudy Hodge

73 Saunders Comprehensive Veterinary Dictionary, 4th editionStella Wheatley

Contributors

“Instructions for authors” are available online (www.canadianveterinarians.net).

Les «Directives à l’intention des auteurs» sont disponibles en ligne (www.veterinairesaucanada.net).

65 Industry News Nouvelles de l’industrie

66, New Products84 Nouveaux produits

92 Index of Advertisers Index des annonceurs

94 Classifieds Petites annonces

NOTICES ANNONCES

21 NEWS NOUVELLESHeather Broughton, Isabelle Vallières

N E W S | N O U V E L L E S


6 CVJ / VOL 59 / JANUARY 2018

The Canadian Veterinary Journal La Revue vétérinaire canadienne

339 rue Booth Street Ottawa, Ontario K1R 7K1 Telephone: (613) 236-1162 Fax: (613) 236-9681 E-mail: [email protected]/Site Web: www.canadianveterinarians.net

www.veterinairesaucanada.net

© Canadian Veterinary Medical Association 2018 L’Association canadienne des médecins vétérinaires 2018

The Canadian Veterinary Journal is indexed or abstracted in:La Revue vétérinaire canadienne est indexée ou ses articles sont résumés dans :AGRICOL, Biological Abstracts, Capsule Report, Current Contents — Agriculture, Derwent Veterinary Drug File, EMBASE/Excerpta Medica, Index Veterinarius, Index Medicus, Quarterly Index, Science Citation Index, Small Animal Practice, Veterinary Bulletin, Veterinary Reference Service, Veterinary Update.

Photo by/Photo de : Shutterstock

Typesetting/Typographie AN Design CommunicationsPrinted by/Imprimé par The Lowe-Martin Group Ottawa, OntarioISSN 0008-5286

Return undeliverable Canadian addresses to: 339 rue Booth Street Ottawa, Ontario K1R 7K1 e-mail: [email protected]

Subscriptions (2018). Annual: Canada $210 + applicable GST or HST; foreign $225 US; institutional $280. Express subscriptions available. Single issue/back issue: $25 each, institutional single issue = $50.00 + GST or HST, if applic able. (All prices subject to change.) Missing issues will be replaced if the Subscriptions Office is notified within 6 months (for requests within Canada) and 1 year (for requests from abroad) of the issue date. The pub lisher expects to supply missing issues only when losses have been sustained in transit and when the reserve stock will permit. Telephone (613-236-1162) or (1-800-567-2862) and fax (613-236-9681) orders accepted with a valid Visa or MasterCard number. Please advise the publisher of address changes promptly.Abonnements (2018). Annuel : Canada 210 $ + TPS ou TVH en vigueur; pays étranger 225 $ É-U; prix d’une institution 280 $. Abonnement express disponible. Anciens numéros (chacun) : 25 $, ancien numéro d’institution 50 $ + TPS ou TVH en vigueur. Les prix sont sujets à changement sans préavis. Les numéros qui ne sont pas reçus seront remplacés si l’éditeur en est informée dans les 6 mois (pour les demandes venant du Canada) et 1 an (pour les demandes venant de l’étranger) suivant la date de parution. L’éditeur s’engage à remplacer les numéros manquants seule ment lorsque les pertes ont été subies en transit et lorsque ses réserves le permettent. On peut payer son abonnement par téléphone (613-236-1162) ou (1-800-567-2862), par télé copieur (613-236-9681) ou par carte de crédit (Visa ou MasterCard). Veuillez aviser le bureau de l’éditeur de tout changement d’adresse.

Editorial policy: All published articles including editorials and letters reflect the opinions of the authors and do not necessarily reflect the opinion of the publisher.Publication of an advertisement does not necessarily imply that the publisher agrees with or supports the claims therein.Politique de la Rédaction : Tous les articles publiés, y compris les éditoriaux et les lettres, représentent l’opinion de l’auteur et non pas nécessairement la position de l’éditeur.La publication d’une annonce ne signifie pas nécessairement que l’éditeur est d’accord avec son contenu ou qu’il l’appuie.

Editor-in-Chief/Rédacteur en chef Carlton Gyles, Guelph, OntarioAssociate Editors/Rédacteurs associés Bruce Grahn, Saskatoon, Saskatchewan Wayne McDonell, Guelph, OntarioFeature Editors/Rédacteurs des chroniques Jangi Bajwa, Burnaby, British ColumbiaBruce Grahn, Saskatoon, SaskatchewanMyrna Milani, Charlestown, New HampshireDebbie Stoewen, Ayr, OntarioTim Blackwell, Fergus, OntarioAssistant Editors/Rédacteurs adjoints Robert Friendship, Guelph, Ontario Greg Harasen, Regina, Saskatchewan Jacob Thundathil, Calgary, Alberta Ron Johnson, Guelph, Ontario Richard Kennedy, Pincher Creek, Alberta Shawn McKenna, Charlottetown, P.E.I. Luis Gaitero, Guelph, OntarioManaging Editor/Directrice de la rédaction Heather Broughton, Ottawa, OntarioAssistant Managing Editor/Directrice adjointe de la rédaction Stella Wheatley, Ottawa, OntarioEditorial Coordinator/Coordonnatrice de la rédaction Kelly Gray-Sabourin, Ottawa, OntarioAdvertising Manager/Gérante de la publicité Laima Laffitte, Wendover, Ontario

Published monthly by/ Publication mensuelle deCanadian Veterinary Medical Association

The editors and staff of The Canadian Veterinary Journal are pleased to have as readers student veterinarians at Canadian veterinary colleges! The production and distribution of student

subscriptions is made possible through the generous sponsorship of Scotiabank

Les rédacteurs et le personnel de La Revue vétérinaire canadienne sont heureux de compter les étudiants en médecine vétérinaire des collèges vétérinaires au Canada au nombre de leurs lecteurs. La production et

la distribution des abonnements des étudiants ont été rendues possible grâce au généreux soutien de Banque Scotia

STUDENT SUBSCRIPTIONS/ABONNEMENTS DES ÉTUDIANTS


ADVANCING YOUR ISSUES, YOUR CONCERNS AND YOUR PROFESSIONAL INTERESTS.

INFLUENCE

As a CVMA member you benefit from…

• Engagement with Government and key stakeholders to influence policy decisions

• International relations to provide the Canadian veterinary perspective• Media and public relations to provide balanced and trustworthy information

and to promote veterinary professionals• Position statements on animal welfare and national veterinary issues• Codes of practice for Canadian kennel and cattery operations,

and for the care and handling of farm animals• Member consultations and online discussions on key veterinary issues• Pan-Canadian Framework for Professional Standards in Veterinary

Oversight of Antimicrobial Use.

KNOWLEDGEKEEPING YOU CURRENT ON VETERINARY SCIENCE AND PRACTICE, RESEARCH, INNOVATION AND TRENDS TO ENHANCE YOUR LIFELONG LEARNING.


• The Canadian Veterinary Journal• Canadian Journal of Veterinary Research• Clinician’s Brief™ (free global digital edition)• CVMA national convention• CVMA Veterinary Summit• CVMA National Issues Forum• CVMA Emerging Leaders Program• CVMA Canadian Veterinary Reserve• Member e-newsletter ‘Online from 339’ • CVMA online continuing education portal• VetFolio® online educational resources (subscription discount)

SUPPORTING YOU THROUGH EVERY STAGE OF YOUR CAREER WITH ACCESS TO EXCLUSIVE PRACTICE TOOLS AND RESOURCES.

RESOURCES


• NEW! CVMA PetcardTM Program - financing options for your clients• NEW! MonerisTM preferred payment processing rates for CVMA members• MyVetStore.ca™ - CVMA web store solution for clinics• Practice owner’s economic survey• Individual practice diagnostic and valuation report• Provincial suggested fee guide• Associate compensation and benefits report• Compensation report for non-DVM staff• Compensation report for DVMs outside private practice• Practice management articles and resources• CVMA group insurance program• CVMA mentoring program• VetLaw Online™ legal advice column• CVMA Green Veterinary Practice and self-audit tool• Antimicrobial SmartVet mobile app• Veterinarian health and wellness resources• Early career DVM web resource hub• Guidelines for the successful employment of new veterinary graduates• Sedative, anaesthetic and pain management protocols posters• Guidelines for the legitimate use of compounded drugs in veterinary

practice• Antimicrobial prudent use guidelines for beef cattle, dairy cattle, poultry

and swine• Therapeutic decision cascade poster• Animal abuse resources for practitioners faced with this issue• Preventive healthcare, nutritional assessment and client education tools

and resources• Animal health week annual public awareness campaign

SAVINGSPUTTING MONEY IN YOUR POCKET AND DELIVERING MORE VALUE TO INCREASE YOUR PROFITABILITY.


• NEW! Mont Tremblant SkiMax (discount on lift tickets)• NEW! GoodLife Fitness Corporate Discount• NEW! HRdownloads™ discounts• Hotel discounts worldwide• National and Enterprise Rent-a-Car discounts• The Personal Insurance home and auto group savings• Scotiabank® business banking and lending solutions• The CVJ classified ads discount• Staples Advantage™ business products• Adtel® telephone hold service and digital signage• Petro-Canada SuperPass™ fuel/diesel/car wash discount• WSAVA World Congress (registration discount)• WVA Congress (registration discount)• Plumb’s Veterinary Drugs™ (subscription discount)

Your CVMA membership means MORE...

CANADIAN VETERINARY MEDICAL ASSOCIATION339 Booth Street, Ottawa (Ontario) K1R 7K1T • (800) 567-2862 • (613) 236-1162F • (613) [email protected]

For information about the many benefits and privileges of membership.

01/2018


800.822.2947 www.abaxis.com/vs2

Abaxis VetScan products are intended for veterinary use only. Abaxis and VetScan are registered trademarks of Abaxis, Inc. © Abaxis 2018.

Inspired by you. Innovated by Abaxis.

We see the same patient.

Innovated by Abaxis.

The Abaxis Chemistry Analyzer is heavily relied on and highly trusted in human medicine. Doesn’t your pet deserve the same standard of care?

The VetScan VS2.Because the health of your patient is just as important as yours.

Abaxis_CVJ _0118.indd 1 12/6/17 4:06 PM


http://g.adspeed.net/ad.php?do=clk&tokid=eNoljTsOwjAMhu_iHQnHdkyd08RtAlkqQVoW1LuTwvg_v2xsn25kkNsCqVs0IAlBwinQYIPUDAWJFJllmDy6-_Y4cwoG7uy16E1Fr-Ilai4hZpziPDP5or-fsenl9W7r_bKv7flH4aBKJiYlKTzVCun4AtrpXCd6


Letter to the Editor Courrier des lecteurs

Food Animal Abuse Not WidespreadDear editor,I would like to thank Dr. Evenson for his letter to the editor in the October issue of The Canadian Veterinary Journal (Can Vet J 2017;58:1017) concerning food animal abuse, as it is always an important issue. However, the letter leaves the incorrect impression that cruelty and abuse to food animals in Canada is widespread, is mainly associated with large commercial opera-tions, and could only be effectively addressed by 24-hour video monitoring. This is not the case.

Most food animals in Canada are treated well, as good welfare is highly correlated with good production and most stock people do what they do because they like caring for animals. Excellent examples of animal welfare can be associated with all sizes of production units, as can egregious examples of animal abuse.

Problem areas which need to be addressed include end-of-production and transportation. However, the response should be targeted and science-based. There are other methods of resolution that do not include 24-hour video monitoring of all

production units. For example, third party welfare auditing is becoming more common, especially in large systems, and can identify the units and production methods in which animal welfare is being carried out well and those in which improve-ments are necessary.

Temple Grandin often states that industry (and therefore society) only improves those aspects of animal welfare, includ-ing handling and slaughter, when they are measured. I would suggest that we take steps to celebrate our successes in improved animal welfare, such as the updated Codes of Practice and on-farm welfare assessment programs that are developed to adhere to it, regardless of the production type and size, in addi-tion to continuing to identify those areas in which improvement is required.

Submitted by Dr. Dennis Will, on behalf of the SVMA Animal Welfare Committee, Saskatoon, Saskatchewan.

Constructive and professional comments made in the spirit of intellectual debate are welcomed by the Editor. Writers are expected to be respectful of others and to ensure that letters are considerate and courteous. The Editor reserves the right to remove comments deemed to be inflammatory or disrespectful.

Veterinary Oversight of Antimicrobial Use in Canada:Health Canada’s Rules are Changing… We Want You to Be Prepared!

Visit canadianveterinarians.net for more information


“The Best CE Value in Canada”April 20 – 22, 2018

Halifax Marriott Harbourfront Hotel

Halifax, NS

www.apvc.ca

Join more than 850 other delegates, exhibiting companies and a world class list of speakers

in an environment of true maritime hospitality

Veterinarians

Dr. Richard Ford

• Vaccines & Vaccinations: Updates and Insights

• Vaccine Adverse Reactions and Injury: What are

We Seeing?

• Antibody Titres: Who, What, Where, When, Why?

• Feline Viral Upper Respiratory Disease…Why it

Persists!

• Infectious Disease Update: What’s New and

What's Hot

• Cutting Your Losses: Amputating Digits, Tail and

Limbs

• An Open and Shut Case: Gastrotomy, Enterotomy

and Anastomosis

• When Bad Things Happen to Good Dogs:

Organ Torsion including GDV

• A Chance to Cut is a Chance to Cure: Splenectomy,

Liver Lobectomy, Gall Bladder Removal

• Salivary Mucoceles, Aural Hematoma and

Intraabdominal Biopsies

• The Good, The Bad and The Ugly. Sarcomas and

Mast Cell Tumors: Do’s and Don’ts

• Didn’t This Used to be Simple? The Spay/Neuter

Controversy

• Grab Bag of Surgical Tips and Tricks

• The Itchy Dog: Infection/Parasites/Work Up

• The Itchy Dog: Allergies

• Ears Looking At You! Diagnosis and Treatment of

Otitis

• So I’ve Tried X, Y & Z and Nothings Working…What

Now?

Dr. John Berg

Dr. Charlie Pye

APVC @APVC18 and #APVC18

Dr. Jennifer Devey

• The Vomiting Cat Emergency: From Simple to Life

Threatening

• Critical Nutrition: Keeping them Going After You’ve

Saved Their Lives

• He Can’t Breathe! He Can’t Pee! He Ate What!

Respiratory, Toxicological and Urinary Emergencies

• Dealing with that Darned Diabetic Cat

• What You Should Know about Hyperthyroidism

• Endocrine Update. There’s More to Cats than

Thyroids and Diabetes

• Healthy Aging in Cats: What’s Normal and What

Isn’t?

• Complex Disease Management. Managing the Cat

with Multiple Disease

• Wounds Part I: Triage, Assessment and Initial

Treatment

• Wounds Part II: Debridement and Open Wound

Management

• Wounds Part III: Wound Closure, Reconstruction and

Infection Control

• A Master Class in Selected Techniques Designed to

Improve Your Diagnostic and Treatment Success in

Feline Medicine

• Practice What Was Preached in Dermatology. Sample

Collection, Cytology & Treatment

Dr. Margie Scherk

Louise O'Dwyer

Dr. Margie Scherk

Dr. Charlie Pye

Wet Lab (Veterinarians):

For further information contact:

Dr. Courtney Sherlock, • APVC Committee on Arrangements

PO Box 310, Eastern Passage, NS, B3G 1M6

Ph: 902-483-2034 • Email: [email protected]

Chair


http://g.adspeed.net/ad.php?do=clk&tokid=eNoljU0SwiAMhe-SvTOSBw2kpyFIlU1nlNaN07tLdfl-v6xeP12hlNuN5q6TEgJzwCmc0kZzUxccIM6nNEw_uvv2OHOwko-SUqnAwhVssmQRWKkx-GIx8e9nbHp9vdt6v-xre_5RblBDhodMJlezSvPxBcgKXCdW

A COMPLETE PACKAGE FOR THE ENTIRE

VETERINARY TEAM

FeesVeterinarians Full $425 (3 days)

Technicians & Vet’s Assistants Full $225 (3 days)

Managers Full $325 (3 days)

Support Staff Full $175 (2 days)

Business Management

Support Staff

At the end of 3 days, managers and owners will

have comprehensive documents that can be

immediately used and implemented for annual

budgeting, marketing and strategic operational

planning.

• Strategic Operational Planning Workshop

• Marketing Workshop

• Budgeting & Financial Workshop

• Civil Wars: Front vs. Back

• Creating & Implementing a Training Program

• Attitude is Everything!

• Connect with Us – Centering the Client

Experience Around Embracing Technology

• Phone Calls Gone Bad

• Implementing Triage & CPR, the First Responders

• Stressful Conversations – How Can We Ease the

Pain?

• Get Cat-A-Tude! Practice Tips and Tricks to

Become More Cat Friendly Part I & II

• Optimizing the Life of an Indoor Cat

Brian Conrad

Melanie Taljjard

Terry O'Neil

Megan Brashear

Brian Conrad

Megan Brashear

Dr. Margie Scherk

(Mgr./Vet)

(Mgr./Team)

(Support Staff/Team)

Animal Health Technicians

Dr. Jennifer Devey

Megan Brashear

Dr. Richard Ford

Louise O'Dwyer

Dr. Charlie Pye

• CPCR: Preventing Arrests & Current Techniques

• Hitting the Mark: Vascular Access and Feeding

Tubes

• Defeating Death: The Critical First 10 Minutes.

Recognizing the Patient in Trouble

• Understanding Fluid Therapy & the Highs and Lows

of Electrolytes

• 2+2=? CRI and Math

• Endocrine Nightmares, Otherwise Known as

Diabetes Mellitus and Addisons Disease

• Somebody Call 911: Top 5 Emergencies We See

• Now That is a Hot Dog: Canine Heatstroke

• Critical Thinking – Using our Grey Matter

• Implementing Triage & CPR, the First Responders

• Stressful Conversations – How Can We Ease the

Pain?

• Zoonosis…How Real is the Threat?

• Small Animal Vaccines and Vaccinations – Changes

and Controversies!

• Anaesthesia and Monitoring of the Respiratory

Patient

• The Golden Years – Anaesthesia and Nursing Care

of Geriatrics

• Respiratory Emergencies – Let’s Nurse these

Patients Back to Health

• Anaesthesia of the Cardiac Patient Including

Handling the Hemodynamically Unstable Cases

• Road Traffic Accident, How We Can Help

• Nutritional Support of the Critical Patient – What is

On the Menu?

• Support your DVM! Derm Diagnostics

• Tips and Tricks for Successful Client Compliance


http://g.adspeed.net/ad.php?do=clk&tokid=eNoljU0SwiAMhe-SvTOSBw2kpyFIlU1nlNaN07tLdfl-v6xeP12hlNuN5q6TEgJzwCmc0kZzUxccIM6nNEw_uvv2OHOwko-SUqnAwhVssmQRWKkx-GIx8e9nbHp9vdt6v-xre_5RblBDhodMJlezSvPxBcgKXCdW

labs

onsite restaurants

hotels connecting the Convention Centre floors

speakers from Canada, US and International

In collaboration with:In partnership with:

Ignite Your Passion.Travel to beautiful Vancouver, B.C. to participate in the 2018 CVMA Convention. Join peers

and colleagues and be exhilarated by west coast charm and hospitality. Attend CVMA Signature events, stellar CE sessions and more!

canadianveterinarians.net

Registration Opens February 21, 2008FOR PERSONAL USE ONLY


President’s Message Le mot de la présidente

D’ abord, permettez-moi de souhaiter une bonne et heureuse année 2018 en santé à tous et à toutes! J’ai pensé que

je résumerais les lignes directrices sur les antimicrobiens et les échéanciers et que je vous présenterais une mise à jour. Comme beaucoup d’entre vous le savent déjà, l’ACMV a investi des ressources dans ce domaine pendant la majeure partie des vingt dernières années. Nous avons travaillé en étroite collaboration avec beaucoup d’intervenants, dont le gouvernement, les groupes de producteurs, le CCRV (Conseil canadien des registraires vétérinaires), l’ICSA (Institut canadien de la santé animale). En collaboration avec le CCRV, l’ACMV a élaboré un cadre de travail intitulé «Surveillance vétérinaire de l’utilisation des antimicrobiens — Normes professionnelles pour les médecins vétérinaires». Ce cadre de travail fournit un modèle de normes professionnelles à être utilisées par les organismes de réglementation vétérinaire des provinces et des territoires lors de l’élaboration de leurs propres règlements et lignes directrices. Le Groupe consultatif sur la gouvernance des produits pharmaceutiques vétérinaires (GCGPPV) a joué un rôle crucial dans l’élaboration de ce cadre de travail. Vous pouvez consulter ce document sur le site Web de l’ACMV (www.veterinairesaucanada.net) sous Politiques et défense des intérêts.

Enfin, il y a une lueur au bout du tunnel et la mise en œuvre prévue des modifications réglementaires et politiques approche à grands pas. Elle inclura notamment les éléments suivants :• Les allégations liées à la stimulation de la croissance ne seront

plus permises sur les étiquettes des produits vétérinaires contenant des antimicrobiens importants en médecine humaine dès le 1er décembre 2018. Un logo volontaire sera inclus sur les étiquettes afin de rappeler aux utilisateurs l’importance d’une utilisation responsable.

• À compter du 1er décembre 2018, une prescription vétérinaire sera requise pour l’achat des antimicrobiens dans les catégories 1 à 3 qui sont importantes en médecine humaine. Ces médicaments cesseront d’être vendus chez les détaillants

F irst of all, let me wish everyone a happy and healthy 2018! I thought I would summarize and update you on the

Antimicrobial Guidelines and timelines. As many of you are already aware, the CVMA has invested resources in this area for the better part of 20 years. We have been working in close asso-ciation with many stakeholders such as government, producer groups, CCVR (Canadian Council of Veterinary Registrars), and CAHI (Canadian Animal Health Institute) to name a few. In collaboration with the CCVR, the CVMA developed a framework entitled “Veterinary Oversight of Antimicrobial Use — Professional Standards for Veterinarians.” This frame-work provides a template of professional standards to be used by provincial and territorial veterinary regulatory bodies when developing their own regulations, guidelines, or by-laws. The CVMA’s Veterinary Pharmaceutical Stewardship Advisory Group (VPSAG) was instrumental in developing this frame-work. You can access this document on the CVMA website (www.canadianveterinarians.net) under Policy and Advocacy.

Finally, there is light at the end of the tunnel and the sched-uled implementation of regulatory and policy changes is just around the corner including:• Growth promotion claims will no longer be allowed on labels

of veterinary products containing antimicrobials that are important to human medicine as of December 1, 2018. A voluntary logo will be included on labels to remind users of the importance of responsible use.

• By December 1, 2018, a veterinary prescription will be required for the purchase of antimicrobials in categories 1–3 that are important to human medicine. These drugs will cease to be available for purchase at livestock outlets, co-operatives, and anywhere else over-the-counter animal medications are sold. Producers will need a veterinary prescription to pur-chase these products through a veterinarian or pharmacist, which also means they will require a valid veterinary client-patient relationship (VCPR) (check with your individual

Update on CVMA activities to support responsible and prudent use of antimicrobial drugs

Mise à jour sur les activités de l’ACMV pour appuyer une utilisation responsable et prudente des médicaments antimicrobiens

Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.

L’usage du présent article se limite à un seul exemplaire pour étude personnelle. Les personnes intéressées à se procurer des réimpressions devraient communiquer avec le bureau de l’ACMV ([email protected]) pour obtenir des exemplaires additionnels ou la permission d’utiliser cet article ailleurs.



LE

MO

T D

E L

A P

RÉ

SID

EN

TE

d’aliments du bétail, dans les coopératives et partout ailleurs où des médicaments en vente libre sont disponibles. Les producteurs auront besoin d’une prescription vétérinaire pour acheter ces produits par l’entremise d’un vétérinaire ou d’un pharmacien, ce qui signifie aussi qu’ils devront avoir en place une relation vétérinaire-client-patient (RVCP) (consultez votre association de médecins vétérinaires afin de vérifier ce qui est nécessaire pour une RVCP valide). Les antimicrobiens mélangés aux aliments seront toujours disponibles dans les usines d’aliments pour animaux et exigeront une prescription.

• À compter du 13 novembre 2017, les antimicrobiens dans les catégories 1 à 3 ne pourront plus être importés pour usage personnel.

• Il y aura une nouvelle façon pour les compagnies d’importer et de vendre des produits de santé animale pour les animaux de compagnie et les animaux destinés à l’alimentation en tant qu’outils additionnels de gestion de la santé.

• Il y aura une déclaration obligatoire des volumes de vente pour les fabricants et les importateurs.Dans le cadre des activités d’antibiogouvernance, l’ACMV

travaille au renouvellement de ses Lignes directrices de 2008 sur l’administration judicieuse des antimicrobiens pour les bovins laitiers, les bovins de boucherie, la volaille, les porcs et élabore de nouvelles lignes directrices pour les petits ruminants et les animaux de compagnie. (L’ACMV avait déjà développé une appli IntelliVet pour les petits animaux en lien avec le traitement des infections des voies urinaires). La date limite pour ces projets est le 31 mars 2018.

Durant 2017, avec le soutien de l’Agence canadienne d’inspection des aliments (ACIA), l’ACMV a entamé le travail dans le cadre d’une initiative de surveillance de l’utilisation des antimicrobiens au niveau de l’interface avec la prescription vétérinaire. On propose que ce projet se poursuive en 2018. Des données de surveillance fiables seront importantes en vue de favoriser une antibiogouvernance responsable et de maintenir l’ouverture des marchés. L’OIE (Organisation mondiale de la santé animale) travaille à la collecte et à la dissémination internationales des données disponibles dans les pays. Au nom du GCGPPV, des lignes directrices préliminaires pour les soins vétérinaires des abeilles ont aussi été créées.

La communication est essentielle et, à l’heure actuelle, l’ACMV travaille avec la Direction des médicaments vétérinaires (DMV) pour contribuer à l’élaboration d’une communication cohérente concernant la transition, la participation des intervenants et l’atteinte des principaux échéanciers relativement à la mise en œuvre et aux impacts de l’ajout, par Santé Canada, de tous les antimicrobiens importants sur le plan médical à la Liste des drogues sur ordonnance. Dans le cadre de cette stratégie de communication, la DMV a consenti à développer une «page d’atterrissage» qui permettra la diffusion des derniers échéanciers et de messages uniformes (https://www.canada.ca/fr/sante-publique/services/resistance-aux-antibiotiques-antimicrobiens/animaux/actes/utilisation-responsable-antimicrobiens.html). Le 1er novembre 2017, l’ICSA (Institut canadien de la santé animale), l’association commerciale représentant les fabricants et les distributeurs de produits de santé animale au Canada, a envoyé un message afin de rappeler aux producteurs, aux

veterinary association with respect to what the classification of a valid VCPR entails). Antimicrobials mixed in feed will still be available at feed mills and will require a prescription.

• As of November 13, 2017 the antimicrobials in categories 1–3 can no longer be imported for own use importation (OUI).

• There will be a new pathway for companies to import and sell veterinary health products for companion and food-producing animals as additional health management tools.

• There will be mandatory reporting of sales volume from manufacturers and importers.As part of antimicrobial stewardship, the CVMA is renewing

its 2008 Antimicrobial Prudent Use Guidelines (PUGS) for dairy, beef, poultry, swine, and developing guidelines for small ruminants and companion animals. (The CVMA previously developed a small animal smart app for urinary tract infection). The deadline for these is March 31, 2018.

With the support of the Canadian Food Inspection Agency (CFIA) during 2017, the CVMA began work on development of an antimicrobial use (AMU) surveillance initiative at the veterinary prescription interface. It is proposed that this work continue in 2018. Reliable surveillance data will be important to foster responsible antimicrobial stewardship and keep mar-kets open. The OIE (World Organisation for Animal Health) is engaging in collecting and disseminating available country data internationally. On behalf of the VPSAG, preliminary guidelines for veterinary care of bees have also been developed.

Communication is key, and currently the CVMA is working with the Veterinary Drugs Directorate (VDD) to help develop consistent communication regarding the transition, stakeholder engagement, and execution of key timelines around the imple-mentation and impacts of Health Canada’s moving all medically important antimicrobials to the Prescription Drug List. As part of this communications strategy, the VDD agreed to develop a web “landing page” allowing for up-to-date timelines and consistent messaging (www.canada.ca/en/public-health/services/antibiotic-antimicrobial-resistance/animals/actions/responsible-use-antimicrobials.html). On November 1, 2017, CAHI, which is the trade association representing the manufacturers and distributers of animal health products in Canada, sent a state-ment reminding farmers, feed mills, and veterinarians that as of December 1, 2018 a veterinary prescription will be needed to use medically important antimicrobials (antibiotics). For more on CAHI and the changes regarding veterinary antimicrobial use please see the website (www.cahi-icsa.ca). The CVMA will keep members updated on information according to timelines put in place. The website (www.canadianveterinarians.net), e-mails and social media will be used for updates.

In closing, “the development of antimicrobials has contrib-uted enormously to improving the health and welfare of people and animals throughout the world. However, the increase in antimicrobial resistance and the spread of resistant bacteria poses a global threat to both human and animal health. A ‘One Health’ approach through cooperation with stakeholders is vitally important to be able to best address this growing problem. Continuous availability of a range of effective antimicrobials is vital, and preservation of antimicrobial efficacy through respon-sible and prudent use of antimicrobials is in the best interest of



PR

ES

IDE

NT

’S M

ES

SA

GE

both animal health and welfare, food safety, human health and the sustainability of our planet.” This statement is taken from the joint statement on Continuous Use of Antimicrobial Use and Antimicrobial Resistance (American Veterinary Medical

Association/Canadian Veterinary Medical Association and the Federation of Veterinarians of Europe 2011). ■

Troye McPherson

usines d’aliments du bétail et aux médecins vétérinaires que, à compter du 1er décembre 2018, une prescription vétérinaire sera requise pour l’utilisation des antimicrobiens importants sur le plan médical (antibiotiques). Pour en savoir davantage sur l’ICSA et les modifications liées à l’utilisation des antimicrobiens vétérinaires, veuillez consulter le site Web (www.cahi-icsa.ca). L’ACMV tiendra les membres au courant en leur communiquant des renseignements à jour conformément aux échéanciers établis. Le site Web (www.veterinairesaucanada.net), des courriels et les médias sociaux seront mis à contribution pour communiquer les mises à jour.

En terminant, «le développement des antimicrobiens a grandement contribué à l’amélioration de la santé et du bien-être des humains et des animaux dans le monde. Cependant, la recrudescence de l’antibiorésistance et de la propagation des bactéries résistantes présente une menace mondiale pour

la santé des humains et des animaux. L’approche «Une seule santé», dans le cadre d’une collaboration avec les intervenants, est cruciale afin de pouvoir aborder ce problème grandissant de la meilleure façon possible. La disponibilité continue d’un éventail d’antimicrobiens efficaces est cruciale et la préservation de l’efficacité des antimicrobiens, par une utilisation responsable et prudente des antimicrobiens, est dans l’intérêt supérieur de la santé et du bien-être des animaux, de la salubrité des aliments, de la santé humaine et de la viabilité de notre planète». Cette citation est tirée de l’énoncé conjoint sur l’utilisation responsable et judicieuse des antimicrobiens (American Veterinary Medical Association, Association canadienne des médecins vétérinaires et Fédération des vétérinaires d’Europe 2011). ■

Troye McPherson

Critical Care Animal Testing Made SimpleIntroducing a new generation veterinary critical care analyser that combines the revolutionary micro-electronics of the consumer world with Nova Biomedical’s innovative MicroSensor Card™ for a simple, small, fast and less expensive analyser.

22 Test Stat MenupH PCO2 PO2 Na K Cl iCa iMg TCO2 Glu Lac Urea Creat Hct Hb SO2% O2Hb COHb MetHb HHb HbF tBil

New tests added for urea, creatinine, ionized magnesium

New disposable, maintenance-free co-oximeter technology

Maintenance-free measurement sensors

Automated liquid quality control

Bidirectional connectivity with remote review and remote control

Comprehensive cybersecurity protectionCompact SizeHeight: 18.2 in (45.7 cm)Width: 14.2 in (35.6 cm)Depth: 15.5 in (39.1 cm) novabiomedical.com

For more information contact

NOVA BIOMEDICAL CANADA, LTD17 - 2900 Argentia Road, Mississauga, Ontario L5N 7X9 CanadaTEL: (905) 567-7700 (800) 263-5999 Fax: (905) 567-5496

e-mail: [email protected]


http://g.adspeed.net/ad.php?do=clk&tokid=eNoljTsOwyAMhu_ivRLGGIw5DRGQsERqSbpUvXtIO_7PL6vTz1BSyL1AGuoViK31dAtUOCB1RUaigNGGabrZPY_tzskqCLKpuTVZpBh20mplH6NHg2w9yu9nbkZ9vfu-Ps69P_8onFTO5ChikFpogfS9XDCr2yaU

Education…Innovation…Inspiration…

C E L E B R AT I O N !Be part of the celebration – nine decades of veterinary education.

Check out what’s happening:

• H I L L’ S C O M E D Y K I C KO F F: K E V I N N E A LO N• M E R C K ’ S C O N C E RT: D A R I U S R U C K E R

• F R E E P R O F E S S I O N A L P O RT R A I T S• C E F O R Y O U R E N T I R E P R A C T I C E , I N C LU D I N G A N E W T R A C K F O R R E C E N T G R A D U AT E S

• 9 0 W AY S T O W I N : M O R E C O M P E T I T I O N S A N D D R A W I N G S

Plus: lower-cost food options, special 90th Anniversary celebration, new Veterinary Technician Lounge, Saturday registration and more!

LEARN MORE AT WVC.ORG/CONFERENCE


http://g.adspeed.net/ad.php?do=clk&tokid=eNoljU0SwiAMhe-SvTMkL7Q0nAahKJvOKK0bx7tLdfl-v2Rq724wSq1Q7DYZwYtM4RRstFNsxp6BWXh2w9TRPfb7mUOMOOSkNWQUZIUPBaXiulS_FqgT-f2MTV-fr7bdLsfWHn8UD6pPUCSXQnZ1ofj5AtJWXCdk


Veterinary Medical Ethics Déontologie vétérinaire

Ethical question of the month — January 2018On dairy herd health visits you routinely bring your technician along to assist you with various procedures. This technician has worked with you for several years and you greatly respect his expertise, dedication, and animal care ethic. On your way back to the clinic after one such visit, the technician mentions to you that at the previous herd health visit he saw the owner’s son repeatedly use an electric prod on a cow that was down in the alleyway and could not get up. On this visit he witnessed the same young man kicking a cow in the head to get her to back out of a stall. You have had reservations about the son’s husbandry skills for some time but have never observed any abusive behavior yourself. The owner is an outstanding dairyman. He has had some problems with this boy but hopes to have his son keep the farm in the family after he retires. Your technician expects you to act on behalf of the welfare of the cows. You suspect the boy has some mental health issues but this, of course, is not your area of expertise. How should you respond?

Question de déontologie du mois — Janvier 2018Lors de vos rondes dans les troupeaux de vaches laitières, vous amenez habituellement votre technicien pour vous assister lors des diverses interventions. Ce technicien travaille pour vous depuis plusieurs années et vous avez un grand respect pour son expertise, son dévouement et son éthique des soins aux animaux. Pendant le trajet de retour à la clinique après l’une de ces visites, le technicien mentionne que lors de la visite précédente du troupeau, il avait vu le fils du propriétaire qui utilisait à répétition un bâton électronique sur une vache qui était couchée dans l’allée et ne pouvait pas se lever. Lors de cette visite, il avait vu le même jeune homme qui donnait des coups de pied sur la tête d’une vache pour la faire sortir d’une stalle. Vous éprouviez certaines réserves à propos des compétences d’élevage du fils, mais vous n’aviez jamais observé un comportement abusif de première main. Le propriétaire est un producteur laitier exceptionnel. Son fils lui a causé quelques problèmes mais il espère que le jeune homme gardera la ferme dans la famille après sa retraite. Votre technicien s’attend à ce que vous preniez des mesures afin de protéger le bien-être des vaches. Vous soupçonnez que le jeune homme souffre de problèmes de santé mentale, mais ce n’est pas, bien entendu, votre domaine d’expertise. Comment devriez-vous réagir?

Responses to the case presented are welcome. Please limit your reply to approximately 50 words and forward along with your name and address to: Ethical Choices, c/o Dr. Tim Blackwell, 6486 E. Garafraxa, Townline, Belwood, Ontario N0B 1J0; telephone: (519) 846-3413; fax: (519) 846-8178; e-mail: [email protected] ethical questions of the month are also welcome! All ethical questions or scenarios in the ethics column are based on actual events, which are changed, including names, loca-tions, species, etc., to protect the confidentiality of the parties involved.

Les réponses au cas présenté sont les bienvenues. Veuillez limiter votre réponse à environ 50 mots et nous la faire parvenir par la poste avec vos nom et adresse à l’adresse suivante : Choix déontologiques, a/s du Dr Tim Blackwell, 6486, E. Garafraxa, Townline, Belwood (Ontario) N0B 1J0; téléphone : (519) 846-3413; télécopieur : (519) 846-8178; courriel : [email protected] propositions de questions déontologiques sont toujours bienvenues! Toutes les questions et situations présentées dans cette chronique s’inspirent d’événements réels dont nous modifions certains éléments, comme les noms, les endroits ou les espèces, pour protéger l’anonymat des personnes en cause.

Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.

L’usage du présent article se limite à un seul exemplaire pour étude personnelle. Les personnes intéressées à se procurer des réimpressions devraient communiquer avec le bureau de l’ACMV ([email protected]) pour obtenir des exemplaires additionnels ou la permission d’utiliser cet article ailleurs.



DÉ

ON

TO

LOG

IE V

ÉT

ÉR

INA

IRE

Ethical question of the month — October 2017Stockpeople raise livestock with the intention of producing meat, milk, fiber, and a range of other products. When an animal develops a problem such as lameness, producers wrestle with a sense of failure together with the belief that it is wrong to “waste” the animal’s life, i.e., euthanize an animal that has not fulfilled its purpose. The belief that an animal’s life should have a purpose is one reason that less than perfectly fit animals are sometimes transported to slaughter. When such animals appear at abattoirs or sales barns, producers may be accused of trying to extract the last bit of profit from an animal, or that they didn’t recognize that the animal had a problem. The producer on the other hand feels it is wrong that an animal that he or she has cared for over months or years should be killed and disposed of on the farm because it was not perfectly fit to travel. Is this belief that an animal should fulfill its intended purpose misguided? Is it wrong to “waste” an animal’s life?

Question de déontologie du mois — Octobre 2017Les éleveurs élèvent le bétail dans le but de produire de la viande, du lait, des fibres et un éventail d’autres produits. Lorsqu’un animal développe des problèmes comme la boiterie, les producteurs composent avec un sentiment d’échec ainsi qu’avec la croyance qu’il n’est pas éthique de «gaspiller» la vie d’un animal, c.-à-d., euthanasier un animal qui n’a pas été utilisé aux fins prévues. La croyance que la vie d’un animal devrait avoir un but est l’une des raisons pour laquelle des animaux qui ne sont pas entièrement aptes sont parfois transportés vers l’abattoir. D’une part, lorsque de tels animaux sont présentés aux abattoirs ou aux encans à bestiaux, on pourra accuser les producteurs de tenter d’extraire un dernier profit de l’animal ou de ne pas avoir reconnu que l’animal avait un problème. D’autre part, le producteur estime qu’il n’est pas juste qu’un animal dont il s’est occupé pendant des mois ou des années soit tué et éliminé à la ferme parce qu’il n’était pas parfaitement apte à voyager. La croyance voulant qu’un animal soit utilisé aux fins prévues est-elle erronée? Est-ce une erreur de «gaspiller» la vie d’un animal?

An ethicist’s commentary on shipping sick animals as to not waste themThe producer rationale for shipping sick animals to slaughter recounted here, namely that “an animal’s life should have a pur-pose,” is one that I find extremely ironic. In my own theoretical account of human moral obligations to animals, the concept of telos, derived from Aristotle, figures very prominently. All living things, according to Aristotle, possess an inherent nature, or func-tion, or purpose, or end, which is the particular form of life they are constituted to live. To put it simply, pigs possess a “pigness,” dogs a “dogness,” and good welfare for an animal consists in large measure in living a life to which it is suited by that nature.

As I argued in my recent book, A New Basis for Animal Ethics: Telos and Common Sense, this view of animals is built into a common sense view of the world — as the song goes, “fish gotta swim, birds gotta fly.” That is precisely why I based my ethical writings upon it, namely that it resonates so well with ordinary people and how they look at the world. Placing animals into situations in which they are forced to live is totally violative of their nature is abhorrent to common decency. That is why gestation crates are so jarring to ordinary people — such crates in which a sow spends her entire productive life, unable to move or even turn around, violate our moral sensibilities. Respect for telos is a fundamental principle of respect for animal welfare.

In my own work, I have used the concept of telos to make progress in improving numerous ways in which we keep ani-mals to suit our purposes, not theirs. It is thus ironic to find producers claiming that we can cavalierly ignore a farm animal’s welfare and ship the animal to slaughter, so that it can fulfill its “nature.” In other words, in the misguided metaphysics of such a producer, the telos of the cow is to become a hamburger or a steak. I am reminded of the absurd advertisements for canned tuna where Charlie Tuna laments not being chosen to be packed in such a can! This is double talk, reminiscent of George Orwell!

The nature of the cow is to live as it is biologically deter-mined to live. I am virtually certain that a sense of the foregoing principle is precisely why the public has tended to reject high confinement for farm animals, austere cages for zoo animals, small pools for keeping killer whales, and innumerable other traditional animal uses, even though many such uses were in some sense enjoyable and sanctified by historical tradition.

I can recall with some bitter amusement walking with my Great Dane in a New York City park and being accosted by a woman who chastised me for not having cropped my dog’s ears for ethical reasons. When I tried to explain, she shouted at me: “Don’t you understand? It belongs to the nature of the Great Dane to have cut ears!” My reply stopped her in her tracks: “If it belongs to the nature of the Great Dane to have cropped ears, then why don’t they come that way?”

The human ability to rationalize virtually any bizarre behavior is well-known. The argument employed by the producer in this case is a poster boy for such rationalization! We need not worry about the shipping of the sick animal and its suffering because such is the animal’s nature. God bless the North American public for seeing through such nonsense!

It has been suggested to me that the case was misstated; it should have said that the telos of the farmer is violated when he or she is unable to perform the function of producing food, and therefore is justified in shipping sick animals. There is a very simple response to that: in my view the telos of the farmer is to provide good husbandry for the animals raised, a point that I have raised repeatedly in this column. And a crucial part of good husbandry is assuring that the animals not suffer. As one husbandry-based cattle rancher said to me, “we should not ship our mistakes; we should eat them.”

Bernard E. Rollin, PhD



1. Which of the following is true regarding the bone marrow reserve available to respond to inflammation?A. Dogs have a limited bone marrow reserve and have a

limited degree of neutrophilia in response to inflammation.B. Cats have a limited bone marrow reserve and have a

limited degree of neutrophilia in response to inflammation.C. Cattle have a limited bone marrow reserve and have a

limited degree of neutrophilia in response to inflammation.D. Horses have no bone marrow reserve and have no

neutrophilia in response to inflammation.

2. “Thrush” is an infection of the oral cavity and esophagus caused by which of the following?A. Streptococcus pyogenesB. Corynebacterium pyogenesC. Actinobacillus lignieresiiD. Candida albicansE. Histophilus somni

3. Which of the following is INCORRECT regarding feline toxoplasmosis?A. Serum immunoglobulin M (IgM) titer is a poor test for

diagnosis of an active infection.B. Transplacental infection can occur.C. Intestinal replication and oocyst shedding occur only in

cats.D. In the bradyzoite state, large tissue cysts form in muscle,

brain, and other organs.E. Toxoplasmosis can cause blindness, uveitis, and

chorioretinitis.

4. Which of the following is NOT true regarding valvular endocardiosis in dogs?A. It is an age-related condition.B. It most frequently involves the mitral valve.C. It is associated with a systolic murmur.D. It causes smooth, nodular thickening of affected valves.E. It is associated with bacterial infection.

1. Lequel des énoncés suivants est vrai à propos de la réserve de moelle osseuse disponible pour répondre à l’inflammation? A. Les chiens possèdent une réserve de moelle osseuse

limitée et ont une faible quantité de neutrophiles en réponse à l’inflammation.

B. Les chats possèdent une réserve de moelle osseuse limitée et ont une faible quantité de neutrophiles en réponse à l’inflammation.

C. Les bovins possèdent une réserve de moelle osseuse limitée et ont une faible quantité de neutrophiles en réponse à l’inflammation.

D. Les chevaux ne possèdent pas de réserve de moelle osseuse et n’ont pas de neutrophiles en réponse à l’inflammation.

2. Le muguet est une infection de la cavité buccale et de l’œsophage causée par lequel des organismes suivants?A. Streptococcus pyogenes;B. Corynebacterium pyogenes;C. Actinobacillus lignieresii;D. Candida albicans;E. Histophilus somni.

3. Lequel des énoncés suivants est INCORRECT à propos de la toxoplasmose féline? A. Le titre d’immunoglobuline M (IgM) sérique constitue

une mauvaise épreuve pour le diagnostic d’une infection active.

B. L’infection transplacentaire peut se produire.C. La réplication intestinale et l’excrétion des oocystes se

produisent seulement chez le chat.D. À l’état de mérozoïte, de gros kystes tissulaires se forment

dans les muscles, l’encéphale et les autres organes.E. La toxoplasmose peut causer de la cécité, de l’uvéite et

de la choriorétinite.

Quiz Corner Test éclair

quiz corner is generously sponsored by le test éclair est généreusement commandité par

Advanced dental health now has a new nameStrixNB™ products will now transitionto our Vetradent™

with Vetradent Water Additive.dechra.ca

brand, starting



TE

ST

ÉC

LA

IR

5. Which of the following is the correct term for a normal behavior of stallions that involves curling the upper lip and dropping the penis?A. BruxismB. Dominance aggressionC. AerophagiaD. Flehmen response

4. Lequel des énoncés suivants N’EST PAS vrai à propos de l’endocardiose valvulaire chez le chien?A. C’est une affection reliée à l’âge.B. Elle implique plus fréquemment la valve mitrale.C. Elle est associée au souffle systolique.D. Elle cause un épaississement nodulaire lisse des valves

atteintes.E. Elle est associée à une infection bactérienne.

5. Lequel des termes suivants est le terme exact pour désigner le comportement normal des étalons lorsqu’ils retroussent la lèvre supérieure et rabattent le pénis?A. bruxisme;B. agressivité de dominance;C. aérophagie;D. flehmen.

Questions and answers were derived from Review Questions and Answers for Veterinary Boards 2nd ed., a 5-volume series including Basic Sciences, Clinical Sciences, Small Animal Medicine and Surgery, Large Animal Medicine and Surgery, and Ancillary Topics, by kind permission of the publisher, Mosby–Year Book, Inc., St. Louis, Missouri.

Les questions et les réponses sont extraites de Review Questions and Answers for Veterinary Boards 2nd ed., une série de cinq volu mes qui comprend Basic Sciences, Clinical Sciences, Small Animal Medicine and Surgery, Large Animal Medicine and Surgery, et Ancillary Topics, avec l’aimable permission de l’éditeur, Mosby–Year Book, Inc. de St. Louis (Missouri).

(See p. 81 for answers./Voir les réponses à la page 81.)

While you’re taking care of them,we’re looking out for you.

Specialized insurance programs and risk management services for CVMA members

• Professional liability insurance• Commercial insurance• Employeebenefits• Individual life and disability• Student and graduate insurance• Personal auto and home insurance

1-866-860-2862 • cvmainsurance.com



N E W S | N O U V E L L E S

Dans le cadre du 70e congrès de l’ACMV qui aura lieu à Vancouver, en Colombie-Britannique, l’Association canadienne

des médecins vétérinaires (ACMV) tiendra la 9e édition du Programme des futurs leaders (PFL) de l’ACMV.

Le programme, qui est commandité par Virox Animal Health, est un atelier hautement interactif d’une durée de huit heures qui est réparti sur deux demi-journées. En plus de l’atelier de huit heures du PFL, les participants seront aussi invités à assister à des événements phares de l’ACMV, dont le Sommet de l’ACMV ainsi que l’Assemblée générale annuelle de l’ACMV et déjeuner de remise des prix.

Nous aimerions rappeler aux membres de l’ACMV qui ont obtenu leur diplôme au cours des dix dernières années (2007 ou ultérieurement) de présenter une demande de pleine commandite pour participer au Programme des futurs leaders 2018 qui aide les vétérinaires, les techniciens et les technologues canadiens à identifier et à développer des compétences en leadership tout en créant un réseau de leadership au sein de la profession.

Les participants commandités bénéficieront des avantages suivants :• Trajet aller-retour à Vancouver, en Colombie-Britannique• Deux nuitées à l’hôtel JW Marriott Vancouver• Atelier de huit heures avec le Dr Rick DeBowes• Inscription gratuite au congrès 2018 de l’ACMV (valeur de

645 $).Jusqu’à deux participants commandités par province seront

choisis.Nous vous encourageons à profiter de cette généreuse

occasion rendue possible par Virox Animal Health.

As part of the 70th CVMA Convention to be held in Vancouver, British Columbia, the Canadian Veterinary

Medical Association (CVMA) will hold the 9th edition of the CVMA Emerging Leaders Program (ELP).

The Program, sponsored by Virox Animal Health, is a highly interactive 8-hour workshop spread across 2 1/2-days. In addi-tion to the 8-hour ELP session, participants are also invited to attend some of CVMA’s signature events including the CVMA Summit and the CVMA Annual General Meeting and Awards Luncheon.

We would like to remind CVMA members who graduated within the last 10 years (2007 or later) to apply for a full spon-sorship to participate in the 2018 Emerging Leaders Program that helps Canadian veterinarians, technicians and technologists to identify and develop leadership skills while building a leader-ship network within the profession.

Sponsored participants will receive the following:• Travel to and from Vancouver, British Columbia• Two nights’ accommodation at the JW Marriott Vancouver

Hotel• Eight-hour workshop with Dr. Rick DeBowes• Complimentary registration for the 2018 CVMA Convention

(value $645).Up to 2 sponsored participants per province will be selected.We encourage you to take advantage of this generous oppor-

tunity made possible by Virox Animal Health.Applications are due to Sarah Cunningham (scunningham@

cvma-acmv.org) on March 28, 2018.

