the highs and lows of genetic prediction highs and... · the highs and lows of genetic prediction...

of 37 /37
The highs and lows of genetic prediction Sir John Burn MD FRCP FRCPE FRCPCH FRCOG FMedSci Professor of Clinical Genetics, Newcastle University, UK Institute of Genetic Medicine Newcastle University, UK Oxford September 15 th 2014

Upload: dinhkhuong

Post on 16-Feb-2018

216 views

Category:

Documents


1 download

TRANSCRIPT

The highs and lows of genetic prediction

Sir John Burn MD

FRCP FRCPE FRCPCH FRCOG FMedSci Professor of Clinical Genetics Newcastle University UK

Institute of Genetic Medicine Newcastle University UK

Oxford September 15th 2014

CCG U C A G

U C A G

UCAG

Phe Phe Leu Leu

Ser Ser Ser Ser

Tyr Tyr STOP STOP

Cys Cys STOP Trp

Leu Leu Leu Leu

Pro Pro Pro Pro

His His Gln Gln

Arg Arg Arg Arg

Ile Ile Ile Met

Val Val Val Val

Thr Thr Thr Thr

Asn Asn Lys Lys

Ala Ala Ala Ala

Asp Asp Glu Glu

Ser Ser Arg Arg

Gly Gly Gly Gly

UCAG

UCAG

UCAG

lsquohereditaryrsquo tumour 2 hit hypothesis

predisposed tumour

Retinoblastoma loss of Rb on 13

Family at risk of breast cancer due to p53 mutation

Breast Cancer

bull 4 high penetrance genes

ndash BRCA1 breastovarian

ndash BRCA2 breastovarian

ndash P53 breast+sarcoma+others

ndash PTEN breast + thyroid+overgrowth

I1 I2

55

II2

49

II1 II3

45

For individual III1Calculated risk of cancer (20Heterozygote risk 190

10 year risk 0920 year risk 4430 year risk 97

Lifetime risk (85) 243

familial breast cancer

Individual III 1 at 20

Heterozygote 19

10 year risk 09

20 year risk 44

30 year risk 97

Lifetime risk 24

PARP inhibitors mechanism

DNA DSB

ATMR

ERCC1 XRCC3

NBS1 MRE11

Rad50 BRCA1

gH2AX

HR repair

DNA SSB

DNA replication

BER PARP

XRCC1

Pol Lig III

FA core complex FANC

D2

Rad 524 RPA

Rad 51 BRCA2

bull Endogenously formed SSB are normally repaired by PARP-dependent BER

bull If PARP is inhibited SSB persist

bull SSB form DSB at replication which are repaired by HR

bull If HR is defective the breaks are not repaired and the cell dies

bull This is the first exploitation of synthetic lethality in cancer therapy

Lynch syndrome

Endometrial

Carcinoma

Bertha

Ted

3 CRC

9 skin

cancers

Family from which DNA used to Demonstrate hMSH2 mutation by Kolodnerrsquos group 1993 1st of the MISMATCH REPAIR GENE DEFECTS

Muir Torre syndrome A sub type of Lynch syndrome

ndash Microsatellites are lengths of short repeated sequences usually

ndash mononucleotides eg BAT25

tgttttgtttttttgatttttttttttttttttttttttttgagaacagagca

ndash or dinucleotides eg D5S346

aatttacacacacacacacacacacacacacacagagta

Microsatellites

600mg aspirinday for 2 yrs reduced Lynch syndrome cancers at 5 yrs

by over 50

Lancet volume 378 December 11th 2011

CAPP2 follow up data May 2013

30

10

40

20

45434

25427

12 years New colorectal cancers in blinded recruits treated for mean 25 yrs with 600mg Aspirin (green) or placebo (red) Unpublished data

= Washington University

Genome Sequencing Center

Baylor College of Medicine

Human Genome Sequencing Center

Using AB 3730 XL

fluorescent Sanger chemistry

on capillary sequencers

per month

Sequencing 2005

Next-generation sequencers

Slide courtesy of

John D McPherson OICR

Sequencing Now

First woman sequenced June 2008

Human amp Clinical Genetics

Marjolein Kriek PhD clinical geneticist

34

ldquoMan takes one step towards understanding womanrdquo

Human Genomics Strategy Group bull Government response

ndash 100000 whole genomes ndash pound100 million investment ndash Genomics Strategy Board

(NHS now HEE)

Newcastle one of four pilot centres 209743 rare disease samples (130114)