Dr./Dr Rick DeBowes

Apply for a Sponsorship to Attend the 2018 Emerging Leaders Program!Présentez une demande de commandite pour assister au Programme des futurs leaders 2018!



N Les demandes doivent être acheminées à Sarah Cunningham ([email protected]) d’ici le 28 mars 2018.

«Au cours des cinq dernières années, j’ai eu l’immense plaisir d’être associé avec des collègues extraordinaires de toutes les régions du Canada qui se réunissent pour participer au Programme des futurs leaders. J’enseigne depuis 39 ans aux étudiants en médecine vétérinaire et aux collègues inscrits aux études supérieures et je peux vous dire que ces personnes figurent parmi les plus brillantes que l’on pourrait rencontrer. C’est une expérience gratifiante et une leçon d’humilité que de constater l’énergie, l’enthousiasme et l’intelligence qu’ils contribuent à nos séances d’apprentissage interactives. Un nombre important poursuivent ensuite le travail en améliorant les équipes de leur pratique ou ils assument un rôle dans la médecine vétérinaire organisée à l’échelle provinciale ou nationale...en donnant toujours l’exemple. Si vous désirez prospérer dans notre profession aujourd’hui et faire une différence positive pour les autres, je vous recommande sans réserve de considérer le Programme des futurs leaders de l’ACMV!» — Dr Rick DeBowes

Congrès 2018 de l’ACMV Du 5 au 8 juillet 2018Éveillez votre passion!

Le congrès de l’ACMV effectue un retour au centre-ville de Vancouver, après dix années d’absence, au nouvel hôtel

JW Marriott Parq Vancouver situé à côté du stade BC Place. Le congrès de l’ACMV est organisé en partenariat avec la section locale de l’ACMV-SBCV et en collaboration avec Technologues et techniciens vétérinaires agréés du Canada (TTVAC).

Êtes-vous intéressé par une occasion unique d’apprentissage et de réseautage dans la collectivité vétérinaire du Canada? Alors, joignez-vous à nous pour le congrès 2018 de l’ACMV où vous et vos collègues pourrez participer à un éventail de plus de 105 ateliers de formation continue présentant 25 conférenciers reconnus provenant du Canada et des États-Unis et, après le travail, vous pourrez échanger avec vos collègues lors de nos populaires activités sociales organisées en soirée. Vous avez soif d’apprentissage? Des laboratoires de travaux pratiques supplémentaires qui seront offerts exigeront une inscription hâtive : Extractions dentaires de base et avancées avec le Dr Kevin Stepaniuk et la Dre Sue McTaggart; et Interventions chirurgicales courantes de l’abdomen canin avec le Dr Ameet Singh. Enfin, Tara Evans de Serona Animal Health présentera un atelier spécial pour faire la démonstration de la manipulation appropriée des instruments dentaires.

“It has been my distinct pleasure over the past 5 years to be associated with the amazing colleagues from across Canada who come together annually to engage in the Emerging Leaders Program. Having taught veterinary students and post-graduate colleagues for the past 39 years, I can tell you that these individuals are among the best and brightest you could find. The energy, enthusiasm, and intelligence they bring to our interactive learning sessions is both gratifying and humbling. So many of them go on to improve their practice teams at home or take on a role in provincial or national organized veterinary medicine...always leading by example. If you want to thrive in our profession today and truly make a positive difference for others, I wholeheartedly recommend the CVMA Emerging Leaders’ Program for your consideration!” — Dr. Rick DeBowes

2018 CVMA ConventionJuly 5 to 8, 2018Ignite Your Passion!

The CVMA Convention returns to downtown Vancouver after 10 years at the newly-opened JW Marriott Parq Vancouver

located next to the BC Place Stadium. The CVMA Convention is organized in partnership with the CVMA-SBCV Chapter and in collaboration with the Registered Veterinary Technologists and Technicians of Canada (RVTTC).

Interested in a unique opportunity to learn and network with Canada’s veterinary community? Then join us for the 2018 CVMA Convention where you and your colleagues can participate in a selection of over 105 continuing education (CE) sessions featuring 25 renowned speakers from Canada and the United States and afterwards, socialize in our popular social evening event. Eager for more knowledge? Additional wet labs will be offered that require early registration: Basic and Advanced Dental Extractions with Dr. Kevin Stepaniuk and Dr. Sue McTaggart; and Common Surgical Procedures of the Canine Abdomen with Dr. Ameet Singh. Finally, Tara Evans of Serona Animal Health will host a special workshop to demonstrate the proper handling of dental instruments.

Continuing Education tracks at the 2018 CVMA Convention include: Business Management, Companion Animal, Ruminant, Equine, Animal Welfare, and more.



NLes volets de formation continue du congrès 2018 de l’ACMV incluent notamment la gestion commerciale, les animaux de compagnie, les ruminants, les équidés, le bien-être animal et plus encore.

Lors de l’atelier de la gestion commerciale, vous entendrez la Dre Heather Romano parler de la nouvelle génération de culture où vous découvrirez comment mettre à contribution les compétences des milléniaux qui entrent sur le marché du travail afin d’améliorer votre pratique en attirant et en conservant les employés les plus talentueux de cette nouvelle génération. La Dre Romano a travaillé pendant plus de vingt ans dans une clinique vétérinaire avant l’obtention de son poste actuel auprès de iVET 360, dont 14 années passées en gestion vétérinaire.

Les ateliers de formation continue sur les animaux de compagnie porteront sur les sujets suivants : Anesthésie et gestion de la douleur, Dentisterie, Dermatologie, Soins des instruments dentaires, Imagerie diagnostique, Endocrinologie et Gastro-entérologie, Médecine féline, Gestion de la douleur, Ophtalmologie, Chirurgie des tissus mous et Soins préventifs et gestion des chats âgés.

Les ateliers de formation continue sur les ruminants porteront sur la médecine et la chirurgie bovines, les maladies du système reproducteur et les maladies respiratoires des bovins de boucherie. Le volet des équidés portera sur l’anesthésie et l’analgésie sur le terrain, la chirurgie de la tête pour le praticien sur le terrain, la médecine et chirurgie et l’ophtalmologie.

Le volet sur le bien-être animal se penchera sur la violence envers les animaux et un autre volet examinera le bien-être au travail. Pour la première fois en 2018, un atelier abordera le sujet des animaux destinés à l’alimentation — Abeilles domestiques pour les nuls : Une introduction pour les vétérinaires.

En plus des ateliers de formation continue, le congrès de l’ACMV offrira un Salon des exposants avec plus de 75 stands d’exposition offrant les plus récents produits et services vétérinaires.

Le congrès de l’ACMV présentera aussi des événements phares auxquels vous pourrez participer, notamment : le Sommet de l’ACMV qui sera animé par la présidente désignée de l’ACMV, la Dre Terri Chotowetz; le Forum de l’ACMV sur les enjeux nationaux; et le Programme des futurs leaders. Ces événements phares offrent des occasions de réseautage, de participation et d’apprentissage uniques.

Investissez dans votre formation et ranimez votre passion pour la médecine vétérinaire pour aussi peu que 70 $ par heure de formation continue. D’autres nouvelles et mises à jour se trouvent sur le site Web de l’ACMV (www.veterinairesaucanada.net).

In the Business Management session, you will listen to Dr. Heather Romano discuss The New Generation of Culture where you will gain insights on how to leverage the skillset of millennials entering the workforce to improve your practice by attracting and retaining the best talents of this new generation. Dr. Romano brings over 20 years of veterinary hospital experi-ence to her current position with iVET 360, including 14 years in veterinary management.

The Companion Animal CE sessions will focus on: Anesthesia and Pain Management, Dentistry, Dermatology, Dental Instrument Care, Diagnostic Imaging, Endocrinology and Gastroenterology, Feline Medicine, Pain Management, Ophthalmology, Soft Tissue Surgery, and Senior Cat Preventative Care and Management.

The Ruminant CE sessions will focus on Bovine Medicine and Surgery, Beef Cattle Reproductive and Respiratory Diseases. The Equine stream will discuss Field Anesthesia and Analgesia, Head Surgery for the Field Practitioner, Medicine and Surgery, and Ophthalmology.

The Animal Welfare stream will examine animal abuse, and another stream will look at workplace wellness. New in 2018, a session will focus on food producing animals — Honey Bees for Dummies: A Primer for Veterinarians.

In addition to the CE sessions, the CVMA Convention offers an Exhibit Hall with over 75 exhibit spaces showcasing the latest in veterinary products and services.

The CVMA Convention also features several signature events that you can partake in, including: the CVMA Summit facilitated by CVMA’s president-elect, Dr. Terri Chotowetz; the CVMA National Issues Forum; and the Emerging Leaders Program. These signature events offer unique networking, engagement and learning opportunities.

Invest in yourself and re-ignite your passion for veterinary medicine for as little as $70 per CE hour. More news and updates on the CVMA website (www.canadianveterinarians.net).

Dr./Dre Sue McTaggartDr./Dr Kevin Stepaniuk Dr./Dr Ameet Singh Dr./Dre Heather Romano



N

Chaque année, dans le cadre du programme national des prix vétérinaires nationaux de l’Association canadienne des

médecins vétérinaires (ACMV), des vétérinaires sont honorés pour leurs contributions exceptionnelles à la médecine vétérinaire. Nous vous encourageons à mettre en candidature des collègues méritants pour leur travail ardu et leur dévouement envers la profession.

Les candidats (sauf ceux mis en candidature pour le titre de membre honoraire) doivent être des membres en règle de l’ACMV pour être admissibles à la mise en candidature. Cependant, ils peuvent être mis en candidature par des non-membres de l’ACMV.

Les Prix de l’ACMV seront présentés durant le congrès de l’ACMV, qui se déroulera à Vancouver, en Colombie-Britannique, du 5 au 8 juillet 2018. Des mises en candidature seront acceptées jusqu’au 31 janvier 2018 pour les prix suivants :Prix humanitaire de l’ACMV

(Commandité par Merck Santé Animale)Prix vétérinaire Merck (Commandité par Merck Santé Animale)Prix du praticien des petits animaux

(Commandité par Petsecure assurance maladie pour animaux)Prix de la pratique de l’année de l’ACMV

(Commandité par la Banque Scotia)Prix de l’industrie de l’ACMVMembre à vie de l’ACMVMembre honoraire de l’ACMV

Les trousses de mise en candidature doivent être soumises d’ici le 31 janvier 2018 par courriel ([email protected]), par télécopieur au 613-236-9681 ou par la poste au bureau de l’ACMV au 339, rue Booth, Ottawa (Ontario) K1R 7K1.

Les trousses de mise en candidature doivent inclure un formulaire de mise en candidature rempli, une description sommaire des principales réalisations professionnelles du candidat et des lettres d’appui (des articles de journaux et des articles écrits par le candidat peuvent être inclus au besoin).

Veuillez visiter la section des Prix de l’ACMV, sous l’onglet À propos de l’ACMV, sur le site Web de l’ACMV (www.veterinaires aucanada.net) pour obtenir les lignes directrices complètes, des descriptions des prix, des formulaires de mise en candidature et le nom des récipiendaires antérieurs.

Each year, through the Canadian Veterinary Medical Association’s (CVMA’s) national veterinary awards program,

veterinarians are honored for their exceptional contributions to veterinary medicine. We encourage you to nominate deserving colleagues for their hard work and dedication to the profession.

Award nominees (excluding those nominated for Honorary Membership) must be current CVMA members to be eligible for nomination; however, they can be nominated by non-CVMA members.

CVMA Awards will be presented during the CVMA Convention, which takes place in Vancouver, British Columbia from July 5 to 8, 2018. Nominations will be accepted until January 31, 2018 for the following awards:CVMA Humane Award (Sponsored by Merck Animal Health)Merck Veterinary Award (Sponsored by Merck Animal Health)Small Animal Practitioner Award

(Sponsored by Petsecure Pet Health Insurance)CVMA Practice of the Year Award (Sponsored by Scotiabank)CVMA Industry AwardCVMA Life MembershipCVMA Honorary Membership

Nomination packages must be submitted by January 31, 2018 via e-mail ([email protected]), by fax to 613-236-9681, or by mail to the CVMA office at 339 Booth Street, Ottawa, ON K1R 7K1.

Nomination packages must include a completed nomination form, an outline of the nominee’s key professional accomplish-ments, and letters of support (newspaper articles and articles written by the nominee can be included if applicable).

Please visit the CVMA Awards section, under About CVMA, on the website (www.canadianveterinarians.net) for complete nomination guidelines, award descriptions, nomination forms, and past award recipients.

2018 CVMA Awards — Last Call!Nominations Close January 31, 2018

Prix de l’ACMV 2018 — Dernier appel! Clôture des mises en candidature le 31 janvier 2018



N

La Banque Scotia est fière de continuer d’appuyer les efforts de La Revue vétérinaire canadienne (La RVC) pour tenir les

étudiants informés à propos de l’industrie durant leurs études. Depuis 2015, la Banque Scotia appuie le programme en offrant des abonnements gratuits à La RVC aux étudiants en médecine vétérinaire du Canada.

La Banque Scotia comprend l’importance de demeurer au courant des enjeux et des sujets de l’heure pour les professionnels au sein de la collectivité vétérinaire au pays. En fournissant l’accès à ces revues, la Banque Scotia fait preuve d’un engagement continu envers la profession.

À titre de fournisseur privilégié de services financiers de l’ACMV, la Banque Scotia a conçu le programme Professions libérales Scotia pour étudiants afin de répondre aux besoins et aux objectifs uniques des étudiants professionnels. Pour les professionnels praticiens, le Plan Professions libérales Scotia offre tout ce qui est requis afin d’améliorer sa situation financière, tant sur le plan personnel que professionnel.

Des ressources additionnelles sont fournies aux étudiants en médecine vétérinaire de chaque école au Canada dans le cadre du programme de représentant de la faculté de la Banque Scotia; ce programme fournit un conseiller attitré afin de répondre aux besoins des étudiants en médecine vétérinaire à chaque université. Les représentants de faculté de la Banque Scotia sont présentés ci-dessous et ils travailleront avec l’ACMV afin de distribuer les revues dans chacune des écoles de médecine vétérinaire.

Scotiabank is proud to continue to support the efforts of The Canadian Veterinary Journal (The CVJ) to keep students

informed about the industry during their studies. Since 2015, Scotiabank has supported the program, offering veterinary stu-dents across Canada subscriptions to The CVJ at no cost.

Scotiabank understands the importance of staying informed about current issues and topics for professionals within the veterinary community across the country. By providing access to these journals Scotiabank demonstrates an ongoing commit-ment to the profession.

As the CVMA’s preferred financial services provider, Scotiabank designed the Scotia Professional Student Plan program to meet the unique needs and goals of professional students. For practicing professionals, the Scotia Professional Plan provides everything needed to help them become financially better off, both personally and professionally.

Additional resources are provided to veterinary students at each faculty across Canada under Scotiabank’s Faculty Representative Program; this program ensures a dedicated advi-sor is assigned to address the needs of veterinary students at each university. The Scotiabank faculty representatives are listed below and will be working with the CVMA to distribute the journals at each of the veterinary colleges.

For more information about Scotiabank’s services for profes-sional students, please visit (www.Scotiabank.com/studentprofes sional) or meet with a Scotiabank small business advisor today.

University Université

Faculty representative Représentant de la faculté

E-mail Courriel

Telephone Téléphone

Calgary Inder Arora [email protected] 403-801-6509

Saskatchewan Trevor Humphries [email protected] 306-668-1419, x7000

Guelph Jason Roberts [email protected] 519-766-7663, x4200

Vivian Contonis [email protected] 519-766-7663, x4200

Montreal/Montréal Afaf Chaghmoum [email protected] 514-499-5511, x3004

PEI/Î.-P.-É. Caroline Nicholson [email protected] 902-629-7755, x3001

Pour en savoir davantage à propos des services de la Banque Scotia pour les étudiants professionnels, veuillez visiter (http://www.scotiabank.com/ca/fr/0,,2580,00.html) ou prenez rendez-vous avec un conseiller en petites entreprises de la Banque Scotia dès aujourd’hui.

Future Veterinarian Support Continues from Scotiabank, a Preferred Partner of the CVMALa Banque Scotia, un partenaire privilégié de l’ACMV, continue d’offrir du soutien aux futurs vétérinaires



N

La surveillance vétérinaire de l’utilisation des antimicrobiens sera renforcée au Canada dans le cadre de la lutte contre

l’antibiorésistance. Cette situation comportera des changements importants pour vous en tant que praticien et pour la profession vétérinaire en général.

Santé Canada ajoutera plusieurs antimicrobiens importants sur le plan médical (AIM) approuvés pour usage vétérinaire avant 2004 à la Liste des drogues sur ordonnance (LDO). Avec ce changement, Santé Canada établira le même niveau de surveillance pour les AIM approuvés avant 2004 que pour ceux approuvés après cette date.

À compter du 1er décembre 2018, tous les AIM à usage vétérinaire seront ajoutés à la LDO et devront être vendus seulement sur ordonnance.

Les modifications apportées par Santé Canada incluent notamment :• L’interdiction de l’importation des AIM pour usage personnel par

les propriétaires d’animaux dès le 13 novembre 2017;• Une surveillance accrue et de nouvelles règles pour la

manipulation des ingrédients pharmaceutiques actifs à usage vétérinaire dès le 17 mai 2018;

• La déclaration obligatoire des données sur les ventes liées aux AIM;

• De nouvelles exigences et l’expansion du programme des produits de santé animale afin d’augmenter l’accès aux produits de santé animale complémentaires pour les animaux d’élevage.Vous avez des questions à propos des modifications aux

règlements et aux politiques? Visitez la section de l’Utilisation responsable des antimicrobiens importants sur le plan médical chez les animaux sur le site Web du gouvernement du Canada (https://www.canada.ca/fr/sante-publique/services/resistance-aux-antibiotiques-antimicrobiens/animaux/actes/utilisation-responsable-antimicrobiens.html).

V eterinary oversight of antimicrobial use is being strengthened in Canada as part of the fight against antimicrobial resistance.

This means important changes for you as a practitioner and for the veterinary profession.

Health Canada is moving a number of Medically Important Antimicrobials (MIAs) approved for veterinary use before 2004 to the Prescription Drug List (PDL). With this change, Health Canada will establish the same level of oversight for those MIAs approved before 2004 as for those approved after.

As of December 1, 2018, all MIAs for veterinary use will be on the PDL and must be sold by prescription only.

Changes being made by Health Canada include:• Ending Own Use Importation of MIA by animal owners

effective November 13, 2017;• Increased oversight and new rules for the handling of Active

Pharmaceutical Ingredients for veterinary use starting May 17, 2018;

• Mandatory reporting of sales information related to MIA; and

• New requirements and the expansion of the veterinary health products program to increase access to alternative animal health products for production animals.Questions about the regulatory and policy changes? Visit the

Responsible use of Medically Important Antimicrobials in Animals section on the Government of Canada website ([email protected]).

If you have questions on the management of the inventory of medically important antimicrobials during the transition to December 1, 2018, visit (www.cahi-icsa.ca/antimicrobial-stewardship).

The Canadian Veterinary Medical Association (CVMA), along with the Canadian Animal Health Institute (CAHI) and other stakeholders, have been engaging with Health Canada’s

Effective December 1, 2018 a Veterinary Prescription will be Needed for Medically Important Antibiotics in AnimalsÀ compter du 1er décembre 2018, une prescription vétérinaire sera requise pour les antibiotiques importants sur le plan médical utilisés chez les animaux



NSi vous avez des questions à propos de la gestion de l’inventaire des antimicrobiens importants sur le plan médical durant la transition jusqu’au 1er décembre 2018, visitez (www.cahi-icsa.ca/antimicrobial-stewardship).

L’Association canadienne des médecins vétérinaires (ACMV), l’Institut canadien de la santé animale (ICSA) et d’autres intervenants ont interagi avec la Direction des médicaments vétérinaires de Santé Canada à propos de ces changements et ils continueront d’appuyer ces actions dans le cadre d’engagements et de communications.

Après de vastes consultations et discussions avec les intervenants, le Conseil canadien des registraires vétérinaires et le Groupe consultatif sur la gouvernance des produits pharmaceutiques vétérinaires de l’ACMV ont créé le document Surveillance vétérinaire de l’utilisation des antimicrobiens — Un cadre de travail pancanadien pour les normes professionnelles régissant les médecins vétérinaires sur la surveillance vétérinaire de l’utilisation des antimicrobiens; ce document peut être téléchargé sur le site Web de l’ACMV (www.veterinairesaucanada.net).

Au Canada, les installations qui effectuent des activités réglementées (p. ex., la manipulation ou l’entreposage)

avec des agents pathogènes humains et zoonotiques ou des toxines sont réglementées en vertu de la Loi sur les agents pathogènes humains et les toxines (LAPHT) et le Règlement sur les agents pathogènes humains et les toxines (RAPHT). Ces installations nécessitent un permis, sauf si elles répondent aux critères d’exclusion spécifiés dans la LAPHT ou qu’elles sont exemptées de l’obligation d’obtenir un permis en vertu du RAPHT. La ligne directrice sur la Conception physique et pratiques opérationnelles dans le cadre d’activités de diagnostic en établissement vétérinaire (Ligne directrice) décrit les précautions et les recommandations pour les établissements vétérinaires où des activités de diagnostic qui ne requièrent pas de permis en vertu du RAPHT sont exécutées.

La présente Ligne directrice décrit les précautions et les recommandations pour la manipulation d’échantillons prélevés d’animaux qui pourraient être infectés par des agents pathogènes humains de groupe de risque 2 (GR2). Elles aideront à gérer les risques associés à l’exposition du personnel à des matières infectieuses, ainsi qu’à prévenir la libération d’agents pathogènes dans l’environnement. Les éléments fournis dans la présente Ligne directrice sont fondés sur les exigences minimales en matière de confinement physique et les exigences opérationnelles pour les installations d’un niveau de confinement 2 énoncées dans la Norme canadienne sur la biosécurité, 2e édition (2015). Ces éléments comprennent les principes de la biosécurité et de la biosûreté

In Canada, facilities that conduct controlled activities, such as handling or storing human and zoonotic pathogens or toxins,

are regulated under the Human Pathogens and Toxins Act (HPTA) and the Human Pathogens and Toxins Regulations (HPTR). As such, they require a Pathogen and Toxin Licence unless they meet the exclusion criteria specified in the HPTA or are exempted from the licensing requirement under the HPTR. The Veterinary Practices: Physical Design and Operational Practices for Diagnostic Activities guideline (the Guideline) describes biosafety precautions and recommendations for veterinary

Veterinary Drugs Directorate about these changes and will continue to support these actions with ongoing engagement and communication.

After broad stakeholder consultation and discussion, the Canadian Council of Veterinary Registrars and the CVMA’s Veterinary Pharmaceutical Stewardship Advisory Group developed Veterinary Oversight of Antimicrobial Use — A Pan-Canadian Framework for Professional Standards for Veterinarians regarding veterinary oversight of antimicro-bial use; it is available for download on the CVMA website (www.canadianveterinarians.net).

Canadian Biosafety GuidelineVeterinary Practices: Physical Design and Operational Practices for Diagnostic Activities

Ligne directrice canadienne sur la biosécuritéConception physique et pratiques opérationnelles dans le cadre d’activités de diagnostic en établissement vétérinaire



N que les établissements vétérinaires peuvent suivre afin de démontrer que toutes les précautions raisonnables ont été prises pour protéger la santé et la sécurité du public contre les risques associés avec les matières en leur possession, conformément à la LAPHT. De plus amples renseignements se trouvent dans le Guide canadien sur la biosécurité, 2e édition (2016).

Les Lignes directrices sont divisées en cinq chapitres :• Le chapitre 1 fournit des informations de base, les critères d’exclusion

de la LAPHT, et des exemples de situations qui exemptent les établissements vétérinaires de l’exigence en matière de permis.

• Le chapitre 2 fournit des informations sur les éléments de conception physique et définit la conception de base de l’installation ainsi que les contrôles techniques qui peuvent être établis pour minimiser l’exposition du personnel à des matières potentiellement infectieuses et limiter la contamination avec des agents pathogènes.

• Le chapitre 3 sur les pratiques opérationnelles porte sur les contrôles administratifs et les procédures qui peuvent être mis en place pour prévenir l’exposition involontaire du personnel et la libération d’agents pathogènes ou de matières potentiellement infectieuses dans l’environnement. Ce chapitre propose également des recommandations pour la manipulation, l’utilisation, l’entreposage et l’élimination sécuritaires des agents pathogènes de GR2 ainsi que d’autres matières biologiques des établissements vétérinaires qui pourraient contenir des agents pathogènes de GR2.

• Le glossaire, la bibliographie et les ressources se trouvent dans les chapitres 4 et 5, respectivement.Le Centre sur la biosûreté a consulté l’Agence canadienne d’inspection

des aliments, les associations provinciales et territoriales des médecins vétérinaires par l’intermédiaire de l’Association canadienne des médecins vétérinaires et des vétérinaires. Tous les commentaires ont été pris en considération pour la version définitive de cette Ligne directrice, qui a été publié sur le site Web du gouvernement du Canada et peut être consultée à l’adresse (https://www.canada.ca/fr/sante-publique/services/normes-lignes-directrices-canadiennes-biosecurite/directrices.html).

Le Centre de la biosûreté aimerait remercier l’ACMV de sa collaboration et de la coordination de la consultation auprès des associations des médecins vétérinaires. Dans le but d’assurer l’amélioration continue de ces Lignes directrices, l’ASPC vous invite à nous transmettre vos commentaires, vos demandes d’éclaircissements et vos suggestions d’éléments à considérer dans les prochaines éditions. Pour ce faire, veuillez communiquer avec nous à l’adresse ([email protected]).

practices where diagnostic activities are performed, but do not require a license under the HPTR.

This Guideline provides biosafety precautions and rec-ommendations for the safe handling of samples collected from animals that may be infected with Risk Group 2 (RG2) human pathogens. These will help to manage risks associated with personnel exposure to infectious material, and prevent the release of pathogens into the environ-ment. Elements provided in the Guideline are based on the minimum physical containment and operational practice requirements for Containment Level 2 facilities specified in the Canadian Biosafety Standard, 2nd edition (2015). These elements encompass the principles of bio-safety and biosecurity that veterinary practices can follow to demonstrate that all reasonable precautions have been taken to protect the health and safety of the public against the risks associated with the material in their possession, in accordance with the HPTA. Additional guidance can be found in the Canadian Biosafety Handbook, 2nd Edition (2016).

The Guideline is divided into 5 chapters:• Chapter 1 provides background information, criteria

for exclusion from the HPTA, and examples of situa-tions that exempt veterinary practices from the require-ment for licensing.

• Chapter 2, Physical Design Features, defines the basic facility design and engineering controls that may be established to minimize personnel exposure to poten-tially infectious material and to limit the spread of pathogens.

• Chapter 3, Operational Practices, refers to the admin-istrative and procedural controls that may be put in place to prevent inadvertent exposure of personnel and release into the environment of pathogens and potentially infectious material. This chapter also offers recommendations for the safe handling, use, storage, and disposal of RG2 pathogens and other biological material that may contain RG2 pathogens in veterinary practices.

• Chapters 4 and 5 are the Glossary and Resources, respectively.The Centre for Biosecurity’s consultation included the

Canadian Food Inspection Agency, provincial and territo-rial veterinary medical associations through the Canadian Veterinary Medicine Association (CVMA), and veterinar-ians. All comments were taken into considerations for the final version of this Guideline, which was published on the Government of Canada’s website and can be found at (www.canada.ca/en/public-health/services/canadian-biosafety-standards-guidelines/guidance.html).

The Centre for Biosecurity would like to thank the CVMA for their collaboration and for coordinating the consultation with veterinary medical associations and veterinarians. We welcome your feedback and sugges-tions for the continual improvement of future editions of this guideline. Please contact us at ([email protected]).



N

La Dre Joyce Van Donkersgoed de Coaldale, en Alberta, a été nommée lauréate du Prix 2017 MetacamMD 20 pour

le bien-être des bovins pour son leadership dans l’industrie bovine canadienne afin d’améliorer le bien-être des animaux des parcs d’engraissement.

Le prix est décerné annuellement par l’Association canadienne des vétérinaires bovins (ACVB) en partenariat avec Boehringer Ingelheim (Canada) Ltée.

«Nous sommes honorés d’annoncer que la Dre Van Donkersgoed est la récipiendaire du Prix 2017 MetacamMD 20 pour le bien-être des bovins», a dit le Dr Germain Nappert, président de l’ACVB. «Son leadership dans le domaine du bien-être animal est exemplaire et son travail aidera à améliorer le bien-être des animaux des parcs d’engraissement partout au pays.»

La Dre Van Donkersgoed gère une pratique privée pour les parcs d’engraissement située dans le sud de l’Alberta où elle offre à ses clients des soins d’urgence ainsi que des services liés à la santé du troupeau et à la production, à la recherche et à la réglementation. Elle a joué un rôle crucial dans l’élaboration de l’outil servant à l’évaluation des soins aux animaux dans les parcs d’engraissement canadiens, en vue de vérifier le bien-être animal, qui a été certifié par la Professional Animal Auditor Certification Organization. Il s’agit du premier outil conçu pour le segment des parcs d’engraissement de l’industrie de la production alimentaire.

«On ne peut pas gérer si on ne mesure pas, ce qui comprend le bien-être animal et nous devons continuellement travailler afin de nous améliorer», a dit la Dre Van Donkersgoed. «Les vétérinaires bovins ont une responsabilité éthique et morale afin d’assurer le bien-être animal tout en tenant compte des besoins de leurs clients. Ce n’est pas toujours simple mais la ténacité est récompensée à la longue si l’on persévère et que l’on travaille dans l’intérêt supérieur des animaux, ce qui, en bout de ligne, sera aussi la meilleure option pour le client.»

Le Prix MetacamMD 20 pour le bien-être des bovins est décerné annuellement à un médecin vétérinaire ou à un expert des sciences animales travaillant au Canada, à un professeur ou à un étudiant diplômé d’une université canadienne afin de reconnaître ses réalisations pour l’avancement du bien-être des animaux en faisant preuve de leadership, en travaillant pour le bien commun, par l’éducation, la recherche et le développement de produits et/ou en défendant des intérêts.

Dr. Joyce Van Donkersgoed of Coaldale, Alberta was named the recipient of the 2017 Metacam® 20 Bovine Welfare Award for

her leadership in the Canadian beef industry to improve the welfare of feedlot animals.

The award is presented annually by the Canadian Association of Bovine Veterinarians (CABV) in partnership with Boehringer Ingelheim (Canada) Ltd.

“We are honored to announce Dr. Van Donkersgoed as the recipient of the 2017 Metacam® 20 Bovine Welfare Award,” said Dr. Germain Nappert, president of the CABV/ACVB. “Her leader-ship in the area of animal welfare is exemplary, and her work will help improve the welfare of feedlot animals across the country.”

Dr. Van Donkersgoed operates a private feedlot practice in south-ern Alberta where she provides emergency, herd health and production services, and research and regulatory services to her clients. She was instrumental in the development of the Canadian Feedlot Animal Care Assessment tool for auditing animal welfare, which has been certified by the Professional Animal Auditor Certification Organization. It is the first certified audit designed for the feedlot segment of the food production industry.

“You can’t manage what you don’t measure, which includes ani-mal welfare, and we must continually strive to improve,” Dr. Van Donkersgoed said. “Beef veterinarians have a key ethical and moral responsibility to ensure animal welfare whilst balancing the needs of their clients. It isn’t always simple or easy to do but persistence does pay off over time if you don’t give up and are doing the right thing for the animals, which is ultimately best for the client.”

The Metacam® 20 Bovine Welfare Award is given annually to a DVM or animal scientist working in Canada, a faculty member or a graduate student of a Canadian university to recognize his/her achievements in advancing the welfare of animals via leadership, public service, education, research/product development, and/or advocacy.

Dr. Tim Nickel (Boehringer Ingelheim Canada Ltd.) presents the Metacam 20 Bovine Welfare Award to Dr. Joyce Van Donkersgoed.

Le Dr Tim Nickel (Boehringer Ingelheim Canada Ltée) présente le Prix Metacam 20 pour le bien-être des bovins à la Dre Joyce Van Donkersgoed.

Dr. Joyce Van Donkersgoed Named the 2017 Metacam® 20 Bovine Welfare Award WinnerLa Dre Joyce Van Donkersgoed est nommée lauréate du Prix 2017 MetacamMD 20 pour le bien-être des bovins


VetPen® Is on TargetWhen accuracy and precision matter most to your clients

VetPen® is available in two sizes providing a convenient choice of different dosing increments/maximum dose:

• 0.5 IU/8 IU when a finer dose adjustment is needed

• 1 IU/16 IU when a larger dose is needed

Innovative and accurate insulin delivery that drives convenience and compliance

CANINSULIN® and VETPEN® are registered trademarks of Intervet International B.V. Used under license.MERCK® is a registered trademark of Merck Canada Inc. © 2017 Intervet Canada Corp. All rights reserved.

VetPen ad EN CVJ.indd 1 2017-01-31 9:49 AM



Case Report Rapport de cas

Acute surgical intervention for a depressed skull fracture causing a laceration to the brain parenchyma from a bite wound in a dog

Natasha Hodgson, Andrea Walters, Corinne Lawson, Devon Hague, Stephen Joslyn, Maureen McMichael

Abstract — A 5-month-old spayed female mixed breed dog was attacked by another dog causing multiple fractures of the left calvarium with a fragment penetrating through the gray matter of the parietal lobe. Surgery was performed to remove the bone fragment. A 6-month follow-up showed dramatic improvement in neurologic status.

Résumé — Intervention chirurgicale d’urgence pour une fracture du crâne pénétrante causant une lacération au parenchyme du cerveau suite à une morsure chez une chienne. Une chienne stérilisée de race croisée âgée de 5 mois a été attaquée par un autre chien causant des fractures multiples de la voûte crânienne gauche avec un fragment pénétrant dans la matière grise du lobe pariétal. La chirurgie a été réalisée pour enlever le fragment d’os. Un suivi de 6 mois a démontré une amélioration spectaculaire de l’état neurologique.

(Traduit par Isabelle Vallières)Can Vet J 2018;59:31–35

T raumatic brain injury (TBI) is defined as an alteration in brain function caused by an external force (1). It is a com-

mon presentation in the veterinary emergency room and can be caused by dog bites, motor vehicle accidents, falls from heights, crush injuries, and human assaults (2). Most cases of TBI are treated medically; however, surgical intervention may become necessary. A major indication for surgery in human medicine is a poor response to medical treatment resulting in worsen-ing intracranial pressure (ICP) measurements (3). Since ICP monitoring is rarely performed, reasons for surgery in veterinary medicine are controversial and may include inadequate response to medical therapy, depressed or open skull fractures, ongoing hemorrhage, foreign bodies, or hematomas (2,4). There is little in the veterinary literature about surgical intervention for TBI, and currently it is unknown even in human medicine if there is a positive correlation between surgery and clinical outcome (5). To the authors’ knowledge this is the first veterinary report describing acute surgical intervention (, 24 h) for depressed skull fractures with fragment penetration into the brain paren-chyma resulting from a bite wound.

Case descriptionA 5-month-old 2.0-kg spayed female mixed breed dog was examined 3 h after being attacked by another dog. On presenta-tion to the Veterinary Teaching Hospital emergency service, the dog had evidence of 2 open bite wounds on the dorsal aspect of her head with no other obvious external injuries. The dog had a

heart rate of 164 beats/min with occasional ventricular prema-ture complexes recorded on electrocardiogram examination. The dog was hypertensive with a systolic blood pressure measured at 210 mmHg with Doppler. On neurologic examination, the dog had an obtunded mentation and a rotary nystagmus in both eyes. No other cranial nerve deficits were identified. The dog was non-ambulatory tetraparetic with decreased withdrawal reflexes in both thoracic limbs. The modified Glasgow Coma Score (MGCS) was 13 (6). The patient’s injury was neurolocal-ized to the central vestibular areas (brainstem) due to the menta-tion change, ambulation deficits, and nystagmus. The decreased withdrawals could be explained by damage to the vestibulospinal tracts causing inhibition to the gray matter interneurons and/or injury to the medial longitudinal fasciculus, affecting the dorsal ventral funiculus of the cervical and cranial thoracic spinal cord segments.

Initial stabilization included intravenous boluses of Lactated Ringer’s solution (Hospira, Lake Forest, Illinois, USA), total dose of 45 mL/kg body weight (BW), mannitol (Nova-Tech, Grand Island, Nebraska, USA), 1 g/kg BW, IV bolus, pain man-agement with fentanyl citrate (Hospira), 6 mg/kg BW bolus then 3 to 5 mg/kg BW/h, IV, and supplemental oxygen via an oxygen chamber (FiO2 of 40%). The wounds on the head were clipped and cleaned aseptically with chlorhexidine gluconate solution (Hibiclens; Mölnlycke Health Care, Norcross, Georgia, USA) and antibiotics were started (ampicillin/sulbactam; Auromedics Pharma, Dayton, New Jersey), 30 mg/kg BW, IV, q8h.

Department of Veterinary Clinical Medicine, University of Illinois, 1008 West Hazelwood Drive, Urbana, Illinois 61802, USA.Address all correspondence to Dr. Maureen McMichael; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.



RA

PP

OR

T D

E C

AS

An initial STAT blood profile (Critical Care Express; Nova Biomedical, Waltham, Massachusetts, USA) did not identify sig-nificant abnormalities. Following initial triage, the dog became stuporous. After stabilization treatments, the dog’s mental status changed from stuporous to dull. Using minimal sedation with fentanyl citrate, 5 mg/kg BW per hour, IV, and midazolam (West-Ward, Eatontown, New Jersey, USA), 0.1 mg/kg BW, IV, computed tomography (CT; GE Lightspeed 16-slice; GE Healthcare, Milwaukee, Wisconsin, USA) scan of the skull, cervical spine, and thorax was performed using the VetMouse Trap (Universal Medical Systems, Solon, Ohio, USA). Multiple fractures of the left calvarium involving the left frontal, parietal, and occipital bones were found (Figures 1A, B). The fractures were open with a small gas pocket seen within the calvarium indicating pneumocephaly. One bony fragment was noted to be displaced toward the left lateral ventricle, penetrating through the gray matter of the parietal lobe. The fractures and overall compression of the left hemisphere were also associated with mid-line shift of the falx cerebri, and reduced attenuation of the

left cerebral white matter consistent with white matter edema (Figures 2A, B). The patient was hospitalized overnight with supportive care and monitoring.

During the first 12 h of hospitalization, the dog returned to a stuporous state. The dog developed an intermittent rotary and vertical nystagmus OU, miotic pupils OU, and absent menace OU. The dog continued to be non-ambulatory tetraparetic. Her MGCS at this time decreased to 11. An additional dose of mannitol (0.5 g/kg BW, IV) was administered. Her mentation improved to an obtunded state, with normalization of pupil size and a MGCS of 15 was recorded. Although her mental status improved with the additional dose of mannitol, a craniectomy was advised due to concerns of increased intracranial pressure secondary to the compressive fracture.

Based on the location of the depressed skull fracture on CT and history of a bite injury with concern for bacterial infection, surgical intervention was recommended to remove the bone frag-ment and lavage the wound. Levetiracetam (Keppra; Hospira), 30 mg/kg BW, IV, q8h, was started before surgery, which was

Figure 1. Transverse (A) and sagittal (B) CT images of the head showing multiple comminuted fractures of the left calvarium (triangles) and associated fragment penetration of the left parietal lobe (arrow).

Figure 2. Transverse CT images of the head showing compression of the left hemisphere associated with mid-line shift of the falx cerebri (A) and reduced attenuation of the left cerebral white matter consistent with white matter edema (B, arrow).



CA

SE

RE

PO

RT

conducted 16 h after presentation to the emergency room. The dog was premedicated with midazolam, 0.2 mg/kg BW, IV, lido-caine (Hospira), 2 mg/kg BW, IV, and fentanyl citrate, 10 mg/kg BW, IV, and induced with propofol (Hospira), 1 mg/kg BW, IV. A continuous rate infusion of propofol, fentanyl citrate, and lidocaine was continued during surgery. Inhalant anesthetics were not used during the procedure.

The patient was positioned in sternal recumbency with the head elevated. The hair over the calvarium was shaved and the area prepared with chlorhexidine gluconate solution. A 4-cm skin incision was made along the midline over the frontoparietal region. The underlying musculature was bruised and edematous. The interscutularis, frontalis, and temporalis muscles were sharply dissected with a #15 blade and reflected away from the skull using a periosteal elevator.

The fractured parietal bone was observed upon exposure of the skull. A depressed fracture fragment in the parietal lobe was penetrating deep into the brain parenchyma. This bone frag-ment was removed and measured 1.5 cm in diameter. There was a mild amount of hemorrhage and a small area ( 2 cm) of damaged cerebral cortex from which the bone fragment had been removed. The remaining cortex appeared grossly normal. The surgical site was flushed and lavaged with 0.9% sodium chloride irrigation (Hospira) to minimize contamination from the bite wound. An aerobic culture was negative for growth. There was no evidence of gross hemorrhage or brain swelling prior to closure. A thin piece of gelfoam was placed over the skull defect. The musculature was apposed using 3-0 polydioxa-none suture (PDS; Ethicon, Guaynabo, Puerto Rico) in a simple continuous pattern, and the subcutaneous layer was closed in a similar manner. The skin was closed in an intradermal pattern with 4-0 poliglecaprone 25 suture (Monocryl; Ethicon). The approximately 1-cm diameter puncture wound lateral to the surgical incision was debrided with a #10 blade and flushed with sterile saline. The patient was stable under anesthesia and did not experience any significant episodes of hypoventilation (mean ETCO2 35 mmHg), hypoxia (mean SpO2 100%), or hypotension (mean systolic blood pressure 112 mmHg). The dog recovered from anesthesia uneventfully.

One day after surgery, the dog’s neurologic status was slightly improved. The dog was able to hold her head up but continued to be intermittently obtunded. The dog had a more significant rotary nystagmus, developed anisocoria, and had a persistent absent menace response in both eyes. The dog continued to be nonambulatory tetraparetic but had improved motor activity within the thoracic limbs. The MGCS was similar to the pre-operative value at 15.

The dog continued to show neurological improvement dur-ing the following 5 d of hospitalization. However, her mentation remained obtunded, with absent menace responses in both eyes and vestibular signs (rolling, head tilt to the left, nystagmus). During this time, the dog was transitioned to oral medications which included alprazolam (Sandoz, Princeton, New Jersey, USA), 0.03 mg/kg BW, PO, q8 to 12h, meclizine (Rugby Laboratories, Livonia, Michigan, USA), 3.1 mg/kg BW, PO, q24h, leveti-racetam (Keppra; Northstar Rx, Memphis, Tennessee, USA), 30 mg/kg BW, PO, q8h, meloxicam (Metacam; Boehringer

Ingelheim Vetmedica, St. Joseph, Missouri, USA), 0.1 mg/kg BW, PO, q24h, amantadine hydrochloride (Pharmaceutical Associates, Greenville, South Carolina, USA), 2 mg/kg BW, PO, q24h, amoxicillin trihydrate/ clavulanate potassium (Clavamox; Zoetis, Kalamazoo, Michigan, USA), 15.6 mg/kg BW, PO, q12h, gabapentin (Amneal Pharmaceuticals, Bridgewater, New Jersey, USA), 10 mg/kg BW, PO, q8 to 12h, and tramadol (Amneal Pharmaceuticals of New York, Hauppauge, New York, USA), 3 mg/kg BW, PO, q8 to 12h. The dog was discharged 7 d after surgery to the care of the owners with a MGCS of 16. The dog’s neurological abnormalities at time of discharge included a dull mentation, improved but persistent rotary nystagmus, absent menace response in both eyes, and a head tilt to the left. The dog was unable to ambulate due to the profound vestibular ataxia, but had strong motor activity in all limbs.

The 1 wk recheck from discharge showed slow improvement. The dog continued to be dull, but was more responsive and aware of her surroundings. The nystagmus was no longer pres-ent. The dog was also regaining some vision in her left eye and had an intermittent menace response, but continued to have an absent menace response in the right eye. She was experiencing profound vestibular ataxia and tried to roll to the left continu-ously. She had excellent withdrawals and motor activity in all limbs.

The dog continued to improve, and at her 2 mo recheck she was bright and alert and had a menace response in both eyes. There was a mild left head tilt and she was ambulatory with moderate vestibular ataxia. In addition, according to the owners, she had regained most of her pre-injury personality. At 6 mo, the owners stated that they were very happy with the dog’s contin-ued improvement with only minor vestibular ataxia still present.

DiscussionThis case report describes the use of a craniectomy within 24 h of TBI to remove a penetrating bone fragment causing a parenchymal brain lesion. There is a dearth of literature in veterinary medicine on craniectomies in the setting of TBI. There have been case reports of dogs and cats having craniecto-mies performed; however, these reports describe debridement of an abscess associated with a previous injury or removal of a partial bullet fragment a few days after the incident in a patient with normal mental status (7–11). The present case specifically reports surgery in the acute setting (, 24 h) after a laceration causing a compressive fracture within the brain parenchyma.

Based on the examination, this patient’s injury was neu-rolocalized to the central vestibular portions of the brain based on her mentation (abnormal level of consciousness), gait abnormalities (tetraparesis and vestibular ataxia), and cranial nerve deficits (nystagmus). The progressive changes on her neurologic examination, specifically the miosis and worsening mentation change, indicated compression of the midbrain or a severe prosencephalic lesion. The progression to a deficit with the menace response most likely indicated a lesion affecting the central visual cortex.

The CT imaging showed evidence of the fracture affecting the skull and causing damage to the cerebral cortex. There are 2 potential explanations for her neurologic clinical symptoms.



RA

PP

OR

T D

E C

AS

One possibility is that the cerebral edema also caused secondary edema and swelling leading to increased intracranial pressure causing transtentorial and/or transforaminal herniation, which is likely, given the clinical signs of a Cushing’s reflex, changes in mentation, and pupil size. The brainstem is difficult to accurately image via CT (due to beam hardening artifact). The other possibility is that the traumatic injury caused a lesion in the conscious vestibular pathway. This is less well-described in the canine species and is likely associated with the conscious auditory pathway projecting from the thalamus (via the medial geniculate nucleus), through the internal capsule, to the vestibu-lar cortex in the temporal lobe (12).

There is substantial controversy about the use of medi-cal versus surgical management for stabilization of veterinary patients with TBI after primary injury (which is the acute, direct injury causing mechanical damage). Medical manage-ment is aimed at minimizing secondary injury, which occurs minutes to days following the trauma and consists of systemic physiologic insults that may decrease cerebral perfusion pres-sure, worsen cerebral edema, increase intracranial pressure, and damage the blood-brain barrier (2). Our patient, therefore, received 16 h of medical management with intravenous fluids to prevent hypotension, oxygenation to prevent hypoxia, and mannitol to decrease presumed spikes in intracranial pressure from cerebral edema (13). Seizures have also been reported to worsen secondary injury, and given that this patient had several risk factors for the development of early seizures after TBI (13), the dog was started on prophylactic anti-convulsants (14,15). During this stabilization period, the neurologic status of the patient was assessed serially to determine the efficacy of treat-ments (including motor activity, brain stem reflexes, and level of consciousness to calculate the MGCS score) (6).

While medical therapy remains the mainstay of TBI in vet-erinary medicine, surgery may be warranted in cases of failed medical treatment, ongoing hemorrhage, hematomas, foreign bodies, pneumocephalus, depressed skull fractures, midline shift of falx cerebri, and compression of the basilar cisterns (2,4,9,16,17). These recommendations are based on little data, as the only experimental surgical study involved healthy dogs and concluded that ICP decreased after the combination of surgical therapies (including craniectomy and durotomy) and medical therapies (including ICP lowering treatments). This study, however, did not differentiate medical versus surgical management (18). In our patient, although medical manage-ment was associated with an overall neurological improvement based on MGCS, surgery was recommended due to the presence of depressed skull fractures, suspected contamination from the bite wound, pneumocephaly, and a midline shift on CT. After surgery, the dog displayed continued evidence of neurological improvement, and at 6 mo after surgery the dog only had mild neurological deficits.

There have been numerous human studies investigating the role of decompressive craniectomies in TBI with varying out-comes. Some of the evidence indicates that they may be useful in patients with severe TBI refractory to medical therapy. A 2012 comprehensive review in human medicine showed that decom-pressive craniectomies may be associated with reduced ICP

values at 24 h and 48 h, although the correlation of ICP with clinical outcome is uncertain (19). In addition, the RESCUEicp study concluded that patients undergoing surgery had lower mortality rates at 6 mo after injury, but higher vegetative states, compared with standard medical therapy (5). The DECRA trial, evaluating early decompressive craniectomy (, 72 h) versus standard medical therapy in patients with severe diffuse TBI and refractory intracranial hypertension, showed that although surgery decreased ICP and length of stay in the intensive care unit, it was associated with more unfavorable outcomes (20). Similarly, a 2016 systematic review concluded that decompres-sive craniectomy was not associated with a favorable outcome compared to medical therapy (1). Due to a lack of consensus on treatments for TBI in humans, the Brain Trauma Foundation recommendations were modified to include decompressive craniectomies for the management of severe TBI, but recognize that there is insufficient high-quality body of evidence on the topic (21).

Another ongoing debate in both human and veterinary medi-cine involves the ideal timing of surgical intervention after TBI. Given that there have been several reports of intracranial abscess formation after a bite wound in dogs (7,8,10), it was presumed in this case that early surgical intervention and debridement of an open wound to the brain parenchyma would minimize the risk of bacterial proliferation and decrease patient morbidity. As such, surgery was recommended as soon as the dog was stable (, 24 h after injury), and was associated with a favorable out-come. There is no veterinary evidence to support ideal timing of surgical debridement, and human literature is contradictory on this matter. The time frame to the development of general-ized infection is considered to be approximately 6 h, and thus prompt wound management would be ideal (22). Culture results from samples obtained during surgery were negative, although only aerobic cultures were submitted. Aerobic bacteria are most common in nonpurulent dog bite wounds which is the reason, in addition to cost, anaerobic culture was not performed. It is possible that anaerobic bacteria were present (23). One prospective human study showed that there was no detriment in outcome in patients who received early (, 24 h) surgical management with a decompressive craniectomy compared to those who had longer medical management and stabilization (. 24 h) before surgery (17). Another human study, however, concluded that a higher survival rate was found in the group of patients who had late decompressive craniectomies (after . 24 h of stabilization or clinical deterioration), compared to early surgical intervention (, 24 h after injury) (24).