3 million

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

CCG U C A G

U C A G

UCAG

Phe Phe Leu Leu

Ser Ser Ser Ser

Tyr Tyr STOP STOP

Cys Cys STOP Trp

Leu Leu Leu Leu

Pro Pro Pro Pro

His His Gln Gln

Arg Arg Arg Arg

Ile Ile Ile Met

Val Val Val Val

Thr Thr Thr Thr

Asn Asn Lys Lys

Ala Ala Ala Ala

Asp Asp Glu Glu

Ser Ser Arg Arg

Gly Gly Gly Gly

UCAG

UCAG

UCAG

lsquohereditaryrsquo tumour 2 hit hypothesis

predisposed tumour

Retinoblastoma loss of Rb on 13

Family at risk of breast cancer due to p53 mutation

Breast Cancer

bull 4 high penetrance genes

ndash BRCA1 breastovarian

ndash BRCA2 breastovarian

ndash P53 breast+sarcoma+others

ndash PTEN breast + thyroid+overgrowth

I1 I2

55

II2

49

II1 II3

45

For individual III1Calculated risk of cancer (20Heterozygote risk 190

10 year risk 0920 year risk 4430 year risk 97

Lifetime risk (85) 243

familial breast cancer

Individual III 1 at 20

Heterozygote 19

10 year risk 09

20 year risk 44

30 year risk 97

Lifetime risk 24

PARP inhibitors mechanism

DNA DSB

ATMR

ERCC1 XRCC3

NBS1 MRE11

Rad50 BRCA1

gH2AX

HR repair

DNA SSB

DNA replication

BER PARP

XRCC1

Pol Lig III

FA core complex FANC

D2

Rad 524 RPA

Rad 51 BRCA2

bull Endogenously formed SSB are normally repaired by PARP-dependent BER

bull If PARP is inhibited SSB persist

bull SSB form DSB at replication which are repaired by HR

bull If HR is defective the breaks are not repaired and the cell dies

bull This is the first exploitation of synthetic lethality in cancer therapy

Lynch syndrome

Endometrial

Carcinoma

Bertha

Ted

3 CRC

9 skin

cancers

Family from which DNA used to Demonstrate hMSH2 mutation by Kolodnerrsquos group 1993 1st of the MISMATCH REPAIR GENE DEFECTS

Muir Torre syndrome A sub type of Lynch syndrome

ndash Microsatellites are lengths of short repeated sequences usually

ndash mononucleotides eg BAT25

tgttttgtttttttgatttttttttttttttttttttttttgagaacagagca

ndash or dinucleotides eg D5S346

aatttacacacacacacacacacacacacacacagagta

Microsatellites

600mg aspirinday for 2 yrs reduced Lynch syndrome cancers at 5 yrs

by over 50

Lancet volume 378 December 11th 2011

CAPP2 follow up data May 2013

30

10

40

20

45434

25427

12 years New colorectal cancers in blinded recruits treated for mean 25 yrs with 600mg Aspirin (green) or placebo (red) Unpublished data

= Washington University

Genome Sequencing Center

Baylor College of Medicine

Human Genome Sequencing Center

Using AB 3730 XL

fluorescent Sanger chemistry

on capillary sequencers

per month

Sequencing 2005

Next-generation sequencers

Slide courtesy of

John D McPherson OICR

Sequencing Now

First woman sequenced June 2008

Human amp Clinical Genetics

Marjolein Kriek PhD clinical geneticist

34

ldquoMan takes one step towards understanding womanrdquo

Human Genomics Strategy Group bull Government response

ndash 100000 whole genomes ndash pound100 million investment ndash Genomics Strategy Board

(NHS now HEE)

Newcastle one of four pilot centres 209743 rare disease samples (130114)

3 million

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

lsquohereditaryrsquo tumour 2 hit hypothesis

predisposed tumour

Retinoblastoma loss of Rb on 13

Family at risk of breast cancer due to p53 mutation

Breast Cancer

bull 4 high penetrance genes

ndash BRCA1 breastovarian

ndash BRCA2 breastovarian

ndash P53 breast+sarcoma+others

ndash PTEN breast + thyroid+overgrowth

I1 I2

55

II2

49

II1 II3

45

For individual III1Calculated risk of cancer (20Heterozygote risk 190

10 year risk 0920 year risk 4430 year risk 97

Lifetime risk (85) 243

familial breast cancer

Individual III 1 at 20

Heterozygote 19

10 year risk 09

20 year risk 44

30 year risk 97

Lifetime risk 24

PARP inhibitors mechanism

DNA DSB

ATMR

ERCC1 XRCC3

NBS1 MRE11

Rad50 BRCA1

gH2AX

HR repair

DNA SSB

DNA replication

BER PARP

XRCC1

Pol Lig III

FA core complex FANC

D2

Rad 524 RPA

Rad 51 BRCA2

bull Endogenously formed SSB are normally repaired by PARP-dependent BER

bull If PARP is inhibited SSB persist

bull SSB form DSB at replication which are repaired by HR

bull If HR is defective the breaks are not repaired and the cell dies

bull This is the first exploitation of synthetic lethality in cancer therapy

Lynch syndrome

Endometrial

Carcinoma

Bertha

Ted

3 CRC

9 skin

cancers

Family from which DNA used to Demonstrate hMSH2 mutation by Kolodnerrsquos group 1993 1st of the MISMATCH REPAIR GENE DEFECTS

Muir Torre syndrome A sub type of Lynch syndrome

ndash Microsatellites are lengths of short repeated sequences usually

ndash mononucleotides eg BAT25

tgttttgtttttttgatttttttttttttttttttttttttgagaacagagca

ndash or dinucleotides eg D5S346

aatttacacacacacacacacacacacacacacagagta

Microsatellites

600mg aspirinday for 2 yrs reduced Lynch syndrome cancers at 5 yrs

by over 50

Lancet volume 378 December 11th 2011

CAPP2 follow up data May 2013

30

10

40

20

45434

25427

12 years New colorectal cancers in blinded recruits treated for mean 25 yrs with 600mg Aspirin (green) or placebo (red) Unpublished data

= Washington University

Genome Sequencing Center

Baylor College of Medicine

Human Genome Sequencing Center

Using AB 3730 XL

fluorescent Sanger chemistry

on capillary sequencers

per month

Sequencing 2005

Next-generation sequencers

Slide courtesy of

John D McPherson OICR

Sequencing Now

First woman sequenced June 2008

Human amp Clinical Genetics

Marjolein Kriek PhD clinical geneticist

34

ldquoMan takes one step towards understanding womanrdquo

Human Genomics Strategy Group bull Government response

ndash 100000 whole genomes ndash pound100 million investment ndash Genomics Strategy Board

(NHS now HEE)

Newcastle one of four pilot centres 209743 rare disease samples (130114)

3 million

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

Family at risk of breast cancer due to p53 mutation

Breast Cancer

bull 4 high penetrance genes

ndash BRCA1 breastovarian

ndash BRCA2 breastovarian

ndash P53 breast+sarcoma+others

ndash PTEN breast + thyroid+overgrowth

I1 I2

55

II2

49

II1 II3

45

For individual III1Calculated risk of cancer (20Heterozygote risk 190

10 year risk 0920 year risk 4430 year risk 97

Lifetime risk (85) 243

familial breast cancer

Individual III 1 at 20

Heterozygote 19

10 year risk 09

20 year risk 44

30 year risk 97

Lifetime risk 24

PARP inhibitors mechanism

DNA DSB

ATMR

ERCC1 XRCC3

NBS1 MRE11

Rad50 BRCA1

gH2AX

HR repair

DNA SSB

DNA replication

BER PARP

XRCC1

Pol Lig III

FA core complex FANC

D2

Rad 524 RPA

Rad 51 BRCA2

bull Endogenously formed SSB are normally repaired by PARP-dependent BER

bull If PARP is inhibited SSB persist

bull SSB form DSB at replication which are repaired by HR

bull If HR is defective the breaks are not repaired and the cell dies

bull This is the first exploitation of synthetic lethality in cancer therapy

Lynch syndrome

Endometrial

Carcinoma

Bertha

Ted

3 CRC

9 skin

cancers

Family from which DNA used to Demonstrate hMSH2 mutation by Kolodnerrsquos group 1993 1st of the MISMATCH REPAIR GENE DEFECTS

Muir Torre syndrome A sub type of Lynch syndrome

ndash Microsatellites are lengths of short repeated sequences usually

ndash mononucleotides eg BAT25

tgttttgtttttttgatttttttttttttttttttttttttgagaacagagca

ndash or dinucleotides eg D5S346

aatttacacacacacacacacacacacacacacagagta

Microsatellites

600mg aspirinday for 2 yrs reduced Lynch syndrome cancers at 5 yrs

by over 50

Lancet volume 378 December 11th 2011

CAPP2 follow up data May 2013

30

10

40

20

45434

25427

12 years New colorectal cancers in blinded recruits treated for mean 25 yrs with 600mg Aspirin (green) or placebo (red) Unpublished data

= Washington University

Genome Sequencing Center

Baylor College of Medicine

Human Genome Sequencing Center

Using AB 3730 XL

fluorescent Sanger chemistry

on capillary sequencers

per month

Sequencing 2005

Next-generation sequencers

Slide courtesy of

John D McPherson OICR

Sequencing Now

First woman sequenced June 2008

Human amp Clinical Genetics

Marjolein Kriek PhD clinical geneticist

34

ldquoMan takes one step towards understanding womanrdquo

Human Genomics Strategy Group bull Government response

ndash 100000 whole genomes ndash pound100 million investment ndash Genomics Strategy Board

(NHS now HEE)