Finally, recommendations about treatment may be cen-tered on certain prognostic indicators associated with TBI. In humans, poor prognostic indicators on advanced imaging include compressed or absent basilar cisterns, the presence of subarachnoid hemorrhage, midline shift, and intracranial hemorrhagic lesions (25). In addition, skull fractures in certain anatomical locations, brain herniation, and an increased size of the intraparenchymal lesion, have also been associated with a poor prognosis in dogs and humans (26–29). In dogs with head trauma (but not specifically TBI), prognosis was also associated linearly with a decreased MGCS, poor perfusion (evidenced by



CA

SE

RE

PO

RT

metabolic acidosis and hyperlactatemia) and decreased SpO2, severe concurrent injuries, or a requirement for hypertonic saline or endotracheal intubation (30). In the present case, the dog displayed many of these negative prognostic indicators on presentation, including intracranial hemorrhage, midline shift, and skull fractures. Despite these, the dog showed some improvement with pre-operative medical management (oxygen, intravenous fluids, and mannitol therapy), and remained stable during the peri- and post-operative periods. Although it is unknown whether medical management would have resulted in the same outcome, this case report may provide evidence to support that the use of early aggressive medical management and surgical intervention can be associated with a positive outcome, even in severely affected dogs.

We describe a canine patient with a compressive skull fracture and penetration into the brain parenchyma after a traumatic injury and subsequent surgical removal of the fragment. After surgery the patient continued to improve, with only mild neurologic abnormalities remaining. Surgical intervention may be indicated in patients with contaminated, compressive, and open fractures into the brain parenchyma. Based on the insuf-ficient data on decompressive craniectomies in dogs with TBI, additional studies are necessary to determine which patients will benefit from medical or surgical therapy, the ideal timing of surgery, and prognostic indicators. Until then, every TBI case should be assessed individually and the clinician should determine whether medical therapy alone is sufficient, or if the patient may benefit from surgical intervention, based on their type and severity of injuries, level of contamination, response to medical management, and ability to withstand anesthesia. As seen in this case report, aggressive therapy may yield a good prognosis despite severe parenchymal lesions of the brain. CVJ

References1. Barthélemy EJ, Melis M, Gordon E, Ullman JS, Germano IM.

Decompressive craniectomy for severe traumatic brain injury: A sys-tematic review. World Neurosurg 2016;88:411–420.

2. Sande A, West C. Traumatic brain injury: A review of pathophysiology and management. J Vet Emerg Crit Care 2010;20:177–190.

3. Haddad SH, Arabi YM. Critical care management of severe traumatic brain injury in adults. Scand J Trauma Resusc Emerg Med 2012; 20:1–15.

4. Dewey CW. Emergency management of the head trauma patient: Principles and practice. Vet Clin North Am Small Anim Pract 2000; 30:207–225.

5. Hutchinson PJ, Kolias AG, Timofeev IS, et al. Trial of decompressive craniectomy for traumatic intracranial hypertension. N Engl J Med 2016;375:1119–1130.

6. Platt SR, Radaelli ST, McDonnell JJ. The prognostic value of the modi-fied Glasgow Coma Scale in head trauma in dogs. J Vet Intern Med 2001;15:581–584.

7. Bilderback AL, Faissler D. Surgical management of a canine intracranial abscess due to a bite wound. J Vet Emerg Crit Care 2009;19:507–512.

8. Wouters EG, Beukers M, Theyse LF. Surgical treatment of a cerebral brain abscess in a cat. Vet Comp Orthop Traumatol 2011;24:72–75.

9. Haley AC, Abramson C. Traumatic pneumocephalus in a dog. J Am Vet Med Assoc 2009;234:1295–1298.

10. Costanzo C, Garosi LS, Glass EN, Rusbridge C, Stalin CE, Volk HA. Brain abscess in seven cats due to a bite wound: MRI findings, surgi-cal management and outcome. J Feline Med Surg 2011;13:672–680.

11. Park S, Park J, Kim JM, et al. Penetrating cranial injury due to gunshot in a dog: A case report. Veterinarni Medicina 2010;55:253–257.

12. De Lahunta A, Glass EN, Kent M. Vestibular system, special proprio-ception. In: Veterinary Neuroanatomy and Clinical Neurology. 4th ed. St. Louis, Missouri: Elsevier Health Sciences, 2014:338–367.

13. Syring RS. Assessment and treatment of central nervous system abnor-malities in the emergency patient. Vet Clin North Am Small Anim Pract 2005;35:343–358.

14. Steinmetz S, Andrea T, Wolfgang L. Epilepsy after head injury in dogs: A natural model of posttraumatic epilepsy. Epilepsia 2013;54:580–588.

15. Bratton SL, Chestnut RM, Ghajar J, et al. Brain trauma founda-tion guidelines for the management of severe traumatic brain injury XIII antiseizure prophylaxis. J Neurotrauma 2007;24:83–85.

16. Dewey CS, Fletcher DJ. Head-trauma management. In: Dewey CW, da Costa RC, eds. Practical Guide to Canine and Feline Neurology. 3rd ed. Ames, Iowa: John Wiley & Sons, 2015:587–615.

17. Wen L, Wang H, Wang F, et al. A prospective study of early versus late craniectomy after traumatic brain injury. Brain Inj 2011;25:1318–1324.

18. Bagley RS, Harrington ML, Pluhar GE, et al. Effect of craniectomy/durotomy alone and in combination with hyperventilation, diuretics, and corticosteroids on intracranial pressure in clinically normal dogs. Am J Vet Res 1996;57:116–119.

19. Bor-Seng-Shu E, Figueiredo EG, Amorim RL, et al. Decompressive craniectomy: A meta-analysis of influences on intracranial pressure and cerebral perfusion pressure in the treatment of traumatic brain injury: A review. J Neurosurg 2012;117:589–96.

20. Cooper DJ, Rosenfeld JV, Murray L, et al. Decompressive craniectomy in diffuse traumatic brain injury. N Engl J Med 201;364:1493–502.

21. Carney N, Totten AM, O’Reilly C, et al. Guidelines for the manage-ment of severe traumatic brain injury, 4th ed. Neurosurg 2017;80:6–15.

22. Hosgood G. Open wounds. In: Tobias KM, Johnston SA, eds. Veterinary Surgery: Small Animal. 1st ed. Vol 2. Milton, Ontario: Elsevier Health Sciences, 2013:1210–1220.

23. Abrahamian FM, Goldstein EJC. Microbiology of animal bite wound infections. Clin Microbiol Rev 2011;24:231–246.

24. Albanèse J, Leone M, Alliez JR, et al. Decompressive craniectomy for severe traumatic brain injury: Evaluation of the effects at one year. Crit Care Med 2003;31:2535–2538.

25. Kim JJ, Gean AD. Imaging for the diagnosis and management of trau-matic brain injury. Neurotherapeutics 2011;8:39–53.

26. Beltran E, Platt SR, McConnell JF, Dennis R, Keys DA, De Risio L. Prognostic value of early magnetic resonance imaging in dogs after traumatic brain injury: 50 cases. J Vet Intern Med 2014;28: 1256–1262.

27. Yuh EL, Mukherjee P, Lingsma HF, et al. Magnetic resonance imaging improves 3-month outcome prediction in mild traumatic brain injury. Ann Neurol 2013;73:224–235.

28. Tanoue K, Matsui K, Nozawa K, Aida N. Predictive value of early radiological findings in inflicted traumatic brain injury. Acta Paediatr 2012;101:614–617.

29. Yanai H, Tapia-Nieto R, Cherubini GB, Caine A. Results of magnetic resonance imaging performed within 48 hours after head trauma in dogs and association with outcome: 18 cases (2007–2012). J Am Vet Med Assoc 2015;246:1222–1229.

30. Sharma D, Holowaychuk MK. Retrospective evaluation of prognostic indicators in dogs with head trauma: 72 cases (January–March 2011). J Vet Emerg Crit Care 2015;25:631–639.




Dietary imbalances in a large breed puppy, leading to compression fractures, vitamin D deficiency, and suspected nutritional secondary hyperparathyroidism

Moran Tal, Jacqueline M. Parr, Shawn MacKenzie, Adronie Verbrugghe

Abstract — A 6-month-old intact female giant schnauzer dog fed a nutritionally unbalanced homemade diet was evaluated because of a 1-month history of lameness and difficulty walking. Abnormalities identified on ancillary tests, in conjunction with the dog’s clinical improvement following diet change, suggested a diagnosis of vitamin D deficiency and nutritional secondary hyperparathyroidism. This report underlines the importance of appropriate feeding management, especially during the vulnerable growth phase.

Résumé — Déséquilibres alimentaires chez un chiot de grande race causant des fractures de compression, une carence en vitamine D et de l’hyperparathyroïdisme soupçonné secondaire à la nutrition. Une chienne Schnauzer géante intacte âgée de 6 mois qui consommait une diète maison qui n’était pas équilibrée sur le plan nutritionnel a été évaluée en raison d’une anamnèse de 1 mois de boiterie et de difficultés ambulatoires. Les anomalies identifiées sur des tests ancillaires, de concert avec l’amélioration clinique du chien après le changement de diète, suggéraient un diagnostic de carence en vitamine D et d’hyperparathyroïdisme nutritionnel secondaire. Ce rapport souligne l’importance d’une gestion appropriée de l’alimentation, particulièrement durant la phase de croissance vulnérable.


G rowing dogs have more demanding dietary requirements than adult dogs (1–3). Unbalanced diets can lead to

nutritional deficiencies or excesses, resulting in detrimental health consequences, especially during growth (4). These clini-cal consequences are most evident in puppies (5,6) with adult weights . 23 kg (6), as they are more prone to diseases related to rapid growth. Such diseases include developmental orthopedic diseases (DODs) (e.g., osteochondritis dissecans, osteochon-

drosis, retained cartilaginous core, panosteitis, hypertrophic osteodystrophy, canine elbow dysplasia, and hip dysplasia) (7) and dilated cardiomyopathy (8). Previous studies dem-onstrated malnutrition, especially energy excess, suboptimal concentrations of dietary vitamin D (VitD), calcium (Ca), and phosphorus (P), as well as a reverse Ca to P ratio (Ca:P), to be a risk factor for the development of DODs in large breed pup-pies (6,9). This report presents an assessment of the nutritional requirements for growth of a large breed puppy as a result of clinical implications due to feeding an unbalanced homemade diet and accounts for the key nutritional factors mentioned above when designing the diet plan.

Case descriptionA 6-month-old, intact female giant schnauzer dog was presented to the Ontario Veterinary College Health Sciences Centre (OVC-HSC) Neurology Service with an acute onset of general-ized pain and paraparesis. Medical history revealed lameness, dif-ficulty walking, and yelping/painful episodes with an unknown trigger during the past 2 mo. One month before consultation at the OVC-HSC, the dog was presented to the referring vet-erinarian with suspected urinary infection — a urine pH of 8, elevated leukocytes (30 to 50/4003 field), and a small amount of bacteria on urinalysis (urine sample collected via free catch). The patient was treated initially with amoxicillin/clavulanic acid [12.5 mg/kg body weight (BW), PO, q12h], based on a first-line drug choice approach (10). On physical examination at the OVC-HSC the puppy was tense and rigid, especially on hind limb palpation. Lumbar pain was noted particularly with

Department of Clinical Studies, Ontario Veterinary College, University of Guelph, Guelph, Ontario N1G 2W1.Address all correspondence to Dr. Adronie Verbrugghe; e-mail: [email protected]. MacKenzie’s current address is Toronto Veterinary Emergency Hospital, Toronto, Ontario M1R 3B1.Dr. Parr’s current address is Royal Canin Canada, Puslinch, Ontario N0B 2J0.This case report won 1st place in the American Academy of Veterinary Nutrition (AAVN) Case Report Contest 2016, and will be published as an abstract in the AAVN newsletter.Disclaimer: Adronie Verbrugghe is the Royal Canin Veterinary Diets Endowed Chair in Canine and Feline Clinical Nutrition at the Ontario Veterinary College.Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.



CA

SE

RE

PO

RT

extension of the hips. The dog was tachypneic and in pain upon abdominal palpation. She was non-ambulatory in her hind legs, lacked proprioception, had a hunched posture, and was knuckling bilaterally.

Nutritional screening evaluation was performed according to the World Small Animal Veterinary Association nutritional assessment guidelines (11). Growth, feeding with an uncon-ventional diet, and the medical condition of the puppy were immediately identified as nutritional risk factors. The owner had fed the puppy a homemade diet since it was 2 mo old. The homemade diet was based on instructions provided on the Canine Life website (http://www.theskyesthelimit.com/). Some alterations were made by the owner. The recipe contained a combination of ingredients; i.e., 2 lbs of regular ground beef, 2 cups of grated carrots, 2 cups of green beans and broccoli, 2 to 3 tbsp of refined sunflower oil, 2 red apples, 3 eggs, 2 cloves of garlic, 3 to 4 cups of brown rice flour, and 1/2 a cup of oat bran per day. All ingredients were mixed together and baked into muffins. Batches of raw ingredients were prepared weekly by the owner and stored in the freezer. Four meals were fed per day. In addition to this daily portion, the dog received 1/2 to 1 cup of cooked white organic rice, apples and carrots, one capsule of cod liver oil, and 1 tsp of bone meal. The brands and manufacturers of the supplements were unknown to the owner. The patient weighed 20.36 kg with a normal body condition score (BCS) of 5/9 (12) and mild muscle wasting, likely due to disuse and

potentially malnutrition (13). Previous information regard-ing the puppy’s BCS or weight was not obtainable. Therefore, although growth standards for various dog breeds are becoming more available, to compare an individual’s growth to a healthy reference population (14), this method was not applicable in the current case. An extended nutritional evaluation was indicated (11). The owner consented to further diagnostics and assess-ment of the homemade diet. The complete blood (cell) count (CBC) was unremarkable. When compared to a reference range for similarly aged dogs (15), serum total Ca and P concentra-tions were decreased, and serum alkaline phosphatase (ALP) and creatine kinase (CK) were elevated on the biochemistry profile (Table 1). A sterile urine sample was obtained through cystocentesis. Urinalysis showed elevated leukocytes (200 to 250/4003 field), pH = 7.5, specific gravity = 1.020. Urinary culture revealed Escherichia coli, susceptible to various antibiotics including cefazolin. Treatment with cefazolin (TEVA cefazolin; Teva Canada, Scarborough, Ontario), 22 mg/kg body weight (BW), IV, every 12 h was initiated.

Differential diagnoses included nutritional VitD deficiency, nutritional secondary hyperparathyroidism (NSH), discospon-dylitis, autoimmune meningomyelitis, spinal empyema, trauma (causing fracture/luxation), and parasitic myelitis (toxoplasma, neospora). Primary hyperparathyroidism was less likely, as hypocalcemia was evident, and not hypercalcemia (16). As there was no evidence of renal dysfunction on urinalysis or blood analysis, renal secondary hyperparathyroidism was considered unlikely (17).

For further evaluation of the acute neurological abnormalities, thoracolumbar spinal radiographs were taken and magnetic reso-nance imaging (MRI) was performed. Diagnostic imaging tests were focused on the thoracic and lumbar spine based on local-ization of neurological deficits and normal findings on physical and orthopedic examination of the front and hind limbs. On orthogonal radiographs of the thoracic and lumbar spine the entire axial skeleton had a reduced opacity with thinning of the cortices and reduced trabecular markings. Multiple vertebral bodies were misshapen, being shortened and more cuboidal than rectangular in shape. The L2 vertebral body had a trapezoidal shape and centered at the L1-2 intervertebral disc there was mild kyphosis (Figure 1). Magnetic resonance imaging of the thoracic and lumbar spine was carried out to further evaluate the abnormalities seen on spinal radiographs and to determine the sites of and degree of spinal cord compression contributing to the acute neurological deficits (Figure 2). Sequences acquired for images included: T2*-weighted single shot fast-spin echo (FSE) in a sagittal plane; T2-weighted FSE in sagittal, dorsal, and transverse planes; T1-weighted FSE in transverse plane; short tau inversion recovery (STIR) in a sagittal plane; T1-weighted FSE in transverse and sagittal planes following intravenous contrast administration. The MRI showed compression fractures of mul-tiple vertebrae (chronic fractures) and an intramedullary spinal cord lesion from L2 to L5 (Figure 2A). A vertebral compression at L4 was associated with marked narrowing of the vertebral canal, attenuation of the subarachnoid space, and loss of the epi-dural fat (Figure 2B). The muscles surrounding the L4 vertebral body had increased signal intensity on T2-weighted and STIR

Table 1. Serum biochemical panel and vitamin D profile of a 6-month-old intact female giant schnauzer dog at presentation and before discharge.

Blood ReferenceParameters analysis range Units

Serum biochemical panela Glucose 4.6 5.39 to 9.22 mmol/L Total protein 61 45 to 73 g/L Albumin 3.7 2.6 to 3.7 g/L Globulins 24 22 to 35 g/L ALP 473 126 to 438 U/L ALT 14 # 32 U/L CK 1058 40 to 192 U/L GGT 4 # 4.3 U/L Amylase 1238 # 1683 U/L Lipase 28 # 139 U/L Cholesterol 8.8 2.6 to 12.9 mmol/L Bilirubin 2.05 0.17 to 2.22 mmol/L BUN 4.2 3.3 to 13.3 mmol/L Creatinine 83.1 23.9 to 77.8 mmol/L Chloride 119 99 to 120 mmol/L Magnesium 1.8 1.4 to 5.2 mmol/L Phosphorus 3.8 5.6 to 9.6 mmol/L Potassium 3.9 3.9 to 6.1 mmol/L Sodium 156 139 to 159 mmol/L Total calcium 2.1 2.5 to 3.3 mmol/L

Vitamin D profileb

iCa 1.5 1.25 to 1.45 mmol/L PTH 4.6 0.50 to 5.80 pmol/L 25(OH)D 8 60 to 215 nmol/L

ALP — alkaline phosphatase; ALT — alanine aminotransferase; GGT — gamma-glutamyl transpeptidase; BUN — blood urea nitrogen; CK — creatine kinase; iCa — ionized calcium; PTH — parathyroid hormone; 25(OH)D — 25-hydroxyvitamin D.a Values at presentation. Reference range: puppies 4 to 6 months old (Reference 15).b Values at discharge (2 days following presentation). Reference range: DCPAH —

Michigan State University, Diagnostic Center for Population & Animal Health.



RA

PP

OR

T D

E C

AS

images, and were moderately contrast enhancing. There was no evidence of spinal cord compression at the T8 or L2 vertebrae (Figure 2C). Given the severity of the changes at this level an acute fracture was suspected and the paraparesis was attributed to this lesion. The growth plates appeared normal for a dog this age, with no indication that the compression fractures involved the endplates. The differential diagnosis for the intramedullary lesion included edema or syringohydromyelia.

The diet was analyzed using computer software (Balance IT online formulation and supplements, West Sacramento, California, USA) and a homogenized sample of the diet (obtained from the owner) was sent for proximate analysis and analyses of minerals (SGS Agri-food Laboratories, Guelph, Ontario) and VitD (NF EN 12821: Determination of vita-min D by high performance liquid chromatography (HPLC) — Measurement of cholecalciferol (vitamin D3) and ergocalciferol (vitamin D2) (Table 1). Both analyses included the main recipe, the additional rice portion, and the 2 supplements. For the software analysis, since the owner was not familiar with the brands or manufacturers, commercially available supplements were added to match the recipe as closely as possible, so that it could be compared to the laboratory analysis. The computer-generated diet analysis represents an estimation of the dietary nutrient profile based on ingredient composition available in an online nutrient database [United States Department of Agriculture (USDA) National Nutrient Database for Standard

Reference Release]. However, the laboratory diet analysis rep-resents the actual nutrient composition of this puppy’s diet (all ingredients and supplements, per owner). The findings of this laboratory analysis were not available until 10 d after presenta-tion. Therefore, an initial computer-generated diet analysis was performed and revealed deficiencies in protein, Ca, chloride, copper, iodine, iron, P, potassium, sodium, selenium and zinc, vitamin E, choline and riboflavin (the most relevant nutrients are shown in Table 2).

Based on the dog’s clinical presentation, initial diagnostics (abnormalities on blood analysis, radiographs and MRI), and the presence of nutrient deficiencies assessed by computer soft-ware (Table 2), the presumptive diagnosis was NSH (18,19). The prognosis for this patient was guarded to poor, and eutha-nasia was considered. However, the owner decided to pursue treatment.

Previous studies have demonstrated malnutrition, especially energy excess, suboptimal dietary VitD, Ca, and P content, as well as a reverse Ca:P ratio, to be a risk factor for DODs in large breed puppies (6,9). Accordingly, on the day of presentation the puppy was immediately transitioned to a balanced commercial large breed puppy dry food (Table 2), accounting for the key nutritional factors mentioned. The daily energy requirement (DER) was calculated, based on a current ideal body weight of 20.36 kg, to be 1476 kcal/day using a DER factor of 2.2 [DER = 70 3 (20.36)^0.75 3 2.2 = 1476 kcal/day] (20,21).

Figure 1. Lateral radiograph of the thoracolumbar vertebrae of an intact 6-month-old female giant schnauzer dog fed an unbalanced homemade diet. The thoracic and lumbar vertebrae have a reduced opacity and thin cortices. The vertebral body of L2 has a trapezoid shape. The vertebral body of T8 is shortened, being more cuboidal in shape.

Figure 2. Magnetic resonance images of the thoracolumbar spine of an intact 6-month-old female giant schnauzer dog fed an unbalanced homemade diet. A — Sagittal T2-weighted image of the thoracolumbar spine showing an increase in size of the spinal cord from L2 to L5, with an associated increased medullary T2 signal intensity. The L4 vertebral body is shortened with a non-uniform T2 signal intensity and multifocal linear areas of low T2 signal intensity (arrow). Within the epaxial muscles surrounding the vertebral body there is a moderate increase in T2 signal intensity. Multiple other vertebral bodies are mildly misshapen and have inhomogenous T2 signal intensity and multifocal linear low signal intensities attributed to compression fractures. B — Transverse T2-weighted image at the level of L4 showing narrowing of the vertebral canal with attenuation of the subarachnoid space and loss of epidural fat. C — Transverse T2-weighted image at the level of L2 showing no attenuation of the subarachnoid space.



CA

SE

RE

PO

RT

The DER factor was chosen for a growing puppy that reached more than 50% of adult weight, but accounted for the dog being cage rested for 6 wk due to vertebral compression fractures, and was therefore lower than the recommended 2.5 for this growth period (20).

Prior to discharge, 2 d following admittance, a blood sam-ple was taken for analysis of parathyroid hormone (PTH), 25-hydroxyvitamin D [25(OH)D], and ionized Ca (iCa) (Diagnostic Centre for Population and Animal Health, Lansing, Michigan). The serum PTH concentration was within the refer-ence range, the serum 25(OH)D concentration was low, and the serum iCa concentration was slightly elevated (Table 1). At the time the blood sample was taken, the dog had been consuming a commercial puppy food for 48 h.

The results of the laboratory diet analysis became available 10 d after presentation. This analysis focused on fewer nutrients due to costs, so comparison to the computer-generated diet analysis was restricted to the nutrients assessed by the labora-tory. Differences between the 2 analyses included higher Ca, P, Ca:P, Na, VitD and lower protein with the computer software analysis compared with the laboratory analysis. These differences resulted from average nutrient profiles of the ingredients based on information from an online nutrient database (USDA — National Nutrient Database for Standard Reference Release) used within the computer software, and the addition of generic supplements to the recipe by the authors, as detailed informa-tion from the owner was lacking. Still, similar end results were obtained (Table 2), i.e., minimal dietary Ca and P concentra-tions, reversed Ca:P ratio, and dietary VitD content that was below the detection level of 100 IU/kg DM. These results suggested the diagnosis of NSH and also that the nutritional VitD deficiency most likely resulted in rickets. This was based on the dog’s young age and the consumption of an unbalanced diet since 2 months of age, although X-rays of the long bones were not performed to confirm this clinical diagnosis (4,18).

Two months after discharge, the puppy was re-checked at the OVC-HSC Neurology Service and the Clinical Nutrition Service. The puppy was bright, alert, and responsive, and the owner noted the positive trend for her recovery approximately 3 wk after discharge. At that time, neurological examination revealed marked improvement with only mild residual ataxia. The dog had also regained strength and had improved activity. On screening nutritional assessment (11), the patient weighed 24 kg and had a BCS of 6/9 (12) with mildly underdeveloped muscle (13). The owner confirmed feeding of the recommended commercial large breed puppy dry food (Table 2). Treats and unbalanced human foods (e.g., salmon skin, apple, carrot, and table scraps) were also given, but the exact amounts were unknown. The risks of excessive energy intake resulting in rapid growth rate and/or obesity during the growth period were explained to the owner, and the link to DODs was emphasised (22). Also, the risks of unbalanced nutrition were reiterated to the owner. The owner agreed to reduce the treats and unbal-anced human foods to no more than 10% of the recommended DER (23). The dog’s DER was recalculated to be 1446 kcal/day based on the estimated ideal body weight, which was reassessed to be 22.5 kg [(24 kg 3 75% lean mass)/80% lean mass] (24). The DER factor was reduced from 2.2 to 2 because of inactivity and overweightness [DER = 70 3 (22.5)^0.75 3 2.0 = 1446 kcal/day] (20). The diet remained the same, and a gradual increase in activity was recommended to improve muscle mass.

Follow-up with the owner 1 year after discharge revealed that the dog was doing well, although she became tired easily. Once rested, she resumed her normal activity. Her hunched posture was permanent. The owner was still feeding her the recommended commercial large breed puppy dry food (Table 2); however, he was about to transition her to an adult food, from the same manufacturer. The dog still received various treats in small amounts (e.g., cooked turkey necks, vegetables, fruits, and some of the muffin mixture that was given to her before

Table 2. Nutrient profiles of an unbalanced homemade diet, fed to a 6-month-old intact female giant schnauzer, and of the commercial puppy dry food given to this puppy following admission. The homemade diet was assessed by both computer software and laboratory analysis. The nutrient profiles of both diets are compared to the National Research Council (2) recommended allowance for growth and American Association of Feed Control Officials (AAFCO) (3) minimum requirements for growth.

Homemade diet

Softwarea Laboratoryb Puppy dry foodc NRC (2) AAFCO (3)

Moisture (%) 58.99 54.07 8.5Protein (% DM) 13.18 18.48 30.60 17.50 22.00Ca (% DM) 0.54 0.09 1.11 1.20 1.00P (% DM) 0.59 0.37 0.84 1.00 0.80Ca:P ratio 1:1.09 1:4 1.32:1 1.2:1e 1 to 2:1Na (% DM) 0.15 0.11 0.56 0.22 0.30K (% DM) 0.37 0.76 0.84 0.44 0.60Mg (% DM) 0.08 0.09 0.09 0.04 0.04VitD (IU/100 g DM) 58 , LODd 100 55.20 50.00ME (kcal/100 g DM) 431.3 NA 398.5

DM — dry matter; Ca — calcium; P — phosphorus; Na — sodium; K — potassium; Mg — magnesium; VitD — vitamin D; ME — metabolizable energy; NA — not available; LOD — limit of detection.a BalanceIT, West Sacramento, California.b SGS Agri-Food Laboratories, Guelph, Ontario.c Royal Canin Maxi Puppy dry food; formulated to meet the nutritional levels established by AAFCO (3) dog food nutrient

profiles for growth.d Upon laboratory analysis, the VitD content of the homemade diet was below the LOD of 100 IU/kg DM.e The ratio was calculated using the recommended allowance according to the NRC (2).



RA

PP

OR

T D

E C

AS

the initial admittance to the hospital). The owner was well aware of the risks for unbalancing the nutrient profile of the diet with excessive treats and the risks associated with feeding cooked bones. A recheck appointment with both the OVC-HSC Neurology and Clinical Nutrition Services was recommended, but the owner declined.

DiscussionNutritional recommendations for large breed puppies take into consideration key nutritional factors, such as energy, VitD, Ca, P, and Ca:P ratio (7). Energy excess results from offer-ing food free choice or above caloric needs, especially when a diet has a high fat content, and therefore high energy density. Excess energy during growth not only promotes obesity (25) and reduced longevity (26), but also promotes rapid growth, and hence DODs (27), such as hip dysplasia and subsequent osteoarthritis (28). Therefore, reduced energy density (350 to 400 kcal/100 g) and a moderate fat level [, 12% on a dry mat-ter (DM) basis], are recommended (6,24).

Passive Ca absorption occurs from 6 wk to 6 mo of age, and corresponds directly to dietary Ca intake (29). When the hormonal and intestinal regulation mature, active Ca absorp-tion represents 90% of Ca uptake (30). Excessive Ca intake was shown to promote occurrence of DODs, even with normal Ca:P ratio (6). Also, 1,25-dihydroxyvitamin D [1,25(OH)2D] may play a role in passive absorption of Ca in the small intestines and modulates active intestinal Ca absorption, as well as renal Ca reabsorption (18,30–32). Other calcitropic hormones, PTH, growth hormone, and calcitonin, are associated with active Ca absorption, and bone mineralization and remodelling (18). In puppies, excessive dietary Ca intake is negatively correlated to P absorption (29). Contrarily, a diet deficient in Ca, but high in P causes a reverse Ca:P ratio, resulting in NSH (18,22). Unbalanced homemade diets that contain a significant amount of meat commonly have high P concentrations (33). For grow-ing puppies 0.8% to 1.2% Ca on DM is recommended (2,3), and P is based upon Ca concentrations, to achieve an appropri-ate Ca:P ratio (22), of 1.2:1 calculated based on the National Research Council (NRC) recommended allowance for both minerals (2), or 1 to 2:1 based on the American Association of Food Control Officials (AAFCO) recommendations for growth (3). For large breed puppies the Ca:P ratio becomes more narrow at 1.1 to 1.3:1 (6). Therefore, if a homemade diet contains insufficient Ca and a reverse Ca:P ratio (above 1:2) occurs (4), this leads to NSH, demineralization of the bones, and skeletal deformity (34). Skeletal abnormalities manifest in 1 to 3 mo, affecting cancellous bone located in the epiphyseal plate of long bones or within the center of the vertebral bones. These areas become very thin, allowing the spiculae to collapse, causing compression fractures (18). Vitamin D and calcitropic hormones, such as PTH, and calcitonin, strongly influence bone and Ca metabolism in the growing dog. Vitamin D3 is formed in most mammals in the skin, under UV-B radiation. However, in dogs, it is an essential vitamin, absorbed from the diet (VitD3 — cholecalciferol, animal origin; VitD2 — ergocalciferol, plant origin), bound to VitD binding protein and transported to the liver for its first hydroxylation into 25(OH)D. A second hydrox-

ylation occurs in the kidneys into either the most biologically active metabolite, 1,25(OH)2D, or 24,25-dihydroxyvitamin D (18). Impaired metabolism or inappropriate dietary intake of VitD will lead to low concentration of serum 25(OH)D and its metabolites. Nutritional VitD deficiency combined with dietary Ca deficiency can manifest as both rickets and fibrous osteodystrophy. In fibrous osteodystrophy, fibrous connective tissue replaces mature bone due to osteoclastic resorption (35). However, in young mammals with open epiphyseal plates, these deficiencies will cause improper bone formation (defective min-eralization/calcification), potentially leading to deformities and fractures, i.e., rickets (18).

In NSH, an increase of 1,25(OH)2D is expected to promote intestinal absorption and renal reabsorption of Ca and P (18). However, if the diet contains insufficient amounts of VitD2 or VitD3, then low concentrations of serum VitD metabolites are inevitable, worsening the concurrent NSH. Nutritional VitD deficiency can also initiate NSH on its own, due to the reduced Ca absorption caused by hypovitaminosis D (18,36).

In this report, a 6-month-old large breed puppy was presented with vertebral compression fractures, suspected rickets, and NSH due to nutritional deficiencies caused by consumption of an unbalanced homemade diet, confirmed by computer- generated and laboratory diet analyses. The computer-generated diet analysis gives an estimation of nutrient composition based on average ingredient composition available in an online nutri-ent database. In addition, since no information was available from the owner regarding the VitD and bone meal supplements he used, common commercial supplements were added accord-ing to the amounts the owner gave, in order to have an approxi-mate initial assessment of the dog’s nutrient intake. This type of analysis was helpful as an initial assessment, and assisted in convincing the owner to have the laboratory analysis performed. The laboratory diet analysis assessed the actual nutrient profile of this puppy’s diet. Although the software analysis overesti-mated the content of Ca, P, Ca:P, Na, and VitD, and underesti-mated protein content (Table 2), both agreed on imbalances of the nutrients of concern. Serum total Ca measured on the day of presentation was lower than the reference range, and could be indicative of low dietary intake or reduced absorption, as a high correlation exists in puppies younger than 6 mo (Table 1) (29). Alkaline phosphatase is a membrane-associated enzyme which can originate from several tissues, including bone, and indicates damage. Creatine kinase (CK) is a cytosolic enzyme, highly active in muscular tissues, brain, and nerves. Increased serum CK concentrations are indicative of muscle damage, and if persistent, indicate on-going muscle damage (37), which in this case, could occur due to the vertebral fractures and the patient’s decreased mobility. An increase in creatinine was observed likely for the same reasons. The hypophosphatemia detected in the serum is a result of insufficient dietary calcium for intestinal passive absorption, reverse Ca:P ratio, and insufficient VitD, which resulted in deficient 1,25(OH)2D levels, and NSH; hence bone resorption (18). Unfortunately, it was difficult to convince the owner that further diagnostics should be done; therefore, serum samples for analysis of PTH, 25(OH)D, and iCa were not submitted on the day of presentation. A tentative diagnosis



CA

SE

RE

PO

RT

of nutritional VitD deficiency and NSH was made based on abnormalities on serum biochemical profile, the presence of vertebral compression fractures, muscle damage, and general-ized osteopenia found on radiographs and MRI, and further supportive findings resulting from the computer-generated diet analysis (Table 2). In this case, the spinal radiographs supported the diagnosis of NSH, but the degree of spinal cord compres-sion associated with the mild vertebral malalignment could not be determined on radiographs alone. An MRI examination was performed as a more sensitive and specific diagnostic test to determine the site and degree of spinal cord compression. The MRI was also used to assess for any lesions that could require surgical decompression. Since no clinical signs of swelling or discomfort were observed in the long bones, which are com-monly affected by NSH, no further diagnostics were performed to evaluate them.

On the day of discharge (48 h after presentation), the owner agreed to perform more in-depth blood analysis (Table 1). Serum iCa concentrations at discharge were mildly higher than the reference range, while serum PTH was within the reference range. Serum 25(OH)D concentrations were low compared with the reference range. In puppies younger than 6 mo, Ca absorp-tion is in direct proportion to the Ca in the diet (29) and passive absorption can represent up to 70% of Ca uptake (30). It is most likely that serum iCa and PTH concentrations normalized (Table 1) by the time of discharge due to passive Ca absorp-tion, especially since the dog was fed a commercial large breed puppy diet following admission (Table 2). However, 25(OH)D might have been too depleted to respond in just 2 d (Table 1). Continuing this diet was recommended as it seemed sufficient to normalize the serum Ca concentration without additional Ca supplementation. The dog continued to improve and recover on this diet after hospitalization, which was observed at the follow-up appointment.

This patient’s debilitating diet-induced diseases and perma-nent hunched posture emphasize the importance of not only nutritional assessment but also of client compliance, based on good client communication. The client had fed the puppy an unbalanced homemade diet since she was 2 mo old, believing that it would improve the dog’s health and strengthen their bond, as many pet owners do. Compassionate communication is required to relay medical findings to the owner, allowing the owner a better understanding of the diet-induced diseases, without blame, anger, or guilt (38). It was also important to set expectations that the dog would be permanently crippled, but could maintain a good quality of life if her pain could be managed. Once the owner understood the severity of the diet-induced diseases, he was willing to cooperate and change the dog’s diet based on the OVC-HSC Clinical Nutrition Service’s recommendations. At the time of the recheck, and also during the follow-up telephone conversation, the owner was satis-fied with the puppy’s improvement; however, it was still dif-ficult for him to maintain a strict regimen for treats, snacks, and human foods of no more than 10% of her daily energy requirements (23).

In conclusion, this report presented a case of nutritional VitD deficiency and NSH causing vertebral compression fractures,

due to a deficient homemade diet fed to a growing large breed puppy. Successful treatment was attributed to an appropriate nutritional assessment and diagnosis. However, a key to this success was the client’s compliance, which resulted from good communication and empathy, encouraging the owner not to focus on guilt and self-blame, but rather on promoting the dog’s recovery. CVJ

References 1. Kirk CA. New concepts in pediatric nutrition. Vet Clin North Am Small

Anim Pract 2001;31:369–392. 2. NRC. Nutrient Requirements of Dogs and Cats. Washington, DC: The

National Academies Press, 2006:357–358. 3. AAFCO. Association of American Feed Control Officials: Association

of American Feed Control Officials Incorporated, 2014:591. 4. Kawaguchi K, Braga IS, Takahashi A, Ochiai K, Itakura C. Nutritional

secondary hyperparathyroidism occurring in a strain of German shep-herd puppies. Jpn J Vet Res 1993;41:89–96.

5. Lauten SD, Cox NR, Brawner WR, et al. Influence of dietary calcium and phosphorus content in a fixed ratio on growth and development in Great Danes. Am J Vet Res 2002;63:1036–1047.

6. Lauten SD. Nutritional risks to large-breed dogs: From weaning to the geriatric years. Vet Clin North Am Small Anim Pract 2006;36: 1345–1359, viii.

7. Demko J, McLaughlin R. Developmental orthopedic disease. Vet Clin North Am Small Anim Pract 2005;35:1111–1135, v.

8. Sanderson SL. Taurine and carnitine in canine cardiomyopathy. Vet Clin North Am Small Anim Pract 2006;36:1325–1343, vii–viii.

9. Richardson DC, Toll PW. Relationship of nutrition to developmental skeletal disease in young dogs. Vet Clin Nutr 1997;4:6–13.

10. Weese JS, Blondeau JM, Boothe D, et al. Antimicrobial Use Guide-lines for Treatment of Urinary Tract Disease in Dogs and Cats: Antimicrobial Guidelines Working Group of the International Society for Companion Animal Infectious Diseases. Vet Med Int 2011; DOI 10.4061/2011/263768.

11. Freeman L, Becvarova I, Cave N, et al. WSAVA Nutritional Assessment Guidelines. J Small Anim Pract 2011;52:385–396.

12. Laflamme D. Development and validation of a body condition score system for dogs. Canine Pract 1997;22:10–15.

13. Baldwin K, Bartges J, Buffington T, et al. AAHA nutritional assessment guidelines for dogs and cats. J Am Anim Hosp Assoc 2010;46:285–296.

14. German AJ. Promoting healthy growth in pets. In: Proceedings of the WALTHAM International Nutritional Sciences Symposium (WINNS), Chicago, Illinois, 2016.

15. von Dehn B. Pediatric clinical pathology. Vet Clin North Am Small Anim Pract 2014;44:205–219.

16. Gear RNA, Neiger R, Skelly BJS, Herrtage ME. Primary hyperparathy-roidism in 29 dogs: Diagnosis, treatment, outcome and associated renal failure. J Small Anim Pract 2005;46:10–16.

17. Stillion JR, Ritt MG. Renal secondary hyperparathyroidism in dogs. Compendium (Yardley, PA) 2009;31:E8.

18. Rijnberk A. Clinical Endocrinology of Dogs and Cats. Dordrecht, The Netherlands: Kluwer Academic Publishers, 1996:167–175.

19. Dwivedi DK, Kushwaha RB, Gupta AK. Clinical management of patho-logical fractures due to rickets and osteopenia in a dog. Intas Polivet 2012;13:361–363.

20. Debraekeleer J, Gross KL, Zicker SC. Feeding growing puppies: Postweaning to adulthood. In: Hand MS, Thatcher CD, Remillard RL, Roudebush P, Novotny BJ, eds. Small Animal Clinical Nutrition. 5th ed. Topeka, Kansas: Mark Morris Institute, 2010:311–319.

21. Debraekeleer J. Appendices: Appendix F — Body Weights and Feeding Guides for Growing Dogs and Cats. In: Hand MS, Thatcher CD, Remillard RL, Roudebush P, eds. Small Animal Clinical Nutrition. 4th ed. Topeka, Kansas: Mark Morris Institute, 2000:1020–1026.

22. Richardson DC, Zentek J, Hazewinkel HAW, Nap RC, Toll PW, Zicker SC. Developmental orthopedic disease of dogs. In: Hand MS, Thatcher CD, Remillard RL, Roudebush P, Novotny BJ, eds. Small Animal Clinical Nutrition. 5th ed. Topeka, Kansas: Mark Morris Institute, 2010:667–713.

23. Yaissle JE, Holloway C, Buffington TCA. Evaluation of owner education as a component of obesity treatment programs for dogs. J Am Vet Med Assoc 2004;224:1932–1935.



RA

PP

OR

T D

E C

AS

24. Toll PW, Yamka RM, Schoenherr WD, Hand MS. Obesity. In: Hand MS, Thatcher CD, Remillard RL, Roudebush P, Novotny BJ, eds. Small Animal Clinical Nutrition. 5th ed. Topeka, Kansas: Mark Morris Institute 2010:501–541.

25. Grandjean D, Paragon B-M. Dietary induced disorders in the puppy. Rec Med Vet 1996;172:519–530.

26. Kealy RD, Lawler DF, Ballam JM, et al. Effects of diet restriction on life span and age-related changes in dogs. J Am Vet Med Assoc 2002; 220:1315–1320.

27. Zentek J, Meyer H, Dämmrich K. The effect of a different energy supply for growing Great Danes on the body mass and skeletal development. 3. Clinical picture and chemical studies of the skeleton. Zentralbl Veterinarmed. Reihe A 1995;42:69–80.

28. Kealy RD, Olsson S-E, Monti KL, et al. Effects of limited food con-sumption on the incidence of hip dysplasia in growing dogs. J Am Vet Med Assoc 1992;201:857–857.

29. Dobenecker B. Influence of calcium and phosphorus intake on the apparent digestibility of these minerals in growing dogs. J Nutr 2002; 132:1665S–1667S.

30. Tryfonidou MA, van den Broek J, van den Brom WE, Hazewinkel HA. Intestinal calcium absorption in growing dogs is influenced by calcium intake and age but not by growth rate. J Nutr 2002;132:3363–3368.

31. Brickman AS, Reddy CR, Coburn JW, Passaro EP, Jowsey J, Norman AW. Biologic action of 1,25-dihydroxy-vitamin D3 in the rachitic dog. Endocrinology 1973;92:728–734.

32. Puschett JB, Moranz J, Kurnick WS. Evidence for a direct action of cholecalciferol and 25-hydroxycholecalciferol on the renal transport of phosphate, sodium, and calcium. J Clin Invest 1972;51:373–385.

33. Remillard RL, Paragon BM, Crane SW, Debraekeleer J, Cowell CS. Making pet foods at home. In: Hand MS, Thatcher CD, Remillard RL, Roudebush P, eds. Small Animal Clinical Nutrition. 4th ed. Topeka, Kansas: Mark Morris Institute, 2000:163–181.

34. Palmer N. Metabolic diseases of bones. In: Jubb KVF, Kennedy PC, Palmer N, eds. Pathology of Domestic Animals. 4th ed. Vol. 1. San Diego, California: Academic Press, 1993:55–92.

35. Dittmer KE, Thompson KG. Vitamin D metabolism and rickets in domestic animals. Vet Pathol 2011;48:389–407.

36. Hazewinkel HAW, Tryfonidou MA. Vitamin D3 metabolism in dogs. Mol Cell Endocrinol 2002;197:23–33.

37. Côté E. Laboratory tests. In: Roth-Johnson L, ed. Clinical Veterinary Advisor Dogs and Cats. 1st ed. St. Louis, Missouri: Mosby, Elsevier, 2007:1424–1504.

38. Shaw JR, Adams CL, Bonnett BN, Larson S, Roter DL. Veterinarian-client-patient communication during wellness appointments versus appointments related to a health problem in companion animal practice. J Am Vet Med Assoc 2008;233:1576–1586.




Can Ureaplasma diversum be transmitted from donor to recipient through the embryo? Two case reports outlining U. diversum losses in bovine embryo pregnancies

M. Bronwyn Crane, Colleen A. Hughes

Abstract — Two bovine embryo recovery results are outlined from different herds. Both cases involve significant late gestational loss from embryos relating back to a single donor. Ureaplasma diversum was confirmed in 3 of 4 cases submitted for postmortem examination. Natural infection originating from the donor and transmitted to the recipient has not previously been documented.

Résumé — Peut-on transmettre Ureaplasma diversum du donneur au récipiendaire par l’embryon? Deux rapports de cas présentant des pertes associées à U. diversum lors de gestations d’embryons bovins. Deux résultats de récupération d’embryons bovins provenant de différents troupeaux sont présentés. Les deux cas portent sur la perte gestationnelle considérablement tardive d’embryons provenant d’un seul donneur. Ureaplasma diversum a été confirmé dans 3/4 des cas soumis à l’examen post mortem. Une infection naturelle provenant du donneur transmise au récipiendaire n’a pas été documentée antérieurement.


M ycoplasmas and ureaplasmas are recognized as 2 of the few potential pathogens that are not removed from embryos

through the recommended International Embryo Transfer Society (IETS) washing procedures (1,2). Ureaplasma diversum is a widespread commensal and pathogenic bacterium associated with vulvitis, endometritis, abortion, and infertility in cattle (3,4). When endemic within a herd, the typical clinical presenta-tion of U. diversum infection includes infertility and vulvitis (5). This article reports pregnancy results from 2 herds experiencing late gestational losses due to U. diversum, in which both herds had the same underlying and unique history of the affected pregnancies all originating from 1 embryo donor. This clinical presentation suggests that it may be possible for this bacterium to be transmitted by embryo transfer. Furthermore, this route of infection and the insidious nature of this bacterium may be more likely to result in late term pregnancy loss. Ureaplasma diversum is likely an unrecognized factor contributing to gesta-tional and neonatal losses in pregnancies from embryo transfer.

Case descriptionsHerd 1: Donor 1A, 1B, and 1CThe first case occurred in a herd of approximately 60 lactating Holstein cows in Nova Scotia. This herd was under regular veterinary care and had a comprehensive vaccination protocol in place for protection against infectious bovine rhinotracheitis (IBR) and bovine viral diarrhea (BVD) viruses. Frozen embryos from 3 donors (Donors 1A, 1B, and 1C) were purchased from a single herd in Ontario. The frozen embryos from each donor were from single collection procedures and therefore the same donor-sire matings. Frozen-thawed embryos were transferred into virgin heifer recipients. Transfers took place between September 2012 and May 2013 and occurred on 5 separate occasions when recipients were synchronized. Recipients that were not pregnant after embryo transfer were bred by artificial insemination (AI) and did not receive a second embryo. The transferred embryos from Donor 1A had an initial pregnancy rate of 7/7, or 100%. Embryos from Donor 1B had an initial pregnancy rate of 4/9, or 44%. Embryos from Donor 1C had an initial pregnancy rate of 5/7, or 71%. The pregnancy out-comes for embryos from Donor 1A are outlined in Table 1. Pregnancies resulting from embryos from Donors 1B and 1C were normal and all calves survived. One of those 9 births occurred early at 255 d; despite this, the calf did survive. Only 1 of the 7 pregnancies from Donor 1A resulted in a full-term surviving calf. The remaining 6 pregnancies were associated with pregnancy loss, stillbirths, premature births, and neonatal loss (Table 1). Each case was either suspicious of, or confirmed, as having U. diversum infection. During this time period, pregnan-cies from AI in heifers from the same groups as the recipients

Department of Health Management (Crane), Department of Biomedical Sciences (Hughes), Atlantic Veterinary College, University of Prince Edward Island, 550 University Avenue, Charlottetown, Prince Edward Island C1A 4P3.Address all correspondence to Dr. M. Bronwyn Crane; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.



RA

PP

OR

T D

E C

AS

were normal and none aborted, were stillborn, or experienced neonatal loss.

The first 3 losses from Donor 1A were not submitted for nec-ropsy. From the 3 calves submitted for necropsy, all polymerase chain reaction (PCR) tests for BVD, IBR, and Neospora caninum were negative and all aerobic bacterial cultures were negative. In addition, when fungal cultures, Coxiella burnetti PCR tests, or Chlamydia spp. PCR tests were performed, all were negative. Samples were submitted for mycoplasma/ureaplasma culture from all 3 calves and there was growth in 2 of the 3 cases. In the case with no mycoplasma/ureaplasma growth (Table 1; Embryo #4), a PCR test for U. diversum was not performed. In the case of Embryo #7 (Table 1), in which only a few colonies were detected by culture, the PCR test for Ureaplasma diversum was also positive.

The first postmortem (PM) examination (#1) was performed on a fresh premature fetus with a placenta that was aborted at 250 d gestation (PM #1, Table 1). This postmortem examination revealed focal placentitis and fetal pneumonia. The fetal pneu-monia consisted of inflammatory cells in the alveoli as well as small lymphoid cell aggregates seen near small bronchioles and blood vessels. The final diagnosis was an abortion of infectious etiology with lesions consistent with a ureaplasma infection. In this case, however, mycoplasmas and ureaplasmas were not isolated from the lung that was submitted for culture and a PCR test for ureaplasmas was not performed.

The second postmortem examination (PM #2) was performed on a fresh bull calf that was born alive at 268 d gestation. It was small for its gestational age and was euthanized (PM #2, Table 1). This postmortem examination revealed placentitis, conjunctivitis, and lung pathology, which was described as an immune-mediated response but not a bronchopneumonia. Lung histopathology showed significant infiltrations and accu-mulations of small lymphocytes throughout the lung near the vessels and bronchioles as well as in alveolar tissue. Sections of eyelid had extensive non-suppurative conjunctivitis with severe

goblet cell metaplasia in the epithelium. In this case, heavy growth (41) of U. diversum was cultured from the placenta and lung tissue.