Newcastle one of four pilot centres 209743 rare disease samples (130114)

3 million

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

Breast Cancer

bull 4 high penetrance genes

ndash BRCA1 breastovarian

ndash BRCA2 breastovarian

ndash P53 breast+sarcoma+others

ndash PTEN breast + thyroid+overgrowth

I1 I2

55

II2

49

II1 II3

45

For individual III1Calculated risk of cancer (20Heterozygote risk 190

10 year risk 0920 year risk 4430 year risk 97

Lifetime risk (85) 243

familial breast cancer

Individual III 1 at 20

Heterozygote 19

10 year risk 09

20 year risk 44

30 year risk 97

Lifetime risk 24

PARP inhibitors mechanism

DNA DSB

ATMR

ERCC1 XRCC3

NBS1 MRE11

Rad50 BRCA1

gH2AX

HR repair

DNA SSB

DNA replication

BER PARP

XRCC1

Pol Lig III

FA core complex FANC

D2

Rad 524 RPA

Rad 51 BRCA2

bull Endogenously formed SSB are normally repaired by PARP-dependent BER

bull If PARP is inhibited SSB persist

bull SSB form DSB at replication which are repaired by HR

bull If HR is defective the breaks are not repaired and the cell dies

bull This is the first exploitation of synthetic lethality in cancer therapy

Lynch syndrome

Endometrial

Carcinoma

Bertha

Ted

3 CRC

9 skin

cancers

Family from which DNA used to Demonstrate hMSH2 mutation by Kolodnerrsquos group 1993 1st of the MISMATCH REPAIR GENE DEFECTS

Muir Torre syndrome A sub type of Lynch syndrome

ndash Microsatellites are lengths of short repeated sequences usually

ndash mononucleotides eg BAT25

tgttttgtttttttgatttttttttttttttttttttttttgagaacagagca

ndash or dinucleotides eg D5S346

aatttacacacacacacacacacacacacacacagagta

Microsatellites

600mg aspirinday for 2 yrs reduced Lynch syndrome cancers at 5 yrs

by over 50

Lancet volume 378 December 11th 2011

CAPP2 follow up data May 2013

30

10

40

20

45434

25427

12 years New colorectal cancers in blinded recruits treated for mean 25 yrs with 600mg Aspirin (green) or placebo (red) Unpublished data

= Washington University

Genome Sequencing Center

Baylor College of Medicine

Human Genome Sequencing Center

Using AB 3730 XL

fluorescent Sanger chemistry

on capillary sequencers

per month

Sequencing 2005

Next-generation sequencers

Slide courtesy of

John D McPherson OICR

Sequencing Now

First woman sequenced June 2008

Human amp Clinical Genetics

Marjolein Kriek PhD clinical geneticist

34

ldquoMan takes one step towards understanding womanrdquo

Human Genomics Strategy Group bull Government response

ndash 100000 whole genomes ndash pound100 million investment ndash Genomics Strategy Board

(NHS now HEE)

Newcastle one of four pilot centres 209743 rare disease samples (130114)

3 million

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

I1 I2

55

II2

49

II1 II3

45

For individual III1Calculated risk of cancer (20Heterozygote risk 190

10 year risk 0920 year risk 4430 year risk 97

Lifetime risk (85) 243

familial breast cancer

Individual III 1 at 20

Heterozygote 19

10 year risk 09

20 year risk 44

30 year risk 97

Lifetime risk 24

PARP inhibitors mechanism

DNA DSB

ATMR

ERCC1 XRCC3

NBS1 MRE11

Rad50 BRCA1

gH2AX

HR repair

DNA SSB

DNA replication

BER PARP

XRCC1

Pol Lig III

FA core complex FANC

D2

Rad 524 RPA

Rad 51 BRCA2

bull Endogenously formed SSB are normally repaired by PARP-dependent BER

bull If PARP is inhibited SSB persist

bull SSB form DSB at replication which are repaired by HR

bull If HR is defective the breaks are not repaired and the cell dies

bull This is the first exploitation of synthetic lethality in cancer therapy

Lynch syndrome

Endometrial

Carcinoma

Bertha

Ted

3 CRC

9 skin

cancers

Family from which DNA used to Demonstrate hMSH2 mutation by Kolodnerrsquos group 1993 1st of the MISMATCH REPAIR GENE DEFECTS

Muir Torre syndrome A sub type of Lynch syndrome

ndash Microsatellites are lengths of short repeated sequences usually

ndash mononucleotides eg BAT25

tgttttgtttttttgatttttttttttttttttttttttttgagaacagagca

ndash or dinucleotides eg D5S346

aatttacacacacacacacacacacacacacacagagta

Microsatellites

600mg aspirinday for 2 yrs reduced Lynch syndrome cancers at 5 yrs

by over 50

Lancet volume 378 December 11th 2011

CAPP2 follow up data May 2013

30

10

40

20

45434

25427

12 years New colorectal cancers in blinded recruits treated for mean 25 yrs with 600mg Aspirin (green) or placebo (red) Unpublished data