The 3rd postmortem examination (PM #3) was performed on a frozen-thawed fetus that aborted at 250 d gestation. The placenta was not submitted with this fetus (PM #3, Table 1). Histological findings included lymphocytic infiltration in the lung near the bronchioles and a moderate to severe conjunc-tivitis. Ureaplasma diversum (few, 21) was cultured from the fetus and was also detected by PCR. The final diagnosis was antigenic stimulation in the lung, conjunctivitis, and late term ureaplasma abortion.

Herd 2: Donor 2The second case occurred in a herd of approximately 100 lac-tating Holstein cows in Prince Edward Island. This herd was also under regular veterinary care and had a comprehensive vaccination protocol in place for protection against IBR and BVD. Pregnancy diagnosis typically occurred between 28 and 42 d and again between 60 and 75 d after embryo transfer. On this farm, embryo collections from various donors were regularly performed (1 to 2/month). Embryo transfers and the resulting pregnancies were generally successful and uneventful.

Although this herd rarely purchased new animals, the own-ers purchased a virgin heifer (Donor 2) at 11 mo old and entered her into the herd in April 2014 with the intent of having her become an embryo donor. Three embryo recoveries were performed between May and September 2014 (Table 2; Flush #1 to #3). A significant proportion of frozen embryos from each of these flushes was sold and the outcomes associ-ated with these embryos are unknown. Fresh embryos were transferred into synchronized recipient heifers from the same housing group as the donor. Although not all the pregnancy outcomes are precisely known, 5/9 pregnancies resulting from fresh embryos from the first 3 flushes were lost after pregnancy diagnosis, with 3 occurring late in gestation (Table 2). Only

Table 1. Details and outcomes from the 7 embryos transferred that originated from Donor 1A in Herd #1. All 7 embryos resulted in pregnancies.

Embryo Gestation number Transfer date length Outcome Postmortem diagnoses

1 November 15, 2012 Full term Stillborn None performed

2 November 15, 2012 250 days Aborted None performed

3 February 6, 2013 270 days Survived 4 days None performed

4 February 6, 2013 250 days Aborted PM #1 — Placentitis and fetal pneumonia, no U. diversum growth, no U. diversum PCR performed

5 February 6, 2013 268 days Dysmature bull PM #2 — Placentitis, calf euthanized conjunctivitis, lung pathology,

U. diversum confirmed by culture (heavy growth), no PCR performed

6 February 6, 2013 Full term Live bull calf N/A

7 March 5, 2013 250 days Aborted PM #3 — No placenta submitted, conjunctivitis, lung pathology, U. diversum confirmed by culture (few colonies) and PCR positive



CA

SE

RE

PO

RT

1 postmortem examination was conducted from these losses. During this same time period, heifers in the same group as the recipients that received embryos from other donors or were bred by AI did not experience gestational losses.

The specimen submitted from herd 2 for postmortem exami-nation was a fresh female fetus, 250 d gestation with the placenta. The final diagnosis was placentitis and bronchopneu-monia. The moderate to severe placentitis was described as necrosuppurative, multifocal, and acute. The moderate to severe bronchopneumonia was described as neutrophilic, diffuse, and acute. Lesions were consistent with a bacterial infection, but bacterial cultures were non-diagnostic (mixed growth), fungal culture was negative and viral PCR tests were all negative. At the submitting clinician’s request, samples were sent for ureaplasma evaluation, which required diagnosis at an outside laboratory and cost approximately an additional $200. Ureaplasma diversum was cultured from the fetal lungs (few, 21) and the fetal aboma-sal fluid (few, 21). These findings explained the inflammatory changes observed in the placenta and fetal lungs, confirming that U. diversum was the cause of abortion in this case.

Donor 2 delivered a full term viable calf in June 2015 and was flushed 3 more times during her first lactation (Table 2; Flush #4 to #6). There were fewer fresh transfers with these flushes, yet 1 out of 2 pregnancies resulted in a mid-gestation loss.

DiscussionThe cases described in this report suggest that there is the potential for Ureaplasma diversum to infect embryos and then for these embryos to result in gestational losses in the recipient heifers. The postmortem results were conclusive for U. diversum infection as the cause of the abortion in 3 of the 4 submitted cases (Tables 1 and 2). Although U. diversum most commonly presents as vulvitis, endometritis, and infertility, it has been shown to cause sporadic abortions at any stage of gestation

(4), but most commonly mid to late gestation (5). Ureaplasma diversum infection also results in stillborn and weak calves (4,6). Based on studies of aborted fetuses, the prevalence of ureaplasma abortion is approximately 1.7% to 3% (7,8). The 2 herds described in this report experienced a cluster of losses among the embryo pregnancies that were suspicious of or confirmed as U. diversum infection in 67% (12/18) of the losses. In these 2 herds, infertility was not the presenting complaint among the recipient heifers, rather pregnancy loss and stillbirths were the prominent clinical problems. It is possible that if embryos are the source of the U. diversum infection, abortions, stillbirths, and weak neonates could be how the disease is manifested. By the time the problem was recognized in these 2 cases, the embryos had been dispersed and it was too late to evaluate the embryos themselves as a source of the disease cluster.

Embryo processing techniques have been developed to reduce the risk of transfer of infectious disease by in vivo-derived bovine embryos (9). The standard International Embryo Transfer Society (IETS) recommended washing procedure includes at least 10 washes with serial 1:100 dilutions of embryo holding medium and 2 trypsin treatments (10). This protocol removes almost all of the important pathogenic viruses and bacteria (11). However, mycoplasmas and ureaplasmas are not removed from embryos with this protocol (12). In addition, standard antibiot-ics present in embryo processing media are not effective against ureaplasmas and mycoplasmas (11). Previously published data on the prevalence of U. diversum has identified the organism in vulvo-vaginal swabs in 38.8% of cows and heifers with granular vulvitis (13), 44% of beef heifers (14), and 11% to 100% of cows’ vaginas (4). Therefore, it is possible that U. diversum pres-ent on the vulva may contaminate the flush catheter or solutions and exist in bovine embryo recoveries at a similar prevalence.

Typical characteristics of an abortion caused by U. diversum include a relatively fresh fetus and a placenta that is frequently retained and exhibits a placentitis (15). Lung pathology of the

Table 2. Details and outcomes from the embryos originating from Donor 2 in Herd #2.

Fresh embryo Total Number pregnancy Loss at Loss at viable pregnant/Number losses/Number 30 to 75 days to embryos fresh transfers pregnant 75 days full term

Flush 1 May 27, 2014 22 2/5 1/2 0 1 (150 days)

Flush 2 July 3, 2014 12 3/6 1/3 0 1 (Stillborn)

Flush 3 September 9, 2014 13 4/7 3/4 2a 1 (250 days)b

Flush 4 September 11, 2015 5 0/1 N/A N/A N/A

Flush 5 November 5, 2015 12 1/1 N/A N/A N/A

Flush 6 December 9, 2015 1 1/1 1/1 N/A 1 (100 days)

Totals 65 11/21 6/11 2 4a Pregnancies were thought to be lost in this time frame because there was no record of live births or late term abortions from these

recipients.b Calf submitted for necropsy (see PM report).N/A — Not available.



RA

PP

OR

T D

E C

AS

fetus and conjunctivitis are often reported as well (6). The only postmortem examination in this report that did not result in a positive U. diversum culture did have a diagnosis of placentitis and fetal pneumonia (Table 1), which is highly suggestive that U. diversum infection was the cause of the abortion. A PCR test for ureaplasmas was not part of this postmortem examina-tion. A PCR assay is a more sensitive test than culture because U. diversum requires special media to grow and it can be hard to isolate from clinical samples. In addition, the sample needs to be received at the laboratory quickly after collection and examined by personnel with expertise in ureaplasma and myco-plasma diagnoses (16). Most veterinary diagnostic laboratories have a standard diagnostic protocol for bovine specimens for postmortem investigation, but PCR testing for ureaplasmas is not usually included as a routine test. This occurred in the case of Herd 2, in which a PCR test for ureaplasmas had to be requested in addition to the standard postmortem examina-tion. Therefore, it is possible that U. diversum abortions are underreported.

Despite the standard procedures put in place to prevent disease transmission, there is a still a risk of introducing U. diversum from a donor’s vulva into her uterus during artifi-cial insemination. In fact, donor cows often undergo multiple inseminations after being super-ovulated. If this bacterium was transmitted into the uterus at the time of breeding, the uterus may have an established infection by the time of embryo collec-tion resulting in adherence of the U. diversum to the developing embryos. Also, certain donor cows may carry a higher load of this bacterium than others, as evidenced in a study that cul-tured ureaplasmas from cows’ vulvas for up to 3 mo following a herd outbreak of granular vulvitis (17). This would potentially explain why even if the donor cow appeared clinically normal at the time of insemination, she could still have U. diversum present in her vulva, which could therefore contaminate the embryos and embryo flush fluid during embryo recovery. It is also theoretically possible that these clusters are connected due to a cause other than the donor cow, such as through a contami-nated embryo transfer (ET) gun. However, if the technician’s ET gun was contaminated with this pathogen in these cases, there should have been an equal chance of infection among all embryos transferred, not only those from a single donor. In addition, in the case of Herd 2, different practitioners trans-ferred the embryos on different locations with the losses spread across both locations. Intravaginal device applicators could be another potential source of transmission among a herd, but the cows would most likely present with a vaginitis and possible infertility if these devices were the source. In the cases reported, intravaginal devices were not used. In both of these herds, the reproductive losses could all be linked to 1 donor cow, so con-tamination from ET guns or intravaginal devices was unlikely to be the cause.

In conclusion, this case report suggests that practitioners need to consider U. diversum as a possible infectious cause of bovine abortion in embryo pregnancies and pursue this dif-ferential diagnosis despite additional costs and testing. To the authors’ knowledge, these cases are unique in that there have been no other published reports describing a single donor cow as a potential cause of natural U. diversum infection originating from her transferred embryos. This report indicates the need to continue investigation into the potential for natural infection of U. diversum by adherence to the embryo. CVJ

References1. Britton AP, Miller RB, Ruhnke HL, Johnson WH. The recovery of

ureaplasmas from bovine embryos following in vitro exposure and ten washes. Theriogenology 1988;30:997–1003.

2. Stringfellow DA, Givens MD. Epidemiologic concerns relative to in vivo and in vitro production of livestock embryos. Anim Reprod Sci 2000;60–61:629–642.

3. Doig, PA, Ruhnke HL, MacKay AL, Palmer NC. Bovine granular vulvitis associated with ureaplasma infection. Can Vet J 1979;20:89–94.

4. Kirkbride CA. Mycoplasma, Ureaplasma, and Acholeplasma infections of bovine genitalia. Vet Clin North Am Food Anim Pract 1987;3:575–591.

5. Miller R, Chelmonska-Soyta A, Smits B, Foster R, Rosendal S. Ureaplasma diversum as a cause of reproductive disease in cattle. Vet Clin North Am Food Anim Pract 1994;10:479–490.

6. Anderson M. Infectious causes of bovine abortion during mid- to late-gestation. Theriogenology 2007;68:474–486.

7. Alves D, McEwen B, Hazlett M, Maxie G, Anderson N. Trends in bovine abortions submitted to the Ontario Ministry of Agriculture, Food and Rural Affairs, 1993–1995. Can Vet J 1996;37:287–288.

8. Ruhnke HL, Palmer NC, Doig PA, Miller RB. Bovine abortion and neonatal death associated with Ureaplasma diversum. Theriogenology 1984;21:295–301.

9. Stringfellow DA, Givens MD. Preventing disease transmission through the transfer of in-vivo-derived bovine embryos. Livest Prod Sci 2000;62:237–251.

10. Stringfellow DA, Givens MD. Manual of the International Embryo Transfer Society, 4th ed. Champaign, Illinois: International Embryo Transfer Society, 2010:65–68.

11. Bielanski A. Disinfection procedures for controlling microorganisms in the semen and embryos of humans and farm animals. Theriogenology 2007;68:1–22.

12. Britton AP, Ruhnke HL, Miller RB, Johnson WH. Adherence of Ureaplasma diversum to the bovine zona pellucida. Theriogenology 1988;29:229.

13. Cardoso MV, Scarcelli E, Grasso LM, Teixeira SR, Genovez ME. Ureaplasma diversum and reproductive disorder in Brazilian cows and heifers; first report. Anim Reprod Sci 2000;63:137–143.

14. Rae DO, Chenoweth PJ, Brown MB, Genho PC, Moore SA, Jacobsen KE. Reproductive performance of beef heifers: Effects of vulvo-vaginitis, Ureaplasma diversum, and prebreeding antibiotic administration. Theriogenology 1993;40:497–508.

15. Miller RB, Ruhnke HL, Doig PA, Poitras BJ, Palmer NC. The effects of Ureaplasma diversum inoculated into the amniotic cavity in cows. Theriogenology 1983;20:367–374.

16. Cardoso MV, Blanchard A, Ferris S, Verlengia R, Timenetsky J, Cunha RAF. Detection of Ureaplasma diversum in cattle using a newly devel-oped PCR-based detection assay. Vet Microbiol 2000;72:241–250.

17. Ruhnke HL, Doig PA, MacKay AL, Gagnon A, Kierstead M. Isolation of ureaplasma from bovine granular vulvitis. Can J Comp Med 1978;42:151–155.




Hybrid surgical treatment for 2 feline cases of intrahepatic shunt

Akiko Uemura, Telma Mary Nakata, Ryou Tanaka

Abstract — Intrahepatic portosystemic shunt was encountered in 2 cats (10 and 5 months old) exhibiting neurological symptoms and general deterioration. Both cats were treated with coil embolization using a hybrid surgical technique combining conventional open surgery and interventional radiology techniques, achieving good postoperative outcomes (follow-up: 22 and 10 months, respectively).

Résumé — Traitement chirurgical hybride pour deux cas félins de shunt intrahépatique. Un shunt portosystémique intrahépatique a été observé chez deux chats (âgés de 10 et de 5 mois) manifestant des symptômes neurologiques et une détérioration générale. Les deux chats ont été traités par une embolisation utilisant des spires à l’aide d’une technique chirurgicale hybride combinant une chirurgie ouverte conventionnelle et des techniques de radiologie d’intervention afin d’obtenir de bons résultats postopératoires (suivi : 22 et 10 mois, respectivement).

(Traduit par Isabelle Vallières)

Can Vet J 2018;59:47–51

U nlike cases of portosystemic shunt (PSS) in canines, cases of feline PSS are rare (1). Ideal methods of treatment

have yet to be established in dogs or cats. Feline PSS is usually identified at a young age, with a mean age at diagnosis of 4 to 9 mo (1–3). The mean body weight (BW) at diagnosis is also low, reportedly ranging from 1.2 to 2.9 kg for intrahepatic cases (mean: 2.3 kg) (4,5) and from 1.1 to 6.2 kg for extrahepatic cases (mean: 2.9 kg) (6,7). Because cats with PSS and neurologi-cal symptoms treated medically are reported to die within 2 y following diagnosis (8), surgery is often required at an early age.

The main method of treatment for feline PSS is surgical ligation (3), but dissection of the liver parenchyma to identify the shunting vessel can be challenging with intrahepatic PSS (IHPSS), in which a direct approach to the shunting vessel is anatomically difficult. Such operative stresses can occasionally prove fatal for kittens (9). Previous methods of treating extra-hepatic portosystemic shunts in cats have included the use of surgical ligation (1,3,10,11), ameroid constrictors (12), and cellophane banding (7,13). With the exception of cellophane banding, these methods are also used for intrahepatic shunt vessels (1,3,4,14).

Microhepatia is seen in half of feline cases of intra- and extra-hepatic PSS (2), and large-diameter shunts usually show a higher volume of blood flow. Attempting to achieve complete occlusion of the shunt in a single procedure under these circumstances sometimes causes portal hypertension, which in turn can cause ascites, postoperative development of multiple shunts, intestinal injury, or even death. Stepwise closure of the shunting vessel is therefore recommended in such cases (12). In our experience, when attempting surgical ligation, multiple approaches to the shunting vessel are sometimes difficult because of adhesions caused by the earlier approaches. An approach other than con-ventional surgery is thus desirable.

Percutaneous transvenous coil embolization (PTCE) has been used for both dogs (11,15) and cats (5) in an attempt to resolve the issues associated with conventional surgery. In those previous reports, jugular, femoral, or saphenous veins were used as approach sites. Size of the device in cats is restricted by the smaller body conformation and vascular diameter, so PTCE has been applied in only a limited number of cases. In addition, based on our personal experience, measuring portal vein (PV) pressure and performing angiography after shunt vessel occlu-sion in PTCE is sometimes difficult in cats.

The hybrid surgical technique (HST) represents a combina-tion of conventional open surgery and interventional radiology. This approach was chosen for the following reasons based on our experience with canine and feline cases of PSS requiring stepwise closure. The HST requires a surgical approach only around the main trunk of the PV or mesenteric vein. The incision for the surgical site is relatively small, and the risk of adhesion is minimal. In addition, no dissection of the hepatic parenchyma is required. The distance between the sheath and shunt vessel is short, facilitating more accurate maneuvering of the catheter tip. Because this procedure is conducted under direct visualization of the organs inside the abdomen, intestinal color and peristaltic

Department of Veterinary Surgery, Tokyo University of Agriculture and Technology, Animal Medical Center, 3-5-8 Saiwaicho, Fuchu-shi, Tokyo 183-8509, Japan.Address all correspondence to Dr. Ryou Tanaka; e-mail: [email protected] financial support was received for the research, authorship, or publication of this article.Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.



RA

PP

OR

T D

E C

AS

movement after coil implantation are easily evaluated, and liver biopsy can be readily and safely conducted. In addition, the sheath acts not only for placement of the device, but also as a catheter for the measurement of PV pressure and the injection of contrast agent.

Case descriptionsCase 1A 10-month-old neutered male exotic shorthaired cat was referred to the Tokyo University of Agriculture and Technology Animal Medical Center (TUATAMC) because of drooling after meals that had appeared 2 mo previously. Two days before the initial hospital visit, the animal exhibited loss of both vigor and appetite, altered consciousness, and convulsive seizures. Plasma ammonia (PA) concentration taken at the referring clinic had been elevated (. 587 mmol/L), and the animal was brought to TUATAMC for further investigation (Day 1).

On initial examination, decreased level of consciousness and generalized seizures were evident. Body weight (BW) was 2.8 kg. The irises of both eyes showed a copper coloration, which has previously been reported in cats with PSS (16). Systolic/diastolic (mean) arterial pressure was 109/63 (80) mmHg. Complete blood cell count revealed anemia (hematocrit: 21.1%), and PA was 72.8 mmol/L. Plasma albumin concentration (29 g/L) was within normal limits. Computed tomography (CT) revealed the tortuous passage of a PV in the left hepatic segment through the liver before forming a direct shunt into the caudal vena cava via the hepatic vein (Figure 1). This shunt represented left divisional intrahepatic portosystemic shunt, which has been reported previously (17). The vascular diameter of the shunt was 5.5 to 6.8 mm, with a maximum vascular length of approxi-mately 15 mm. Only 1 shunt vessel was present, and no other intrahepatic vascular anomalies were identified.

An attempt was made to control the symptoms with phar-macotherapy using levetiracetam (Otsuka Pharmaceutical, Tokyo, Japan), 20 mg/kg BW, q12h, and zonisamide (Sumitomo Dainippon Pharma, Tokyo, Japan), 2.5 mg/kg BW, q12h. However, no clear improvements were identified, and the PA concentration remained elevated (73.4 mmol/L). Coil emboliza-

tion of the shunt vessel by HST was performed on Day 21. First, ampicillin sodium (injectable ampicillin Na; Kyoritsu Seiyaku, Tokyo, Japan), 30 mg/kg BW, IV, buprenorphine hydrochloride (Lepetan injection 0.2 mg; Otsuka Pharmaceutical), 0.01 mg/kg BW, IV, and atropine sulfate (Atropine Sulfate Injection 0.5 mg; Mitsubishi Tanabe Pharma, Osaka, Japan), 0.05 mg/kg BW, SC, were administered as premedications, and anesthesia was induced by inhalation of 5% isoflurane (Isoflurane for Animal; Intervet, Tokyo, Japan). After tracheal intubation, inhalation anesthesia was maintained using 2.0% to 3.5% isoflurane. After surgical preparation, a midline incision was made in the abdomen ( 8 cm in length), and a 3-Fr sheath was inserted in the mesenteric vein. A 0.018-inch guide wire and microcatheter were inserted into the sheath, and the microcatheter was placed at the narrowest part of the shunt vessel under fluoroscopic guidance. A detachable coil [Platinum Coil Vascular Occlusion System (Interlocking Detachable Coil); Boston Scientific Japan, Tokyo, Japan] with a diameter of 7 mm and a length of 10 mm was deployed under fluoroscopic guidance and then detached. Systolic/diastolic PV pressure was 5/2 (mean: 3) mmHg before coil deployment and 14/11 (mean: 12) mmHg after coil occlu-sion. Before coil occlusion, an injection of iopamidol contrast agent (Oypalomin; Konica Minolta Japan, Tokyo, Japan) via the mesenteric vein revealed the flow of contrast agent directly into the caudal vena cava from the shunt vessel. Shunt flow was decreased after coil deployment, but as expected, some residual flow remained (Figure 2). No additional coil implantation was considered during this operation. After removal of the sheath, the hole in the mesenteric vein was closed with continuous sutures using synthetic absorbable monofilament (6/0 Prolene; Johnson & Johnson, Tokyo, Japan). The procedure took 71 min to complete.

The patient recovered from anesthesia uneventfully, and showed clinical improvement in the postoperative period. On Day 154, BW had increased to 4.2 kg, no clinical symptoms were apparent, and PA concentrations had decreased to within normal limits (37.6 mmol/L) without the use of either oral

Figure 1. Computed tomography in Case 1 reveals tortuous passage of a portal vein in the left hepatic segment through the liver before forming a direct shunt into the caudal vena cava via the hepatic vein.

Figure 2. Shunt flow is decreased after coil deployment in Case 1, but is still present.



CA

SE

RE

PO

RT

medication or dietary therapy. On Day 191, ultrasonographic examination showed that shunt flow had completely disappeared (Figure 3).

Case 2A 5-month-old intact male Russian blue cat was referred to TUATAMC because of loss of appetite that had appeared 2 mo previously, high serum levels of total bile acid (137.0 mmol/L preprandially, 108.2 mmol/L postprandially), and a high PA concentration (133.8 mmol/L).

On initial examination (Day 1), loss of appetite and mild wasting were observed (body condition score: 2/5). Body weight was 980 g. The mucous membranes were slightly pale, and mild dehydration was evident. The superficial lymph nodes were not enlarged and no heart murmurs were audible. Blood tests revealed mild anemia (hematocrit: 26.7%), hyperammonemia (163.8 mmol/L), hypoalbuminemia (20 g/L), and low urea nitrogen (5.9 mmol/L). Contrast-enhanced CT revealed marked microhepatia and passage of a PV branch in the left hepatic seg-ment through the liver toward the cranial side before forming a direct shunt into the caudal vena cava. This shape of the shunt suggested patent ductus venosus, but we could not confirm the origin. The vascular diameter of the shunt ranged from a mini-mum of 4.1 mm to a maximum of 4.8 mm. No other vascular abnormalities were evident.

Given the underdeveloped state of the liver and the large vascular diameter of the shunt, stepwise embolizations of the shunt vessel were planned. On Day 13, general anesthesia was induced using the same method applied in Case 1. After tracheal intubation, inhalation anesthesia was maintained with 1.0% to 1.9% isoflurane. After surgical preparation, a midline inci-sion was made in the abdomen, and a 4-Fr sheath was inserted in the main trunk of the PV. Under fluoroscopic guidance, a 0.035-inch guidewire and a 4-Fr multipurpose catheter were inserted into the sheath and placed at the cranial side of the shunt vessel. An anchor (Coil Anchor II S; Medikit, Tokyo, Japan) was deployed in the shunt vessel under fluoroscopic guidance, and coil implantation was planned for after stabi-lization of the anchor against the vessel wall. This coil anchor proved very useful in preventing migration of the coils added later. Unlike stents for PTCE, this coil anchor can be placed in

a small space. After removal of the sheath, the hole in the PV was closed with polypropylene synthetic non-absorbable sutures (8-0 PROLENE; Johnson & Johnson). The PV pressure was 4/1 (mean: 2) mmHg before coil anchor deployment and 6/3 (mean: 4) mmHg after coil anchor deployment. After this initial anchor implantation, the appetite of the animal improved and BW increased to 1.1 kg, but PA concentration remained high (300.5 mmol/L on Day 21). On Day 71, the patient showed neurological symptoms (apparent loss of vigor after meals). We attempted medical control with phenobarbital (1.0 mg/kg BW, q12h) and lactulose (1 mL, q12h). A second HST for coil implantation was then carried out on Day 78. Sutures from the initial procedure were visible on the PV, but no adhesions were evident. A 4-Fr sheath, 0.035-inch guidewire, and 4-Fr multipurpose catheter were therefore inserted into the main trunk of the PV in a similar fashion to that of the first HST. Under fluoroscopic guidance, a pushable coil (Trufill Pushable Coil Selection Complex; Johnson & Johnson) (diameter: 7 mm; length: 60 mm) was deployed to coil around the coil anchor already in place. The PV pressure was 8/5 (mean: 4) mmHg before coil implantation and 7/5 (mean: 5) mmHg after coil implantation. Although a residual shunt was observed around the coil, thrombus formation around the coil was expected, and no additional coil implantation was conducted during the procedure. The cat recovered uneventfully from the anes-thesia. A third HST was conducted on Day 102 because PA concentrations remained high (281.8 mmol/L on Day 85) and neurological symptoms were becoming worse, with the appear-ance of convulsions. Anesthesia and the approach to the shunt vessel were conducted as previously described, except that this procedure used a 3-Fr sheath, 0.018-inch guidewire, and microcatheter. An additional pushable coil (Trufill Pushable Coil Selection Complex; Johnson & Johnson) (diameter: 7 mm; length: 60 mm) was implanted in the PV slightly caudad to the coil deployed in the second HST (Figure 4). Because residual shunt was still observed, another pushable coil (diameter, 5 mm; length, 40 mm) was added. The PV pressure was 5/3 (mean: 3) mmHg before additional coil implantation and increased to 27/24 (mean: 26) mmHg after additional coil implantation. Fluoroscopic observation revealed that the velocity of shunt flow was markedly reduced, as determined from the flow speed

Figure 3. A — Case 1, Day 40. Doppler examination shows evidence of blood flow in the shunting vessel. Arrow, coil. B — Case 1, Day 191. The coil deployed in the shunt vessel shows no change in position. Color Doppler ultrasonographic examination shows no blood flow around the coil in the shunt vessel. Arrow, coil.



RA

PP

OR

T D

E C

AS

of contrast medium at the coil site. The cat recovered from the procedure uneventfully; the PA concentration was 35.2 mmol/L preprandially and 58.7 mmol/L at 2 h postprandially. Mild temporary ascites was seen after the third HST, but the gen-eral condition of the animal was markedly improved; the cat appeared energetic, showed good appetite, and was able to walk independently. Procedure time was 61 min for the first HST, 73 min for the second, and 62 min for the third. By Day 126, clinical symptoms had resolved without pharmacotherapy, and PA levels remained at approximately 58.7 mmol/L. Color Doppler ultrasonographic examination showed no blood flow around the coil in the shunt vessel on Day 144.

The interval between the first and second interventions was as planned. However, the interval between the second (Day 78) and third interventions (Day 102) was short, because the cat showed neurological symptoms on day 71. At first (Day 71), loss of vigor after meals was the only neurological symptom. However, general physical condition and neurological symptoms gradually worsened, to the point where convulsions developed. We attempted medical control with phenobarbital and lactulose, but clinical symptoms did not improve. We therefore made the decision to perform a third intervention within the short period of 3.5 mo.

DiscussionBoth animals in these cases were in poor general condition at presentation. An attempt was made to control the condition of the cat in Case 1 with medication, but this did not result in any apparent improvement. Waiting for the animal to gain BW was impossible in Case 2. The use of PTCE for a cat with PSS that weighed 2.9 kg at 4 mo of age has been reported (5), but the cat in Case 2 weighed only 980 g and the diameter of the jugular vein was small, so physical insertion of the catheter into this vessel for PTCE would have been difficult. Because both animals had been diagnosed with left-sided intrahepatic PSS, surgical shunt vessel ligation was also a treatment option.

However, both animals were in poor condition and anemic, so HST was chosen as a less-invasive procedure to limit bleeding and avoid the need for hepatic parenchymal dissection. Bleeding mainly occurred when the mesenteric vein or PV was punctured to insert the device and during withdrawal, and hemostatic control was good. To avoid troublesome device manipulation, the sheath was inserted directly into the PV, providing good maneuverability and enabling use of a large device not only in Case 1, in which the shunt vessel followed a complex, tortuous course, but also in Case 2, in which the animal was extremely small. In Case 2, the broad shunt vessel and severe microhepatia meant that a need for staged occlusion was anticipated, but even though HST was actually performed 3 times, no problems were identified with postoperative adhesions within the peritoneum or at the PV suture site where the sheath had been inserted. The HST is thus useful for avoiding the risk of approaching an adhesion site and averting problems such as prolonged operating time and excessive bleeding that would arise from the need to detach adhesions created during multiple surgeries.

The cat in Case 2 was initially treated in an unusual stepwise manner using an anchor. The purpose of the first intervention (on Day 13) was to create an anchor, not to initiate thrombosis.

Although postoperative outcomes were uneventful in both cases reported here, issues warranting further investigation were also apparent. The thrombogenic speed of coils is difficult to predict, and protocols for staged embolization have yet to be established. In Case 2, the thrombogenic speed of coils imme-diately after the third HST was rapid, and mild postoperative retention of ascites occurred. Due to the rise in intraoperative PV pressure after coil deployment and the marked weakening of blood flow in the area around the coil observed on postoperative abdominal ultrasonography, the cause of ascites was inferred to have been a transient increase in PV pressure resulting from rapid thrombus formation with the introduction of the coils. By the time of the third HST (Day 102), neurological symptoms had worsened. We considered immediate occlusion of the shunt

Figure 4. The sheath is inserted into the portal vein (arrow). The support threads (8-0 PROLENE, arrowheads) are placed on both sides of the area of puncture. These threads are then clamped with the mosquito forceps (*) and handled to control bleeding from the puncture site. After removing the sheath, the threads are used as continuous sutures to close the puncture site.



CA

SE

RE

PO

RT

as necessary, even though the patient faced a growing risk of portal hypertension. Even though the cat in Case 2 remained in good general condition, with good appetite and energy, and the amount of ascites retained was small, this represents an impor-tant issue in HST that requires further investigation. Venous shunt vessels are also highly elastic, making the maximum diameter during coil embolization more difficult to predict than with arterial vessels. No coil standards defined by diameter of the shunt vessel have been established, and the optimal method for measuring PV pressure after coil embolization also remains to be determined.

The HST enables direct insertion of a device into the portal or mesenteric vein via open surgery, mitigating the restrictions on usable device size, permitting easy device manipulation, and allowing device manipulation while directly observing the peritoneal organs. We believe that HST offers a potentially useful new method to extend the range of options available for treating feline PSS.

AcknowledgmentsWe thank Drs. Toshiharu Fukayama, Kazumi Shimada, and Seijirow Goya for their assistance in providing anesthesia for these cases. CVJ

References 1. Ruland K, Fischer A, Reese S, Zahn K, Matis U, Hartmann K.

Portosystemic shunts in cats — Evaluation of six cases and a review of the literature. Berl Munch Tierarztl Wochenschr 2009;122:211–218.

2. Lamb CR, Forster-van Hijfte MA, White RN, McEvoy FJ, Rutgers HC. Ultrasonographic diagnosis of congenital portosystemic shunt in 14 cats. J Small Anim Pract 1996;37:205–209.

3. Lipscomb VJ, Jones HJ, Brockman DJ. Complications and long-term outcomes of the ligation of congenital portosystemic shunts in 49 cats. Vet Rec 2007;160:465–470.

4. White RN, Forster-van Hijfte MA, Petrie G, Lamb CR, Hammond RA. Surgical treatment of intrahepatic portosystemic shunts in six cats. Vet Rec 1996;139:314–317.

5. Weisse C, Schwartz K, Stronger R, Mondschein JI, Solomon JA. Transjugular coil embolization of an intrahepatic portosystemic shunt in a cat. J Am Vet Med Assoc 2002;22: 66–67, 1287–1291.

6. Kyles AE, Hardie EM, Mehl M, Gregory CR. Evaluation of ameroid ring constrictors for the management of single extrahepatic porto-systemic shunts in cats: 23 cases (1996–2001). J Am Vet Med Assoc 2002;220:1341–1347.

7. Cabassu J, Seim HB, 3rd, MacPhail CM, Monnet E. Outcomes of cats undergoing surgical attenuation of congenital extrahepatic portosystemic shunts through cellophane banding: 9 cases (2000–2007). J Am Vet Med Assoc 2011;238:89–93.

8. Tobias KM. Portosystemic shunts. In: Bonagura DJ, Twedt CD, eds. Kirk’s Current Veterinary Therapy XIV. St. Louis, Missouri: Saunders 2009:581–586.

9. VanGundy TE, Boothe HW, Wolf A. Results of surgical management of feline portosystemic shunts. J Am Anim Hosp Assoc 1990;26:55–62.

10. Levesque DC, Oliver JE, Jr, Cornelius LM, Mahaffey MB, Rawlings CA, Kolata RJ. Congenital portacaval shunts in two cats: Diagnosis and surgical correction. J Am Vet Med Assoc 1982;181:143–145.

11. Leveille R, Pibarot P, Soulez G, Wisner ER. Transvenous coil emboliza-tion of an extrahepatic portosystemic shunt in a dog: A naturally occur-ring model of portosystemic malformations in humans. Pediatr Radiol 2000;30:607–609.

12. Vogt JC, Krahwinkel DJ, Jr, Bright RM, Daniel GB, Toal RL, Rohrbach B. Gradual occlusion of extrahepatic portosystemic shunts in dogs and cats using the ameroid constrictor. Vet Surg 1996;25:495–502.

13. Hunt GB, Kummeling A, Tisdall PL, et al. Outcomes of cellophane banding for congenital portosystemic shunts in 106 dogs and 5 cats. Vet Surg 2004;33:25–31.

14. Bright SR, Williams JM, Niles JD. Outcomes of intrahepatic porto-systemic shunts occluded with ameroid constrictors in nine dogs and one cat. Vet Surg 2006;35:300–309.

15. Gonzalo-Orden JM, Altonaga JR, Costilla S, Gonzalo Cordero JM, Millán L, Recio AO. Transvenous coil embolization of an intrahepatic portosystemic shunt in a dog. Vet Radiol Ultrasound 2000;41:516–518.

16. Vandermeulen E, Combes A, de Rooster H, et al. Transsplenic portal scintigraphy using 99mTc-pertechnetate for the diagnosis of portosys-temic shunts in cats: A retrospective review of 12 patients. J Feline Med Surg 2013;15:1123–1131.

17. White RN, Burton CA, McEvoy FJ. Surgical treatment of intrahepatic portosystemic shunts in 45 dogs. Vet Rec 1998;142:358–365.

18. Weisse C, Berent AC, Todd K, Solomon JA, Cope C. Endovascular evaluation and treatment of intrahepatic portosystemic shunts in dogs: 100 cases (2001–2011). J Am Vet Med Assoc 2014;244:78–94.



Article

Babesia odocoilei as a cause of mortality in captive cervids in Canada

Amélie Mathieu, Adriana R. Pastor, Charlene N. Berkvens, Carolyn Gara-Boivin, Michel Hébert, Alexandre N. Léveillé, John R. Barta, Dale A. Smith

Abstract — Nine cases of fatal infection with Babesia odocoilei were confirmed in reindeer (Rangifer tarandus tarandus) and elk (Cervus canadensis) housed in zoological institutions located in southern Quebec, Ontario, and Manitoba, Canada between 2013 and 2016. All animals died of a hemolytic crisis. Frequent postmortem findings were extensive hemorrhage, pigmenturia, and intrahepatic cholestasis. The described ante- and postmortem signs are consistent with those of previously reported cases in the United States. Diagnosis was confirmed in all cases by polymerase chain reaction performed on DNA extracted from whole blood or frozen spleen. We propose that babesiosis is an emerging disease of cervids in multiple Canadian provinces, most likely as a result of climate change and the northward range expansion of Ixodes scapularis, the primary tick vector for B. odocoilei. The role of captive animals as sentinels for wildlife health is also highlighted.

Résumé — Babesia odocoilei, une cause de la mortalité chez les cervidés captifs au Canada. Entre 2013 à 2016, neuf cas d’infection fatale par Babesia odocoilei ont été détectés chez des caribous (Rangifer tarandus tarandus) et des wapitis (Cervus canadensis) gardés dans des établissements zoologiques situés dans le sud du Québec, de l’Ontario et du Manitoba, Canada. Les animaux sont morts suite à une crise hémolytique. Hémorragies, pigmenturie et cholestase intra-hépatique ont fréquemment été identifiées à l’examen postmortem. Les signes ante- et postmortem décrits correspondent avec ceux des cas précédemment signalés aux États-Unis. Le diagnostic de babésiose fut confirmé par réaction en chaîne par polymérase sur l’ADN extrait d’échantillons de sang ou de rate congelée. Nous proposons que la babésiose des cervidés est une maladie émergente au Canada, et ce probablement en conséquence du réchauffement climatique et du mouvement vers le nord de la tique Ixodes scapularis, le principal vecteur de B. odocoilei. La valeur des animaux captifs comme sentinelles pour la santé de la faune est également discutée.

(Traduit par les auteurs)

Can Vet J 2018;59:52–58

Introduction

B abesia odocoilei (Apicomplexa, Piroplasmida, Babesiidae) is a tick-borne intraerythrocytic protozoal parasite originally

described in white-tailed deer (Odocoileus virginianus) (1,2). Ixodes scapularis is the organism’s only proven vector (3–5). Dermacentor albipictus, Amblyomma americanum, and Ixodes pacificus ticks have been found on, respectively, elk (Cervus elaphus canadensis), white-tailed deer, and bighorn sheep (Ovis canadensis nelsoni) infected with B. odocoilei, but have not been confirmed as vectors (1,6,7).

Babesiosis has been described in wild white-tailed deer and desert bighorn sheep, as well as in captive elk, woodland caribou (Rangifer tarandus caribou), reindeer (Rangifer tarandus taran-dus), muskoxen (Ovibos moschatus), markhor (Capra falconeri), yaks (Bos grunniens), and muntjacs (Muntiacus reevesi) in the United States (1,6–12) (Figure 1). However, clinical disease has only been reported in elk, reindeer, and caribou (6–8). Clinical signs reported in these cervids include lethargy, pyrexia, icterus, hemoglobinuria, and sudden death (8,13,14). Disease can develop following infection of naïve animals or can manifest

Columbus Zoo and Aquarium, 9990 Riverside Drive, Powell, Ohio 43065, USA (Mathieu); San Antonio Zoo, 3903 North St. Mary’s Street, San Antonio, Texas 78212, USA (Pastor); Assiniboine Park Zoo, 2595 Roblin Boulevard, Winnipeg, Manitoba R3R 0B8 (Berkvens); Département de pathologie et microbiologie, Faculté de Médecine Vétérinaire, Université de Montréal, 3200 rue Sicotte, Saint-Hyacinthe, Québec J2S 2M2 (Gara-Boivin); Bureau Vétérinaire Iberville, 795 Samuel de Champlain, St-Jean-sur-Richelieu, Québec J2X 5V6 (Hébert); Department of Pathobiology, Ontario Veterinary College, University of Guelph, 50 Stone Road East, Guelph, Ontario N1G 2W1 (Léveillé, Barta, Smith)Address all correspondence to Dr. Amélie Mathieu; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.



AR

TIC

LE

as a recrudescence of a latent infection in persistently infected animals (13). The stressors responsible for this recrudescence are often unknown, but may include concurrent disease, poor nutrition, rutting season, calving, high population density, and transportation (13,15,16). In persistently infected immunocom-petent white-tailed deer, a mild transient decrease in hematocrit or clinical disease manifested by pyrexia, anemia, and emaciation can occur in association with low-grade parasitemia (11).

Knowledge of the epidemiology of B. odocoilei in North America is limited despite a number of published reports. Insufficient targeted surveillance for this pathogen in wild-life might explain the lack of geographic continuity between reported endemic regions; only sporadic reports exist regarding B. odocoilei infections in wildlife despite the widespread dis-tribution of Ixodes spp. ticks in the eastern half of the United States (4). Serological evidence of B. odocoilei has been demon-strated in free-ranging white-tailed deer in southern Virginia, eastern Texas, Oklahoma, and Saskatchewan, as well as in desert bighorn sheep in southern California (1,2,7,11,16,17). Babesia odocoilei DNA was also detected in I. scapularis ticks found in Maine, Massachusetts, and Wisconsin (3). Reports of disease in captive susceptible hosts in ranches, farms, or zoos may

provide further insight into the geographic range of the dis-ease. Captive cervids and bovids infected with B. odocoilei have been identified in New Hampshire, New York, Pennsylvania, Indiana, Texas, Minnesota, and Wisconsin (6,7,13,14). Cervid babesiosis was reported for the first time in Canada in ranched elk in central Saskatchewan in 2012 (18). Although the source of the infection has rarely been investigated, several authors have proposed that cases in captive animals reflect endemicity in local wildlife or tick populations (8,13,18,19).

This is an overview of the diagnosed cases of cervid babesiosis in Canada following its first recognition in 2012 until 2016. This report highlights the emergent nature of the disease in Canada, as well as the role of captive animals in wildlife disease surveillance.

Materials and methodsCase historiesMedical files of cervid babesiosis cases diagnosed by the authors were gathered and data regarding signalment, antemortem clinical signs, clinical pathology findings, ancillary diagnostic test results, and postmortem findings were collated. Clinical presentation was defined as peracute or acute. Animals that died

Figure 1. Geolocations of documented cases of Babesia odocoilei infection in cervids and bovids in the US and in Canada from 1968 to 2016. White and black points represent, respectively, cases in the USA and Canada, in chronological order of publication.1 — wild white-tailed deer in Texas (1); 2 — wild white-tailed deer in Virginia (11); 3 — wild desert bighorn sheep in California (7,12); 4 — captive elk in Texas (6); 5 — captive reindeer, muskoxen, and woodland caribou in Minnesota (6,7,14); 6 — captive elk in Indiana (13); 7 — captive reindeer in Wisconsin (34); 8 — captive elk in Wisconsin (36); 9 — captive elk in New Hampshire (7); 10 — captive reindeer in New York (7); 11 — captive reindeer in Pennsylvania (7); 12 — captive reindeer, yak, muntjac, and markhor in New York (8); 13 — captive elk in New York (19); 14 — captive elk in Saskatchewan (18); 15 — wild white-tailed deer in Saskatchewan (17); 16 — captive reindeer and elk in Ontario; 17 — captive elk in Quebec; 18 — captive reindeer in Manitoba.



AR

TIC

LE

without overt prodromal signs were classified as peracute cases, while animals that showed clinical signs for a few days before death were classified as acute. Tissue and blood samples were collected during necropsy and held at 220°C for later DNA extraction. Data were reviewed for trends and patterns, but no statistical analysis was performed.

DNA Extraction, piroplasm-specific PCR and sequencingMolecular genetic analysis of the cervid spleen and blood samples collected during necropsies at the Toronto Zoo was per-formed by the Department of Pathobiology, Ontario Veterinary College, University of Guelph, Guelph, Ontario, using the fol-lowing protocol. DNA was extracted from the samples using a DNAzol kit according to the manufacturer’s protocol (Molecular Research Center, Cincinnati, Ohio, USA). After isolation, DNA was quantified spectrophotometrically using a Nanodrop 2000 instrument (Thermo Fisher Scientific, Wilmington, Delaware, USA). Standard polymerase chain reaction (PCR) was performed in a T100 thermal cycler (Bio Rad, California, USA) in a 50-mL reaction containing 13 PCR buffer, 2U Platinum® Taq polymerase (Invitrogen, Carlsbad, California, USA), 0.8 mM dNTPs, 3 mM MgCl2, 0.5 mM of each amplification primer (Table 1) and 100 to 200 ng DNA template (mixed cervid/parasite DNA). The PCR reaction conditions consisted of an initial melt at 94°C for 3 min followed by 35 amplifica-tion cycles (denature at 94°C for 30 s, anneal at 59°C for 45 s, extend at 72°C for 1.5 min), and then terminate with a final extension of 72°C for 5 min to complete any partial products. Annealing temperatures were chosen based on Primer3 imple-mented from within the Geneious bioinformatics software (Version 6.1 and later, available from http:\\www.geneious.com) (22). Polymerase chain reaction (PCR) products were separated electrophoretically using a submarine 1.4% agarose gel with 13 TAE buffer (100 mL) and 4 mL of ethidium bromide dye (10 mg/mL, w/v). The GeneRuler 1 kb Plus DNA size ladder (Thermo Fisher Scientific) was used to determine product fragment lengths. Gels were examined using an ultraviolet transilluminator and DNA bands of expected sizes were excised using a sterile scalpel. DNA was extracted from the gel slice using the QIAquick Gel Extraction Kit (QIAGEN, Toronto, Ontario) according to the manufacturer’s instructions. Purified PCR amplicons were then submitted for sequencing in both directions with forward and reverse amplification primers

using an ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, California, USA) by the Molecular Biology Unit of the Laboratory Services Division, University of Guelph, Guelph, Ontario. Chromatograms received from sequencing reactions were imported into Geneious for analyses.

Molecular genetic analysis of the blood and spleen sam-ples collected from the elk housed at the Parc Safari in Hemmingford, Quebec was performed by the Department of Veterinary Pathobiology, College of Veterinary Medicine, Texas A&M University, College Station, Texas, USA using primers and methods described by Schoelkopf et al (7).

The sample of spleen collected from the female reindeer that died in November 2014 at the Toronto Zoo (Z167-14) was submitted to the Department of Veterinary Pathology, Western College of Veterinary Medicine, University of Saskatchewan, and molecular genetic analysis was performed following the protocol described by Pattullo et al (18). The blood sample collected from the reindeer housed at the Assiniboine Park Zoo in Winnipeg, Manitoba, was sent to the Vector Borne Disease Laboratory, College of Veterinary Medicine, North Carolina State University, Raleigh, North Carolina, USA, for molecular genetic analysis. The DNA extraction was performed using QIAsymphonySP (Qiagen, Valencia, California, USA) with QIAsymphony DNA Mini Kit (192) (Qiagen). Standard PCR was performed in a thermal cycler (Mastercycler EP gradient aluminum block ther-mocycler, Eppendorf North America, Hauppauge, New York, USA) in a 25-mL reaction containing 12.5 mL of Mytaq Red Mix 2X (Bioline, London, UK), 0.5 mM of each amplification primer (Table 1) and 150 ng DNA template (mixed cervid/para-site DNA). The PCR reaction conditions consisted of an initial melt at 94°C for 5 min followed by 35 amplification cycles (denature at 95°C for 20 s, anneal at 58°C for 30 s and extend at 72°C for 1 min) and then terminate with a final extension of 72°C for 5 min to complete any partial products. The PCR products were separated by electrophoresis through a 2% (w/v) agarose gel. The unpurified PCR product was directly sent for Sanger sequencing through GENEWIZ (Research Triangle Park, North Carolina, USA). Sequences were aligned and compared with GenBank sequences using the AlignX software (Vector NTI Suite 6.0, InforMax, Bethesda, Maryland, USA).

ResultsNine confirmed cases of fatal infection by B. odocoilei were identified in captive reindeer and elk in 3 Canadian provinces

Table 1. Polymerase chain reaction (PCR) amplification primers used for amplification of Babesia odocoilei from cervid tissue samples.

Product Amplified fragment size (bp) Primer names Primer sequences (59–39)

Ribosomal 18S rDNAa 1687 Medlin A (F)b AACCTGGTTGATCCTGCCAGT Piro_18S_1688_Rc CGACTTCTCCTTCCTTTAAGTGATAAG

Ribosomal 18s rDNAd 681 Piro_144_S ACCGTGCTAATTGTAGGGCTAATACA BCOMMON2R TGCTTTCGCAGTAGTTCGTCa PCR performed by the Department of Pathobiology, Ontario Veterinary College, University of Guelph, Guelph, Ontario, Canada.b Primer A of Medlin et al (20) less polylinker region.c Equivalent to primer BN1700 of Ramos et al (21).d PCR performed by the Vector Borne Disease Laboratory, College of Veterinary Medicine, North Carolina State University,

Raleigh, North Carolina, USA, using primers described by Schoelkopf et al (7).



AR

TIC

LE

(Manitoba, Ontario, and Quebec) subsequent to the first report of clinical babesiosis in Canada in 2 ranched elk in central Saskatchewan in 2012 (18). Signalment and geographic loca-tion of all 9 cases are detailed in Table 2 and Figure 1. Clinical disease was not reported in any of the other susceptible species housed in these zoos (i.e., white-tailed deer, muskox, markhor, yak); however, PCR was not performed to identify asymptom-atic carriers. More females than males were affected. Diseased animals ranged in age from 2.5 to 14 y. Cases occurred between the months of June and December.

Reported antemortem clinical syndromes and major postmor-tem findings are displayed in Table 3. All reindeer cases were acute, while elk cases were either peracute or acute. Postmortem lesions in peracute cases included jaundice, hematochezia, and pigmenturia. Clinical signs in acutely affected animals included depression, dysorexia, respiratory distress, jaundice, pigmenturia, hematochezia, pyrexia, and separation from herd-mates, and were identified between 0 to 3 days before death. The 4 animals for which clinical pathology results were available were anemic and showed evidence of hemolysis and hyperbilirubinemia. Blood smears were performed in 7 cases, and a presumptive diagnosis of babesiosis based on visualization of intraerythro-cytic piroplasms was made in 5 of these (Table 3, Figure 2). Necropsies were performed on all cases; the most consistent gross findings were extensive subcutaneous and muscular hem-orrhages and the presence of deep red-brown urine (Table 3). On histopathologic examination, the most consistent finding was the presence of intrahepatic cholestasis. Other microscopic

lesions described included hepatic necrosis (1/9), centrilobular hepatocyte degeneration (1/9), hepatic lipidosis (1/9), extravas-cular erythrophagia (2/9), and reactive spleen (2/9).

Diagnosis of B. odocoilei infection was confirmed in all cases using PCR performed on whole blood or frozen spleen (Table 3). Partial 18S rDNA sequences from ID #Z176-12 and D24259, 2 American elk, and from ID #Z147-15, a European reindeer, were submitted to GenBank under accession num-bers AB12345.6, MF045131.1 and AB12345.6, respectively. All 18S rDNA sequences had 100% sequence identity to one another and to a number of B. odocoilei sequences submitted previously to GenBank from various hosts and geographic loca-tions: white-tailed deer in Texas (AY046577; U16369.2); elk in New Hampshire (AY661503.1), Wisconsin (AY294206.1) and Saskatchewan (KC460321); and muskox from Minnesota (AY661507.1).

DiscussionBetween 2012 and 2016, there were at least 11 confirmed deaths in captive cervids in 4 Canadian provinces as a result of infection by B. odocoilei (18). Although this list is likely not exhaustive, the cases reported here suggest that cervid babesiosis is an emerging disease in Canada. Prior to the first report of the disease in a Saskatchewan elk herd, cervid babesiosis was not recognized as a clinical problem in Canada, and surveillance for the pathogen in free-ranging wildlife was not of high priority. In part, this was likely a result of the presumptive absence of the main tick vector, I. scapularis (4). While endemism in wild

Table 2. Signalment and geographic location of captive elk (Cervus canadensis) and reindeer (Rangifer tarandus) that died of infection with Babesia odocoilei.

Age Latitude Longitude ID Species Gender class City Province (°N) (°W) Date of death

Z165-12 Elk Female Adulta Scarborough Ontario 43° 499 79° 119 October 2012Z175-12 Elk Female Adult Scarborough Ontario 43° 499 79° 119 November 2012Z176-12 Elk Female Adult Scarborough Ontario 43° 499 79° 119 November 2012Z137-13 Elk Female Adult Scarborough Ontario 43° 499 79° 119 October 2013Z174-13 Reindeer Female Adult Scarborough Ontario 43° 499 79° 119 December 2013K00075 Reindeer Male Adult Winnipeg Manitoba 49° 529 97° 149 June 2014D24259 Elk Female Adult Hemmingford Quebec 45° 029 73° 319 June 2014Z167-14 Reindeer Female Adult Scarborough Ontario 43° 499 79° 119 November 2014Z147-15 Reindeer Female Adult Scarborough Ontario 43° 499 79° 119 November 2015a Over 2.5 years of age.

Table 3. Major clinical and pathologic findings in captive elk (Cervus canadensis) and reindeer (Rangifer tarandus) that died of infection with Babesia odocoilei.

Piroplasms Tissue(s) PCR Clinical on blood Intrahepatic positive for ID Species syndrome smear Hemorrhage Pigmenturia cholestasis B. odocoilei

Z165-12 Elk Acute 2a 2 1b 1 SpleenZ175-12 Elk Peracute 2 2 1 1 SpleenZ176-12 Elk Peracute NAc 1 1 1 SpleenZ137-13 Elk Peracute NA 1 1 1 SpleenZ174-13 Reindeer Acute 1 2 2 1 SpleenK00075 Reindeer Acute 1 1 1 1 Whole bloodD24259 Elk Acute 1 1 1 1 Whole blood, spleenZ167-14 Reindeer Acute 1 1 1 2 SpleenZ147-15 Reindeer Acute 1 1 1 2 Whole blood, spleena Absent.b Present.c NA — data not available.



AR

TIC

LE

Canadian cervids has yet to be conclusively demonstrated, it is reasonable to assume that in Canada, as in the United States, the white-tailed deer is a natural reservoir of infection (1,5,18). Research is currently underway in Saskatchewan and Ontario to establish its prevalence in farmed and wild cervids (17).

The antemortem clinical syndromes and postmortem findings reported here are consistent with previously documented cases of cervid babesiosis. Until recently, infection with B. odocoilei in reindeer and caribou was only known to manifest as a rapidly fatal acute disease. However, subclinical infections were recently demonstrated in reindeer at the Toronto Zoo (23). Disease manifestation in elk is more variable, and ranges from peracute to asymptomatic (6,13). The variability of clinical manifesta-tions of infection with B. odocoilei is believed to be linked to differences in host susceptibility, levels of host infection and degree of stress-induced immunosuppression (13). Documented postmortem findings in peracute and acute cases of cervid babe-siosis are consistent with a hemolytic crisis, and often include marked icterus, extensive multifocal petechial hemorrhages, splenomegaly, and pigmenturia. Commonly observed histologic lesions are hemoglobinuric nephrosis with tubular degeneration, splenic hemosiderosis, and hepatic centrolobular degeneration (6,8,13,19).

Adult males are overrepresented in the literature, with most fatal cases of cervid babesiosis occurring during the rutting season (i.e., between the months of September and November) (7,8,10,13,14,19). In the present report, cases occurred mainly in adult females, and were not restricted to the rutting season. The apparent gender predilection in our study is likely biased as herds of cervids in zoos typically are mostly composed of females, but does also support the premise that stressors other than rut may be implicated in the pathogenesis of cervid babe-siosis. No particular predisposing factors were identified in the

cases presented here. The absence of cases in juvenile cervids may also be biased as a result of low numbers of young animals in captive collections that were available to become infected, or may be a result of an inverse age resistance, as described with bovine babesiosis (24). Cervid babesiosis has been described in woodland caribou as young as 6 to 8 mo of age (10).

The seasonality of mortality correlates with that of the tick vector’s life cycle. The development cycle of I. scapularis is controlled by temperature and day-length, with the maximum activity of nymphs and adult ticks from mid-summer through autumn in the northern United States and southern Ontario (25–28). Transtadial survival of B. odocoilei from nymph to adult, and transmission from deer to deer by the adult tick were demonstrated for I. scapularis under laboratory conditions (5). Transmission by nymphs has not been shown, but is plausible given the fact that a related Babesia species, Babesia divergens, can be transmitted to hosts by all tick life stages (29).

The recent increase in detection of B. odocoilei in Canada is the combined result of the progressive incursion of its tick vector and of an increase in disease recognition and reporting by veterinarians. Movement of asymptomatic carriers between institutions may have contributed to the spread of the patho-gen. Although most animals included in this report were born on-site, all 3 institutions occasionally acquire animals from other institutions, making the introduction of infected animals from endemic areas possible. Disease vectors are sensitive to climatic factors, and the effects of global warming on the extension of vector range from tropical to more temperate areas are well-documented with other vector-borne diseases such as malaria, Lyme borreliosis, and dengue fever (30). Scanning and targeted surveillance for I. scapularis shows that its range has been expanding northward from the northern United States into southern Manitoba, Ontario, Quebec, and the Maritimes; with detection clusters around Winnipeg, Toronto, and Montreal (30,31). The locations of the cervid babesiosis cases reported here coincide with the described geographic distribution of I. scapularis. Although the presence of B. odocoilei has yet to be demonstrated in I. scapularis in Canada, carriage of the patho-gen is assumed. Interestingly, I. scapularis has been identified in Saskatchewan on northern pocket gophers (Thomomys talpoides) and in a handful of submissions by the public, but there are no known established populations in this province (30,32). It was hypothesized that the ticks responsible for transmitting B. odocoilei to the Saskatchewan elk herd had been carried by birds that migrated northward from American states or westward from Canadian provinces that support endemic I. scapularis and B. odocoilei populations (18,31,33). Preliminary results of ongoing research indicate that the tick is found sporadically in Saskatchewan cervids, but no endemic foci have been identi-fied so far (17). These findings support the hypothesis that migratory birds are randomly transporting I. scapularis along with B. odocoilei into the province. As the tick vector range continues to expand northwards, it is likely that additional cases of babesiosis will emerge in captive cervids, and possibly other ungulate species, at higher latitudes than described here, and that B. odocoilei may eventually pose a risk to the health of the wild elk and caribou populations.

Figure 2. Photomicrograph of a blood smear from an elk with cervid babesiosis. Note the multiple Babesia odocoilei organisms located peripherally within erythrocytes.



AR

TIC

LE

Conducting unbiased disease surveillance in free-ranging populations can be challenging. Population-based surveillance, which involves the collection of data through screening and targeted surveillance activities, is a powerful tool for monitor-ing infectious diseases, but is often labor-intensive and costly to implement and maintain. In the context of identifying disease in free-ranging wildlife, scanning surveillance relies on the oppor-tunistic detection of disease events through the observation of diseased or dead animals, while targeted surveillance is based on the purposeful searching for evidence of disease or pathogens in animal populations. Sentinel surveillance can enhance detection of diseases and improve the cost-effectiveness of surveillance. In-depth data collection is performed on selected subpopula-tions, and the resulting analysis is used to signal disease out-breaks, identify epidemiologic trends, and monitor the burden of disease in the overall targeted population. Zoos and other collections of captive animals can be useful sentinel units for wildlife health, especially in regions in which minimal economic and human resources are dedicated to wildlife disease surveil-lance, or when population-based surveillance of wildlife health is limited to known enzootic pathogens (34). A telling example of how both the native and non-native species housed within zoos can act as sentinels for wildlife pathogens is the role of the Bronx Zoo in the investigation of the outbreak of West Nile viral encephalitis in New York in 1999 (35). Samples collected from wild crows and from various non-native and native captive birds found dead on zoo grounds led to the identification of the virus for the first time in the western hemisphere. Serological surveys of apparently healthy animals may also lead to the detection of endemic wildlife pathogens (34). The finding of B. odocoilei in captive cervids suggests local endemicity in wild cervid or tick populations, and reinforces the value of captive collections as sentinel units for wildlife health.

Cervid babesiosis should be included as a differential diagnosis for peracute or acute hemolytic crisis in captive cervids in Canada. Although further research is needed to clarify the epidemiology of B. odocoilei in Canadian wildlife, this case series suggests that the parasite has been introduced to southern Quebec, Ontario, and Manitoba. Cervid babesiosis is expected to become increasingly prevalent in Canada as global warming continues to alter the geographic and seasonal distributions of tick vectors.

AcknowledgmentsThe authors thank the veterinary and animal care staff of the Toronto Zoo, the Assiniboine Park Zoo, and Parc Safari for the exceptional care provided to the animals in this report, and for sharing their data for publication. We acknowledge Drs. Adriana M.W. Nielsen (Toronto Zoo, Ontario Veterinary College, University of Guelph; currently Wadi al Safa Wildlife Centre, Dubai, United Arab Emirates) and Doran Kirkbright (Ontario Veterinary College, University of Guelph, currently Animal Health Centre, Ministry of Agriculture, Abbotsford, British Columbia), Drs. Doris Sylvestre and Annie Deschamps (Faculté de Médecine Vétérinaire, Université de Montréal), and Dr. Brenda Bryan (Animal Health Centre, Veterinary Services Branch, Manitoba Agriculture, Food & Rural Development) for performing necropsy and histopathology of the cases

described in this report. We also thank Dr. Patricia J. Holman (Texas Veterinary Medical Center, Texas A&M University) and the Vector Borne Disease Laboratory (College of Veterinary Medicine, North Carolina State University) for their assistance with the molecular diagnostics performed on Parc Safari and Assiniboine Park Zoo cases. CVJ

References1. Emerson HR, Wright WT. The isolation of a Babesia in white-tailed

deer. J Wildl Dis 1968;4:142.2. Emerson HR, Wright WT. Correction. J Wildl Dis 1970;6:519.3. Armstrong PM, Katavolos P, Caporale DA, Smith RP, Spielman A,

Telford SR. Diversity of Babesia infecting deer ticks (Ixodes dammini). Am J Trop Med Hyg 1998;58:739–742.

4. Keirans JE, Hutcheson HJ, Durden LA, Klompen JS. Ixodes (Ixodes) scapularis (Acari:Ixodidae): Redescription of all active stages, distribu-tion, hosts, geographical variation, and medical and veterinary impor-tance. J Med Entomol 1996;33:297–318.

5. Waldrup KA, Kocan AA, Barker RW, Wagner GG. Transmission of Babesia odocoilei in white-tailed deer (Odocoileus virginianus) by Ixodes scapularis (Acari: Ixodidae). J Wildl Dis 1990;26:390–391.

6. Holman PJ, Craig TM, Crider DL, Petrini KR, Rhyan J, Wagner GG. Culture isolation and partial characterization of a Babesia sp. from a North American elk (Cervus elaphus). J Wildl Dis 1994;30: 460–465.

7. Schoelkopf L, Hutchinson CE, Bendele KG, et al. New ruminant hosts and wider geographic range identified for Babesia odocoilei (Emerson and Wright 1970). J Wildl Dis 2005;41:683–690.

8. Bartlett SL, Abou-Madi N, Messick JB, Birkenheuer A, Kollias GV. Diagnosis and treatment of Babesia odocoilei in captive reindeer (Rangifer tarandus tarandus) and recognition of three novel host species. J Zoo Wildl Med 2009;40:152–159.

9. Goff WL, Jessup DA, Waldrup KA, et al. The isolation and partial char-acterization of a Babesia sp. from desert bighorn sheep (Ovis canadensis nelsoni). J Eukaryot Microbiol 1993;40:237–243.

10. Holman PJ, Petrini K, Rhyan J, Wagner GG. In vitro isolation and cultivation of a Babesia from an American woodland caribou (Rangifer tarandus caribou). J Wildl Dis 1994;30:195–200.

11. Perry BD, Nichols DK, Cullom ES. Babesia odocoilei Emerson and Wright, 1970 in white-tailed deer, Odocoileus virginianus (Zimmermann), in Virginia. J Wildl Dis 1985;21:149–152.

12. Thomford JW, Conrad PA, Boyce WM, Holman PJ, Jessup DA. Isolation and in vitro cultivation of Babesia parasites from free-ranging desert bighorn sheep (Ovis canadensis nelsoni) and mule deer (Odocoileus hemionus) in California. J Parasitol 1993;79:77–84.

13. Gallatin LL, Irizarry-Rovira AR, Renninger ML, et al. Babesia odocoilei infection in elk. J Am Vet Med Assoc 2003;223:1027–1032.

14. Petrini KR, Holman PJ, Rhyan JC, Jenkins SJ, Wagner GG. Fatal babesiosis in an American woodland caribou (Rangifer tarandus caribou). J Zoo Wildl Med 1995;26:298–305.

15. Holman PJ, Madeley J, Craig TM, et al. Antigenic, phenotypic and molecular characterization confirms Babesia odocoilei isolated from three cervids. J Wildl Dis 2000;36:518–530.

16. Waldrup KA, Kocan AA, Qureshi T, Davis DS, Baggett D, Wagner GG. Serological prevalence and isolation of Babesia odocoilei among white-tailed deer (Odocoileus virginianus) in Texas and Oklahoma. J Wildl Dis 1989;25:194–201.

17. Healthy Wildlife: The blog of the Canadian Wildlife Health Cooperative. Babesia odocoilei recently detected in Canada. [updated 2014 June 18]. Available from: blog.healthywildlife.ca/babesia-odocoilei-recently-detected-in-canada/ Last accessed November 9, 2017.

18. Pattullo KM, Wobeser G, Lockerbie BP, Burgess HJ. Babesia odocoilei infection in a Saskatchewan elk (Cervus elaphus canadensis) herd. J Vet Diagn Invest 2013;25:535–540.

19. Ameri M, Anderson WI, Holman PJ, Palmer GW. Babesia odocoilei infection in a North American elk (Cervus elaphus canadensis). Comp Clin Pathology 2012;21:363–365.

20. Medlin L, Elwood HJ, Stickel S, Sogin ML. The characterization of enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene 1988;71:491–499.

21. Ramos CM, Cooper SM, Holman PJ. Molecular and serologic evidence for Babesia bovis-like parasites in white-tailed deer (Odocoileus virginia-nus) in south Texas. Vet Parasitol 2010;172:214–220.



AR

TIC

LE

22. Untergasser A, Cutcutache I, Koressaar T, et al. Primer3 — New capa-bilities and interfaces. Nucleic Acids Res 2012:40.

23. Pastor AR, Nielsen AMW, Kirkbright DW, et al. Babesiosis (Babesia odocoilei): An emerging disease of Ontario cervids. Proc Am Assoc Zoo Vet 2016:101–102.

24. Christensson DA, Thorburn MA. Age distribution of naturally occur-ring acute babesiosis in cattle in Sweden. Acta Vet Scand 1987;28: 373–379.

25. Belozerov VN, Naumov RL. Nymphal diapause and its photoperiodic control in the tick Ixodes scapularis (Acari: Ixodidae). Folia Parasitol 2002;49:314–318.

26. Daniels TJ, Falco RC, Curran KL, Fish D. Timing of Ixodes scapularis (Acari: Ixodidae) oviposition and larval activity in southern New York. J Med Entomol 1996;33:140–147.

27. Ogden NH, Bigras-Poulin M, Barker IK, et al. A dynamic population model to investigate effects of climate on geographic range and sea-sonality of the tick Ixodes scapularis. Int J Parasitol 2005;35:375–389.

28. Siegel JP, Kitron U, Bouseman JK. Spatial and temporal distribution of Ixodes-dammini (Acari: Ixodidae) in a Northwestern Illinois State Park. J Med Entomol 1991;28:101–104.

29. Zintl A, Mulcahy G, Skerrett HE, Taylor SM, Gray JS. Babesia divergens, a bovine blood parasite of veterinary and zoonotic importance. Clin Microbiol Rev 2003;16:622–36.

30. Smith KR, Woodward A, Campbell-Lendrum D, et al. Human health: Impacts, adaptation, and co-benefits. In: Climate Change 2014:

Impacts, Adaptation, and Vulnerability. Cambridge, UK and New York, USA: Cambridge University Pr, 2014:709–754.

31. Ogden NH, Trudel L, Artsob H, et al. Ixodes scapularis ticks collected by passive surveillance in Canada: Analysis of geographic distribution and infection with Lyme borreliosis agent Borrelia burgdorferi. J Med Entomol 2006;43:600–609.

32. Anstead CA, Chilton NB. Ticks feeding on northern pocket gophers (Thomomys talpoides) in central Saskatchewan and the unexpected detection of Ixodes scapularis larvae. J Vector Ecol 2011;36:355–360.

33. Ogden NH, Bouchard C, Kurtenbach K, et al. Active and passive surveillance and phylogenetic analysis of Borrelia burgdorferi elucidate the process of Lyme disease risk emergence in Canada. Environ Health Perspect 2010;118:909–914.

34. Hidalgo E, Salgado R, Pizarro J. Zoo animals as sentinels for wild ani-mal infectious diseases in regions without resources for wildlife health surveillance: First report of a native South American wildlife species, southern pudu (Pudu puda), BVDV persistently infected. Proc Wild Dis Assoc Annu Conf 2016:179.

35. Steele KE, Linn MJ, Schoepp RJ, et al. Pathology of fatal West Nile virus infections in native and exotic birds during the 1999 outbreak in New York City, New York. Vet Pathol 2000;37:208–224.

36. Holman PJ, Bendele KG, Schoelkopf L, Jones-Witthuhn RL, Jones SO. Ribosomal RNA analysis of Babesia odocoilei isolates from farmed reindeer (Rangifer tarandus tarandus) and elk (Cervus elaphus canadensis) in Wisconsin. Parasitol Res 2003;91:378–383.

Zoonotic Tuberculosis: Mycobacterium bovis and Other Pathogenic Mycobacteria, 3rd edition

Thoen CO, Steele JH, Kaneene JB. Wiley-Blackwell, Chichester, United Kingdom. 2014. 413 pp. ISBN: 9781-1184-7429-7.

T he 3rd edition of this book updates the current status of M. bovis in industrialized and developing countries from

the 2006, 2nd edition, includes new chapters on One Health, and covers 6 additional African countries. The book is well-organized with individual chapters building on each other while also being able to stand alone as review of a specific topic or location.

The book starts with the discussion on a One Health approach to manage zoonotic tuberculosis, followed by a chap-ter on its significance to public health. Subsequent chapters describe pathogen and disease specifics, including pathogenesis, macro- and molecular epidemiology, and current approaches for isolation, identification, and genotyping of M. bovis. These chapters are comprehensive and well-referenced. I found the

molecular epidemiology section especially interesting as this technology is becoming more affordable and the information gained is so valuable in tracing the origin of an outbreak in either humans or animals.

These overview chapters are followed by chapters describing zoonotic tuberculosis in a specific country or region, as well as a chapter on zoonotic tuberculosis in nonhuman primates. Given the variation in the epidemiology, wildlife reservoirs, and management of zoonotic tuberculosis, country-specific programs have significant similarities and differences.

The book describes the long history of zoonotic tuberculosis occurrence and management, and the role pasteurization has played in food safety and public health. This book would be helpful for veterinarians, students, and allied health professionals working in government, academia, research, or private practice in regions of Canada impacted by zoonotic tuberculosis, or those who work importing animals or managing endangered species or zoo populations.

Reviewed by Judy Hodge, BSc, DVM, MPH, Winnipeg, Manitoba.

Book Review Compte rendu de livre



Article

A clinical trial investigating the impact of in-feed flavophospholipol on Salmonella shedding and antimicrobial resistance in pigs

Saranya Nair, Abdolvahab Farzan, Terri L. O’Sullivan, Robert M. Friendship

Abstract — A clinical trial was conducted to assess the effectiveness of in-feed flavophospholipol in reducing Salmonella shedding and antimicrobial resistance (AMR) associated with Salmonella and generic Escherichia coli in naturally infected grower-finisher pigs. Pigs were obtained from a farm with a history of salmonellosis and were housed at a research facility. Over the span of 10 weeks the pigs received either a feed containing 4 ppm of flavophospholipol (treatment, n = 25) or a non-medicated feed (control, n = 20). Weekly fecal samples were collected and cultured for Salmonella and generic E. coli. A subset of Salmonella and E. coli isolates were tested for antimicrobial susceptibility. A multilevel mixed-effects logistic regression model was used to compare the prevalence of Salmonella shedding and AMR in Salmonella and E. coli isolates in treatment and control groups. Overall, the prevalence of Salmonella shedding (P . 0.05) and AMR in Salmonella (P . 0.01) and E. coli (P . 0.005) isolates was not different between the treatment and control groups.

Résumé — Essai clinique étudiant l’impact du flavophospholipol dans les aliments sur l’excrétion de Salmonella et l’antibiorésistance chez les porcs. Un essai clinique a été réalisé pour évaluer l’efficacité du flavophospholipol dans les aliments pour réduire l’excrétion de Salmonella et l’antibiorésistance associée à Salmonella et à Escherichia coli générique chez les porcs d’engraissement naturellement infectés. Les porcs obtenus provenaient d’une ferme ayant des antécédents de salmonellose et ils ont été logés à un établissement de recherche. Pendant 10 semaines, les porcs ont reçu soit des aliments contenant 4 ppm de flavophospholipol (traitement, n = 25) ou des aliments non médicamentés (témoin, n = 20). Des échantillons fécaux hebdomadaires ont été prélevés et soumis à des cultures pour Salmonella et E. coli générique. Un sous-groupe d’isolats de Salmonella et d’E. coli ont été testés pour la susceptibilité antimicrobienne. Un modèle de régression logistique à effets contrastés à plusieurs niveaux a été utilisé pour comparer la prévalence d’excrétion de Salmonella et de l’antibiorésistance dans les isolats de Salmonella et d’E. coli dans le groupe de traitement et le groupe témoin. Dans l’ensemble, la prévalence d’excrétion de Salmonella (P . 0,05) et de l’antibiorésistance des isolats de Salmonella (P . 0,01) et d’E. coli (P . 0,005) n’était pas différente entre le groupe de traitement et le groupe témoin.


Introduction

N on-typhoidal Salmonella spp. (Salmonella) are commonly recovered in the feces of swine but are rarely found to

cause clinical disease (1). Studies have revealed that Salmonella are present on most Ontario swine farms (2,3). The most common serotype recovered from Ontario pigs is Salmonella Typhimurium DT 104 (2), a multi-drug resistant serotype that is a common human pathogen (4). Salmonella can be difficult to control and there is little financial incentive for Canadian

pork producers to institute costly on-farm measures to reduce Salmonella because the presence of Salmonella is not usually asso-ciated with recognizable clinical disease. However, flavophospho-lipol (bambermycin, flavomcyin, moenomycin), an inexpensive antibiotic used as a growth promoter, may be an attractive method for swine producers to reduce on-farm Salmonella and the associated antimicrobial resistance (AMR) in pigs.

Flavophospholipol is an antibiotic without any therapeu-tic applications in human or veterinary medicine due to its poor pharmacokinetic and pharmacodynamic features (5,6). Moreover, resistance to this phosphoglycolipid antimicrobial agent amongst bacterial populations is only slowly developed through mutations in the bacterial chromosome and is non-transferable (5,7). Research suggests that flavophospholipol may alter the microflora in favor of beneficial bacteria inhibiting the colonization of Salmonella in animals (8). The inhibition by fla-vophospholipol is likely due to competition among pathogenic and beneficial bacteria for intestinal binding sites or may be due to reduced intestinal pH (8). Furthermore, flavophospholipol,

Department of Population Medicine, Ontario Veterinary College, University of Guelph, Guelph, Ontario.Address all correspondence to Saranya Nair; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.



AR

TIC

LE

by inhibiting R-plasmid carrying bacteria in a process referred to as a “plasmid-curing effect,” may reduce AMR (9–12). Although the impact of flavophospholipol on Salmonella and AMR in pigs has been previously studied by experimental challenge studies, use of flavophospholipol under commercial pig farming condi-tions in which pigs are naturally infected with Salmonella has not been thoroughly investigated. The objectives of this study were to evaluate whether the in-feed use of flavophospholipol can reduce Salmonella shedding in naturally infected pigs and if flavophospholipol can influence AMR associated with Salmonella and generic E. coli in those pigs.

Materials and methodsThe research trial was approved by the animal care committee of the University of Guelph, in accordance with the guidelines of the Canadian Council of Animal Care.

Pigs and treatment groupsForty-five pigs at 10 wk of age were obtained from a com-mercial farm in which Salmonella shedding in pigs was known to be prevalent based on previous diagnostic work. The pigs were transported to the Ponsonby General Animal Facility (University of Guelph) where they were randomly assigned to 1 of 9 pens (5 pigs/pen) and ear tagged. The treatment group consisted of 5 pens (n = 25 pigs) and these pigs were provided with a diet containing 4 ppm of flavophospholipol (Flavomycin; Huvepharma, distributed by Bio Agri Mix, Mitchell, Ontario). The control group (n = 20 pigs) housed in 4 pens received an identical diet but without the medication. In order to accom-modate the growing pigs, at the beginning of week 8 of the trial, 2 to 3 pigs were randomly removed from each pen and placed in the corresponding pen in a second, similar room in the research facility. Pigs that had been receiving the treatment ration continued to receive this feed and likewise pigs that were moved from control pens to the new room continued to receive the control ration. This movement of pigs resulted in a total of 18 pens (10 treatment, 8 control) from weeks 8 to 11 of the trial. Boot covers and gloves were changed to prevent transmis-sion of microbial agents between rooms and treatment groups.

Sample collectionOver the 10-week period (weeks 1 to 11), fecal samples or rectal swabs were collected weekly from the 45 pigs. Samples were col-lected in stomacher bags (Seward Laboratory Systems, Bohemia, New York, USA) directly from pigs as they defecated and when pigs failed to defecate during the period of observation, rectal swabs (BBL Culture Swab Culture & Transport System; Thermo Fisher Scientific, Ottawa, Ontario) were taken. In addition, pooled-fecal samples found on the floor of each pen were col-lected weekly. Samples were transported to the Centre for Public Health and Zoonoses (CPHAZ, University of Guelph) labora-tory in insulated coolers with ice packs.

Bacterial cultureSalmonellaFecal samples collected weekly before treatment (week 1) until the end of treatment (week 11) were cultured for Salmonella.

The fecal samples were diluted with tetrathionate broth (TTB) (Becton Dickinson, Franklin Lakes, New Jersey, USA) at a 1 to 9 ratio. The fecal samples were then homogenized for 30 s with a Seward Stomacher 400 Circulator (Seward Laboratory Systems) and incubated at 37°C for 18 to 24 h. Rectal swabs were cultured in 9 mL TTB and incubated as homogenized fecal samples. Then, 100 mL of TTB culture was transferred to 9.9 mL of Rappaport-Vassiliadis broth (RV; Becton Dickinson) and incubated at 41°C for 18 to 24 h. Next, a loopful (20 mL) of the RV broth was streaked onto xylose-lysine-tergitol 4 (XLT4) agar (Remel Thermo Fisher Scientific, Lenexa, Kansas, USA) and incubated at 37°C for 18 to 24 h. One colony was selected per Salmonella-positive sample. Salmonella isolates were confirmed by agglutination in Salmonella poly O antiserum (Becton Dickinson).

Generic E. coliPigs were tested for generic E. coli before treatment (week 1) and at the end of the trial (week 11). The fecal samples were added to buffered peptone water (Oxoid BPW; Thermo Scientific Oxoid, Thermo Fisher Scientific) at a 1 to 9 ratio, homogenized for 30 s with a Seward Stomacher 400 Circulator (Seward Laboratory Systems) and incubated at 37°C for 18 to 24 h. A loopful (20 mL) of the BPW broth was streaked onto MacConkey agar (BBL; Becton Dickinson) and incubated at 37°C for 18 to 24 h. One colony was selected per E. coli-positive sample. Colonies were then streaked on to LB agar (Fisher BioReagents; Thermo Fisher Scientific) and incubated at 37°C for 18 to 24 h. Escherichia coli isolates were identified using the spot indole reagent (Remel Thermo Fisher Scientific) and Simmons citrate agar (BBL, Becton Dickinson) tests.

Salmonella serotypingA subset of 24 Salmonella isolates consisting of the first (n = 11) and last positive Salmonella culture (n = 13) from 13 randomly selected pigs (7 treatment and 6 control) was serotyped. The first positive Salmonella cultures belonged to weeks 1 or 2, while the last positive Salmonella cultures belonged to pigs in weeks 3, 4, 7, 9, and 11. Isolates were submitted to Biovet (St-Hyacinthe, Quebec) for molecular serotyping by means of xMAP Salmonella Serotyping Assay Kit. The xMAP Salmonella serotyping assay is a microsphere-based, molecular serotyping method that detects genes which express serotype-specific O and H antigens.

Antimicrobial susceptibility testingSalmonella isolates from pigs before treatment (week 1) and at week 3 and weeks 1 and 4 were included in antimicrobial sus-ceptibility testing. Escherichia coli isolates from pigs at week 1 (before treatment) and week 11 (at the end of treatment) were tested. Antimicrobial susceptibility testing was performed by means of a micro-dilution broth using a Sensititre NARMS Gram-negative plate (TREK Diagnostic Systems, Thermo Fisher Scientific, Oakwood Village, Ohio, USA). The antimicrobials and MIC (minimum inhibitory concentrations in mg/mL) were: amoxicillin/clavulanic acid (Au; 32/16), ampicillin (A; 32), cefoxitin (Ce; 32), ceftriaxone (Cx; 64), chloramphenicol (C; 32), ciprofloxacin (Ci; 4), gentamicin (G; 16), nalidixic



AR

TIC

LE

acid (N; 32), streptomycin (S; 64), sulfisoxazole (Su; 256), tet-racycline (T; 32), trimethoprim/sulphamethoxazole (T/S; 4/76). Isolates that grew at concentrations of antimicrobials greater than the MIC threshold were classified as resistant. Isolates that grew only at concentrations below the threshold were identified as susceptible. Isolates with intermediate MIC breakpoints were classified as susceptible in order to prevent overestimation of resistance in isolates.

Briefly, isolates were streaked onto LB agar, incubated at 37°C for 24 h, then tested for antimicrobial susceptibility with the Trek Diagnostic System Sensititre equipment. The colonies on LB agar were added to sterile water, mixed, and adjusted to a 0.5 McFarland Standard. Then, 30 mL of the bacterial suspen-sion were added to 11 mL of Müeller-Hinton broth with TES buffer and mixed thoroughly. The Sensititre AutoInoculator was then used to dispense 50 mL of the Müeller-Hinton broth suspension into the wells of the plate. Plates were covered with the adhesive seal and labeled. After incubation at 37°C for 18 h, plates were read using the Sensititre Automated Reading and Incubation System.

Statistical analysisData were entered into Microsoft Excel for Mac 2011 Version 14.5.5 (Microsoft, Redmond, Washington, USA) and after cleaning were imported into Stata (Stata/SE 14.1 for Mac; StataCorp, College Station, Texas, USA). A multilevel mixed-effects logistic regression model with pen (common environ-ment) and pig (repeated measurements) as a random effect was used to compare the prevalence of Salmonella shedding among pigs in the treatment and the control group. To control for the addition of a second room in weeks 8 to 11, room was held as a fixed effect.

To assess AMR, statistical analysis was only conducted for antimicrobials that had a change in resistance. Descriptive analysis of resistance patterns in Salmonella and E. coli isolates was assessed. A multilevel mixed-effects logistic regression model with pen as a random effect, room as a fixed effect, and resistance before treatment (week 1) as a covariate was used to separately assess each antimicrobial to compare AMR in Salmonella isolates recovered from pigs in the treatment and control groups. A similar model was built for E. coli isolates. Bonferroni adjustments were used to control for multiple anti-microbial comparisons.

ResultsSalmonella sheddingTwo pigs (1 from each group) were euthanized in week 3 for reasons unrelated to the trial. A total of 479 individual fecal samples and 135 pooled-fecal samples were collected. The preva-lence of Salmonella shedding in individual pig samples from weeks 1 to 11 is shown in Figure 1. Salmonella was cultured from 36 (80%) pigs at arrival at the research facility (Week 1); over 11 weeks it was recovered from 27% and 28% of the indi-vidual fecal samples from the treatment and control groups, respectively. Over the 10-week period during which treatment pigs received feed containing 4 ppm of flavophospholipol, the presence of Salmonella in the fecal samples collected from pens

or pigs was not significantly different between treatment and control pigs (P . 0.05).

Salmonella serotypesTwenty-four isolates recovered at different times from 13 pigs were serotyped. In total, pigs shed 8 serotypes over the study period including S. Typhimurium (25%), S. Livingstone (25%), S. Senftenberg (21%), S. I:Rough-O (8%), S. Montevideo (8%), S. Benfica (4%), S. Amsterdam (4%), and S. Infantis (4%). Of the 11 pigs with first and last isolates, 91% (n = 10) were rein-fected with a different serotype. Pigs were initially colonized by S. Typhimurium (36%), S. Senftenberg (36%), S. Benfica (9%), S. Amsterdam (9%), and S. I:Rough-O (9%); however, reinfection with S. Livingstone (45%) was the most common followed by S. Typhimurium (18%), S. Montevideo (18%), S. Senftenberg (9%), and S. I:Rough-O (9%).

E. coli sheddingUsing the remaining fecal samples from 18 and 14 pigs from the treatment and control groups, respectively, generic E. coli was cultured at 2 time points (at entry and at the end of the finisher period). Generic E. coli was found at week 1 and week 11 in all pigs tested.

Antimicrobial resistanceOverall, Salmonella isolates were resistant to ampicillin, chlor-amphenicol, streptomycin, sulfisoxazole, and tetracycline. After controlling for multiple antimicrobial comparisons using Bonferroni adjustments, the P-value required for significance was # 0.01. No significant difference was found in antimi-crobial resistance associated with Salmonella isolates recovered from pigs in the treatment and control groups (P . 0.01). The antimicrobial resistance profiles for Salmonella isolated from pigs in control and treatment groups at weeks 1, 3, and 4 are shown in Table 1. The most prevalent resistance pattern associ-ated with Salmonella in week 1 was “S” in both the treatment (65%) and control (75%) groups. In weeks 3 and 4, “ASSuT” (67%) and “SSuT” (40%) were common in the treatment group while “ASSuT” (week 3 = 53%; week 4 = 43%) was the most prevalent in the controls (Table 1). Penta-resistance (ACSSuT) was also observed in Salmonella isolates (Table 1).

Figure 1. Salmonella shedding in naturally infected grower-finisher pigs in the treatment (4 ppm flavophospholipol medicated) and non-medicated control groups from week 1 (10 weeks of age) to week 11 (20 weeks of age).

Salm

onel

la (%

)

Week

1 2 3 4 5 6 7 8 9 10 11

100

80

60

40

20

0

Control Treatment



AR

TIC

LE

Escherichia coli isolates had resistance to amoxicillin/ clavulanic acid, ampicillin, cefoxitin, chloramphenicol, cipro-floxacin, gentamicin, nalidixic acid, streptomycin, sulfisoxazole, tetracycline, and trimethoprim/sulphamethoxazole (Figure 2). After controlling for multiple antimicrobial comparisons using Bonferroni adjustments, the P-value required for significance was # 0.0045. When assessing resistance for each antimicrobial for E. coli isolates, there was no difference in antimicrobial resis-tance in isolates recovered from the treatment group compared with the control group (P . 0.0045). Antimicrobial resistance patterns in E. coli isolates are shown in Table 2. The most prevalent resistance patterns in E. coli isolates in week 1 were “T” (28%) and “ST” (28%), while “AT” (17%) and “ACSSuT” (17%) were most common in Week 11 in the treatment group. Resistance patterns “ACSSuT” (29%) and “SSuT” (14%) were most common in the control group in week 1, but during week 11 “ACSSuTT/S” (36%) and “ASSuTT/S” (14%) were commonly recovered.

DiscussionChallenge studies have been primarily used to assess the impact of flavophospholipol on Salmonella shedding and antimicro-bial resistance in pigs and poultry. However, the results are inconsistent. Some experimental challenge studies found fla-vophospholipol to be effective in reducing Salmonella shedding in swine and broilers (8,13). For example, Dealy and Moeller (13) found a significantly reduced duration and prevalence of Salmonella shedding in 4- and 5-week-old pigs challenged with S. Typhimurium and fed a ration containing 4.4 ppm of flavo-phospholipol compared to challenged pigs fed a non-medicated control diet over a 7-week period. Over the duration of the Dealy and Moeller (13) trial, fecal samples were collected on 11 occasions; Salmonella were cultured using tetrathionate bril-liant green broth (TBGB) and plated onto brilliant green agar (BGA). Bolder et al (8) found 9 ppm of flavophospholipol to be effective in decreasing the rate and magnitude of shedding of S. Enteritidis in broilers challenged at 6 wk of age. Weekly fecal samples were cultured using incubation in buffered peptone water (BPW) followed by plating onto BGA (8).

In contrast, other experimental challenge studies conducted in chickens and pigs with S. Typhimurium found that flavo-

phospholipol was not effective in reducing Salmonella (14,15). Letellier et al (15) found that 0.5 ppm of flavophospholipol in-feed given to pigs that were inoculated with S. Typhimurium 14 d after beginning treatment did not significantly reduce the presence of S. Typhimurium in feces by day 28 of the trial. This study used rectal swabs collected from pigs; Salmonella was cultured using TBGB and plating on to BGA (15). Similarly, Humbert et al (14) found 1-day-old chicks (n = 46) treated with 5 ppm of flavophospholipol and challenged with S. Typhimurium at day 2 did not have a different Salmonella shedding pattern from that of untreated chicks (n = 92) at days 3 and 6 (14). Cecal samples collected from chicks were cultured using BPW as pre-enrichment, tetrathionate Müeller-Kaufmann broth and RV broth for enrichment, and then plating onto BGA and Wilson Blair agar (WBA).

Letellier et al (15) used a low dosage of flavophospholipol (0.5 ppm), while Humbert et al (14) conducted their trial over a very short time. In contrast, Dealy and Moeller (13) and Bolder et al (8), conducted trials over a longer duration with higher than the recommended dosage of flavophospholipol (. 4 ppm). Furthermore, these studies (8,13) used fecal samples which have been found in previous studies to have a greater sensitivity than rectal swabs in detecting Salmonella (16,17). The discrepancies in the results from different studies might be due, in part or in whole, to different animal species (poultry versus pigs) used, study design (number of animals, number of replicates, dura-tion of trial, treatment dosage, and length of treatment period), challenge model (challenge serotype and strain characteristics, challenge dosage), and methods used for Salmonella culturing.

Unlike the challenge studies in which animals were experi-mentally infected in a controlled environment with Salmonella and fed low dosages of flavophospholipol for a short period, the current study used naturally infected pigs and followed these pigs over 10 wk, which was more representative of the farm situation. The present study also had improved sensitivity compared with some of the challenge studies due to repeated weekly fecal sample collection. However, our findings indicate that naturally infected pigs fed flavophospholipol had similar Salmonella shedding to pigs fed a non-medicated diet. An important difference between controlled challenge studies and the present study was that this population of pigs was infected

Table 1. Antimicrobial resistance patterns of Salmonella isolates from grower-finisher pigs fed a diet containing 4 ppm flavophospholipol (treatment) and pigs fed a similar but non-medicated diet (control). Pigs were naturally infected with Salmonella and entered the trial at 10 weeks of age (Week 1).

Week 1 (%) Week 3 (%) Week 4 (%)

AMR Treatment Control Treatment Control Treatment Control pattern (n = 17) (n = 16) (n = 15) (n = 15) (n = 5) (n = 7)

A 0 0 0 0 0 14S 65 75 7 40 0 0AT 6 0 0 0 0 0AST 0 6 0 0 0 14SSu 0 6 0 0 20 14SSuT 12 6 20 0 40 0ASSuT 0 0 67 53 20 43ACST 6 0 0 0 0 0ACSSuT 12 6 7 7 20 14

A — ampicillin; C — chloramphenicol; S — streptomycin; Su — sulfonamides; T — tetracycline.n = number of isolates.



AR

TIC

LE

with multiple serotypes. Although the pigs were fed the recom-mended dosage, the multiple serotypes present made it difficult to estimate the effectiveness of flavophospholipol on Salmonella shedding due to reinfections and renewed shedding in pigs.

Most challenge studies have been conducted in young pigs (shortly after weaning), while the pigs in the current study were older (grower-finisher pigs). It is likely that Salmonella may have colonized the gut and possibly invaded tissues such

as mesenteric lymph nodes before the start of the trial, making it difficult for the treatment to alter the microbiome or elimi-nate the pathogen. If a high degree of Salmonella colonization occurred in the microbiome before the pigs received treatment, this may have prevented flavophospholipol from significantly reducing Salmonella shedding. If these same pigs were provided with the treatment diet at an earlier stage (i.e., beginning at weaning) when the pigs were most susceptible to alterations in the microbiome, then a more favorable outcome might have occurred. Future studies to examine the benefits of administer-ing flavophospholipol, as a preventive measure, before pigs are infected with Salmonella need to be conducted in order to rule out the possibility that under certain conditions flavophospho-lipol can reduce Salmonella shedding.

While previous challenge studies found flavophospholipol to be capable of reducing antimicrobial resistance (13,18), the present study found no difference in antimicrobial resistance in Salmonella recovered from pigs fed a ration containing flavophospholipol and from pigs consuming a non-medicated feed. It is possible that 3 and 4 wk of treatment with flavo-phospholipol may not be adequate for resistance patterns to be altered. In an earlier study, Dorr and Gebreyes (18) challenged 60-day-old pigs with S. Typhimurium DT 104 or DT 193 then treated them with 4.85 ppm of flavophospholipol and isolated Salmonella weekly over 20 wk. This treatment resulted in less resistance to ampicillin and amoxicillin-clavulanic acid compared to control. Dealy and Moeller (13) compared isolates from pigs treated with 4.4 ppm of flavophospholipol to control pigs over 7 wk and found a reduction in the number of isolates resistant to ampicillin, streptomycin, triple sulfa, and tetra-cycline. It is possible that the antimicrobial resistance curing properties of flavophospholipol may require longer than 3 or 4 wk to be effective.

No difference was found in antimicrobial resistance in E. coli isolated from flavophospholipol treated pigs compared with

Figure 2. Antimicrobial resistance in E. coli isolates from naturally infected grower-finisher pigs in the treatment (4 ppm flavophospholipol medicated) and non-medicated control group at week 1 (10 weeks of age) and week 11 (20 weeks of age).* Au — amoxicillin/clavulanic; A — ampicillin; Ce — cefoxitin; C — chloramphenicol; Ci — ciprofloxacin; G — gentamicin; N — nalidixic acid; S — streptomycin;

Su — sulfonamides; T — tetracycline; T/S — trimethoprim/sulphamethoxazole.

Res

ista

nce

in is

olat

es (%

)

100

90

80

70

60

50

40

30

20

10

0

Control

Treatment

W1 W11 W1 W11 W1 W11 W1 W11 W1 W11 W1 W11 W1 W11 W1 W11 W1 W11 W1 W11 W1 W11

Au A Ce C Ci G N S Su T T/S

0 0 71 93 0 0 57 43 7 0 0 7 14 7 86 93 71 71 93 100 14 57

0 11 32 84 0 5 11 26 0 0 0 11 5 5 63 74 26 68 95 100 5 5

Table 2. Antimicrobial resistance patterns of commensal E. coli isolates from grower-finisher pigs fed a diet containing 4 ppm flavophospholipol (treatment) and pigs fed a similar but non-medicated diet (control). Naturally Salmonella infected pigs entered the trial at 10 weeks of age (week 1) and were monitored for 10 weeks.

Week 1 (%) Week 11 (%)

AMR Treatment Control Treatment Control pattern (n = 18) (n = 14) (n = 18) (n = 14)

T 28 7 6 0ST 28 0 0 7AT 6 7 17 7AST 11 7 11 7ACS 0 7 0 0SSuT 0 14 6 0ASSuT 11 0 11 7CSSuT 6 7 6 0ACST 0 0 0 7AGSSuT 0 0 6 7ACSSuT 0 29 17 0AuASuT 0 0 6 0CNSSuT 6 0 0 0ASSuTT/S 6 0 0 14ACGSSuT 0 0 6 0ANSSuTT/S 0 7 6 7ACSSuTT/S 7 0 0 36ACCiNSSuT 0 7 0 0AuACeSSuT 0 0 6 0

Au — amoxicillin/clavulanic; A — ampicillin; Ce — cefoxitin; C — chloramphenicol; Ci — ciproflaxacin; G — gentamicin; N — nalidixic acid; S — streptomycin; Su — sulfonamides; T — tetracycline; T/S — trimethoprim/sulphamethoxazole.n = number of isolates.



AR

TIC

LE

isolates from control pigs by week 11. Earlier work by van den Bogaard et al (12) found that a dosage of 9 ppm flavophospho-lipol effectively suppressed multidrug resistant E. coli in chal-lenged pigs. Researchers found a decrease in the mean degree of resistance against oxytetracycline (12). The standard dosage of 4 ppm flavophospholipol used herein may not have been suffi-cient to reduce antimicrobial resistance in generic E. coli isolates. Based on previous findings, a higher dosage or exposure for a longer time may be required to reduce antimicrobial resistance in Salmonella and E. coli isolates. It is also important to note that the use of Bonferroni adjustments, when assessing multiple antimicrobials for Salmonella and E. coli isolates, was a limita-tion for this type of study design. Future research with different study designs to better assess the impact of flavophospholipol on antimicrobial resistance may be beneficial.

Salmonella challenge studies that found flavophospholipol to significantly reduce antimicrobial resistance were conducted using 1 strain of Salmonella (13,18). There is a possibility that flavophospholipol was ineffective in the present study due to the presence of multiple serotypes and a situation of repeated infections with different serotypes. Antimicrobial susceptibility of isolates at the start of the trial was compared with data on isolates from weeks 3 and 4. These weeks were chosen com-pared to the end of the trial because of the high prevalence of Salmonella at this time. However, most pigs at weeks 3 and 4 were found to be shedding a different serotype than at week 1. Furthermore, the plasmid profiles of the E. coli and Salmonella isolates in this study are unknown. A previous study reported variations in plasmid profiles from a single Salmonella serotype found on Ontario swine farms (19). Given the presence of mul-tiple serotypes in the present study, the possibility of variation in plasmid profiles exists that may not exist in the single strain used in challenge studies. Although the present study may have been representative of the farm situation, it was difficult to estimate the effectiveness of flavophospholipol on Salmonella shedding and antimicrobial resistance of Salmonella.

The multi-resistance in Salmonella (18,19) and E. coli (20–23) isolates found in this study has been previously reported in different pig populations. However, there is a lack of literature on resistance patterns found in Salmonella and E. coli isolates recovered from flavophospholipol treated pigs. Dorr and Gebreyes (18) found there were significantly fewer S. Typhimurium DT 104 isolates with resistance to just strepto-mycin over time. Although the present study conducted descrip-tive analysis, there were noticeably fewer Salmonella isolates resistant to just streptomycin from weeks 1 to weeks 3 and 4. However, over time there was a greater number of isolates that were multi-resistant to “SSuT,” “ASSuT,” and “ACSSuT” in both the treatment and control groups. In particular, in the flavophospholipol group a greater number of isolates were found to be resistant to “SSu” compared with the control group. Although there may be less resistance to just streptomycin in isolates, there is a growing number of isolates that are resistant to 1 or more antimicrobials, including streptomycin over time. It is also important to note that the resistance in isolates may be affected by the multiple serotypes that were present in the population. Unlike challenge studies in which pigs are experi-

mentally infected with S. Typhimurium (18), in the present study assessing resistance patterns in this pig population over time was difficult due to the changes in serotypes amongst pigs over the trial. Similarly, in E. coli isolates, from weeks 1 to 11, there was increasing multi-resistance in isolates. However, there was no distinctive trend in resistance patterns between the treat-ment and control groups.

In conclusion, naturally infected pigs subsequently given fla-vophospholipol at 4 ppm in feed continued to shed Salmonella for a similar length of time compared to non-medicated pigs. Susceptibility to antibiotics in Salmonella (after 2 or 3 wk) and E. coli (after 10 wk) isolates was similar in the treatment and control groups.