= Washington University

Genome Sequencing Center

Baylor College of Medicine

Human Genome Sequencing Center

Using AB 3730 XL

fluorescent Sanger chemistry

on capillary sequencers

per month

Sequencing 2005

Next-generation sequencers

Slide courtesy of

John D McPherson OICR

Sequencing Now

First woman sequenced June 2008

Human amp Clinical Genetics

Marjolein Kriek PhD clinical geneticist

34

ldquoMan takes one step towards understanding womanrdquo

Human Genomics Strategy Group bull Government response

ndash 100000 whole genomes ndash pound100 million investment ndash Genomics Strategy Board

(NHS now HEE)

Newcastle one of four pilot centres 209743 rare disease samples (130114)

3 million

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

PARP inhibitors mechanism

DNA DSB

ATMR

ERCC1 XRCC3

NBS1 MRE11

Rad50 BRCA1

gH2AX

HR repair

DNA SSB

DNA replication

BER PARP

XRCC1

Pol Lig III

FA core complex FANC

D2

Rad 524 RPA

Rad 51 BRCA2

bull Endogenously formed SSB are normally repaired by PARP-dependent BER

bull If PARP is inhibited SSB persist

bull SSB form DSB at replication which are repaired by HR

bull If HR is defective the breaks are not repaired and the cell dies

bull This is the first exploitation of synthetic lethality in cancer therapy

Lynch syndrome

Endometrial

Carcinoma

Bertha

Ted

3 CRC

9 skin

cancers

Family from which DNA used to Demonstrate hMSH2 mutation by Kolodnerrsquos group 1993 1st of the MISMATCH REPAIR GENE DEFECTS

Muir Torre syndrome A sub type of Lynch syndrome

ndash Microsatellites are lengths of short repeated sequences usually

ndash mononucleotides eg BAT25

tgttttgtttttttgatttttttttttttttttttttttttgagaacagagca

ndash or dinucleotides eg D5S346

aatttacacacacacacacacacacacacacacagagta

Microsatellites

600mg aspirinday for 2 yrs reduced Lynch syndrome cancers at 5 yrs

by over 50

Lancet volume 378 December 11th 2011

CAPP2 follow up data May 2013

30

10

40

20

45434

25427

12 years New colorectal cancers in blinded recruits treated for mean 25 yrs with 600mg Aspirin (green) or placebo (red) Unpublished data

= Washington University

Genome Sequencing Center

Baylor College of Medicine

Human Genome Sequencing Center

Using AB 3730 XL

fluorescent Sanger chemistry

on capillary sequencers

per month

Sequencing 2005

Next-generation sequencers

Slide courtesy of

John D McPherson OICR

Sequencing Now

First woman sequenced June 2008

Human amp Clinical Genetics

Marjolein Kriek PhD clinical geneticist

34

ldquoMan takes one step towards understanding womanrdquo

Human Genomics Strategy Group bull Government response

ndash 100000 whole genomes ndash pound100 million investment ndash Genomics Strategy Board

(NHS now HEE)

Newcastle one of four pilot centres 209743 rare disease samples (130114)

3 million

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

Lynch syndrome

Endometrial

Carcinoma

Bertha

Ted

3 CRC

9 skin

cancers

Family from which DNA used to Demonstrate hMSH2 mutation by Kolodnerrsquos group 1993 1st of the MISMATCH REPAIR GENE DEFECTS

Muir Torre syndrome A sub type of Lynch syndrome

ndash Microsatellites are lengths of short repeated sequences usually

ndash mononucleotides eg BAT25

tgttttgtttttttgatttttttttttttttttttttttttgagaacagagca

ndash or dinucleotides eg D5S346

aatttacacacacacacacacacacacacacacagagta

Microsatellites

600mg aspirinday for 2 yrs reduced Lynch syndrome cancers at 5 yrs

by over 50

Lancet volume 378 December 11th 2011

CAPP2 follow up data May 2013

30

10

40

20

45434

25427

12 years New colorectal cancers in blinded recruits treated for mean 25 yrs with 600mg Aspirin (green) or placebo (red) Unpublished data

= Washington University

Genome Sequencing Center

Baylor College of Medicine

Human Genome Sequencing Center

Using AB 3730 XL

fluorescent Sanger chemistry

on capillary sequencers

per month

Sequencing 2005

Next-generation sequencers

Slide courtesy of

John D McPherson OICR

Sequencing Now

First woman sequenced June 2008

Human amp Clinical Genetics

Marjolein Kriek PhD clinical geneticist

34

ldquoMan takes one step towards understanding womanrdquo

Human Genomics Strategy Group bull Government response

ndash 100000 whole genomes ndash pound100 million investment ndash Genomics Strategy Board