AcknowledgmentsWe acknowledge the Ontario Ministry of Agriculture, Food and Rural Affairs (OMAFRA) — Food Safety Research Program, Swine Innovation Porc, Huvepharma Animal Health and the University of Guelph-OMAFRA Research Partnership for financial support. CVJ

References 1. Stevens MP, Gray JT. Salmonella infections in pigs. In: Barrow P,

Methner U, eds. Salmonella in Domestic Animals. 2nd ed. Wallingford, Oxfordshire, UK: CABI, 2013:263–294.

2. Farzan A, Friendship RM, Dewey C, Muckle AC, Gray JT, Funk J. Distribution of Salmonella serovars and phage types on 80 Ontario swine farms in 2004. Can J Vet Res 2008;72:1–6.

3. Farzan A, Friendship RM, Cook A, Pollari F. Occurrence of Salmonella, Campylobacter, Yersinia enterocolitica, Escherichia coli O157 and Listeria monocytogenes in swine. Zoonoses Public Health 2010;57:388–396.

4. Public Health Agency of Canada. Canadian Antimicrobial Resistance Surveillance System — Report 2015. 2015. Available from: http://publications.gc.ca/collections/collection_2015/aspc-phac/HP37-21-2015-eng.pdf Last accessed November 21, 2017.

5. Pfaller M. Flavophospholipol use in animals: Positive implications for antimicrobial resistance based on its microbiologic properties. Diagn Microbiol Infect Dis 2006;56:115–121.

6. Butaye P, Devriese L, Haesebrouck F. Antimicrobial growth promoters psed in animal feed: Effects of less well known antibiotics on Gram-positive bacteria. Clin Microbiol Rev 2003;16:175–188.

7. Kissel A. Determination of the in-vitro susceptibility of selected bacte-rial strains carrying resistance plasmids to the feed additives salinomy-cin–sodium (SAL) and flavophospholipol (FPL) and to various active substances used for therapeutic purposes — MIC determination before and after 5 or 10 passages in additive-free and in SAL- ir FPL-containing liquid media. Germany: Hoechst Roussel Vet 1998.

8. Bolder N, Wagenaar J, Putirulan F, Veldman K, Sommer M. The effect of flavophospholipol (Flavomycin) and salinomycin sodium (Sacox) on the excretion of Clostridium perfringens, Salmonella Enteritidis, and Campylobacter jejuni in broilers after experimental infection. Poult Sci 1999;78:1681–1689.

9. George B, Fagerberg D. Effect of bambermycins, in vitro, on plasmid-mediated antimicrobial resistance. Am J Vet Res 1984;45:2336–2341.

10. Sokol A, Kremery V, Federic F, Rejtar V, Janouskova J. The influence of flavomycin on the elimination of R factors of Escherichia coli in vitro. Folia Microbiol 1973;18:176–179.

11. Watanabe T, Ogata Y, Sugawara K. Increase of flavomycin sensitivity of bacteria by R-factors. In: Kremery V, Rosiwal I, Watanabe T. eds. Bacterial Plasmids and Antibiotic Resistance. New York, New York: Springer Verlag, 1972:105–113.

12. Van den Bogaard A, Hazen M, Hoyer M, Oostenbach P, Stobberingh E. Effects of flavophospholipol on resistance in fecal Escherichia coli and enterococci of fattening pigs. Antimicrob Agents Chemother 2002;46:110–118.

13. Dealy J, Moeller M. Influence of bambermycin on Salmonella infection and antibiotic resistance in swine. J Anim Sci 1976;42:1331–1336.



AR

TIC

LE

14. Humbert F, Lalande F, L’Hospitalier R, Salvat G, Bennejean G. Effect of four antibiotic additives on the Salmonella contamination of chicks protected by an adult caecal flora. Avian Pathol 1991;20:577–584.

15. Letellier A, Messier S, Lessard L, Quessy S. Assessment of various treat-ments to reduce carriage of Salmonella in swine. Can J Vet Res 2000; 64:27–31.

16. Hurd HS, Stabel TJ, Carlson S. Sensitivity of various fecal sample collec-tion techniques for detection of Salmonella typhimurium in finish hogs. In: Proceedings of the Third International Symposium for Epidemiology and Control of Salmonella in Pork. Washington, DC, USA, 2001:63–64.

17. Funk JA, Davies PR, Nichols MA. The effect of fecal sample weight on detection of Salmonella enterica in swine feces. J Vet Diagn Invest 2000;12:412–418.

18. Dorr P, Gebreyes W. Flavophospholipol: Effect on multi-drug resistant Salmonella enterica serovar Typhimurium in swine. J Swine Health Prod 2009;17:308–317.

19. Farzan A, Friendship R, Poppe C, Martin L, Dewey CE, Funk J. Molecular epidemiology and antimicrobial resistance of Salmonella typhimurium DT104 on Ontario swine farms. Can J Vet Res 2008;72: 188–194.

20. Lay KK, Koowattananukul C, Chansong N, Chuanchuen R. Antimicrobial resistance, virulence, and phylogenetic characteristics of Escherichia coli isolates from clinically healthy swine. Foodborne Pathog Dis 2012;9:992–1001.

21. Bibbal D, Dupouy V, Prère MF, Toutain PL, Bousquet-Mélou A. Relatedness of Escherichia coli strains with different susceptibility phenotypes isolated from swine feces during ampicillin treatmen. Appl Environ Microbiol 2009;75:2999–3006.

22. Wang XM, Jiang HX, Liao XP, et al. Antimicrobial resistance, virulence genes, and phylogenetic background in Escherichia coli isolates from diseased pigs. FEMS Microbiol Lett 2010;306:15–21.

23. Rosengren LB, Waldner CL, Reid-Smith RJ. Associations between antimicrobial resistance phenotypes, antimicrobial resistance genes, and virulence genes of fecal Escherichia coli isolates from healthy grow-finish pigs. Appl Environ Microbiol 2009;75:1373–1380.

Industry News Nouvelles de l’industrie

The Canadian Animal Blood Bank and the blood bank of the Centre Hospitalier Universitaire Vétérinaire of the University of Montreal announce a new partnership

The Canadian Animal Blood Bank (CABB) and blood bank of the Centre Hospitalier Universitaire Vétérinaire (CHUV; Faculté de médecine vétérinaire) of the University of Montreal are pleased to announce their new collaborative relationship that expands CABB’s capabilities to supply high quality blood products to more Canadian veterinarians. This unique new part-nership will provide veterinarians in Quebec and the Maritime provinces with canine blood products with same or next day delivery service.

Established in 1996 as a joint venture of Red River College and the Manitoba Veterinary Medical Association, the blood bank remains spearheaded by founding president, Ken Mould BSc (Hons) DVM. The Canadian Animal Blood Bank is a non-share capital (not-for-profit) corporation headquartered at Red River College, Notre Dame Campus in Winnipeg, Manitoba.

Marie-Claude Blais DVM Dipl. ACVIM and Small Animal Internal Medicine Associate Professor at the University of Montreal joins the CABB Board and advises on evolving quality control and operating procedures.

“We are very much in sync with CHUV and Dr. Blais’ desire to assist veterinarians and veterinary technicians by being able to supply products and expertise in cases where animal patients benefit from blood product transfusions. This is a significant step in our evolution,” said Dr. Mould. A fundamental goal of CABB is providing benchmark blood products by meeting and exceeding standard North American blood transfusion

protocol and production methods. CABB will assist Dr. Blais in research projects related to veterinary hematology and transfu-sion medicine.

“The CABB was already exceeding veterinary blood banking standards (ex.: testing extensively every single units for infectious agents, producing leukoreduced packed red blood cells); joining force with this great corporation was a logical step to achieve both our missions! In addition to improving the accessibility to high quality canine blood products throughout Canada, our col-laboration will facilitate the education of veterinarians and ani-mal health technicians on transfusion medicine. In addition, it will help improve our knowledge and care from the selection of canine blood donors to the actual administration of blood prod-ucts through systematic and organized clinical research. High quality care, high quality education and high quality research…what’s not to look forward?!” said Dr. Blais. Recognized blood collection sites in Alberta and Southern Ontario augment an established and successful collection network in Manitoba. All blood collections are from family owned pets whose owners have voluntarily made the commitment to have their dogs help support both acutely and chronically ill canine patients.

Contact: The Canadian Animal Blood Bank, AB71–2055 Notre Dame Avenue, Winnipeg, Manitoba R3H OA9; phone: (204) 632-2586; e-mail: [email protected]



New Products Nouveaux produits

Equine sarcoid tumor products now available to Canadian veterinariansNovaVive Inc., an animal health immunobiology com-pany, is pleased to announce that an equine-specific version of its Immunocidin® product for equine sarcoid tumors is now available to Canadian veterinarians. The new product, Immunocidin® Equine, is packaged in 5mL vials for the con-venience of practitioners. The company believes that there is no other regulator-approved equine sarcoid therapy in North America.

Equine sarcoids are locally aggressive tumors that are consid-ered to be the most common skin tumors of horses worldwide. They are often found around the eyes, head/face, neck, chest, and shoulder, and at the site of old scars. Young to middle-aged horses are most commonly affected, and it is estimated that sarcoids affect 1 in 100 horses in North America.

Current treatment options include surgery, ligation, cryo-therapy, topical treatment, chemotherapy, radiation therapy, or laser removal. Their application results in limited efficacy and, occasionally, adverse reactions. In addition, some of these prod-ucts do not have regulatory approval for use in sarcoid tumors. Immunotherapy is a safe and effective treatment option that is gaining interest in both human and veterinary oncology.

Immunocidin® Equine is administered by intratumoral injection, but the response is generalized and untreated sites frequently undergo regression as well.

“Immunocidin Equine has a high post-treatment tumor-free rate and is well-tolerated by horses, including older animals,” said Dr. Stan Alkemade, Chief Veterinary Scientific Officer at NovaVive Inc. “The product has minimal side effects and an excellent safety profile. It offers an economical treatment option to veterinarians.”

Here are before and after pictures of a horse treated with Immunocidin. The second picture was taken two weeks after four injections (administered at 14-day intervals).

Contact: NovaVive Inc., Belleville, Ontario; phone: (613) 391-3837; website: www.NovaVive.ca

Dechra Pharmaceuticals announce the launch of Zycortal.caDechra Pharmaceuticals, a leader in animal health endocrinol-ogy, is committed to partnering with veterinarians in order to care for their clients’ and their pets. We are pleased to announce the launch of Zycortal.ca, a website created to support vet-erinarians and pet owners in the education and management of Addison’s disease. Also known as Hypoadrenocorticism, Addison’s disease is relatively rare with symptoms that are similar to more common diseases. With treatment and moni-toring, your dog will be able to live a normal and active life. However, if left untreated Addison’s disease can be potentially fatal. Zycortal.ca includes extensive information about Addison’s disease, its diagnosis, treatment and ongoing management as well as a personalized logbook, where pet owners can keep and share with their veterinarian a record of their pet’s progress while they undergo treatment for Addison’s disease. Dechra is one of the fastest growing global brands in the veterinary market; our mission is to deliver the highest quality products and support to our partners to help keep their patients in good health.

Contact your local sales representative or visit Zycortal.ca and Dechra.ca



Article

Comparison of hand-sewn and oversewn stapled jejunojejunal anastomoses in horses

José L. Bracamonte, Ian Devick, Keri L. Thomas, Steven Hendrick

Abstract — The objective of this study was to compare the biomechanical properties of hand-sewn jejunojejunal anastomoses to those of oversewn stapled jejunojejunal anastomoses. Jejunojejunal anastomoses were constructed from harvested jejunal segments using a single-layer Lembert technique (1HS), double-layer simple continuous/Cushing technique (2HS), stapled side-to-side technique oversewn with Cushing pattern (SS), and closed 1-stage stapled functional end-to-end technique oversewn with Cushing pattern (FEE). Anastomosed segments were distended with fluid until the point of biomechanical failure. The 2HS had the longest construction time of all anastomoses. Bursting pressures were significantly higher for hand-sewn jejunojejunostomies than those for oversewn stapled jejunojejunostomies. No significant differences were found in bursting pressures between 1HS and 2HS or between SS and FEE. Hand-sewn jejunojejunostomies proved to be biomechanically stronger than oversewn stapled jejunojejunostomies when initially constructed. However, all anastomotic types would be secure techniques to be used clinically based on the supraphysiological pressures they are capable of withstanding.

Résumé — Comparaison des anastomoses jéjuno-jéjunales cousues à la main et agrafées et cousues chez les chevaux. Cette étude avait pour objectif de comparer les propriétés biomécaniques des anastomoses jéjuno-jéjunales cousues à la main et celles des anastomoses jéjuno-jéjunales agrafées et cousues. Des anastomoses jéjuno-jéjunales ont été construites à partir de segments jéjunaux prélevés en utilisant la technique Lembert à couche unique (1HS), la technique Cushing à double couche simple continue (2HS), la technique agrafée côte à côte selon la méthode Cushing (SS) et la technique fonctionnelle de bout en bout fermée en 1 étape avec couture selon la méthode Cushing (FEE). Des segments anastomosés ont été dilatés avec du liquide jusqu’au point de défaillance biomécanique. La technique 2HS présentait le temps de construction le plus long de toutes les anastomoses. Les pressions de rupture étaient significativement supérieures pour les jéjuno-jéjunostomies cousues par rapport aux jéjuno-jéjunostomies agrafées et cousues. Aucune différence significative n’a été constatée au niveau des pressions de rupture entre 1HS et 2HS ou entre SS et FEE. Les jéjuno-jéjunostomies cousues à la main se sont avérées plus fortes sur le plan mécanique que les jéjuno-jéjunostomies agrafées et cousues lors de la construction initiale. Cependant, tous les types anastomotiques seraient des techniques sûres pour utilisation clinique en se basant sur les pressions supra-physiologiques qu’elles sont capables de supporter.


Can Vet J 2018;59:67–73

Introduction

N umerous surgical techniques have been reported for anastomosis of the small intestine in horses, includ-

ing end-to-end, side-to-side and functional end-to-end using either a hand-sewn or stapling technique (1–6). Until recently, double-layer hand-sewn end-to-end anastomosis has been the most commonly used technique in horses. However, single-layer Lembert anastomosis has been emerging in popularity as a safe and effective alternative to be used in horses for

end-to-end anastomoses (7). Nieto et al (8) demonstrated that a single layer Lembert anastomosis was faster to perform and created a larger lumen diameter, while having equivalent bursting strength compared to a double-layer anastomosis. Stapled anastomoses, on the other hand, are favored by others because of their reported reductions in surgery time, reduced contamination and improved anastomotic healing (5,9). Stapled small intestinal anastomoses are most commonly performed in horses using a side-to-side technique or a functional end-to-end

Department of Large Animal Clinical Sciences, Western College of Veterinary Medicine, University of Saskatchewan, Saskatoon, Saskatchewan S7N 5B4.Address all correspondence to Dr. José L. Bracamonte; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.



AR

TIC

LE

technique (1). An experimental study reported no difference in bursting strength between stapled side-to-side and closed 1-stage, stapled functional end-to-end anastomoses; however, the latter was significantly faster to construct (10).

Several experimental studies have been performed deter-mining the bursting strength and characteristics of hand-sewn and stapled anastomotic techniques in the equine jejunum (8,10–12). Bursting strength measures the resistance of the intestinal wall to increasing intraluminal pressure until leak-age or disruption occurs, and can be expressed as bursting pressure or bursting wall tension (13). Nieto et al (8) reported mean bursting pressures for single and double-layer jejunal anastomoses of 208 mmHg and 221 mmHg, respectively. Bickers et al (10) compared the bursting strength of stapled side-to-side and closed 1-stage stapled functional end-to-end jejunal anastomoses and reported mean bursting pressures of 31.27 mmHg and 48.64 mmHg, respectively, for these 2 sta-pled anastomotic techniques. The bursting pressures reported for hand-sewn jejunojejunal anastomoses were approximately 4 to 5 times higher than the bursting pressures reported for stapled jejunojejunal anastomoses using a similar experimental set-up (constant infusion rate of 1 L/min). The significantly lower bursting pressures for stapled jejunojejunal anastomoses compared to those of hand-sewn jejunojejunal anastomoses may be concerning especially in the immediate postoperative period. The holding strength of intestinal anastomoses has been reported to be crucial during the first 3 d after surgery (14). Furthermore, one may question that the biomechanical strength of stapled anastomoses may be even lower if stapled devices are used in excessively thick or edematous tissue, which can increase the risk of failure of the anastomosis. Therefore, reinforcement of stapled anastomoses would seem appropriate in order to provide the required security to prevent potential complications, such as leakage or hemorrhage, which may occur at the site of the anastomosis. Reinforcement of stapled anastomoses has been performed by either placing interrupted sutures at both ends of the staple line or by oversewing the entire staple line (15). There is a clinical perception by sur-geons who favor using stapling devices, that oversewing stapled anastomoses will biomechanically strengthen the anastomotic constructs to the point of making them as strong or stron-ger than hand-sewn anastomoses. However, to the authors’ knowledge, there are no studies that have compared the bio-mechanical strength of oversewn stapled jejunojejunal anas-tomoses specifically to hand-sewn jejunojejunal anastomoses in horses.

The purpose of this study was to determine if oversewn stapled anastomoses were biomechanically as strong as hand-sewn anastomoses. Our objectives were to compare construction times, bursting strength, and mode of failure of the following jejunojejunal anastomoses: single-layer continuous Lembert (1HS), double-layer simple continuous/Cushing (2HS), over-sewn stapled side-to-side (SS), and oversewn closed 1-stage stapled functional end-to-end (FEE). We hypothesized that oversewn stapled jejunojejunostomies would have comparable bursting strengths and construction times to those of hand-sewn jejunal anastomoses.

Materials and methodsSeven adult horses (4 geldings and 3 mares; 2 Thoroughbreds, 3 American Quarter horses, 1 Paint, 1 Canadian Warmblood) euthanized for reasons unrelated to gastrointestinal tract disease were used in this study. Horses ranged from 3 to 16 y of age [mean: 8.3 y 6 standard deviation (SD) 4.5 y] and weighed between 450 and 735 kg (mean: 548 kg 6 109 kg). Immediately following euthanasia, 5 mid-jejunal segments, 60-cm long were collected from each horse. Segments were rinsed with saline (0.9% NaCl) solution and the intestinal lumen was evacuated of ingesta.

A randomized block design was used to assign each seg-ment of intestine to 1 of the following groups: control (C); single-layer continuous Lembert (1HS); double-layer simple continuous/Cushing (2HS); oversewn stapled side-to-side (SS); or oversewn closed 1-stage stapled functional end-to-end (FEE). All anastomoses were preserved in lactated Ringer’s solution at 4°C and tested within 4 h of the horse being euthanized.

Construction of jejunojejunal anastomosesA board-certified surgeon (JLB) performed all jejunal anastomo-ses. For all hand-sewn anastomoses, the intestinal segments were sharply transected at their midpoints at approximately 60° to the mesenteric attachment. The transected ends were apposed with the use of stay sutures placed at the mesenteric and antimesen-teric borders of both intestinal segments. Mosquito forceps were placed at the end of each stay suture to apply constant tension in order to keep the ends of the intestinal segment stretched and in apposition while the surgeon performed the hand-sewn anastomoses.

Single-layer Lembert jejunojejunostomy (1HS)Single-layer anastomoses were performed as previously described (16). Polydioxanone (2-0 PDS II, Johnson & Johnson Medical Products, Peterborough, Ontario) was used to suture the sero-muscular and submucosal layers using a continuous Lembert pattern that was interrupted at the mesenteric and antimes-enteric borders. Suture bites were taken such that the needle entered the tissue 1 mm from the incised edge and exited the tissue 5 mm from the incised edge. Suture bites were taken 3 mm apart. When performing the single-layer anas-tomoses, care was taken to engage the submucosa with each suture bite.

Double-layer jejunojejunostomy (2HS)Double-layer anastomoses were performed as previously described (16). For the first layer, 2-0 PDS was used in a full-thickness simple continuous pattern to appose all layers of the intestinal wall. Suture bites were taken approximately 5 mm apart and 3 mm from the incised edge. A second layer was then performed to oversew the seromuscular layer using a Cushing pattern with 2-0 PDS. Suture bites were placed approximately 3 mm from the incision and were 5 mm long. The suture pattern was interrupted at the mesenteric and antimesenteric borders to prevent a purse-string effect during construction of the anastomosis.



AR

TIC

LE

Oversewn stapled side-to-side jejunojejunostomy (SS)An 80-mm, linear stapling device (ILA-80; Covidien, Norwalk, Connecticut, USA), loaded with a 4.8-mm staple cartridge was placed across the midpoint of a 60-cm intestinal segment. The stapling device was then fired to create 2 blind ends, and obtain two 30-cm segments. The blind ends were oversewn using a Cushing suture pattern with 2-0 PDS. Thereafter, the 2 blind ends were placed in an isoperistaltic fashion at the antimesen-teric borders, overlapping approximately 10 cm. Stay sutures were then placed at each end of the overlapping segments of jejunum. Two adjacent 1-cm stab incisions were made on the antimesenteric border at 1 end of the overlapping segments. A 100-mm linear stapling device (ILA-100; Covidien) with a 4.8-mm staple cartridge was then used, with the arms of the stapling device inserted into each of the created stab incisions. After the jaws of the stapler were properly positioned, it was held closed for 30 s (precompression time) and then fired once to create the stoma. Stab incisions were closed with 2-0 PDS in a single layer using a continuous Cushing suture pattern and the suture pattern was continued to oversew the staple line to the end of the anastomotic construct. Thereafter, the suture pattern was interrupted; the anastomotic construct was rotated 180° and a Cushing suture pattern was used to complete oversewing the entire staple line.

Oversewn closed 1-stage stapled functional end-to-end jejunojejunostomy (FEE)Closed 1-stage stapled functional end-to-end anastomoses were constructed as previously described (17) with slight variation due to the ex vivo nature of the construction. For this study, the intestinal segment was positioned in an antiperistaltic fashion such that the intestine was folded back on itself. Two stay sutures were placed to secure the segments of jejunum relative to each other before creating the anastomosis. The first stay suture was placed 10 cm from the apex created in the folded segment of jejunum. The second stay suture was placed approximately 15 cm relative to the first stay suture. Thereafter, an adjacent 1-cm stab incision was made in the antimesenteric border of each jejunal segment, 2 cm away from the first stay suture. The arms of the 100-mm linear stapler (ILA-100; Covidien) were then inserted into each of the stab incisions. Special care was taken to ensure that the antimesenteric borders of each jejunal segment were correctly apposed, before coupling and locking the stapling device. The ILA-100 stapler was then held closed for 30 s (precompression time) and fired once to create the stoma. The ILA-100 stapler was removed and a 90-mm lin-ear stapler (TA-90; Covidien) was positioned diagonally across the anastomosis to close the common stab incisions. The TA-90 stapler was fired such that the staple line overlapped a portion of the anastomotic staple lines on the antimesenteric borders of the anastomotic construct. With the stapling device still in place, sharp transection was then made close to the TA-90 stapler in order to remove the intestinal apex. A continuous Cushing suture pattern with 2-0 PDS was used to oversew the staple line created to close the stab incisions. The entire anastomotic staple line was then oversewn using a continuous Cushing suture

pattern with 2-0 PDS. The staple line was oversewn starting on the antimesenteric side and interrupted at the crotch of the “V” where the 2 intestinal segments merged. The anastomotic construct was then rotated 180° and the mesenteric side was similarly oversewn.

Anastomosis construction timeFor the 1HS and 2HS groups, the time recorded for the con-struction of the anastomosis was the interval between the place-ment of the first stay suture and the completion of the anasto-motic construct. For the SS group, time was recorded started with the placement of the 80-mm linear stapling device across the midpoint of the intestinal segment to create the 2 blind ends and ended with completion of the oversewing of the staple line. For the FEE group, time for construction began with the placement of the first stay suture and ended when oversewing of the staple line was completed.

Biomechanical testingFor this study, bursting pressure (BP) was used as a biome-chanical indicator of the bursting strength for all anasto-motic constructs. Biomechanical testing was performed as previously described (16). Briefly, each intestinal segment was submerged in 30 L of 0.9% NaCl solution in a custom-made bath. The open ends of the intestinal segments were attached to 2 barbed connectors, one of which was coupled to an end cap with a bleeder valve. The other barbed connector was attached to a T-connector attached to a pressure trans-ducer (P55 Compact Differential Pressure Transducer; Validyne Engineering, Northridge, California, USA) and a peristaltic roller pump (Karl Storz-Endoskope SCB Hamou Endomat 263310 20; Karl Storz GmbH & Co., Mississauga, Ontario) for delivery of fluid. Intra-luminal pressures were continuously monitored and recorded with a strain gauge amplifier (Interface Model SGA AC/DC Powered Signal Conditioner; Interface, Scottsdale, Arizona, USA), an analog to digital data acquisi-tion card (National Instruments, NI USB-6210; Austin, Texas, USA) and a personal computer with data acquisition software (LabView; National Instruments, Austin, Texas, USA). The volume of fluid infused into each intestinal segment during the bursting trial was measured using a load cell (Interface, Model SSM Sealed S-Type Load Cell, Interface) and associated instrumentation consisting of the same strain gauge amplifier, analog-to-digital data acquisition card, and computer with data acquisition software used to determine the increase in sample pressure. For each measurement, two 3-L 0.9% NaCl solution bags stained with new methylene blue dye were used for fluid delivery into the intestinal segment.

Bursting strength (bursting pressure) was determined by increasing the intra-luminal pressure of the intestinal segment until mechanical failure occurred. Fluid was infused into the intestinal segment by the peristaltic roller pump at a constant rate of 1 L/min until failure, signaled by leakage of blue dye into the fluid bath. Bursting strength was the maximum pressure, or bursting pressure, that was recorded before a sudden decrease in the slope of the pressure versus time curve or, alternatively, the pressure that was recorded when the methylene blue solution



AR

TIC

LE

was observed to leak onto the outer surface of the intestinal segment. The bursting pressure in mmHg at the time of biome-chanical failure, the mode of failure (leaking or bursting), and the location of the failure were recorded.

Statistical analyses were performed using software package Stata 12 (StataCorp, College Station, Texas, USA) and for all statistical tests, P , 0.05 was considered significant. Descriptive statistics were reported as mean 6 standard error (SE). A Shapiro-Wilk test was used to determine whether the data were normally distributed. Mixed linear regression models were used to compare bursting pressure and construction times by surgical technique. Variation among horses was controlled as a random effect in the above models. In each of the models, breed and age were evaluated as potential confounding variables. The residuals for each model were tested for normality and homoscedasticity.

ResultsTime for construction of anastomosisThe FEE was the jejunojejunal anastomotic technique with the shortest construction time (Table 1). Mean 6 SE construc-tion time for the FEE was significantly shorter than for SS (P , 0.0001), 1HS (P = 0.0012), and 2HS (P , 0.0001). The 1HS had a shorter construction time than did SS (P , 0.001). The 2HS group had the longest construction time com-pared with 1HS (P , 0.001), FEE (P , 0.0001), and SS (P , 0.0001).

Bursting strengthMean 6 SE BP for the control jejunal segments was sig-nificantly higher than for 1HS (P , 0.001), SS (P , 0.0001), and FEE (P , 0.0001) groups (Table 1). No differences were found between control segments and 2HS (P = 0.0503). There were no significant differences in BP between 1HS and 2HS (P = 0.0963) or between SS and FEE (P = 0.1216). Both hand-sewn jejunojejunostomies (1HS and 2HS) had significantly higher BP than did oversewn stapled jejunojejunostomies (SS: P , 0.001, P , 0.001) and (FEE: P , 0.001, P , 0.001), respectively.

Mode and location of failureAll control jejunal segments failed by bursting along the mesen-teric border. All 2HS anastomotic constructs failed by bursting. Failure of 5 of the 2HS constructs occurred 3 to 5 cm away

from the anastomosis while the anastomosis remained intact. In 2 of the 2HS constructs, failure occurred at the intestinal wall adjacent to the anastomosis with the suture remaining intact (Figure 1). In the 1HS group, 5 anastomotic constructs failed by bursting 1 to 3 cm away from the anastomosis, while 2 con-structs failed by leakage at the anastomosis where the first suture bite was taken to appose the mesenteric border (Figure 2). In all hand-sewn anastomoses the sutures remained intact. In the FEE group, 5 constructs failed by bursting and 2 by leakage. Failure of all FEE constructs occurred consistently at the crotch of the “V” where the 2 intestinal segments merged (Figure 3). For the SS group, 4 constructs failed by leakage and 3 by bursting. Failure occurred consistently at the staple end of the stoma adja-cent to one of the blind stumps of the jejunum (Figure 4). In 4 constructs failure occurred at the end of the staple line where the stab incisions were made and in 3 constructs failure occurred at the end of the staple line away from the stab incisions.

DiscussionThis study compared the bursting strength between hand-sewn and oversewn stapled jejunal anastomoses. The results indicate that oversewing the staple line of stapled side-to-side and closed 1-stage stapled functional end-to-end jejunojejunostomies does not provide the additional reinforcement to make these anastomotic constructs biomechanically as strong as hand-sewn anastomoses when initially created.

Table 1. Mean 6 standard error values of anastomosis construction time and bursting pressure from single-layer continuous Lembert (1HS), double-layer simple continuous/Cushing (2HS), oversewn stapled side-to-side (SS), and oversewn closed 1-stage stapled functional end-to-end (FEE) anastomoses.

Construction Bursting pressure Group time (min) (mmHg)

Control N/A 257.63 6 45.41a

1HS 19.52 6 1.40 197.31 6 32.27b

2HS 26.34 6 1.42 224.84 6 48.94a,b

SS 22.07 6 2.33 108.65 6 30.04c

FEE 16.41 6 1.44 134.18 6 8.47c

a,b,c Values marked with the same superscript letters were not significantly different from each other. N/A — Not available. Figure 1. Hand-sewn double-layer (2HS) jejunojejunostomy.

The black arrow marks the point of failure (bursting) away from the anastomosis while the anastomosis remains intact.

Figure 2. Single-layer Lembert (1HS) jejunojejunostomy. The black arrow marks the point of failure (leakage) at the anastomosis where the first suture bite was taken to appose the mesenteric border.



AR

TIC

LE

Use of stapling devices has become more prevalent in equine abdominal surgery because of the reduction in surgery time and minimized risk of abdominal contamination when these instruments are used appropriately (5,18,19). The greatest advantage claimed for the use of stapling devices has been speed in construction of anastomoses (5). There is evidence that stapling devices can decrease the surgical time required to perform an intestinal resection in horses by over 50% (20). However, an experimental study comparing stapled side-to-side jejunojejunal anastomosis to traditional double-layer hand-sewn jejunojejunal anastomosis found no difference in their construc-tion times (18). Additionally, another study found no difference in duration of surgery when hand-sewn end-to-end, stapled functional end-to-end, or stapled side-to-side anastomoses were performed in horses undergoing jejunal resection and anastomo-sis (21). In our study, although we found a statistical difference in construction times between oversewn stapled techniques and hand-sewn techniques, we believe a 10-minute difference in time (found between FEE and 2HS) may not be clinically significant. Nevertheless, surgeons should make every effort to shorten surgery times when undertaking exploratory celiotomies because of the reported negative association between duration of surgery and survival rates (22).

Evaluation of the bursting strength has been the preferred method to investigate anastomotic integrity and intestinal heal-ing in horses (8,10–12,16,23,24). Several studies have compared the bursting strength of jejunojejunal anastomoses in horses using different suture patterns or stapling techniques (8,10–12). A previous experimental study reported single and double layer hand-sewn jejunojejunal anastomoses to have bursting pres-sures significantly higher (8) than values reported for stapled side-to-side and closed 1-stage stapled functional end-to-end jejunojejunal anastomoses (10) using similar methodology. Moreover, these findings have also been reported for jejunoileal anastomoses in which bursting pressure for single- and double-layer end-to-end jejunoileal anastomoses were 4 to 5 times higher than those for stapled side-to-side and stapled functional end-to-end jejunoileal anastomoses (16). In horses, this may be relevant in the immediate postoperative period where excessively

thickened or edematous tissue may make the anastomosis more susceptible to failure. Bickers et al (10) reported mean bursting pressures of 48.64 mmHg for closed 1-stage stapled functional end-to-end jejunojejunostomy and 31.27 mmHg for stapled side-to-side jejunojejunostomy. Experimentally, intraluminal pressures ranging from 8 to 24 mmHg have been reported during extraluminal intestinal obstruction of the jejunum in conscious ponies (25). Interestingly, in that study, cyclic pres-sure peaks up to 60 mmHg were frequently measured during the obstructive trials, which are higher than bursting pressures reported by Bickers et al (10) for stapled side-to-side and closed 1-stage stapled functional end-to-end jejunojejunal anastomoses. Therefore, one could argue that oversewing stapled jejunojejunal anastomosis is warranted for anastomotic security. In our study, we found that oversewing the staple line of stapled jejunojejunal anastomoses (SS and FEE) did not strengthen the construct to obtain bursting pressures comparable to those obtained in hand-sewn jejunojejunal anastomoses and we therefore failed to prove our hypothesis. The bursting pressures we report for oversewn stapled jejunojejunal anastomoses were 1.5 to 2 times lower than those for single and double hand-sewn anastomoses. Nevertheless, all tested oversewn stapled anastomotic constructs failed at pressures from 96 to 166 mmHg. These pressures are significantly higher than the intraluminal pressures reported in non-surviving horses with obstructive small intestinal disease, which reached pressures up to 21 cm H2O (15.44 mmHg) (26) and higher than the cyclic pressure peaks (60 mmHg) measured during the obstruction trials (25). Although single and double-layer hand-sewn jejunojejunal anastomoses proved to be biomechanically stronger anastomotic constructs, we believe that oversewn stapled side-to-side and closed 1-stage stapled functional end-to-end anastomoses will be unlikely to fail in clinical cases because of the supraphysiological pressures they are capable of withstanding.

A limitation of this study is that a “stapled only” group was not used to compare the bursting strength of anastomoses with staples only to those of oversewn stapled anastomoses and hand-sewn anastomoses. We chose not to include a stapled only group as the bursting strengths of stapled side-to-side and closed

Figure 3. Oversewn closed stapled 1-stage functional end-to-end jejunojejunostomy. The black arrow marks the point of failure (bursting) at the crotch of the “V” of the anastomosis.

Figure 4. Oversewn stapled side-to-side jejunojejunostomy. The black arrow marks the point of failure (bursting) at the staple end of the stoma.



AR

TIC

LE

1-stage stapled functional end-to-end jejunojejunostomy have been previously reported experimentally (10) and therefore we were aware of their low bursting pressures. In addition, the pur-pose of our study was to specifically compare oversewn stapled anastomoses to those of hand-sewn anastomoses. The mean bursting pressures we report in this study (134.18 mmHg for oversewn closed 1-stage stapled functional end-to-end jejunoje-junostomy and 108. 65 mmHg for oversewn stapled side-to-side jejunojejunostomy) are 2.5 to 3 times higher, respectively, than those reported by Bickers et al (10) using a similar experimen-tal set-up. Therefore, although a stapled only group was not included in this study, our results show that oversewing stapled jejunojejunal anastomoses would considerably strengthen the anastomotic construct. Nevertheless, further research is war-ranted to compare the bursting strength between stapled and oversewn stapled anastomoses.

The submucosa is the strongest layer (holding layer) in the small intestine and therefore, its inclusion in an anastomosis is crucial to provide biomechanical strength and resistance (27,28). A Cushing suture pattern is an inverting pattern that penetrates the submucosal layer but not the lumen of hollow viscera (29). By oversewing stapled anastomoses using an inverting suture pattern, the staple line primarily serves to reduce contamination during resection, while the inverting suture pattern serves as the primary method of closure (19). We initially believed that oversewing stapled anastomoses with a Cushing suture pattern would create a stronger anastomosis of similar biomechanical strength to single and double-layer hand-sewn anastomoses. However, the results of this study clearly demonstrate that single and double-layer hand-sewn anastomoses are stronger constructs than oversewn stapled anastomoses when initially created. We attribute the difference in bursting strength between hand-sewn and oversewn stapled anastomoses to i) the disparity in anastomotic geometry, and ii) location of stress raisers in the stapled anastomotic techniques. The hand-sewn anastomoses resemble the geometry of a cylinder; therefore, when forces are applied to hand-sewn anastomotic constructs they will be evenly distributed along the intestinal walls (30). Biomechanically, a construct is strongest when force is evenly distributed over its area (31), as would occur in hand-sewn single and double layer anastomoses. The 2 stapled techniques reported in this study, however, are shaped in a complex manner, resulting in unevenly distributed forces along the wall of the intestinal segment and largely different actual stress distributions making them prone to fail at lower pressures (28). Oversewn closed 1-stage stapled functional end-to-end anastomoses consistently failed at the crotch of the “V” where the 2 intestinal segments merged, while oversewn stapled side-to-side anastomoses consistently failed at the staple end of the stoma. These locations have been previously reported as sites of failure in stapled jejunojejunostomies (10) and stapled jejunoileal anastomoses (16). Although not specifi-cally tested, the crotch of the “V” and the end of the staple line most likely create stress raisers where high local stresses con-centrate, ultimately resulting in rapid failure at relatively low bursting pressures. Further research is warranted to investigate these areas of high stress concentration in stapled anastomoses in order to provide more secure anastomotic constructs.

Anastomotic leakage is a feared complication following resection and anastomosis that can lead to devastating conse-quences in horses such as septic peritonitis (1). In our study, 2 single-layer Lembert constructs failed by leakage. Failure in these constructs consistently occurred where the first suture bite was taken to appose the mesenteric border. The bursting pressures at the time of leakage in these constructs were 176.12 and 186.70 mmHg, which are significantly higher than the intraluminal pressures in non-surviving horses with obstructive small intestinal disease (26). It has been reported that failure to gain a substantial purchase through the seromuscular layer at this area makes anastomotic leakage inevitable (1). In clinical cases, edema forms rapidly in the strangulated intestinal wall making it difficult to distinguish between the mesenteric attach-ment and the seromuscular layer. Therefore, when performing a single-layer Lembert jejunojejunostomy, surgeons should ensure that optimal seromuscular layer purchase is obtained to appose the mesenteric borders to prevent anastomotic leakage at this area. Nevertheless, a recent clinical study (7) has shown single-layer continuous Lembert anastomosis to be a safe and effective option for small intestinal anastomosis as horses had comparable short-and long-term survival rates to those reported previously for double-layer anastomoses (21,32).

We found no difference in the bursting strength between single-layer and double-layer anastomoses (power = 0.23) or between oversewn stapled side-to-side and oversewn closed 1-stage stapled functional end-to-end anastomoses (power = 0.58). A larger sample size would have been needed to determine differences between these hand-sewn and oversewn anastomoses. Although hand-sewn anastomoses proved to be biomechanically stronger than oversewn stapled anastomoses when initially cre-ated, all reported anastomotic types would be secure techniques to be used clinically as they will provide the biomechanical strength to withstand the forces and pressures that a newly cre-ated anastomosis may experience in the immediate postoperative period. Nonetheless, further research is needed to evaluate the healing characteristics and biomechanical properties of over-sewn stapled jejunojejunostomies during the early postopera-tive period, to provide more conclusive evidence as to whether oversewn stapled anastomoses (SS and FEE) continue to have lower bursting strength than hand-sewn anastomoses after the immediate postoperative period. CVJ

References 1. Freeman DE. Surgery of the small intestine. Vet Clin North Am Equine

Pract 1997;13:261–301. 2. Reinertson EL. Comparison of three techniques for intestinal anasto-

mosis in Equidae. J Am Vet Med Assoc 1976;169:208–212. 3. Dean PW, Robertson JT. Comparison of three suture techniques for

anastomosis of the small intestine in the horse. Am J Vet Res 1985;46: 1282–1286.

4. Edwards G. Resection and anastomosis of small intestine: Current methods applicable to the horse. Equine Vet J 1986;18:322–330.

5. Doran RE, Allen D. The use of stapling devices in equine gastrointes-tinal surgery. Compend Contin Educ Pract Vet 1987;9:854–860.

6. Latimer FG, Blackford JT, Valk N, Wan P, Patton S. Closed one-stage functional end-to-end jejunojejunostomy in horses with use of linear stapling equipment. Vet Surg 1998;27:17–28.

7. Mendez-Angulo JL, Ernst NS, Mudge MC. Clinical assessment and outcome of a single-layer technique for anastomosis of the small intes-tine in horses. Vet Rec 2010;167:652–655.



AR

TIC

LE

8. Nieto JE, Dechant JE, Snyder JR. Comparison of one-layer (continu-ous Lembert) versus two-layer (simple continuous/Cushing) hand-sewn end-to-end anastomosis in equine jejunum. Vet Surg 2006;35:669–673.

9. Ballantyne GH, Burke JB, Rogers G, Lampert EG, Boccia J. Accelerated wound healing with stapled enteric suture lines. An experimental study comparing traditional sewing techniques and a stapling device. Ann Surg 1985;201:360–364.

10. Bickers RJ, Blackford JT, Eiler H, Rohrbach B. A comparison of the mechanical strength of two stapled anastomosis techniques for equine small intestine. Vet Surg 2002;31:104–110.

11. Auletta L, Lamagna F, Uccello V, Lamagna B, Pasolini MP. In vitro comparison of three suture techniques for anastomosis of the equine small intestine. Equine Vet J 2011;43:46–50.

12. Sherlock C, Lee W, Mueller POE, Eggleston R, Epstein K. Ex vivo comparison of three hand sewn end-to-end anastomoses in normal equine jejunum. Equine Vet J 2011;43:76–80.

13. Hendriks T, Mastboom WJ. Healing of experimental intestinal anasto-moses. Parameters for repair. Dis Colon Rectum 1990;33:891–901.

14. Fellows NM, Burge J, Hatch CS, Price PB. Suture strength and heal-ing strength of end-to-end intestinal anastomoses. Surg Forum 1951: 111–117.

15. Fugaro MN, Côté NM. Survival rates for horses undergoing stapled small intestinal anastomosis: 84 cases (1988–1997). J Am Vet Med Assoc 2001;218:1603–1607.

16. Bracamonte JL, Anderson SL, Hendrick S, Barbere SM, Deutscher D, Sumner D. Ex vivo comparison of the biomechanical properties of hand-sewn and stapled jejunoileal anastomoses in horses. Vet Surg 2014; 43:451–458.

17. Latimer FG, Blackford JT, Valk N, Wan P, Patton S. Closed one-stage functional end-to-end jejunojejunostomy in horses with use of linear stapling equipment. Vet Surg 1998;27:17–28.

18. Baxter GM, Hunt RJ, Tyler DE, Parks AH, Jackman BR. Sutured end-to-end and stapled side-to-side jejunal anastomoses in the horse. Vet Surg 1992;21:47–55.

19. Mueller POE, Allen D. Instrumentation and techniques in equine gastrointestinal surgery. Vet Clin North Am Equine Pract 1996; 12:207–233.

20. Sullins KE, Stashak TS, Mero KN. Evaluation of intestinal staples for end-to-end anastomosis of the small intestine in the horse. Vet Surg 1985;14:87–92.

21. Semevolos SA, Ducharme NG, Hackett RP. Clinical assessment and outcome of three techniques for jejunal resection and anastomosis in horses: 59 cases (1989–2000). J Am Vet Med Assoc 2002;220:215–218.

22. Phillips TJ, Walmsley JP. Retrospective analysis of the results of 151 exploratory laparotomies in horses with gastrointestinal disease. Equine Vet J 1993;25:427–431.

23. Eggleston RB, Muller PO, Parviainen AK, Groover ES. Effect of car-boxymethylcellulose and hyaluronate solutions on jejunal healing in horses. Am J Vet Res 2004;65:637–643.

24. Lee WL, Epstein KL, Sherlock CE, Muller PO, Eggleston RB. In vitro comparison of a single-layer (continuous Lembert) versus two-layer (simple continuous/Cushing) hand-sewn end-to-end jejunoileal anas-tomosis in normal equine small intestine. Vet Surg 2012;41:589–593.

25. MacHarg MA, Adams SB, Lamar CH, et al. Electromyographic, myo-mechanical, and intraluminal pressure changes associated with acute extraluminal obstruction of the jejunum in conscious ponies. Am J Vet Res 1986;47:7–11.

26. Allen D, White NA, Tyler DE. Factors for prognostic use in equine obstructive small intestinal disease. J Am Vet Med Assoc 1986;189: 777–780.

27. Halsted WS. Circular suture of the intestine-an experimental study. Am J Med Sci 1887;94:436–461.

28. Egorov VI, Schatslivtsev IV, Prut EV, Baranov AO, Turusov RA. Mechanical properties of the human gastrointestinal tract. J Biomech 2002;35:1417–1425.

29. Kümmerle JM. Suture material and patterns. In: Auer JA, Stick JA, eds. Equine Surgery. 4th ed. St. Louis, Missouri: Saunders Elsevier, 2012: 181–202.

30. Nelsen TS, Anders CJ. Dynamic aspects of small intestinal rupture with special consideration of anastomotic strength. Arch Surg 1966; 93:309–314.

31. Pilkey WD. Stress concentration analysis and design. In: Peterson’s Stress Concentration Factors. 2nd ed. Hoboken, New Jersey: John Wiley & Sons, 1999:441–499.

32. Proudman CJ, Edwards GB, Barnes J. Differential survival in horses requiring end-to-end jejunojejunal anastomosis compared to those requiring side-to-side jejunocaecal anastomosis. Equine Vet J 2007;39: 181–185.

Saunders Comprehensive Veterinary Dictionary, 4th edition

Studdert VP, Gay CC, Blood DC, eds. Elsevier Saunders, Philadelphia, Pennsylvania, USA. 2013. ISBN: 9780-7020-3231-8. 1325 pp. $83.89.

T he first notable feature of this edition is its size. The previ-ous edition, which measured 7 3 9.5 3 2 3/4 inches, has

now grown to 8.5 3 10 3/4 3 2 inches. It is not easily thrown into a backpack. The font size, while still quite readable, has been decreased to accommodate more information and allow for the addition of new figures and photographs.

This expanded edition has been thoroughly reviewed and updated. Disciplines such as holistic medicine, camelid hus-bandry, animal welfare, and food safety relating to veterinary medicine have been incorporated. The style of tables in the appendices has been improved to facilitate reading.

This highly recommended reference book provides veterinary students, veterinarians, and scientific editors with valuable information pertaining to veterinary technical and scientific terminology.

Reviewed by Stella Wheatley, Hon BSc, Assistant Managing Editor, Journals, Canadian Veterinary Medical Association, Ottawa, Ontario.

Book Review Compte rendu de livre



Review Article Compte rendu

Brucella canis: An update on research and clinical management

Kevin L. Cosford

Abstract — In Canada, Brucella canis remains a potentially devastating infectious agent that is still considered uncommon, despite the increasing international movement of dogs. There may be a growing risk to the Canadian canine population due to a reliance on outdated seroprevalence studies and the lack of federal regulation. With the complex diagnostic and management challenges associated with Brucella canis, a One Health approach is necessary to address the need for ongoing research, including updating canine and human seroprevalence rates in Canada, elucidating the pathogenesis, and determining the most appropriate treatment and prevention strategies. Clinical management decisions are often complicated by currently available treatment protocols, and health risks to both canine and human populations. This article integrates recent research focusing on the pathogenesis, diagnosis, and treatment of Brucella canis, and outlines current clinical management approaches.

Résumé — Brucella canis : mise à jour sur la recherche et la gestion clinique. La brucellose canine, causée par un agent infectieux important et potentiellement dévastateur, est toujours considérée rare au Canada malgré l’arrivée croissante de chiens provenant de régions ayant une prévalence supérieure de l’infection par Brucella canis. Il y a un risque grandissant pour la population canine canadienne parce que l’on se fie à des études de séroprévalence désuètes et qu’il existe une absence de règlements fédéraux. En raison des défis complexes liés au diagnostic et à la gestion de Brucella canis, l’approche Une seule santé est nécessaire afin d’aborder le besoin de poursuivre la recherche, y compris la mise à jour des taux de séroprévalence canine et humaine au Canada, la clarification de la pathogénèse, la définition de l’éventail potentiel de manifestations cliniques et la détermination du traitement et des stratégies de prévention les plus appropriés. Les décisions de gestion clinique sont souvent compliquées par les protocoles de traitement actuellement disponibles et les risques pour la santé des populations canine et humaine. Cet article intègre de la recherche récente portant sur la pathogénèse, le diagnostic et le traitement de Brucella canis et présente les approches de gestion clinique actuelles.


Can Vet J 2018;59:74–81

IntroductionAlthough endemic to Canada, Brucella canis is an elusive infec-tious agent of unknown significance to most practitioners. Clinical disease attributed to Brucella canis infection occurs spo-radically, reinforcing the perception that the disease is uncom-mon in Canada compared with other regions of North America such as Mexico and the southeastern USA. Seroprevalence rates in the southeastern USA are estimated to be 7% to 8% (1).

Earlier reports from Quebec (1970’s) and southwestern Ontario (1980) still serve as the main Canadian seroprevalence data with rates of 1.6% and 0.3%, respectively (2,3). There is currently a paucity of seroprevalence studies in western Canada, but out-breaks have been observed in a Saskatchewan kennel and the Calgary, Alberta area (4,5).

With the unprecedented rates of animals moving across international borders and the lack of federal regulation, canine brucellosis may be changing its geographical distribution. In 1988, a Canadian Veterinary Journal article documented the identification of 2 strains, an American type strain RM66 and a Mexican strain Mex 51, in 11 Brucella canis isolates from Canadian dogs (6). Characterization of the current circulat-ing strains is warranted. Until this information is available, Canadian veterinarians should be aware of the agent and con-sider it as a reasonable differential diagnosis in appropriate cases, regardless of historical information, or neuter status.

Establishing a diagnosis can be challenging due to the wide spectrum of clinical manifestations reported and the limita-tions of available diagnostic tests. The intent of this article is

Department of Small Animal Clinical Sciences, Western College of Veterinary Medicine (WCVM), 52 Campus Drive, Saskatoon, Saskatchewan S7N 5B4.Address all correspondence to Dr. Kevin Cosford; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.



RE

VIE

W A

RT

ICL

E

to familiarize clinical, public health, and research veterinarians with the etiology, transmission, pathogenesis, course of infec-tion, clinical manifestations, diagnosis, treatment, prevention, and public health aspects of the disease.

EtiologyBacteria in the genus Brucella are nonmotile, nonencapsulated, non-spore-forming, facultatively intracellular Gram-negative coccobacilli or short rods (7,8). Four of the six classical Brucella species are known to cause disease in dogs and humans: Brucella canis (natural reservoir animal is the dog), Brucella melitensis (sheep, goats), Brucella suis (pigs), and Brucella abortus (cattle, bison, buffalo) (7,8). The remaining 2 of the 6 classical Brucella species [Brucella neotomae (rodents, desert rats) and Brucella ovis (sheep)] are not associated with disease in dogs. Additional Brucella species including both terrestrial forms (B. microti, B. inopinata) and marine forms (B. maris, B. pinnipediae, B. ceti) are of uncertain pathogenicity to dogs.

Brucella canis was discovered in 1966–1967 during an investi-gation of abortion in beagles, in which the organism was isolated from aborted tissues and vaginal discharge (9–12). Brucella canis was initially thought to be a biotype of Brucella suis based on genotypic and phenotypic similarities (13). The significance of this distinction is paramount to the Canadian swine industry and the Canadian Food Inspection Agency (CFIA) as Canada is considered free of Brucella suis biovar 3 (4). Differentiation between Brucella canis and Brucella suis biovar 3 can be chal-lenging (4). A multiplex conventional polymerase chain reac-tion (PCR) has been optimized to differentiate between these Brucella species (14).

The host range for Brucella canis is predominantly domestic dogs, but other species have been investigated. Serologic studies of wild canids have documented positive antibody titers in foxes and coyotes (7). Experimental studies involving conjunctival and oral inoculation of cattle, swine, and sheep with B. canis showed that these host species were highly resistant to B. canis infec-tion, despite 2 field reports of B. canis in cattle (7). Similarly, oral experimental infection of cats documented transient bac-teremia in 3/14 but none developed agglutinating antibody titers (7).

TransmissionMajor routes of transmission for this venereally transmitted agent are genital, conjunctival, and oronasal mucosae, as occurs during normal reproductive, social, and grooming activities in dogs (7,8,15,16). The primary sources of transmission are reproductive fluids: vaginal discharges and semen. Tissues and fluids associated with the fetus, the placenta, and the vagina after abortion or stillbirth have approximately 106 organisms/mL (7). Shedding of the organism occurs in vulvar secretions for up to 6 wk after abortion and during estrus (7,8). In males, semen has high concentrations of the bacterium for 6 to 8 wk after infection (7). The agent is then shed intermittently for up to 2 y at lower concentrations in semen which remains an important source of infection for other dogs (7). The minimum infectious dose is approximately 106 organisms/mL via the oral route and 104 to 105 organisms/mL by the conjunctival route (7). Minor

routes of transmission include in utero, broken skin, blood transfusions, feces, milk, and fomites such as contaminated syringes, vaginoscopes, and artificial insemination equipment (7,8,15,16).

PathogenesisCurrent paradigmBrucella bacteria attach to mucous membranes, penetrate the epithelial barrier, and are taken up by the mononuclear phagocytic system, where they reside intracellularly. This is accomplished by utilizing virulence factors presumably via the type IV secretory system, and inhibiting the bactericidal myeloperoxidase-peroxide-halide system through the release of 5-guanosine and adenine (8,17,18). The intracellular organ-isms then travel through the reticuloendothelial system to local lymph nodes (retropharyngeal, inguinal, superficial iliac), liver, spleen, and possibly bone marrow. After 7 to 30 d, the bacteria move into the blood stream to cause intermittent bacteremia. The organism targets “steroid-dependent” reproductive tissues, including the prostate, testicles, epididymides, gravid uterus, and placenta (8). Evaluation of a Saskatchewan kennel outbreak of brucellosis found that the progestational, non-gravid uterus was also a reservoir for the bacterium (4). A mixed inflammatory response consisting of lymphocytes, plasmacytes, and histiocytes has been observed in these reproductive tissues (4,7,8). Focal coagulative necrosis of the chorionic villi, necrotizing arteritis, and numerous bacteria in trophoblastic epithelial cells can be found in the aborted placenta (4,8).

Non-reproductive body systems become affected as the bacteremia spreads organisms and antibody-antigen com-plexes to the end-arterial circulation of the intervertebral disk (discospondylitis), or the eye (anterior uveitis or endophthal-mitis) (7,8). Interestingly, in experimentally infected dogs, immunosuppression with glucocorticoids or anti-lymphocyte serum may increase susceptibility to initial infection, but does not appear to alter the severity of disease or the course of infec-tion (7). Elucidation of this organism’s role in idiopathic inflam-matory conditions such as meningoencephalitis, panniculitis, lymphadenitis, hepatitis, and splenitis should be given due consideration by future research initiatives.

Recent researchA murine study has confirmed the pathogenic strategy of B. canis as an intracellular bacterium, with an intracellular trafficking route indistinguishable from that of B. abortus (17). The study documented a less robust response in mice infected with B. canis compared with B. abortus in terms of proinflam-matory cytokines (TNF-alpha, IL-6, IL-12), IFN-gamma levels, splenic inflammation, and hepatic granulomas (17). It appears that B. canis may be less pathogenic than other Brucella species in this murine model, which supports clinical observations.

Another study in mice and dogs support a Th1 immune response as essential for protection from B. abortus infection (19). VirB proteins are virulence factors that are part of the type IV secretory system. VirB proteins are presumably on the outer surface of the Brucella bacterium and are believed to promote intracellular survival. Anti-VirB antibodies promote



CO

MP

TE

RE

ND

U

complement-dependent bacteriolysis (19). Immunization of mice with VirB proteins resulted in increased IFN-gamma and undetectable IL-4 in VirB-vaccinated individuals compared to the placebo, which is a pattern consistent with a Th-1 response (19). In addition, VirB-vaccinated mice challenged intraperitoneally with live B. abortus had a splenic bacterial load of 1 log lower than the placebo (19). Similarly, peripheral blood mononuclear cells of VirB-vaccinated dogs produced significantly higher levels of IFN-gamma than in the placebo; and in vitro complement-dependent bacteriolysis was significant in VirB-vaccinated dogs versus the placebo (19). Further studies evaluating vaccination against the virulence factor, VirB, are warranted.

A new perspective on rough and smooth colony morpholo-gies has recently been proposed. Colony morphologies have been classified into smooth and rough forms, based on the respective presence or absence of the most external antigen, O-polysaccharide, within the lipopolysaccharide (LPS) of the cell wall. Traditionally, smooth (B. melitensis, B. abortus, and B. suis) and rough (B. canis, and B. ovis) forms were believed to represent laboratory artifacts that occur with Gram-negative bacterial colonies in culture (7,20). Recent research suggests that the loss of O-polysaccharide results from the spontaneous excision of the wbkA glycosyltransferase gene (21). This phenomenon is referred to as smooth to rough dissociation (20,21). The significance of colony morphology and Brucella LPS genetics remains contro-versial, but a potential link to virulence might exist (20,21).

Different strains or isolates of B. canis have also been reported. A less mucoid (M-) laboratory strain is maintained in the laboratory as the antigen source for serology assays (22). Interestingly, this M-strain is believed to be avirulent in dogs, but has been reported to infect a laboratory worker in a similar fashion to wild-type Brucella canis (22). A Swedish outbreak investigation documented differences within prophage gene content of American, African, and European isolates compared to Asian strains (23). The significance of these strains in terms of their relative pathogenicity remains unclear.

Course of infectionBacteremic episodes can last for years as experimentally infected dogs can have positive blood cultures for 5.5 y (8). The animal seroconverts as early as 2 to 4 wk but this can be as long as 8 to 12 wk after infection (1,7,8). After 3 to 4 mo the degree of bacteremia declines, but the organism remains persistently in the blood or sequestered in tissues. The current paradigm with respect to the outcome of B. canis infection is that cell-mediated immune responses typically result in self-elimination within 2 to 3 y on average (7). Alternatively, humoral immune responses do not eliminate the organism resulting in persistently infected dogs (7).

Experimentally infected dogs allowed to recover naturally were immune to subsequent oral or intravenous rechallenge for up to 4 y (7). In contrast, infected dogs that did not self-eliminate the organism were susceptible to oronasal challenge 12 wk after completion of antimicrobial therapy (7). Antibiotic therapy is widely believed to be unsuccessful at eliminating persistent infection in dogs.

Clinical manifestationsBrucella canis is typically associated with reproductive abnormal-ities but a wide range of non-reproductive signs can occur (1). The organism has been given the nickname “the Great Imposter” to illustrate this point (1). It is important to remember that most infected dogs do not appear seriously ill. Deaths are rare except in utero, in newborns, and in animals with severe illness (7).

Female dogs infected venereally experience early embryonic death 2 to 3 wk after transmission, which looks like failure to conceive or infertility (7). If the pregnancy progresses sponta-neous abortion occurs most commonly between 7 and 9 wk of gestation (45 to 55 d), which is referred to as a late stage spontaneous abortion (7). Normal canine gestation is 57 to 72 d (24). Mucoid, serosanguinous, or gray-green vaginal discharge persists for 1 to 6 wk after abortion (7). Endometritis has also been observed (7). Some B. canis infected bitches can give birth to litters that appear clinically normal. These puppies are born infected and can manifest disease later in life (7).

During the acute stage, venereally infected male dogs may initially experience epididymitis and scrotal edema, while orchitis occurs less frequently. Scrotal dermatitis also occurs due to self-induced irritation from licking. The disease can then progress to a chronic stage characterized by testicular atrophy (unilateral or bilateral) and infertility. Affected males develop chronic epididymitis and, ultimately, infertility due to anti-sperm agglutinating antibodies and delayed-type hypersensitivity reactions against the spermatozoa, leading to spermatogenic arrest (6). In male dogs that develop chronic epididymitis, 90% of sperm are abnormal at 20 wk after infection (1). Some male dogs do not develop spermatic abnormalities and infertility, but still spread the organism most likely through prostatic fluid. Prostatic disease manifestations, such as prostatitis, have also been observed (7).

Non-reproductive manifestations of B. canis infection most commonly include chronic uveitis, endophthalmitis, and disco-spondylitis. Infected dogs with ocular involvement can present with blepharospasm, aqueous flare, constricted pupils, synechiae, hypopyon, and hyphema. Dogs with discospondylitis can pres-ent with stiffness, back pain, lameness, exercise intolerance, paresis, and possibly paralysis due to spinal compression. Other manifestations of B. canis infection include lymphadenitis (common), pyogranulomatous dermatitis (rare), endocarditis (rare), appendicular osteomyelitis (rare), and meningoencepha-litis (unknown frequency) (7). Various nonspecific signs have been associated with B. canis infection, including fever (rare), lethargy/ fatigue, exercise intolerance, decreased appetite, weight loss, and behavioral anomalies such as loss of alertness and poor performance of tasks (7).

DiagnosticsRoutine diagnostics such as complete blood (cell) count (CBC), serum biochemistry profile, and urinalysis are often normal. Occasionally, nonspecific findings supportive of inflamma-tory disease are identified, such as leukocytosis, neutrophilia, hyperglobulinemia, and hypoalbuminemia (18). In cases with suspected discospondylitis, imaging with plain radiography or computed tomography is indicated to identify end vertebral



RE

VIE

W A

RT

ICL

E

body osteomyelitis. Similarly, magnetic resonance imaging (MRI) along with cerebrospinal fluid (CSF) analysis and bacte-rial culture are performed in cases of suspected meningoencepha-litis. Uveitis or panophthalmitis may warrant taking aqueous or vitreous humor aspirates for cytology and culture, under an ophthalmologist’s care.

History, clinical signs, and ancillary diagnostics may prompt more definitive testing for B. canis. A positive culture can be definitive but low sensitivity leads practitioners and researchers to serology and PCR. Definitive testing for B. canis has been plagued by many pitfalls including sensitivity, specificity, quality control, and availability.

Blood cultureThe traditional gold standard diagnostic test for B. canis has been culture of blood, urine, vaginal discharge, semen, or aborted fluids/tissues (1,7,8,25,26). Samples should be col-lected sterilely in a standard aerobic culture vial or a green top (heparinized) tube, stored on ice (not frozen) and shipped within 24 h to the laboratory, where Farrell’s medium or Thayer-Martin’s modified medium can be used for culture (7,25,26). Unfortunately, our ability to detect this organism is limited due to low levels of bacteria; intermittent shedding; poor sample choice for submission; inappropriate handling of sample; slow growing, fastidious forms; and incorrect culture media (7). A negative culture should not rule out infection, as the low sensi-tivity corresponds to an unacceptable number of false negatives. Although culture is an inappropriate screening test, it is the ideal confirmatory test.

Traditional serologic assaysTraditional serologic assays for B. canis are summarized in Table 1. Rapid slide agglutination tests (RSAT), tube agglutina-tion tests (TAT) and immunofluorescent antibody tests (IFA) are typically used as initial screening tools to rule out infection (7,8,32). False negatives can occur as a result of testing prior to seroconversion, and low circulating antibody titers in some chronically infected dogs (7). False positives are the predomi-nant concern with these serology assays due to both nonspecific and specific cross reactions with shared surface antigens on Pseudomonas aeruginosa, Bordetella bronchiseptica, Actinobacillus equuli, Streptococcus, Staphylococcus, Moraxella-type organisms and Gram-negative bacteria (7,8,25,38). A screening test must be followed with a confirmatory test such as 2-mercaptoethanol RSAT (2ME-RSAT) or agar gel immunodiffusion assay using an internal cytoplasmic antigen (AGIDcpa) (7,8,32). The more specific confirmatory test addresses the high rate of false posi-tives associated with the screening tests.

ELISAs and PCRResearch into new diagnostics for B. canis is focused on enzyme-linked immunosorbent assays (ELISAs) and PCR, which are summarized for researchers in Tables 2 and 3, respectively. Quality control and assurance are paramount with these assays, especially PCR, to ensure accuracy of the test result, given the potential impact of a positive or negative result on an individual dog, the canine population, an individual client or a kennel operator. Assuming accurate test results, the benefits of PCR are species and sometimes biovar identification; improvements

Table 1. Comparison of traditional serologic assays for the diagnosis of brucellosis in dogs.

Test Antigen Sensitivity Specificity How to use test

Rapid Slide Agglutination Test B. ovis (27,28) Moderate to high sensitivity Low to moderate specificity Screening test (RSAT) (M-) strain B. canis (29)a — older studies suggest high (30,31) — older studies suggest (1,7,8) — newer study suggests 70.58% (32) 40%–50% (27,30) — newer studies suggest 83.34% (32)

2-MercaptoEthanol Rapid (M-) strain B. canis (8) Lower sensitivity than RSAT Higher specificity than RSAT Confirmatory Slide Agglutination Test 31.76% versus 70.58% (32) 100% versus 83.34% (32) test (1,7,8) (2ME-RSAT)

Tube Agglutination Test B. canis (8) High sensitivity (1,8) Low specificity (1,8) Screening testb

(TAT) (1,7,8)

Indirect Fluorescent Assay Anti-canine Unknown sensitivity (7) Unknown specificity Screening test (1,8)(IFA) immunoglobulin (Ig)G directed against antibodies to B. canis

Agar Gel Immunodiffusion Lipopolysaccharide High sensitivity (1,7,8) Lower specificity Screening test (1,8) Assay using Cell Wall Antigen antigen from the cell than AGIDcpa (37)c

(AGIDcwa) wall of B. canis (8,36)

Agar Gel Immunodiffusion LPS-free, soluble, internal Low sensitivity High specificity Confirmatory test Assay using CytoPlasmic cytoplasmic proteins — 52.94% sensitive (32) 100% (32,37)d (1,8) Antigen extracted from B. canis — 47.06% false negatives (32)(AGIDcpa) or B. abortus (8,36)a False positives — 10% using B. canis antigen versus 50% using B. ovis antigen.b Results are semiquantitative (8,30,33–35) with a titer of : . 1:200 — has a good correlation with the organism being recovered from blood culture; 1:200 — presumptive

of active infection; 1:25, 1:50 — recovery or chronic infection.c False positives occur due to nonspecific cross reactions with cell wall antigenic complexes.d Reacts with antibodies against Brucella spp. (B. canis, B. abortus, B. suis); therefore, specific to the Brucella genus but not individual species.



CO

MP

TE

RE

ND

U

in sensitivity and specificity; minimal biological containment requirements; relatively short turnover time for results; and genetic fingerprinting to facilitate epidemiological studies and disease control (38).

Most PCR assays reported in the literature for detection of B. canis are genus-based not species-specific. In the past, multi-plex PCRs have been used to differentiate between some Brucella species (14). In more recent years, Brucella canis — specific PCRs have been developed (23,50,51). These assays have yet to undergo extensive evaluation in canine populations to evaluate sensitivity and specificity. Until then, PCR should be used in conjunction with clinical information and serology.

TreatmentThe generally accepted recommendation is that treatment should be discouraged, and truly infected animals should be euthanized due to the risk to canine and human populations (1,7,8,25,26). Disease due to B. canis is not currently reportable in Canada, which leaves the decision-making process to the cli-ent and the veterinarian. Euthanasia serves as a strict approach, but if this is not possible due to client opinion, then isolation can be considered after appropriate client education and medical record documentation. Patients with no clinical manifestations of the disease should be isolated and allowed to self-eliminate the organism if possible. If an adequate Th1 response occurs, the patient might spontaneously recover in 2 to 3 y on average (7,8).

Although significant illness is rare, those patients experienc-ing clinical signs that warrant intervention will have to be either euthanized or treated. Treatment is notoriously unsuccessful as dogs experiencing morbidity have had a Th2 response leading to persistent infection. It is important for clinicians to remember that it is not only the antimicrobial therapy, but also the indi-vidual’s immune response that works in concert to determine

the outcome of infection. Antibiotic therapy does not guarantee elimination of the organism, with relapse or re-infection believed to be common (1,7,8,25,26).

Original studies have demonstrated the superiority of combination antibiotic therapy over a single agent protocol. Traditionally, a tetracycline-based antibiotic (tetracycline hydro-chloride, doxycycline, minocycline) is administered orally with daily or divided standard dosing for a minimum of 1 to 2 mo. The second antibiotic is an aminoglycoside (dihydrostrepto-mycin, streptomycin, or gentamicin) administered parenterally with daily standard dosing for either the initial 7 to 14 d of treatment, or a 7-day period every 3 to 4 wk (7,8,18,25,30,52). Aminoglycosides have significant limitations: nephrotoxicity monitoring and possible hospitalization with intravenous flu-ids; parenteral administration; streptomycin availability; and inadequate ocular and central nervous system penetration (18).

A recent report documents the successful treatment of 3 dogs with chronic or recurrent uveitis using combination antimicro-bial therapy (doxycycline, enrofloxacin, and streptomycin, with or without rifampin) (54). All 3 dogs in this report responded in terms of clinical factors like resolution of ocular inflammation and conversion to seronegativity. Negative serology was attained after a median of 96 wk (range: 36 to 112 wk) of therapy (54).

Another article documents the response of 12 dogs in a breed-ing facility that was experiencing infertility and spontaneous abortions. A novel single agent enrofloxacin treatment protocol consisted of 5 mg/kg body weight (BW) orally every 12 h for 30 d with additional courses administered to females during all subsequent estrual and luteal cycles (range: 0 to 2 cycles) (55). Fourteen months later, the dogs in this study did not have any further abortions, transmission to offspring was not observed, vaginal secretions were culture negative after subsequent births, fertility was maintained, and titers declined (55). Veterinarians will appreciate the significant antimicrobial resistance concerns that might arise with respect to long-term, intermittent fluo-roquinolone use.

In these studies, clinical improvement and declining antibody titers were observed with antibiotic therapy, but definitive elimination of the organism was not demonstrated (53,54). The intermittent nature of clinical disease manifestations, particularly those involving reproductive performance abnor-malities, makes definitive comments about treatment efficacy impossible without an untreated group. Ethical concerns make a negative control group in clinical patients unlikely in future research endeavors.

Unfortunately, the treatment and monitoring protocols are often lengthy and time consuming, leading to escalating expense and declining client compliance (8). To the author’s knowledge, there is no universally accepted treatment protocol especially in terms of treatment duration, which has involved 1 to 2 mo of therapy, 90-day treatment cycles separated by 1 to 2 mo, or indefinite antimicrobial use (8,18). Monitoring the AGIDcpa every 2 to 6 mo can potentially help guide both the recogni-tion of relapse, and the duration of antibiotic therapy with 2 consecutive negative results suggesting adequate therapy (8). Monitoring is indefinite and relapse necessitating retreatment is considered likely (8).

Table 2. ELISA assays for the diagnosis of brucellosis in dogs.

Antigen Sensitivity Specificity

Lipopolysaccharide-free cytoplasmic proteins 92% 96.7% of B. abortus (39)

Hot-saline extract of B. canis containing 92% 94.3% outer membrane antigens (39)

Luminaze synthase of Brucella sp. (39) 81% 96.7%

18 kDa cytoplasmic protein of B. canis (40) 87%a 98%b

Bacterial whole cell extract from wild isolate 95% 91% of B. canis used as solid phase antigen (41)

Heat soluble bacterial extract from wild 91.18% 100% isolate B. canis (42)c

M-strain B. canis antigen (43) 100% 98.8%

B. ovis strain #11 antigen (43) 100% 98.8%

B. abortus RB51 strain antigen (43) 100% 98.8%a Sensitivity not reported as percentage, which was calculated from the data set as

26/30 known cases tested positive with this ELISA.b Specificity not reported as percentage, which was calculated from the data set as

2/103 animals tested falsely positive with this ELISA in the healthy population.c Heat soluble extracts were more useful than ultrasonic homogenates of bacterial

isolates to generate candidate capture antigens, as sonicated antigens were associated with more cross reactivity and, therefore, false positives in both ELISA and Western blot.



RE

VIE

W A

RT

ICL

E

PreventionAlthough not universally standardized, detailed prevention strat-egies in breeding facilities have been proposed by the USDA and the Georgia Department of Agriculture websites (1,26). Dogs should test negative on serial screening tests performed 8 wk apart prior to admission to a kennel or a breeding program. Dogs testing positive should be isolated and decisions made about euthanasia, or treatment and monitoring. An important preventative measure will involve sterilization.

Prevention also involves rigid attention to biosecurity. Principles of infection control will include: one-time-use protec-tive equipment (gloves, goggles, masks, gowns, boots); thorough hand washing; appropriate sample handling; routine disinfec-tion (i.e., 2.5% sodium hypochlorite, quaternary ammonium compounds or 70% ethanol with a minimum of 10 min contact time); biofilm prevention (minimize organic material); drying and exposure to sunlight; education of staff and clients; and notification of laboratory personnel receiving specimens as to the suspected diagnosis (1,7,8,25,26,55).

Public healthApproximately 100 to 200 cases of human brucellosis (all Brucella species) are diagnosed annually in the USA (55). One case report that has received a lot of attention is that of a 3-year-old female toddler who is believed to have acquired B. canis infection from a Yorkshire terrier puppy in New York City (56). In addition, HIV-positive patients with appropriate CD4 counts and negative viral loads have also been diagnosed and success-fully treated for B. canis infections (55,57).

The pathogenicity of Brucella canis is considered relatively low, making it less of a perceived public health concern than other Brucella species, in particular Brucella melitensis, and biotypes 1 and 3 of Brucella suis (23,25,55). It is important to

remember that B. canis is not reportable in Canadian provinces or territories, and Brucella is not routinely tracked beyond the genus level at the Center for Disease Control (CDC). The absence of a structured regulatory program for B. canis means that we do not know if human infection is underdiagnosed, especially when considering the nonspecific clinical signs, and the variable incubation period of 2 wk to 3 mo (25,55). Diagnostic limitations are also a complicating factor, necessitat-ing research into ELISA and PCR technologies.

Currently reported clinical signs associated with human brucellosis include fever (often periodic and nocturnal), fatigue, headache, weakness, malaise, chills, sweats, weight loss, hepa-tomegaly, splenomegaly, and lymphadenopathy (7,8,25,55). Serious complications from B. canis infection in humans include septic arthritis, aortic valve vegetations, calvarial osteomyelitis, epidural abscess, pleural effusion, oral lesions, lower extrem-ity aneurysms, and culture negative endocarditis (7,8,25,55). Deaths are rare except with serious underlying sites of infec-tion or delayed treatment. Unlike in dogs, treatment of human B. canis infections has been associated with elimination of the organism (7,8,25,55)

In conclusion, Brucella canis should be considered as a poten-tial differential diagnosis for small animal and public health practitioners in Canada. A One Health approach is essential to update our understanding of canine and human seroprevalence rates, pathogenesis, and management options. CVJ

References1. Best Practices for Brucella canis Prevention and Control in Dog Breeding

Facilities [monograph from the Internet]. Washington, DC: United States Department of Agriculture, Animal and Plant Health Inspection Service. Available from: https://www.aphis.usda.gov/animal_welfare/downloads/brucella_canis_prevention.pdf Last accessed November 6, 2017.

Table 3. PCR assays for the detection of Brucella antigen in dogs.

Detection: Primers directed to Genus or Species Sample Sensitivity Specificity

16S-23S rDNA Interspace region (44) Brucella genus Whole blood 100% 100%

16S-23S rDNA Interspace region (45)a Brucella genus Vaginal swabs Not available Not available

16S-23S rDNA Interspace region (46)a Brucella genus Semen Not available Not available

16S rRNA sequence (47) Brucella genus Whole blood 100% 100%

16S-23S rRNA Interspace region (48) Brucella genus Inguinal lymph node 100% 100%

16S-23S rRNA Interspace region (49) Brucella genus Whole blood Whole blood: 97.14% Whole blood: 100% Serum Serum: 25.71% Serum: 100%

Intergenic spacer IS711 fragment (23)b Brucella genus Males: preputial swab, Not available Not available semen, or urine Female: vaginal swab

Gene fragment on chromosome 1 (23)b Brucella canis As immediately above Not available Not available species-specific

B. canis outer membrane protein 25 Brucella canis Vaginal swabs Vaginal swabs: 92.31% Vaginal swabs: 51.92% DNA quantitative PCR (50) species-specific Whole blood Whole blood: 16.67% Whole blood: 100%

BCAN_B0548-0549 region in Brucella canis Whole blood Not available Not available chromosome 2 of Brucella species-specific Buffy coats canis (51)c

a PCR on vaginal swabs and semen in these studies correlated with blood PCR, and blood culture as assessed by a Kappa co-efficient and the McNemar test.b Both Brucella genus-based and Brucella canis specific PCRs used in Swedish outbreak investigation.c Brucella canis inoculated samples; PCR on buffy coats separated from whole blood was approximately 100 times more sensitive than from whole blood.



CO

MP

TE

RE

ND

U

2. Higgins R, Hoquet F, Bourque R, Gosselin Y. A serological survey for Brucella canis in dogs in the Province of Quebec. Can Vet J 1979; 20:315–317.

3. Bosu WT, Prescott JF. A serological survey of dogs for Brucella canis in southwestern Ontario. Can Vet J 1980;21:198–200.

4. Brennan SJ, Ngeleka M, Philibert HM, Forbes LB, Allen AL. Canine brucellosis in a Saskatchewan kennel. Can Vet J 2008;49:703–708.

5. 5 Calgary dogs diagnosed with rare infectious disease — CBC.ca [mono-graph on the Internet] Calgary, Alberta. Available from: http://www.cbc.ca/ news/canada/calgary/5-calgary-dogs-diagnosed-with-rare-infectious-disease-1.2595999 Last accessed November 6, 2017.

6. Forbes LB, Pantekoek JF. Brucella canis isolates from Canadian dogs. Can Vet J 1988;29:149–152.

7. Carmichael LE, Greene CE. Canine brucellosis. In: Greene CE, ed. Infectious Diseases of the Dog and Cat. 3rd ed. Philadelphia, Pennsylvania: Elsevier Saunders, 2006:369–381.

8. Hollett RB. Canine brucellosis: Outbreaks and compliance. Theriogenology 2006;663:575–587.

9. Moore JA, Bennett M. A previously undescribed organism associated with canine abortion. Vet Rec 1967;80:604–605.

10. Carmichael LE, Kenney RM. Canine abortion caused by Brucella canis. J Am Vet Med Assoc 1968;152:605–616.

11. Carmichael LE. Abortion in 200 beagles. J Am Vet Med Assoc 1966;149:1126.

12. Taul LK, Powell HS, Baker OE. Canine abortion due to an unclassified Gram-negative bacterium. Vet Med Small Anim Clin 1967;73:543–544.

13. Moreno E, Cloeckaert A, Moriyon I. Brucella evolution and taxonomy. Vet Microbiol 2002;90:209–227.

14. López-Goñi I, García-Yoldi D, Marín CM, et al. New Bruce-ladder multiplex PCR assay for the biovar typing of Brucella suis and the discrimination of Brucella suis and Brucella canis. Vet Microbiol 2011; 154:152–155.

15. Wanke MM. Canine brucellosis. Anim Reprod Sci 2004;82–83: 195–207.

16. Makloski CL. Canine brucellosis management. Vet Clin North Am Small Anim Pract 2011;41:1209–1219.

17. Chacon-Diaz C, Altamirano-Silva P, Gonzalez-Espinoza G, et al. Brucella canis is an intracellular pathogen that induces a lower proin-flammatory response than smooth zoonotic counterparts. Infect Immun 2015;83:4861–4870.

18. Davidson AP, Sykes JE. Canine brucellosis. In: Sykes JE, ed. Canine and Feline Infectious Diseases. 1st ed. St. Louis, Missouri: Elsevier Saunders, 2014:512–519.

19. Pollak CN, Wanke MM, Estein SM, et al. Immunization with Brucella VirB proteins reduces organ colonization in mice through a Th-1 type immune response and elicits a similar immune response in dogs. Clin Vaccine Immunol 2015;22:274–281.

20. Mancilla M. Smooth to rough dissociation in brucella: The missing link to virulence. Front Cell Infect Microbiol 2016;5:98.

21. Mancilla M, Marin CM, Blasco JM, Zarraga AM, Lopez-Goni I, Moriyon I. Spontaneous excision of the O-polysaccharide wbkA glyco-syltransferase gene is a cause of dissociation of smooth to rough Brucella colonies. J Bacteriol 2012;194:1860–1867.

22. Wallach JC, Giambartolomei GH, Baldi PC, Fossati CA. Human infection with M-strain Brucella canis. Emerg Infect Dis 2004;10: 146–148.

23. Kaden R, Agren J, Baverud V, et al. Brucellosis outbreak in a Swedish kennel in 2013: Determination of genetic markers for source tracing. Vet Microbiol 2014;174:523–530.

24. Lamm CG, Makloski CL. Current advances in gestation and parturition in cats and dogs. Vet Clin Small Anim 2012;42:445–456.

25. Canine Brucellosis: Brucella canis [monograph on the Internet]. Ames, Iowa: The Center for Food Security and Public Health. Available from: http://www.cfsph.iastate.edu/Factsheets/pdfs/brucellosis_canis.pdf Last accessed November 6, 2017.

26. Canine Brucellosis (Brucella canis) [monograph on the Internet]. Atlanta, Georgia: Available from: http://www.agr.georgia.gov/Data/Sites/1/media/ag_animalindustry/.../caninebrucellosis.pdf Last accessed November 6, 2017.

27. Brown J, Blue JL, Wooley RE, Dreesen DW, Carmichael LE. A sero-logic survey of a population of Georgia dogs for Brucella canis and an evaluation of the slide agglutination test. J Am Vet Med Assoc 1976; 169:1214–1216.

28. George LW, Carmichael LE. A plate agglutination test for the rapid diagnosis of canine brucellosis. Am J Vet Res 1974;35:905–909.

29. Carmichael LE, Joubert JC. A rapid slide agglutination test for the serodiagnosis of Brucella canis infection that employs a variant (M-) organism as antigen. Cornell Vet 1987;77:3–12.

30. Flores-Castro R, Carmichael LE. Canine brucellosis: Current states of methods for diagnosis and treatment. In: Proc of the 27th Gaines veterinary symposium, White Plains, New York, 1977:17–24.

31. Wooley RE, Hitchcock PL, Blue JL, Neumann MA, Brown J, Shotts EB. Isolation of Brucella canis from a dog seronegative for brucellosis. J Am Vet Med Assoc 1978;173:387–388.

32. Keid LB, Soares RM, Vasconcellos SA, Megid J, Salgado VR, Richtzenhain LJ. Comparison of agar gel immunodiffusion test, rapid slide agglutination test, microbiological culture, and PCR for the diag-nosis of canine brucellosis. Res Vet Sci 2009;86:22–26.

33. Fredrickson LE, Barton CE. A serologic survey for canine brucellosis in a metropolitan area. J Am Vet Med Assoc 1974;165:987–989.

34. Rhoades HE, Mesfin GM. Brucella canis infection in a kennel. Vet Med Small Anim Clin 1980;75:595–599.

35. Henderson RA, Hoerlein BF, Kramer TT, Meyer ME. Discospondylitis in three dogs infected with Brucella canis. J Am Vet Med Assoc 1974; 165:451–455.

36. Zoha SJ, Carmichael LE. Serological responses of dogs to cell wall and internal antigens of Brucella canis. Vet Microbiol 1982;7:35–50.

37. Carmichael LE, Zoha SJ, Flores-Castro R. Problems in the serodiagnosis of canine brucellosis: Dog responses to cell wall and internal antigens of Brucella canis. Dev Biol Stand 1984;56:371–383.

38. Yu WL, Nielsen K. Review of detection of Brucella spp. by polymerase chain reaction. Croat Med J 2010;51:306–313.

39. Wanke MM, Delpino MV, Baldi PC. Comparative performance of tests using cytosolic or outer membrane antigens of Brucella for the serodiagnosis of canine brucellosis. Vet Microbiol 2002;88:367–375.

40. Baldi PC, Wanke MM, Loza ME, Monachesi N, Fossati CA. Diagnosis of canine brucellosis by detection of serum antibodies against an 18kDa cytoplasmic protein of Brucella spp. Vet Microbiol 1997;57:273–281.

41. Barrouin-Melo SM, Poester FP, Ribeiro MB, et al. Diagnosis of canine brucellosis by ELISA using an antigen obtained from wild Brucella canis. Res Vet Sci 2007;83:340–346.

42. Daltro de Oliveira MZ, Vale V, Keid L, et al. Validation of an ELISA method for the serological diagnosis of canine brucellosis due to Brucella canis. Res Vet Sci 2011;90:425–431.

43. Escobar GI, Boeri EJ, Ayala SM, Lucero NE. The feasibility of using antigens prepared with rough Brucella strains for diagnosis of canine brucellosis. Rev Argent Microbiol 2010;42:35–40.

44. Keid LB, Soares RM, Vieira NR, et al. Diagnosis of canine brucellosis: Comparison between serological and microbiological tests and a PCR based on primers to 16S-23S rDNA interspacer. Vet Res Commun 2007;31:951–965.

45. Keid LB, Soares RM, Vasconcellos SA, et al. A polymerase chain reac-tion for detection of Brucella canis in vaginal swabs of naturally infected bitches. Theriogenology 2007;68:1260–1270.

46. Keid LB, Soares RM, Vasconcellos SA, et al. A polymerase chain reaction for the detection of Brucella canis in semen of naturally infected dogs. Theriogenology 2007;67:1203–1210.

47. Noosud J, Sirinarumitr K, Sirinarumitr T. Comparison of a serological method. A bacteriological method and 16S rRNA Brucella canis PCR for canine brucellosis diagnosis. Kasetsart J (Nat Sci) 2009;43:159–164.

48. Aras Z, Ucan US. Detection of Brucella canis from inguinal lymph nodes of naturally infected dogs by PCR. Theriogenology 2010;74:658–662.

49. Keid LB, Soares RM, Vasconcellos SA, Salgado VR, Megid J, Richtzenhain LJ. Comparison of a PCR assay in whole blood and serum specimens for canine brucellosis diagnosis. Vet Rec 2010;167:96–99.

50. Kauffman LK, Bjork JK, Gallup JM, Boggiatto PM, Bellaire BH, Petersen CA. Early detection of Brucella canis via quantitative poly-merase chain reaction analysis. Zoonoses Public Health 2014;61:48–54.

51. Kang SI, Lee SE, Kim JY, et al. A new Brucella canis species-specific PCR assay for the diagnosis of canine brucellosis. Comp Immunol Microbiol Infect Dis 2014;37:237–241.

52. Jennings PB, Crumrine MH, Lewis GE, Fariss BL. The effect of a two stage antibiotic regimen on dogs infected with Brucella canis. J Am Vet Med Assoc 1974;164:513–514.

53. Ledbetter EC, Landry MP, Stokol T, Kern TJ, Messick JB. Brucella canis endophthalmitis in 3 dogs: Clinical features, diagnosis, and treatment. Vet Ophthalmol 2009;12:183–191.

54. Wanke M, Delpino M, Baldi P. Use of enrofloxacin in the treatment of canine brucellosis in a dog kennel (clinical trial) Theriogenology 2006;66:1573–1578.



55. Public Health Implications of Brucella canis Infections in Humans — NASPHV [monograph on the Internet]. Available from: http://www.nasphv.org/Documents/BrucellaCanisInHumans.pdf Last accessed July 20, 2017.

56. Dentinger CM, Jacob K, Lee LV, et al. Human Brucella canis infection and subsequent laboratory exposures associated with a puppy, New York City, 2012. Zoonoses Public Health 2015;62:407–414.

57. Lucero NE, Maldonado PI, Kaufman S, Escobar GI, Boeri E, Jacob NR. Brucella canis causing infection in an HIV-infected patient. Vector Borne Zoonotic Dis 2010;10:527–529.

1. C) Cattle have a limited bone marrow reserve and have a limited degree of neutrophilia in response to inflammation.

C) Les bovins possèdent une réserve de moelle osseuse limitée et présentent une faible quantité de neutrophiles en réponse à l’inflammation.

2. D) Candida albicans is a yeast which infects intact mucous mem-branes, most commonly the tongue and the esophagus. The infection is most common in young ungulates, and is usually associated with an underlying primary debilitating condition (i.e., thrush is a secondary disease). Streptococcus pyogenes and Corynebacterium pyogenes are bacteria which trigger a suppurative inflammatory response (i.e., pus formation or abscess formation); these agents most commonly affect the upper respiratory tract. Actinobacillus lignieresii is the cause of “wooden tongue,” a granulomatous condition resulting from opportunistic invasion of damaged lingual tissue by the causative bacterium. Histophilus somni is associated with respiratory, neurologic, and reproductive infections in the cattle.

D) Candida albicans est une levure qui infecte les muqueuses intactes, le plus communément la langue et l’œsophage. L’infection est plus commune chez les jeunes ongulés et est habituellement associée à une affection débilitante primitive sous-jacente (le muguet est une atteinte secondaire). Streptococcus pyogenes et Corynebacterium pyogenes sont des bactéries qui déclenchent une réponse inflammatoire suppurée (p. ex., formation de pus ou d’abcès); ces agents affectent le plus communément les voies respiratoires supérieures. Actinobacillus lignieresii est la cause de la «langue de bois», une affection granulomateuse résultant d’une invasion opportuniste des tissus linguaux endommagés par la bactérie causale. Histophilus somni est associée aux infections des systèmes respiratoire, neurologique et reproducteur chez les bovins.

3. A) Serum IgM titer is the best test for diagnosis of an active infection.

A) Le titre d’IgM sérique est le meilleur test pour le diagnostic d’une infection active.

4. E.) Valvular endocardiosis is an age-related, degenerative change in which there is accumulation of a myxomatous connective tissue matrix within the valve leaflets, causing nodular thick-ening. The suffix “-osis” implies a degenerative condition; bacterial infection of the heart valves would lead to valvular endocarditis, or inflammation of the valves. Since endocar-diosis most commonly affects the atrioventricular valves (and the mitral valve more commonly than the tricuspid), the condition may be associated with a systolic heart murmur.

E) L’endocardiose valvulaire est un changement dégénératif associé à l’âge dans lequel il y a une accumulation d’une matrice de tissu conjonctif myxomateux dans les festons des valves, causant un épaississement nodulaire. Le suffixe «ose» implique une condition dégénérative; l’infection bactérienne des valves cardiaques conduira à de l’endocardite valvulaire, soit l’inflammation des valves. Puisque l’endocardiose affecte le plus communément les valves atrioventriculaires (la valve mitrale plus souvent que la valve tricuspide), l’affection peut être associée à un souffle cardiaque systolique.

5. D) The flehmen response occurs in stallions following exposure to mares in estrus. The stallion will curl its upper lip and drop its penis.

D) Le flehmen est un comportement observé chez les étalons en présence de juments en chaleur. L’étalon retroussera la lèvre supérieure et rabattra le pénis.

Answers to Quiz Corner Les réponses du test éclair

quiz corner is generously sponsored by le test éclair est généreusement commandité par

Advanced dental health has a new nameStrixNB™ products will now transition to our Vetradent™ brand, starting with Vetradent Water Additive. dechra.ca



Student Paper Communication étudiante

Acute sternal subluxation in an indoor cat

Louise Lam

Abstract — A 1-year-old spayed female cat was presented with tachypnea and a protrusion on the ventral thorax. Radiography revealed ventral sternal subluxation between the 6th and 7th sternebrae. There was no evidence of respiratory distress, even after follow-up, and a conservative management approach was successful in this healthy, young, indoor cat.

Résumé — Subluxation sternale aiguë chez un chat d’intérieur. Une chatte stérilisée âgée de 1 an a été présentée avec de la tachypnée et une protrusion sur le thorax ventral. La radiographie a révélé une subluxation sternale ventrale entre le 6e et le 7e sternèbre. Il n’y avait pas de signe de détresse respiratoire, même après le suivi, et une approche de gestion prudente a été efficace chez ce jeune chat d’intérieur en santé.


Can Vet J 2018;59:82–84

A 1-year-old spayed female cat was presented with an unusual protrusion on the ventral thorax. The owner reported

feeling the protrusion for the first time the previous day and that the cat’s behavior had changed from her usual high activ-ity to being more quiet and docile. On physical examination, she appeared to be quiet, alert, and responsive. Her vital signs were: temperature 38.1°C, heart rate 172 beats/min, respira-tory rate 100 breaths/min, and her mucous membranes were pink and moist with a capillary refill time of , 2 s. The cat was abnormally quiet (based on the owners’ report) with the pos-sibility of being in pain. There was no open-mouth breathing. On palpation, a bump protruding ventral to the sternal midline was detected; it was bony and non-mobile and approximately 1 cm in diameter.

The owner opted for a 1-view radiograph and no other diagnostic tests. The right lateral thoracic and abdominal radiograph revealed subluxation at the articulation between the 6th and 7th sternebrae (Figure 1). There was also a slight deviation between the 7th sternebra and the xiphoid. The end result was that the 7th sternebra and the xiphoid were ventrally deviated from the line of the sternum. The associated costal cartilages also appeared to be deviated. The bony protrusion

did not seem to penetrate the ventral thoracic wall, and the rest of the thoracic cavity, including the lung fields and the heart, appeared to be within normal limits. The abdominal cavity also appeared to be within normal limits. Since there was no evidence of labored breathing and puncture of the thoracic wall was unlikely, based on the radiograph and clinical signs, conservative management was recommended. Meloxicam (Metacam Oral Suspension, 1.5 mg meloxicam/mL; Boehringer Ingelheim, Burlington, Ontario), 0.1 mg/kg body weight (BW), PO, q24h for 5 d, was dispensed for pain control and possible inflammation. The owner was advised to monitor the cat and to contact the clinic if any changes were observed. A follow-up conversation with the owner 3 wk later revealed that the cat was doing well at home. She had been quieter since the incident, and showed no signs of labored respiration or open-mouth breathing.

DiscussionIn carnivores, the sternum consists of 8 sternebrae, including the manubrium (1st sternebra), body (2nd to 7th sternebrae), and xiphoid process (8th sternebra) with xiphoid cartilage (1,2). In most species, the intersternal joints are comprised of impermanent synchondroses, with the manubriosternal joint being a synovial joint in some (3). In the cat, the manubrium is slightly keeled, the sternebral body consists of 6 articulated sternebrae, and the last sternebra is the xiphisternum with a distal xiphoid process (4). Sternal luxations or subluxations may involve partial or full dislocation(s) at any of the articulations along the sternum.

Sternal luxations or subluxations are a potentially painful con-dition that may or may not affect the integrity of the thoracic wall. If the thoracic wall is punctured by dislocated segments, the thoracic cavity’s ability to maintain negative transthoracic pressure for inspiration is compromised, potentially leading to

Ontario Veterinary College, University of Guelph, 50 Stone Road East, Guelph, Ontario N1G 2W1.Address all correspondence to Louise Lam; e-mail: [email protected]. Lam will receive 50 copies of her article free of charge courtesy of The Canadian Veterinary Journal.Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.



ST

UD

EN

T P

AP

ER

impairment of ventilation. It may even result in paradoxical movement of the thoracic wall due to instability of the wall (1). The possible causes of sternal luxations or subluxations include trauma (blunt force or animal attacks), idiopathic, and, anecdot-ally, secondary to chronic respiratory disease. This condition is distinct from pectus excavatum or pectus carinatum, which are structural deformities in the thoracic wall.

There is little documentation in the literature about sternal luxation or subluxation, its occurrence, or the options for man-agement. Several small animal surgery textbooks briefly mention sternal fractures and luxations and that their occurrence is rela-tively rare (1,5–7). The first reported successful management of traumatic sternal luxation was published in 2014, revealing no complications 18 mo after surgery (8). The dog in that case had an acute history of falling down the stairs followed by clinical signs of dyspnea, tachycardia, and ventral thorax discomfort. Radiographs revealed luxation at the 3rd and 4th sternebrae with dorsal displacement. Surgical reduction of the sternum using a dynamic compression plate resulted in rapid recovery and minor complications (8). Despite some reports of success, sternal reduction involves open chest surgery, which carries surgical risks and the potential for complications. Moreover, traumatic sternal dislocations often include intrathoracic inju-ries. For instance, a case report in 2015 described a cat with manubrio-sternal luxation and tracheal stenosis after being hit by a car (9). Although surgery was performed, the owners opted for intra-operative euthanasia following suture dehiscence involving the trachea (9).

The infrequent number of reports may be due to several possible reasons. Anecdotal evidence suggests that the most common reason for sternal dislocation is trauma, which often includes other life-threatening complications and possible euthanasia or death that is not reported. Moreover, it may be underreported or missed due to the possible perception that it is a rare condition (5). Despite the lack of peer-reviewed reports, there is additional information about the management of sternal luxations and subluxations on veterinary forum discussions, such as Veterinary Information Network (VIN). Anecdotal findings indicate that sternal luxations and subluxations are usually man-aged conservatively, due to risks associated with surgical repair of the thoracic cavity. Therefore, regardless of thoracic wall

integrity, most of these cases are managed symptomatically with-out documentation of surgical options, or in many cases these patients are euthanized. If the patient does not exhibit labored breathing, the best option is medical management since surgery of the thoracic cavity carries many risks, including compromise to the thoracic cavity and its ability to maintain normal negative intrathoracic pressure, failure of surgical closure, anesthetic risks, and contamination risks. This was the approach used in this case report; analgesia and an anti-inflammatory drug were used to manage the patient’s symptoms, and the owner was instructed to monitor for respiratory distress. This strategy is supported by an emergency surgery textbook, which describes the case of a cat with subluxation at the 5th and 6th sternebrae (10). The patient was medically resuscitated with intravenous fluids, oxygen, pain therapy, and antimicrobial drugs. Hospitalization was continued for several days with supportive care as needed. The patient showed initial improvement, had septic complications due to a limb fracture, but was eventually discharged from hospital (10).

In the case of respiratory distress involving penetration of the thoracic wall, medical management alone would not be suf-ficient to ensure quality of life in the long term. Either surgery or euthanasia would need to be considered without further delay. Guidelines on surgical approach are described in surgical emergency textbooks, which mostly describe general open chest surgery instead of specific instructions on sternal reduction, but the fundamental principles should not be different (1,6,10). Surgical approaches for pectus carinatum and pectus excavatum may be considered based on similar open chest surgical prin-ciples (11). Note that penetrating thoracic wall injury does not always warrant surgical exploration unless there is evidence of ongoing hemorrhage, pneumothorax, or sepsis (6). However, suspected full-thickness thoracic wall defects resulting in air movement in the pleural space require immediate attention to maintain intrathoracic and pleural space integrity (6).

In all cases, pre-surgical management of the patient includes cleaning and bandaging external wounds, pain control, and pre-operative antimicrobial therapy (10). Penetration of the thoracic wall by dislocated segments should be treated as an open wound continuous with the pleural cavity and requires immediate debridement and sealing with suture closure, petroleum-based ointments and gauze packs, pleural evacuation, and stabilization (1,6). Soft tissue penetration, rupture, or herniation should be considered. Rib fracture and intercostal vessel lacerations related to the type of sternal luxations or subluxations should also be taken into account. Internal fixation of the sternum with small intramedullary pins is a possible approach, as described with rib fracture fixations (1). Chest bandages should be used with caution due to concern with impairment of ventilation (1). Potential complications include failure of closure leading to loss of negative intrathoracic pressure required for ventilation, persistent ventilation impairment, hypoxemia, and sepsis.

In conclusion, sternal luxations and subluxations are rarely reported and there is little documentation about their success-ful management. Absence of breathing impairment indicates medical management with oxygen, intravenous fluids, and pain control is appropriate. Due to risks involved with open thoracic wall exploration, surgery is not indicated unless there

Figure 1. Right lateral view of thoracic and abdominal radiograph in a 1-year-old female cat with a subluxated sternum. Ventral subluxation is observed between the 5th and 6th sternebrae (arrow).



CO

MM

UN

ICA

TIO

N É

TU

DIA

NT

E

is breathing impairment due to penetration of the chest wall. Further documentation of similar cases may help guide the proper management of sternal luxation and subluxation.

AcknowledgmentsI am grateful for the support and guidance from all the vet-erinarians, veterinary technicians, and support staff from St. Lawrence Veterinary Services. I offer special thanks to Dr. Phil Ball and Dr. Ameet Singh for their expertise. CVJ

References 1. Slatter D. Textbook of Small Animal Surgery. 3rd ed. Vols 1 and 2.

Toronto, Ontario: WB Saunders, 2003:373–374. 2. Pasquini C, Spurgeon T, Pasquini S. Anatomy of Domestic Animals:

Systemic & Regional Approach. 11th ed. Pilot Point, Texas: Sudz pub-lishing, 2007:71.