(NHS now HEE)

Newcastle one of four pilot centres 209743 rare disease samples (130114)

3 million

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

ndash Microsatellites are lengths of short repeated sequences usually

ndash mononucleotides eg BAT25

tgttttgtttttttgatttttttttttttttttttttttttgagaacagagca

ndash or dinucleotides eg D5S346

aatttacacacacacacacacacacacacacacagagta

Microsatellites

600mg aspirinday for 2 yrs reduced Lynch syndrome cancers at 5 yrs

by over 50

Lancet volume 378 December 11th 2011

CAPP2 follow up data May 2013

30

10

40

20

45434

25427

12 years New colorectal cancers in blinded recruits treated for mean 25 yrs with 600mg Aspirin (green) or placebo (red) Unpublished data

= Washington University

Genome Sequencing Center

Baylor College of Medicine

Human Genome Sequencing Center

Using AB 3730 XL

fluorescent Sanger chemistry

on capillary sequencers

per month

Sequencing 2005

Next-generation sequencers

Slide courtesy of

John D McPherson OICR

Sequencing Now

First woman sequenced June 2008

Human amp Clinical Genetics

Marjolein Kriek PhD clinical geneticist

34

ldquoMan takes one step towards understanding womanrdquo

Human Genomics Strategy Group bull Government response

ndash 100000 whole genomes ndash pound100 million investment ndash Genomics Strategy Board

(NHS now HEE)

Newcastle one of four pilot centres 209743 rare disease samples (130114)

3 million

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

600mg aspirinday for 2 yrs reduced Lynch syndrome cancers at 5 yrs

by over 50

Lancet volume 378 December 11th 2011

CAPP2 follow up data May 2013

30

10

40

20

45434

25427

12 years New colorectal cancers in blinded recruits treated for mean 25 yrs with 600mg Aspirin (green) or placebo (red) Unpublished data

= Washington University

Genome Sequencing Center

Baylor College of Medicine

Human Genome Sequencing Center

Using AB 3730 XL

fluorescent Sanger chemistry

on capillary sequencers

per month

Sequencing 2005

Next-generation sequencers

Slide courtesy of

John D McPherson OICR

Sequencing Now

First woman sequenced June 2008

Human amp Clinical Genetics

Marjolein Kriek PhD clinical geneticist

34

ldquoMan takes one step towards understanding womanrdquo

Human Genomics Strategy Group bull Government response

ndash 100000 whole genomes ndash pound100 million investment ndash Genomics Strategy Board

(NHS now HEE)

Newcastle one of four pilot centres 209743 rare disease samples (130114)

3 million

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

CAPP2 follow up data May 2013

30

10

40

20

45434

25427

12 years New colorectal cancers in blinded recruits treated for mean 25 yrs with 600mg Aspirin (green) or placebo (red) Unpublished data

= Washington University

Genome Sequencing Center

Baylor College of Medicine

Human Genome Sequencing Center

Using AB 3730 XL

fluorescent Sanger chemistry

on capillary sequencers

per month

Sequencing 2005

Next-generation sequencers

Slide courtesy of

John D McPherson OICR

Sequencing Now

First woman sequenced June 2008

Human amp Clinical Genetics

Marjolein Kriek PhD clinical geneticist

34

ldquoMan takes one step towards understanding womanrdquo

Human Genomics Strategy Group bull Government response

ndash 100000 whole genomes ndash pound100 million investment ndash Genomics Strategy Board

(NHS now HEE)

Newcastle one of four pilot centres 209743 rare disease samples (130114)

3 million

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

= Washington University

Genome Sequencing Center

Baylor College of Medicine

Human Genome Sequencing Center

Using AB 3730 XL

fluorescent Sanger chemistry

on capillary sequencers

per month

Sequencing 2005

Next-generation sequencers

Slide courtesy of

John D McPherson OICR

Sequencing Now

First woman sequenced June 2008

Human amp Clinical Genetics

Marjolein Kriek PhD clinical geneticist

34

ldquoMan takes one step towards understanding womanrdquo

Human Genomics Strategy Group bull Government response

ndash 100000 whole genomes ndash pound100 million investment ndash Genomics Strategy Board

(NHS now HEE)

Newcastle one of four pilot centres 209743 rare disease samples (130114)

3 million

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

First woman sequenced June 2008

Human amp Clinical Genetics

Marjolein Kriek PhD clinical geneticist

34

ldquoMan takes one step towards understanding womanrdquo

Human Genomics Strategy Group bull Government response

ndash 100000 whole genomes ndash pound100 million investment ndash Genomics Strategy Board

(NHS now HEE)

Newcastle one of four pilot centres 209743 rare disease samples (130114)

3 million

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

Human Genomics Strategy Group bull Government response

ndash 100000 whole genomes ndash pound100 million investment ndash Genomics Strategy Board

(NHS now HEE)

Newcastle one of four pilot centres 209743 rare disease samples (130114)

3 million

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

3 million

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

Error rates inadequate depth of coverage

copy number variation imprinted genes

splice variants

W hole genome sequencing

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

Functional classification of JDW SNPs

SNP Type Known SNPs Novel SNPs

Missense 8967 2421

Nonsense 44 5

Synonymous 9121 2261

UTR 18517 7102

Intron 922048 381924

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

August 2010 China National Highway 110 traffic jam China worldrsquos worst

traffic jam everhellip

more than 100 kilometres from August 14 - 26 inc at least 11 days of total

gridlock

We are heading for the biggest traffic jam in history

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

Hereditary colorectal cancer Should I request colonoscopy

Donna-Marie Ian

25 24

Positive FH

MSI high tumour

MLH1 leu559arg

Missense

Not inherited

Robert Hofstra

Rolf Sijmons

Westernno expression

Pulldown no interaction

MAPP-MMR and SIFT v2

Suggest pathogenic

Polyphen inconclusive

Reported Belvederesi EJHG

2006

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

Grantham Variation (GV) and Deviation (GD)

C

P

V Grantham R Science 185 862-864 1974

Tavtigian et al JMG 43 295 2006

GV

GD

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

HVP4 UNESCO Headquarters Paris 11-15 June 2012

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

Estimates of Heritability

Disorder Frequency () ()

bull Schizophrenia 1 85

bull Asthma 4 80

bull Ankylosing spondylitis 02 70

bull Neural tube defects 02 60

bull Congenital heart disease 05 60

21

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

bull Paper by Galton

ldquoChildren regress to

Mediocrityrdquo

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

Imagine if there were only 2 genes for height each with only 2 alleles H or T of equal

frequency

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

10

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

We discover one of the genes and call it BYH1 somebody would suggest using it for disease