3. Dyce KM, Sack WO, Wensig CJG. Textbook of Veterinary Anatomy. 4th ed. Philadelphia, Pennsylvania: WB Saunders, 2010:43.

4. Sebastiani A, Fishbeck DW. Mammalian Anatomy: The Cat. 2nd ed. Englewood, Colorado: Morton Publishing Company, 2005:27.

5. Farrow CS. Veterinary Diagnostic Imaging, The Dog and Cat, Vol I. St. Louis, Missouri: Mosby, 2003:397–398.

6. Tobias KM, Johnston SA. Veterinary Surgery Small Animal. St. Louis, Missouri: Elsevier Saunders, 2012:1719–1782.

7. Fossum TW, Dewey CW, Horn CV, et al. Small Animal Surgery. 4th ed. St. Louis, Missouri: Elsevier Mosby, 2013:963–970.

8. Serra CI, Soler C, Moratalla V, Sifre Vl, Redondo JI. Surgical manage-ment of traumatic dislocation of the sternum in an English bulldog. J Small Anim Pract 2015;56:407–410.

9. Pietra M, Pisoni L, Linta N, Pinna S, Romagnoli N, Diana A. Endoscopy-assisted tracheal reconstruction of post-traumatic obstruc-tion in a cat: A case report. Veterinarni Medicina 2015;60:341–344.

10. Aronson LR. Small Animal Emergencies. Ames, Iowa: Wiley Blackwell, 2016:350–354.

11. Yoon H, Mann FA, Jeong S. Surgical correction of pectus excavatum in two cats. J Vet Sci 2008;9:335–337.

New Products Nouveaux produits

New class of probiotics, with a unique mode of action, will now be available across Canada

MicroSintesis Inc. is delighted to announce they have signed an exclusive distribution agreement with VHS to distribute its first product, YGIA, which contains Proteobiotics, newly discovered molecules produced by Probiotics.

MicroSintesis, a new animal health company, has, for the past five years, been researching this novel probiotic technol-ogy which has the potential to significantly impact the way animals are treated for gut health and intestinal distress. The MicroSintesis technology platform builds on the discovery that probiotics produce bioactive substances that are respon-sible for a significant portion of a probiotic’s activity. Termed “Proteobiotics,” these substances directly interfere with a patho-gen’s genome and down-regulate genes involved in infection, promoting a healthy digestive tract as a result. Proteobiotics, therefore, supports a more selective use of antibiotics, which may reduce the incidence of antibiotic resistance development, long-term. YGiA-14 is the first product of its kind to contain both a highly effective probiotic and this new Proteobiotic technology.

“The majority of our veterinary customers to date been using our YGIA-14 product with huge success,” says Hannah McIver, CEO of MicroSintesis. “Both pet owners and veterinarians alike want to treat their animals in ways that don’t negatively impact their natural body’s flora. YGIA-14 provides a stronger and faster response than regular probiotics, without the negative impact of antibiotics.”

VHS Veterinary Healthcare Solutions (VHS) is an indepen-dent Canadian veterinary marketing and sales company dedi-cated to delivering innovative products to the veterinary market. With seven sales representatives across Canada, the partnership now gives MicroSintesis the opportunity to sell their products nationally while providing VHS a platform product on which to expand their offering in key clinics.

“VHS is very excited to add the YGIA-14 product to our portfolio.” said Dr. Tom Branton, President of VHS. “The science behind this product coupled with the professionalism and knowledge of the MicroSintesis team are exceptional. More than ever, animal health practitioners and pet owners are seek-ing natural treatments for their pet ailments. YGIA-14 is a great new treatment modality to address gastrointestinal health. The VHS Sales Team is looking forward to introducing YGIA-14 to clinics across Canada.”

YGIA-14 will be available for sale through veterinary hospitals across Canada in June 2017.

Contact: Veterinary Healthcare Solutions, 2516 Binder Crescent, Oldcastle, ON N0R 1L0; website: www.vhsvets.com or www.microsintesis.com



Veterinary Dermatology Dermatologie vétérinaire

I recently received a visit from a pair of unrelated 8-year-old housemate West Highland White terriers referred for chronic

pruritic skin disease (Figure 1). Both Westies, a spayed female and a castrated male dog, had exhibited skin and ear disease starting before they were 1 year of age. Their histories were long and convoluted but in short, both dogs suffered from seasonal atopic dermatitis, recurrent pyoderma, and recurrent otitis externa. Previous therapies had included oral corticosteroids and cyclosporine. To my surprise, while the clinical appearance of the 2 dogs was similar, the female dog had generalized demodicosis: abundant Demodex mites (predominantly D. canis with fewer D. injai) were found on all deep skin scrapings.

The idea for this article came about when I thought about these dogs, and realized how dramatically veterinary dermatol-ogy had changed in their lifetime. The treatments I considered were ones I could not have imagined when they were 1 year old and just starting to show clinical signs. Today, I could be optimistic about helping them be comfortable quickly, without disturbing the bottle of prednisone gathering dust on my phar-macy shelf. This article describes some of the key therapeutic developments in small animal veterinary dermatology in the last decade. Most have had a very favorable effect on the landscape of dermatology in Canada, but others have provided unfortunate therapeutic challenges.

This article and the upcoming features in the Veterinary Dermatology column are a collaboration of The Canadian Veterinary Journal and the Canadian Academy of Veterinary Dermatology (CAVD). The CAVD is a federally incorporated not-for-profit organization that has promoted the advancement of veterinary dermatology in Canada for over 30 years. The initiatives of the CAVD include:• providing continuing education such as lectures and webinars to veterinarians, animal health technicians/technologists, and

veterinary students;• keeping members up-to-date with developments in the form of a member publication, electronic newsletters, and other

communications;• developing clinical tools such as the Dog and Cat Itch Scale and the Cytology Scale for Ears and Skin (see www.cavd.ca); and• funding researchThe CAVD invites all veterinarians, veterinary technicians and technologists, and veterinary students with an interest in veterinary dermatology to join the academy to stay current with the advances and challenges in this dynamic field. Memberships ($25 annually, free for students) are available at www.cavd.caPresident of the Canadian Academy of Veterinary Dermatology.Westbank Animal Care Hospital, West Kelowna, British Columbia.Address all correspondence to Dr. Kinga Gortel; e-mail: [email protected] of interest: In the last 5 years, Kinga Gortel has received honoraria, consulting fees, and/or has collaborated with Royal Canin, Purina, Zoetis, and Novartis/Elanco.Use of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.

Developments in small animal veterinary dermatology

Kinga Gortel

the dermatology feature is generously sponsored by royal canin.

la rubrique sur la dermatologie est généreusement commanditée par royal canin.



DE

RM

AT

OLO

GIE

VÉ

TÉ

RIN

AIR

E

The most recent advances in veterinary dermatology have affected the way we treat our most common patients: aller-gic dogs. The spring of 2016 marked the arrival of a much- anticipated product in the Canadian veterinary market. Apoquel (oclacitinib; Zoetis Canada, Kirkland, Quebec) was approved in Canada for the control of pruritus associated with allergic dermatitis and the control of atopic dermatitis in dogs at least 12 months of age. Apoquel inhibits the activity of various pro-inflammatory and pruritogenic cytokines including Interleukin (IL)-31, one of the key mediators of itch in dogs. Since its launch, Apoquel has provided veterinarians with a novel, effec-tive, and well-tolerated treatment for these very common ail-ments (1–3). A key benefit of the drug is its impressively rapid effect (1), comparable to that of oral corticosteroids. I chose Apoquel for treating the male Westie patient. I hoped that in addition to rapidly reducing his severe pruritus, it would provide an effective long-term therapy for his atopic dermatitis.

For the female Westie with atopic dermatitis and general-ized demodicosis, I preferred to avoid drugs with the potential to inhibit normal immune function. This would have been difficult in the past, but with the recent availability of a novel therapy I had another option for controlling her pruritus. Cytopoint (lokivetmab; Zoetis Canada), a caninized anti-IL- 31monoclonal antibody, was launched in June 2017 to aid in the reduction of clinical signs associated with canine atopic

dermatitis. It has been shown to be a safe (4) and effective (5,6) treatment for this disease. Despite the overlapping indication and activity on the same key cytokine, Cytopoint works very differently from Apoquel. Remarkably, it can be effective even in some dogs whose signs are not adequately controlled with the latter. Cytopoint differs from other treatments in a number of ways. It does not affect normal immune function, and can be given to dogs of any age (but should never be used in other species). It can be used in dogs with diseases that could pre-clude using Apoquel, Atopica (cyclosporine; Elanco Canada, Guelph, Ontario), or corticosteroids. These include patients with malignancies, severe infections, and — like my Westie patient — generalized demodicosis.

It would be difficult to overstate the positive impact that Atopica has made on veterinary dermatology. For a decade, Atopica was the only highly effective alternative to cortico-steroids available in Canada for the control of clinical signs of atopic dermatitis in dogs (7). It remains the most effective licensed treatment for feline allergic dermatitis. The use of Atopica for dermatologic indications was a game-changer that allowed, for the first time, relief for many allergic patients either without corticosteroids, or with a significant steroid-sparing effect. Compared to the therapies just described, Atopica has a slower onset of action (1). After several weeks of administration, however, its efficacy in reducing pruritus in dogs is similar to that of Apoquel (1) and the dosing frequency for Atopica can often be decreased. Cyclosporine has also received extensive extra-label use for various inflammatory dermatologic condi-tions. These include proliferative otitis externa, sebaceous adenitis, perianal fistulae, chronic pododermatitis, pemphigus foliaceus, reactive histiocytosis, and many other immune-mediated and autoimmune conditions (8).

Systemic corticosteroids are no longer the mainstay in treating allergic dogs, but one newer topical product deserves mention. A potent dermal corticosteroid spray with a low rate of percu-taneous absorption, hydrocortisone aceponate (Cortavance Topical Spray Solution; Virbac Canada, Cambridge, Ontario), is licensed for use in dogs for a period of 7 consecutive days. Several studies confirm the efficacy and safely of this product for longer periods if needed, (7,9) though patients treated in this way should be carefully monitored for cutaneous atrophy (10).

The role of the skin barrier has received ample attention in human and veterinary allergy, and skin barrier defects have been demonstrated in canine atopic dermatitis (11). Several topical therapies and veterinary diets have been shown to enhance this barrier, and can be a useful part of the multi-modal treatment of allergic pets.

Even with the extraordinary advances in symptom-relieving treatments, addressing the cause of allergy remains a key part in managing the disease. Allergen-specific immunotherapy can change the course of atopic dermatitis or possibly effect a cure, rather than simply achieving symptom control. The develop-ment of sublingual immunotherapy products has made this treatment possible for clients reluctant to give injections. Early investigations of this treatment are promising (12), although larger studies are needed. The investigation of cutaneous adverse food reactions (food allergies) can still be difficult. A reliable

Figure 1. Female (left) and male (right) West Highland White terriers at initial presentation. Notably, the female dog exhibited minimal alopecia or skin lesions despite having high numbers of Demodex mites in skin scrapings.

Female Male



VE

TE

RIN

AR

Y D

ER

MA

TO

LOG

Y

serologic test for food allergens does not exist (13), and an elimination diet trial with subsequent provocation testing remains the diagnostic procedure of choice. Although client compliance remains a major hurdle in diet trials, the selection of veterinary diets available has greatly increased. Novel protein diets now include exotic offerings such as rabbit, kangaroo, and alligator-based foods. The hydrolyzed protein diet selection has also expanded to include extensively hydrolyzed feather pro-tein foods for dogs and cats (Allergenic; Royal Canin, Guelph, Ontario).

Although it is overshadowed by the developments in allergy treatment, there has also been a revolution in the treatment of a typically stubborn parasitic disease. For dogs with generalized demodicosis, like my female Westie patient, slow improvement has typically meant many months of administering drugs with significant toxic potential. This all changed after the arrival of the first oral isoxazoline in Canada (fluralaner, Bravecto; Merck Animal Health, Kirkland, Quebec) in 2014. By 2015, a study showed unprecedentedly rapid efficacy after 1 dose of fluralaner in 8 dogs (14). A larger unpublished case study subsequently confirmed an overall response rate of 100%, with most (87.1%) of the 163 dogs achieving negative skin scrapings in 1 month, with the remainder by 2 months (15). Afoxolaner (NexGard; Mérial Canada, Baie D’Urfé, Quebec) and sarolaner (Simparica; Zoetis Canada) have also subsequently shown rapid efficacy (16,17). The treatment of demodicosis with isoxazo-lines intended for flea and tick control is extra-label use. Select isoxazolines have also been successfully used in the extra-label treatment of ectoparasites including Demodex cati (18), Otodectes cynotis (17), and Sarcoptes scabiei (19,20).

Along with these remarkable additions to our therapeutic arsenal have come some unwelcome challenges. The increase in methicillin-resistant staphylococci, particularly Staphylococcus pseudintermedius, S. schleiferi, and S. aureus, has been of particu-lar concern in companion animals. These infections are espe-cially troublesome in dogs because of this species’ predisposition to developing recurrent pyoderma. These bacteria are resistant not only to all of the beta-lactam drugs so commonly used to treat skin infections, but frequently to other antimicrobial drugs as well. Empirical systemic drug selection is contraindicated when one of these infections is suspected based on a treatment failure (21). Unfortunately, systemic treatment of methicillin-resistant staphylococcal infections can require the use of poten-tially toxic drugs such as rifampin and amikacin. Resistant staphylococci are now endemic in many areas. A Canadian study examining canine pyoderma cases found them in 12.1% of staphylococcal skin cultures in primary care practices (22). If there is any good news, it is that these resistant bacteria have made it apparent that systemic therapy is often unnecessary for pyoderma. For the very common superficial infections, topical therapy — such as chlorhexidine shampoos and sprays — can be just as effective as antibiotics, even when caused by resistant staphylococci (23). Topical therapy is now recommended as the sole treatment for surface and superficial methicillin-resistant staphylococcal infections whenever pet and owner compliance can be expected (21). Although the selection of topical products is limited in Canada compared to other markets, it is improv-

ing, with 2% to 4% chlorhexidine shampoos, sprays, wipes, and solutions now available for companion animals.

The catalog of developments is much longer, with just a few more listed here. Various new formulations of antibiotics allowing for easier compliance are available, with a once-daily cephalosporin (cefpodoxime proxetil, Simplicef; Zoetis Canada), an injectable cephalosporin with a long half-life (cefovecin sodium, Convenia; Zoetis Canada), and various palatable tablet formulations of cephalexin and amoxicillin-clavulanate now marketed. Gel preparations for otitis externa requir-ing infrequent application (e.g., Osurnia; Elanco Canada) are also simpler to administer. The selection of topical therapies in Canada is expanding, though the selection of products containing chlorhexidine combined with an azole antifungal for mixed bacterial and Malassezia infections remains limited (e.g., Douxo Pyo products; Ceva Animal Health, Cambridge, Ontario). Veterinary dermatology is an exceptionally active area of research and publication. Open-access clinical guidelines have been published by the World Association for Veterinary Dermatology (21,24), and by the International Committee on Allergic Diseases of Animals (25,26) to help veterinarians with several of the most common skin diseases.

It is an exciting time to be practicing veterinary dermatology, even if the expanding therapeutic arsenal can make treatment selection more complicated than before. Some of the devel-opments mentioned in this article will be profiled in future Veterinary Dermatology columns. As for the Westies: they are reportedly doing very well, and I look forward to seeing them for follow-up examinations soon. Like most pets with chronic skin disease, they have a long road ahead of them. But thanks to the changing landscape of veterinary dermatology, I have more hope than ever that the road ahead for these dogs will be smoother than the one they have traveled for their first 8 years.

References 1. Little PR, King VL, Davis KR, Cosgrove SB, Stegemann MR. A blinded,

randomized clinical trial comparing the efficacy and safety of oclacitinib and ciclosporin for the control of atopic dermatitis in client-owned dogs. Vet Dermatol 2015;26:23–30.

2. Cosgrove SB, Cleaver DM, King VL, et al. Long-term compassionate use of oclacitinib in dogs with atopic and allergic skin disease: Safety, efficacy and quality of life. Vet Dermatol 2015;26:171–179.

3. Cosgrove SB, Wren JA, Cleaver DM, et al. A blinded, randomized, placebo-controlled trial of the efficacy and safety of the Janus kinase inhibitor oclacitinib (Apoquel®) in client-owned dogs with atopic dermatitis. Vet Dermatol 2013;24:587–597.

4. Michels GM, Walsh KF, Krydka KA, et al. A blinded, randomized, placebo-controlled trial of the safety of lokivetmab (ZTS-00103289), a caninized anti-canine IL-31 monoclonal antibody in client-owned dogs with atopic dermatitis. Vet Dermatol 2016;27:505–e136.

5. Moyaert H, Van Brussel L, Borowski S, et al. A blinded, randomized clinical trial evaluating the efficacy and safety of lokivetmab compared to ciclosporin in client-owned dogs with atopic dermatitis. Vet Dermatol 2017;28:593–e145.

6. Michels GM, Ramsey DS, Walsh KF, et al. A blinded, random-ized, placebo-controlled, dose determination trial of lokivetmab (ZTS-00103289), a caninized, anti-canine IL-31 monoclonal anti-body in client owned dogs with atopic dermatitis. Vet Dermatol 2016;27:478–e129.

7. Nuttall T, Reece D, Roberts E. Life-long diseases need life-long treat-ment: Long-term safety of ciclosporin in canine atopic dermatitis. Vet Rec 2014;172:3–12.

8. Forsythe P, Paterson S. Ciclosporin 10 years on: Indications and efficacy. Vet Rec 2014;174:13–21.



DE

RM

AT

OLO

GIE

VÉ

TÉ

RIN

AIR

E

9. Lourenço AM, Schmidt V, São Braz B, et al. Efficacy of proactive long-term maintenance therapy of canine atopic dermatitis with 0.0584% hydrocortisone aceponate spray: A double-blind placebo controlled pilot study. Vet Dermatol 2017;27:88–92.

10. Bizikova P, Linder KE, Paps J, Olivry T. Effect of a novel topical diester glucocorticoid spray on immediate- and late-phase cutaneous allergic reactions in Maltese-beagle atopic dogs: A placebo-controlled study. Vet Dermatol 2010;21:70–79.

11. Marsella, R. Fixing the skin barrier: Past, present and future — Man and dog compared. Vet Dermatol 2013;24:73–e18.

12. Deboer DJ, Verbrugge M, Morris M. Clinical and immunological responses of dust mite sensitive, atopic dogs to treatment with sublin-gual immunotherapy (SLIT). Vet Dermatol 2016;27:82–87.

13. Mueller RS, Olivry T. Critically appraised topic on adverse food reactions of companion animals (4): Can we diagnose adverse food reactions in dogs and cats with in vivo or in vitro tests? BMC Vet Res 2017;13:275.

14. Fourie JJ, Liebenberg JE, Horak IG, Taenzler J, Heckeroth AR, Frénais R. Efficacy of orally administered fluralaner (BravectoTM) or topically applied imidacloprid/moxidectin (Advocate®) against general-ized demodicosis in dogs. Parasit Vectors 2015;28:187.

15. Karas-Tecza J, Dawidowicz J. Efficacy of fluralaner for the treatent of canine demodicosis. Abstract in Proc Annual Congress of the European Society and College of Veterinary Dermatology, Nice, France, 2015:126.

16. Beugnet F, Halos L, Larsen D, de Vos C. Efficacy of oral afoxolaner for the treatment of canine generalised demodicosis. Parasite 2016;23:14.

17. Six RH, Becskei B, Mazaleski MM, et al. Efficacy of sarolaner, a novel oral isoxazoline, against two common mite infestations in dogs: Demodex spp. and Otodectes cynotis. Vet Parasitol 2016;222:62–66.

18. Matricoti I, Maina E. The use of oral fluralaner for the treatment of feline generalised demodicosis: A case report. J Small Anim Pract 2017;58:476–479.

19. Beugnet F, de Vos C, Liebenberg J, Halos L, Larsen D, Fourie J. Efficacy of afoxolaner in a clinical field study in dogs naturally infested with Sarcoptes scabiei. Parasite 2016;23:26.

20. Taenzler J, Liebenberg J, Roepke RAK, Frénais R, Heckeroth AR. Efficacy of fluralaner administered either orally or topically for the treatment of naturally acquired Sarcoptes scabiei var. canis infestation in dogs. Parasit Vectors 2016;9:392.

21. Morris DO, Loeffler A, Davis MF, Guardabassi L, Weese JS. Rec-ommendations for approaches to meticillin-resistant staphylococcal infections of small animals: Diagnosis, therapeutic considerations and preventative measures: Clinical Consensus Guidelines of the World Association for Veterinary Dermatology. Vet Dermatol 2017; 28:304–e69.

22. Joffe D, Goulding F, Langelier K, et al. Prevalence of methicillin-resistant staphylococci in canine pyoderma cases in primary care veterinary practices in Canada: A preliminary study. Can Vet J 2015; 56:1084–1086.

23. Borio S, Colombo S, La Rosa G, De Lucia M, Damborg P, Guardabassi L. Effectiveness of a combined (4% chlorhexidine diglu-conate shampoo and solution) protocol in MRS and non-MRS canine superficial pyoderma: A randomized, blinded, antibiotic-controlled study. Vet Dermatol 2015;26:339–344.

24. Moriello KA, Coyner K, Paterson S, Mignon B. Diagnosis and treatment of dermatophytosis in dogs and cats: Clinical Consensus Guidelines of the World Association for Veterinary Dermatology. Vet Dermatol 2017; 28:266–e68.

25. Hensel P, Santoro D, Favrot C, Hill P, Griffin C. Canine atopic derma-titis: Detailed guidelines for diagnosis and allergen identification. BMC Vet Res 2015;111:196.

26. Olivry T, DeBoer DJ, Favrot C, et al. Treatment of canine atopic der-matitis: 2015 updated guidelines from the International Committee on Allergic Diseases of Animals (ICADA). BMC Vet Res 2015;11:210.



Veterinary Practice Management Gestion d’une clinique vétérinaire

Managing your purchases? Get out your calculator

Vous gérez vos achats? Sortez votre calculatrice!

Darren Osborne, MA

C ost of goods is the highest expense in mixed animal practices, and the second highest expense in companion

animal hospitals. Yet, it’s one of the most ambiguous areas of veterinary practice management. Responsible veterinarians who try to manage their cost of goods are often advised to lower their spending. They’re given advice such as, “Your purchases should be 20% of sales every month,” or simply, “You’re buying too much.” However, this advice is almost always given without any veterinary industry data or knowledge of how much is being sold. For a veterinarian who is selling twice the average amount of goods, their cost of goods sold will be twice the average.

What is cost of goods sold?The term “cost of goods sold” (COGS) is used to describe the amount a veterinarian will spend to purchase anything that is sold to a client, such as pet food, medication, over-the-counter products and toys. In veterinary medicine, cost of goods also incorporates the cost of products that are used to deliver services, but are not sold directly to the client, such as gauze, antiseptic, suture material, and vaccines. Separating the amount used in the hospital from the amount sold to clients is ideal for managing

L e coût des biens est la dépense la plus élevée dans les pratiques vétérinaires mixtes et la deuxième dépense en

importance dans les cliniques pour animaux de compagnie. Pourtant, c’est l’un des domaines les plus ambigus de la gestion d’une pratique vétérinaire. On conseille souvent aux vétérinaires responsables qui tentent de gérer le coût des biens de réduire leurs dépenses. On leur offre souvent des conseils comme : «Vos achats devraient représenter 20 % de votre chiffre d’affaires tous les mois» ou simplement «Vous achetez trop». Cependant, ces conseils sont presque toujours communiqués sans posséder de données de l’industrie vétérinaire ou de connaissances sur le volume des ventes. Pour un vétérinaire qui vend deux fois la quantité moyenne des produits, le coût des produits vendus s’établira à deux fois la moyenne.

Quel est le coût des produits vendus?Le terme «coût des produits vendus» (CPV) est utilisé pour décrire le montant dépensé par un vétérinaire pour acheter les biens vendus à un client, comme les aliments pour animaux, les médicaments, les produits en vente libre et les jouets. En médecine vétérinaire, le coût des produits inclut aussi le coût

Darren Osborne has been the Director of Economic Research for the Ontario Veterinary Medical Association for 20 years. He completed a MA (Economics) from York University and has worked as an economic analyst in veterinary medicine, dentistry, human medicine, and the transport industry.Address all correspondence to Darren Osborne; e-mail: [email protected] article is provided as part of the CVMA Business Management Program, which is co-sponsored by IDEXX Laboratories, Petsecure Pet Health Insurance, Merck Animal Health, and Scotiabank.Address all correspondence to the CVMA Business Management Committee; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.

Darren Osborne est directeur de la recherche économique à l’Ontario Veterinary Medical Association depuis 20 ans. Il a obtenu une maîtrise en économie de l’Université York et a travaillé en tant qu’analyste économique en médecine vétérinaire, en dentisterie et en médecine humaine ainsi que dans l’industrie des transports.Veuillez adresser la correspondance à Darren Osborne; courriel : [email protected] présent article est rédigé dans le cadre du Programme de gestion commerciale de l’ACMV, qui est cocommandité par IDEXX Laboratories, Petsecure Insurance, Merck Santé Animale et la Banque Scotia.Veuillez adresser toute correspondance au Comité de la gestion commerciale de l’ACMV; courriel : [email protected]’usage du présent article se limite à un seul exemplaire pour étude personnelle. Les personnes intéressées à se procurer des réimpressions devraient communiquer avec le bureau de l’ACMV ([email protected]) pour obtenir des exemplaires additionnels ou la permission d’utiliser cet article ailleurs.



GE

ST

ION

D’U

NE

CL

INIQ

UE

VÉ

TÉ

RIN

AIR

E

des produits qui sont utilisés pour offrir des services, mais qui ne sont pas vendus directement au client, comme la gaze, les antiseptiques, le matériel de suture et les vaccins. La séparation du montant utilisé à la clinique du montant des produits vendus aux clients est idéale pour la gestion des achats, mais cela se produit rarement. Il faut donc se rappeler que lors de la comptabilisation du coût des produits vendus, cela équivaut en fait au «coût des produits utilisés dans la pratique» (ou CPUP).

Mythe : Le modèle «taille unique»Le mythe le plus commun est que tout le monde peut utiliser le même chiffre pour gérer le coût des produits. Ce mythe doit probablement provenir d’autres industries où la vente des produits est plus homogène. Si la vente de produits représentait toujours 50 % du revenu, alors un seul chiffre conviendrait à toutes les situations. Cependant, en médecine vétérinaire, il existe de la variabilité au niveau des ventes d’aliments et de produits pharmaceutiques. Un vétérinaire pour animaux de compagnie qui s’intéresse particulièrement à la nutrition pourrait vendre deux fois le volume d’aliments et il aurait donc deux fois le CPV. Les recettes moyennes provenant de la vente de produits peuvent représenter 40 % des recettes brutes (15 % aliments pour animaux et 25 % produits pharmaceutiques), mais la fourchette se situe entre 32 % et 48 % pour la plupart des pratiques.

La majoration du prix des produits vendus par la pharmacie affectera aussi la contribution au revenu et donc au CPV. Si une clinique vend un produit à un prix de 25 % inférieur à celui d’une autre clinique, la première clinique affichera un revenu inférieur et le coût des produits sera supérieur. Par exemple, supposons qu’un produit coûte 10 $ à conserver en inventaire. Si une clinique majore le prix de 100 % et le vend 20 $, son revenu total sera de 20 $ et le coût du produit sera de 10 $ ou 50 %. Si une deuxième clinique applique une majoration du prix de 50 % au même produit et le vend 15 $, le revenu total sera de 15 % et le coût des produits sera de 67 %. Les deux cliniques ont vendu le même produit, mais le coût des produits varie parce que la majoration du prix est différente.

Les honoraires professionnels sont un autre facteur qui affecte le prix des produits. Si deux cliniques appliquent la même majoration de prix aux produits, mais qu’une clinique facture deux fois plus pour les services professionnels, le CPV variera grandement (Tableau 1).

La clinique 1 ne devrait pas avoir de problème à maintenir les achats sous la barre de 20 % du revenu brut, mais il serait impossible de réduire le coût des produits en deçà de 25 %.

Mythe : Les cliniques doivent réduire les achats

Lorsque les vétérinaires demandent de l’aide pour leur CPV, beaucoup de consultants présument qu’il y a un problème. Leur première réaction consiste à suggérer une réduction des dépenses. Si le coût des biens est réduit, et que toutes les choses sont égales par ailleurs, les dépenses seront réduites et il y aura une hausse du profit. Mais beaucoup de cliniques effectuent déjà des achats de manière responsable. Si les achats sont réduits, les cliniques commenceront à manquer d’inventaire.

purchasing, but this rarely happens. So, remember that when accounting for cost of goods sold, this is actually “cost of goods used in the practice” (or COGUIP).

Myth: One size fits allThe most common myth is that everyone can use the same number to manage their cost of goods. This must come from other industries in which product sales are more consistent. If sale of products always represents 50% of revenue, then one figure would work in all situations. In veterinary medicine though, there is variability in pet food and pharmacy sales. A companion animal veterinarian with a keen interest in nutri-tion may sell twice the amount of food and will therefore have twice the COGS. The average revenue from product sales may be 40% of gross revenue (15% pet food and 25% pharmacy), but the range for most practices is 32% to 48%.

The markup on products sold through the pharmacy will affect the contribution to revenue and resulting COGS. If one hospital sells a product for 25% less than a second hospital, the first hospital will have lower revenue and cost of goods will be higher. For example, suppose a product costs $10 to stock. If one hospital marks it up 100% and sells it for $20, their total revenue is $20, and their cost of goods is $10 or 50%. If a second hospital marks up the same product 50% and sells it for $15, total revenue is 15% and cost of goods is 67%. The two hospitals sold the same product, but the cost of goods varies because the markup varies.

Another factor that affects the cost of goods is professional fees. If two hospitals charge the same markup on products, but one charges twice as much for professional services, the COGS will differ greatly (Table 1).

Hospital 1 should have no problem keeping purchases below 20% of gross revenue, but it would be impossible to lower cost of goods to below 25%.

Myth: Hospitals need to decrease purchases

When veterinarians ask for assistance managing their COGS, many consultants assume there’s a problem. Their first reaction is to suggest a decrease in spending. If the cost of goods is low-ered, and all things are equal, expenses will be lower and there will be an increase in profit. But many hospitals are already purchasing responsibly. If purchases are lowered, the hospitals will start to run out of inventory. Most hospitals have a great relationship with their distributors and order products as they need them. They sell a bag of dog food to a client on Tuesday

Table/Tableau 1. Factors affecting the cost of goods sold./Facteurs affectant le coût des produits vendus.

Hospital 1 Hospital 2 Clinique 1 Clinique 2

Sale of professional services $100 $200Vente de services professionnels Sale of products/Vente de produits $100 $100Total revenue/Revenu total $200 $300Cost of products/Coût des produits $50 $50COGS percentage/Pourcentage du CPV 25% 16%



VE

TE

RIN

AR

Y P

RA

CT

ICE

MA

NA

GE

ME

NT

Figure 1. Companion animal product sales and cost of goods. Vente des produits pour animaux de compagnie et coût des produits.

Cos

t of

goo

ds (%

)C

oût

des

prod

uits

(%)

Product sales as a percentage of gross revenueVente de produits en tant que pourcentage

du revenu brut

y = 0.25x 1 0.17R2 = 0.1853

0 10 20 30 40 50 60 70

50

45

40

35

30

25

20

15

10

5

0

La plupart des cliniques possèdent une excellente relation avec leurs distributeurs et commandent des produits en fonction de leurs besoins. Elles vendent un sac de nourriture pour chiens à un client le mardi, puis commandent un sac de remplacement le mercredi. Les achats de la clinique correspondent aux achats des clients.

La réduction de l’inventaire crée d’autres problèmes comme, par exemple, des ventes supérieures de médicaments antiparasitaires en raison de la prévalence accrue des tiques et la hausse des ventes d’aliments pour animaux par l’entremise des boutiques vétérinaires sur le Web. Au cours des dernières années, l’introduction des médicaments pour la prévention des tiques a créé une nouvelle source de revenu pour les pratiques vétérinaires, mais elle a aussi entraîné des achats supérieurs. Parallèlement, beaucoup de cliniques constatent une hausse des ventes d’aliments pour animaux découlant des achats en ligne par l’entremise de leur boutique sur le Web. Par ailleurs, la hausse des ventes associées aux commandes automatiques entraîne une augmentation du revenu provenant des aliments ainsi que de l’achat d’aliments.

Réalité : Les recettes provenant des ventes varient et le coût des produits

devrait donc aussi être différentLes données provenant du Sondage économique 2016 auprès des propriétaires de pratique fournissent des preuves directes à l’égard de la variabilité des achats. Elles expliquent la tendance associée au revenu provenant des produits et au coût des produits qui en découle. Beaucoup de vétérinaires savent que l’augmentation des ventes de produits entraînera une hausse des achats, mais bon nombre croient aussi qu’ils peuvent maintenir la stabilité des achats par rapport au revenu sans égard à la vente de produits. Ils croient que le maintien des achats à 20 % du revenu brut est possible avec l’augmentation de la vente de produits. Or, les données montrent que, au fur et à mesure que la contribution au revenu augmente, le coût des achats en tant que pourcentage du revenu progressera aussi. Lorsqu’il se produit une hausse de la vente des produits en tant que pourcentage

and then order a replacement bag on Wednesday. The hospital’s purchases match client purchases.

Other problems with decreasing inventory are, for example, higher sales of parasite medication due to increased prevalence of ticks and increased pet food sales through veterinary webstores. The introduction of tick prevention medication in the last few years has resulted in a new source of revenue for veterinary practices but it has also resulted in higher purchases. Similarly, many hospitals are finding an increase in pet food sales from offering online purchases through their webstore. Increased sales associated with automatic reorder is increasing both diet revenue and diet purchases.

Reality: Revenue from sales varies and so should cost of goods

Data from the 2016 Practice Owners Economic Survey provides direct evidence on the variability of purchases. It explains the trend associated with revenue from products and the resulting cost of goods. Many veterinarians know that increased product sales will lead to increased purchases, but many believe that they can keep purchases as a percent of revenue stable regardless of product sales. They think that keeping purchases at 20% of gross revenue is possible as product sales increase. The data show that as the contribution to revenue increases, so does the cost of pur-chases as a percent of revenue. As product sales as a percentage of revenue increases, so do product purchases as a percent of revenue. If product sales as a percent of gross revenue increase, so does product purchases as a percent of revenue (Figure 1).

For companion animal practices, the cost of goods rises a 1/4% with each percent increase in sales. For example, if a hos-pital increases sale of products from 40% to 44% of revenue, COGS will go up 1%.

In mixed and large animal practices, in which the sale of medications is a bigger part of the practice, the cost of goods goes up 0.38% for each percentage contribution from product sales (Figure 2). If a dairy veterinarian adds a large herd to the practice, medication sales, as a percent of gross revenue, may go from 40% to 50% and the cost of goods would go up 3.8%.

Figure 2. Mixed animal product sales and cost of goods. Vente de produits pour les cliniques mixtes et coût des biens.

Cos

t of

goo

ds (%

)C

oût

des

prod

uits

(%)

Product sales as a percentage of gross revenueVente de produits en tant que pourcentage

du revenu brut

y = 0.38x 1 0.19R2 = 0.3768

0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9

0.7

0.6

0.5

0.4

0.3

0.2

0.1

0



GE

ST

ION

D’U

NE

CL

INIQ

UE

VÉ

TÉ

RIN

AIR

E

Product sales can be calculated as a percentage of gross rev-enue and entered into the following formulae:

Companion animal COGS % of gross = Product sales % of gross * 0.25 1 0.17

Mixed and large animal COGS % of gross = Product sales % of gross * 0.38 1 0.19

The range in markups and professional fees means the equa-tion may not fit all hospitals. Since the cost of goods varies, be sure to use numbers that reflect your hospital’s sales practices. ■

du revenu, l’achat de produits augmentera aussi en tant que pourcentage du revenu. S’il y a une hausse des ventes de produits en tant que pourcentage du revenu brut, l’achat de produits en tant que pourcentage du revenu augmentera aussi (Figure 1).

Pour les cliniques pour animaux de compagnie, le coût des biens progresse de 1/4 % avec chaque pourcentage d’augmentation des ventes. Par exemple, si une clinique augmente la vente de produits de 40 % à 44 % du revenu, le CPV augmentera de 1 %.

Dans les pratiques mixtes et pour grands animaux, où la vente de médicaments représente un poste budgétaire plus important pour la pratique, le coût des biens augmente de 0,38 % pour chaque pourcentage d’apport provenant de la vente de produits (Figure 2). Si un vétérinaire laitier ajoute un grand troupeau à la pratique, la vente de médicaments, en tant que pourcentage du revenu brut, pourra passer de 40 % à 50 % et le coût des biens augmentera de 3,8 %.

On peut calculer les ventes de produits en tant que pourcentage du revenu brut et les inclure dans les formules suivantes :

Animaux de compagnie % du CPV du revenu brut = % des ventes de produits du revenu brut * 0,25 1 0,17

Cliniques mixtes et % du CPV du revenu brut = % des pour grands animaux ventes de produits du revenu brut

* 0,38 1 0,19

La fourchette de majoration du prix et des honoraires professionnels signifie que l’équation pourra ne pas convenir à toutes les cliniques. Vu que le coût varie, il faudra vous assurer d’utiliser les chiffres qui reflètent les pratiques de vente de votre clinique. ■

The participation of advertisers in the CVJ is an indication of their com-mitment to the advancement of veterinary medicine in Canada. We encourage our readers to give their products and services appropriate consideration. — Ed.

Le support des annonceurs démontre leur engagement pour l’avancement de la médecine vétérinaire au Canada. Nous vous encourageons à prendre connaissance de leurs services et produits. — NDLR

Index of AdvertisersIndex des annonceurs

Abaxis.................................................................................................... 8

AtlanticProvincesVeterinaryConference............................ 10,11

BoehringerIngelheim...................................................................... IFC

BordenLadnerGervaisLLP............................................................104

CampbellPetCompany..................................................................103

CanadianVeterinaryMedicalAssociation................................7,12

ChironCompoundingPharmacy...................................................104

GallantCustomLaboratoriesInc.................................................103

Hill’sPetNutritionCanada,Inc....................................................... 1

Jackson&Associates......................................................................104

Lebalab,Inc.......................................................................................IBC

Merck................................................................................................... 30

NestlePurinaCanada,Inc................................................................. 2

NovaBiomedicalCanadaLtd......................................................... 15

PawsitiveResources.......................................................................104

PracticeOneConsulting................................................................103

SensorHealthVeterinaryDiagnostics,Inc................................104

UXR,Inc...........................................................................................104

VetoquinolNorthAmerica,Inc..................................................OBC

WashingtonStateUniversity.......................................................102

WesternFinancialGroupInsuranceSolutions............................... 4

WesternVeterinaryConference.................................................... 16



Commentary Commentaire

In today’s world, in some cases for better and in others for worse, scientific information can be rapidly disseminated

and made available for use, interpretation, and extrapolation by the non-scientific public (1). To address recent speculation in a PubMed citation that dogs may serve as a reservoir host for Zika virus (ZIKV), it should be made abundantly clear that to date there is no evidence to indicate that dogs a) are capable of trans-mitting ZIKV to humans, or b) are a reservoir host for ZIKV (2).

If extrapolation regarding zoonosis is going to be built on a single seroconverted dog from a group of dogs who may also show seroconversion to the cross-reactive human dengue virus, it should not be ignored that dogs are not a competent reser-voir for several long-established arboviral flaviviruses including dengue, yellow fever, Japanese encephalitis, West Nile, and St. Louis encephalitis viruses (3). Humans and domestic animals are exposed to a wide range of infectious agents for which we and the animals are not susceptible host species. Seroconversion of an individual does not equate to fulfillment of the myriad biologic requirements that are necessary to establish competency as a reservoir host (4). Although there are always idiosyncratic cases in which an infectious agent is able to gain foothold in an aberrant host species (often associated with individual immune compromise), no such case of canine ZIKV infection exists (5).

To this day the course of human history does show abundant evidence — whether recorded from statesmen (6–8), scientists (9), or Nobel laureates (10), or whispered in homes — for the nobility, affection, and loyalty of man’s best friend (11). Yet in the United States alone, over half a million dogs are euthanized annually (12) for no additional reason than overpopulation.

Until meaningful empirical evidence emerges that immuno-logically unmanipulated dogs can be susceptible to ZIKV, this kinder and already burdened species should be spared undue speculation.

References 1. Narayan P. Your pet may be a dengue carrier. The Times of India,

May 31, 2012. Available from: https://timesofindia.indiatimes.com/city/chennai/Your-pet-may-be-a-dengue-carrier/articleshow/13681168.cms Last accessed October 18, 2017.

2. CDC. Zika and animals. 2016 [2016/08/05 2017/04/09]; Available from: https://www.cdc.gov/zika/transmission/qa-animals.html Last accessed October 18, 2017.

3. Go YY, Balasuriya UB, Lee CK. Zoonotic encephalitides caused by arbo-viruses: Transmission and epidemiology of alphaviruses and flaviviruses. Clin Exp Vaccine Res 2014;3:58–77.

4. Haydon DT, Cleaveland S, Taylor LH, Laurenson MK. Identifying reservoirs of infection: A conceptual and practical challenge. Emerg Infect Dis 2002;8:1468–1473.

5. Joob B, Wiwanitkit V. Immunological reactive rate to Zika virus in canine sera: A report from a tropical area and concern on pet, zoonosis and reservoir host. Asian Pac J Trop Med 2017;10:208–209.

6. Vest GG. Eulogy of the dog. Cong Rec 1870;101:S4823–4824. 7. Byron GG. Epitaph to a dog. Newstead Abbey, Nottinghamshire, UK,

1808. 8. Scott W. The Talisman. LaVergne, Tennessee: Lightning Source,

Incorporated, 2005. 9. Darwin C. The Origin of Species. New York, New York: PF Collier &

Son, 1909.10. O’Neill E. Blemie’s Will: The Last Will and Testament of Silverdene

Emblem O’Neill. Toronto, Ontario: Nightshade Press, 1988.11. Blanning T. Frederick the Great: King of Prussia. New York, New York:

Random House Publishing Group, 2016.12. ASPCA. Pet Statistics. [2017/04/09]; Available from: https://www.aspca.

org/animal-homelessness/shelter-intake-and-surrender/pet-statistics Last accessed October 18, 2017.

Seroconversion does not a reservoir host make: No scientific proof to date that dogs are a reservoir for Zika virus

Kenneth Kim

SDx Histopathology, Carlsbad, California, USA.Address all correspondence to Dr. Kenneth Kim; e-mail: [email protected] of this article is limited to a single copy for personal study. Anyone interested in obtaining reprints should contact the CVMA office ([email protected]) for additional copies or permission to use this material elsewhere.



Classifieds Petites annonces

Business Directory

Experts in Autogenous Bacterins, and Swine Influenza Virus Vaccines

✓ High quality Autogenous Biologics

✓ Licensed by the CFIA✓ We make Vaccines for • Swine • Poultry • Bovine

For more information, contact: Sam MostafaPhone: 1-888-838-5223e-mail: [email protected]

www.gallantcustomlaboratories.com

We make autogenous vaccines

Practice One cOnsulting

Practice Valuations Practice PurchasePractice Sale Practice Management

Dr. Frank Richardson, DVM, MBAVeterinary Management Consultant

PO Box 176 Phone: (902) 531-2617Western Shore, Nova Scotia E-mail: [email protected] 3M0 Fax: (902) 531-2618

Personalized Leashes!

www.campbellpet.com(800) 228-6364

»Digital & Dental X-Ray »Underwater Treadmills

»Infusion Pumps/Monitors »Cages & Cat Condos

»Assisi Loop – Anti-inflammation

»Centrifuges »Sterilization

»Lighting/Tables/ Treatment Rooms

Canadian Integrated Supplier of

Veterinary Equipment & Digital Radiography Solutions

227G Brunswick Blvd. Pointe-Claire, Quebec

1-877-440-4494 [email protected]

»Digital & Dental X-Ray »Underwater Treadmills

»Infusion Pumps/Monitors »Cages & Cat Condos

»Assisi Loop – Anti-inflammation

»Centrifuges »Sterilization

»Lighting/Tables/ Treatment Rooms

Canadian Integrated Supplier of

Veterinary Equipment & Digital Radiography Solutions

227G Brunswick Blvd. Pointe-Claire, Quebec

1-877-440-4494 [email protected]

VetAdvise.com

Terry A. Jackson, CPA, CGA Nika Dorofyeyeva, CPA, CA

Phone: 604.939.2323 [email protected]

All About VeterinariansConsulting, Coaching, Valuations, Negotiations, Purchase / Sale

TERRY A. JACKSON, CPA Inc.

PROFESSIONALPRECISEPROMPTSpeak to a Veterinary CompoundingPharmacist today!Please call: Becky, Scott, Linda or Sara

[email protected] Free: 1-800-446-8689

100% Canadian Owned and Operated

Providing Pet Loss Sympathy Resources for Veterinarians

Condolence Cards • Memorial Keepsakes Books on Pet Loss and Grief for Children

End of Life Brochures

W W W. PA W S I T I V E R E S O U R C E S . C O M

Created with Care by Canadian Veterinarians


http://g.adspeed.net/ad.php?do=clk&tokid=eNoljUsSwiAMhu-SvTMNSSCE0yAFZdMZpXXjeHepLv_nl43tPYwMcl8hDfMGJM5JPAUa7JC6oSBRwIA6TZ7dY7-fOTmDWltcXLTUxTVUbmVlcRrFq4TAGcvvZ25Gfb76drscW3_8UTipkolJ2deI-Qrp8wXEgSb4

http://g.adspeed.net/ad.php?do=clk&tokid=eNotjUsOwiAQhu8yexPmCUxPgy0qmyZK68b07tLo8n9-xcU_3dmhtAWm7ubASmR2CnTYYGqOisyRQqRhyuju2-PMmRxmE06Ycoy4FAnGWsXqHK5Jbxj-P2PT6-vd1vtlX9vzh8JB1cLCuSSikBWm4wuQaSXz

http://g.adspeed.net/ad.php?do=clk&tokid=eNoljUkOwyAMRe_ifaWYD8ExpwHcgU2klqSbKncvUZZ_fFm9_rpCKTej1HVWQnBunk7BShulphwYiByFh-lHd99eZw6nxBKiwXM1FC5TrfbwXFywXDCSzcn1Mzb9_vm29Xnb1_a-UDyoIcNDJDhbYqF0_AG6vCbT

http://g.adspeed.net/ad.php?do=clk&tokid=eNoljUsOwiAQhu8ye5POA5DhNFMKyqaJ0roxvbvULv_nZyr67coK1hZIXb0CO1wiL6dAhQ1SU3TIHDCGOEwZ3X17njmTAhVjmrBWpojz3abMhtVCLkYSiP4_Y9PL-9PWx21f2-tC4aA6Y-EoM2dfHKTjB8qiXCcs


Business Directory

• Practice Management Agreements• Incorporations• Employment Matters• Discipline Proceedings and Malpractice Defence• Buying and Selling a Practice

DOUGLAS C. JACK – Partner

P 416.367.6389 | TF 800.563.2595 F 416.367.6749 | [email protected]

Bay Adelaide Centre, East Tower 22 Adelaide St W, Toronto, ON Canada M5H 4E3

Calgary | Montréal | Ottawa Toronto | Vancouver Lawyers | Patent & Trademark Agents Borden Ladner Gervais LLP is an Ontario Limited Liability Partnership.

blg.com

Reaching Canada’s VeterinariansGet your message into

The Canadian Veterinary JournalFor more information contact:Laima LaffitteAdvertising ManagerTel.: (613) 673-2659Fax: (613) 673-2462e-mail: [email protected]

LIMITED TIME OFFER!

WWW.SENSORHEALTHVET.COM

1-888-777-7080Facebook.com/SensorHealth/Vet@SensorHealthVet

The MicroSenseTM Incubator is the perfect choice for your AgarSenseTM

culture plates and UriCult® Culture Paddles. A high-quality, reliable

incubator, without the high price tag!

Choose one of the following FREE AgarSenseTM culture plate options with your MicroSenseTM Incubator:

5 FREE AgarSenseTM Bacteria Bi-Plates

5 FREE AgarSenseTM Tri-Plates

5 FREE AgarSenseTM Quad Plates

5 FREE UriCult® Urine Culture Paddles

Call your Purchasing Group for ordering information,or Sensor Health Vet for Direct Shipping.


http://g.adspeed.net/ad.php?do=clk&tokid=eNoljU0SwiAMhe-SvTOQEDDpaZCUlk1nlNaN07tLdfm-95c16KcrKeRmMHWNCsSIkS_hFXaYmnr2RAkdhgHDyB77evmEClgeWZwUrlZDFefITHyeyaoIlfjbGZ0-v95tW27H1p7_Kz9eOVMgSfdkxgOeX-a2XCet

http://g.adspeed.net/ad.php?do=clk&tokid=eNolTUkOwjAM_IvvSHUcO8R5jZsFcqkEabkg_k4Kl5FmN_X6HkoK1gukoaJA7BzzSVBhh9QVGUkmxGWKfmaP_X765BQkxBLzXCIFzbDk5lsRDJjbwqtVkt_O7Iz6fPXtdjm2_vhf4Xxlo1Aby9VxWCF9vuKKXCeg


http://g.adspeed.net/ad.php?do=clk&tokid=eNoljcsOwiAQRf9l9ibeGaAwfA0vlU0TpXVj-u_SdHmfXCep0d9QUUq9UhzqlMQyO5wCShvFrrAQWeDZTNPM7r69zlxcWKkgPBoDpi3sQvUQeOdzyKZZlHD9zM1on29fn7d97e8LhUm1SYz4fG-2SqF4_AGiqyaw

www.vetoquinol.ca

PUTTING THE ‘TREAT’ IN TREATMENT

T H E E A S Y W AY TO A D M I N I S T E R C E FA L E X I NI N T R O D U C I N G C E FA S E P T I N ® :

Palatable Available in blisters

Making dosing accurate

Chewable

Innovative Quadri-scored tablet