prediction

T T T T

T T

T T

H

T

H

H

H

H

H H H

H

H

H

H H

H H

H H H H H H T T T

T

T

T T T T

T T

H

H H H T

T

T

H H H

H H H

H T T T

T T

T T

T T

4 3 2 1 0

average short Very

short tall

Very

tall

Always bump

your head

Often bump

Your head

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

ldquohundreds of variants in at least 180 loci influence human heightrdquo

Nature 2010 Oct 14467(7317)832-8 doi 101038nature09410 Epub 2010 Sep 29 Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen H1 Estrada K Lettre G Berndt SI Weedon MN Rivadeneira F Willer CJ Jackson AU Vedantam S Raychaudhuri S Ferreira T Wood AR Weyant RJ Segregrave AV Speliotes EK Wheeler E Soranzo N Park JH Yang J Gudbjartsson D Heard-Costa NL Randall JC Qi L Vernon Smith A Maumlgi R Pastinen T Liang L Heid IM Luan J Thorleifsson G Winkler TW Goddard ME Sin Lo K Palmer C Workalemahu T Aulchenko YS Johansson A Zillikens MC Feitosa MF Esko T Johnson T Ketkar S Kraft P Mangino M Prokopenko I Absher D Albrecht E Ernst F Glazer NL Hayward C Hottenga JJ Jacobs KB Knowles JW Kutalik Z Monda KL Polasek O Preuss M Rayner NW Robertson NR Steinthorsdottir V Tyrer JP Voight BF Wiklund F Xu J Zhao JH Nyholt DR Pellikka N Perola M Perry JR Surakka I Tammesoo ML Altmaier EL Amin N Aspelund T Bhangale T Boucher G Chasman DI Chen C Coin L Cooper MN Dixon AL Gibson Q Grundberg E Hao K Juhani Junttila M Kaplan LM Kettunen J Koumlnig IR Kwan T Lawrence RW Levinson DF Lorentzon M McKnight B Morris AP Muumlller M Suh Ngwa J Purcell S Rafelt S Salem RM Salvi E Sanna S Shi J Sovio U Thompson JR Turchin MC Vandenput L Verlaan DJ Vitart V White CC Ziegler A Almgren P Balmforth AJ Campbell H Citterio L De Grandi A Dominiczak A Duan J Elliott P Elosua R Eriksson JG Freimer NB Geus EJ Glorioso N Haiqing S Hartikainen AL Havulinna AS Hicks AA Hui J Igl W Illig T Jula A Kajantie E Kilpelaumlinen TO Koiranen M Kolcic I Koskinen S Kovacs P Laitinen J Liu J Lokki ML Marusic A Maschio A Meitinger T Mulas A Pareacute G Parker AN Peden JF Petersmann A Pichler I Pietilaumlinen KH Pouta A Ridderstraringle M Rotter JI Sambrook JG Sanders AR Schmidt CO Sinisalo J Smit JH Stringham HM Bragi Walters G Widen E Wild SH Willemsen G Zagato L Zgaga L Zitting P Alavere H Farrall M McArdle WL Nelis M Peters MJ Ripatti S van Meurs JB Aben KK Ardlie KG Beckmann JS Beilby JP Bergman RN Bergmann S Collins FS Cusi D den Heijer M Eiriksdottir G Gejman PV Hall AS Hamsten A Huikuri HV Iribarren C Kaumlhoumlnen M Kaprio J Kathiresan S Kiemeney L Kocher T Launer LJ Lehtimaumlki T Melander O Mosley TH Jr Musk AW Nieminen MS ODonnell CJ Ohlsson C Oostra B Palmer LJ Raitakari O Ridker PM Rioux JD Rissanen A Rivolta C Schunkert H Shuldiner AR Siscovick DS Stumvoll M Toumlnjes A Tuomilehto J van Ommen GJ Viikari J Heath AC Martin NG Montgomery GW Province MA Kayser M Arnold AM Atwood LD Boerwinkle E Chanock SJ Deloukas P Gieger C Groumlnberg H Hall P Hattersley AT Hengstenberg C Hoffman W Lathrop GM Salomaa V Schreiber S Uda M Waterworth D Wright AF Assimes TL Barroso I Hofman A Mohlke KL Boomsma DI Caulfield MJ Cupples LA Erdmann J Fox CS Gudnason V Gyllensten U Harris TB Hayes RB Jarvelin MR Mooser V Munroe PB Ouwehand WH Penninx BW Pramstaller PP Quertermous T Rudan I Samani NJ Spector TD Voumllzke H Watkins H Wilson JF Groop LC Haritunians T Hu FB Kaplan RC Metspalu A North KE Schlessinger D Wareham NJ Hunter DJ OConnell JR Strachan DP Wichmann HE Borecki IB van Duijn CM Schadt EE Thorsteinsdottir U Peltonen L Uitterlinden AG Visscher PM Chatterjee N Loos RJ Boehnke M McCarthy MI Ingelsson E Lindgren CM Abecasis GR Stefansson K Frayling TM Hirschhorn JN

Hundreds of variants clustered in genomic loci and biological pathways affect human height Lango Allen et alNature 2010 Oct 14467(7317)832-8

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

RISK SCORE METHOD

PROCAMFramingham Classical Risk factors

0

025

05

075

1

10 105 11 115 12 125 13 135

Risk Score

Pro

ba

bil

ity

no CHD CHD Set Specificity at

5 False Positive

in no-CAD

11 of men who get

CAD have baseline

score over cut-off

89 of the events that occurred over 10 years

would not be predicted by the score

Can we improve on this with genotypes

Whıch genes

to study

20

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

Genotype - smoking interactions

in risk score

Better than classical +

genotypes plt00001

Adding Environment-Genotype interactions

enhances (DOUBLES) risk prediction score

0

02

04

06

6 7 8 9 10 11 12

Risk score

pro

bab

ilit

y

no CHD CHD

EVEN BETTER

24 of cases

have score

over cut-off

5 FPR

Classical Risk factors + Genotypes + Smokıng

22

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

2001

Cui Y Wei QQ Park HK amp Lieber CM Nanowire nanosensors for highly sensitive and selective detection of biological and chemical species Science 293 1289ndash1292 (2001)

ldquoDevices based on nanowires are emerging as a powerful platform for the direct detection of biological and chemical species including low concentrations of proteins and virusesrdquo 1st July 2006 Analytic Chemistry

No

rma

lise

d

con

du

ctan

ce c

han

ge

Figure 18 | taken from E Stern JF Klemic DA Routenberg PN Wyrembak DB

Turner-Evans AD Hamilton DA LaVan TM Fahmy and MA Reed Label-free

immunodetection with CMOS-compatible semiconducting nanowires Nature 445

05498 (2007)

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

Born April 2014

Nanowire chip

DNA extraction

PCR

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

ldquoHandheldrdquo

Arrived from the engineers at A Star Singapore LAST WEEK

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

First cassettes Chloroquine resistant Malaria warfarin BRAF

tumour marker

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated

Summary

bull Identification of monogenic causes of cancer increase service pressure but are economical where prevention is possible

bull DNA sequencing is now cheap bull We face variant inundation bull Power to predict common disease

is over-estimated bull Point of care testing has a place for

drug sensitivity tumour testing and infectious diseases

bull Predictive power of gene testing in polygenic traits is overstated