the role of the rho gef arhgef2 in ras tumorigenesis · figure 1.6 crystal structure of the dh-ph...
TRANSCRIPT
The Role of the Rho GEF Arhgef2 in RAS
Tumorigenesis
by
Jane Cullis
A thesis submitted in conformity with the requirements
for the degree of Doctor of Philosophy
Graduate Department of Medical Biophysics
University of Toronto
© by Jane Cullis 2013
ii
The Role of Rho GEF Arhgef2 in RAS Tumorigenesis
Jane Cullis
Degree of Doctor of Philosophy, 2013
Graduate Department of Medical Biophysics, University of Toronto
Abstract
Tumorigenesis is driven by the sequential accumulation of genetic lesions within a cell, each
which confer the cell with traits that enable its abnormal growth. The result is a mass of
dysregulated cells, or tumor, which, upon further mutation, may spread, or metastasize, to other
organs of the body. The dissemination of tumor cells makes treatment difficult, and thus confers
cancer with its associated lethality. Over the past 30 years, the RAS genes have been critical in
teaching us the mechanisms underlying the molecular progression of cancer. RAS is mutated in
33% of all cancers and is often an early event in its stepwise progression1. As a result, the RAS
genes are widely accepted as ‘drivers’ or ‘initiators’ of human tumorigenesis. Unfortunately,
efforts directed at targeting RAS in the clinic have as of yet been unsuccessful. This has
triggered a need to identify genes that are required for RAS tumorigenesis that are
therapeutically tractable.
My research has focused on deciphering the potential role of the Rho GEF Arhgef2 in RAS-
mediated tumorigenesis. I have found that Arhgef2 is a bona fide transcriptional target of RAS
and is upregulated in human tumors harboring RAS mutations. Importantly, depletion of Arhgef2
in RAS-mutated cells inhibits their survival, proliferation, and tumor growth in murine models.
In search of the mechanism underlying the requirement of Arhgef2 in RAS tumorigenesis, I have
uncovered a novel function for Arhgef2 as a positive regulator of a central RAS pathway, the
iii
mitogen-activated protein kinase (MAPK) pathway. Thus, Arhgef2 is part of a positive feedback
loop in which RAS-dependent increases in Arhgef2 expression results in the amplification of
RAS signaling. Moreover, Arhgef2 confers tumor cells with properties favoring their malignant
conversion, thereby implicating Arhgef2 in the formation of metastases. Together, these studies
suggest that Arhgef2 plays an important role at multiple stages of tumorigenic progression and
may therefore be a promising therapeutic target in RAS-mutated tumors.
1Karnoub et al., 2008
iv
Acknowledgments
First and foremost, I would like to thank my amazing family for their unwavering support and
encouragement throughout my degree. My father, who not only inspires me with his science, but
whose compassion and sense of fun I admire and strive to emulate. My mother, one of the
strongest, most brilliant women I know: thank you for being not just a mother to me in the last 6
years but also one of my best friends. My brother Jepray, you have been a tremendous source of
comfort, positivity and wisdom and I thank you for always being there for me.
To my supervisor, Rob. You made it about more than science. You are the one who taught me
how to run marathons. You taught me that the work you put in is the work you get out; that
strength and endurance takes time and patience and cannot be forced; that the lows are worth the
highs; that there are no shortcuts; that it’s not how fast you can sprint but how well you can push
to the very end. Most importantly, you taught me never to give up until you’re there. Not many
people can teach such hard lessons while expressing so much love, compassion and
understanding, but you did. Thank you.
Thank you to my committee members, Jane and Dr. Medin. I appreciate the time you took to
oversee my project and improve my research with your excellent advice and encouragement.
Thank you to my dear collaborators, Nikolina Radulovich and Dr. Ming Tsao, for your help and
guidance with my animal and immunohistochemical studies.
Dedi. You gave meaning to the word ‘Dedidit’ and together, we did it . You are a remarkable
scientist but an even more amazing person and friend. Thank you for always putting things in
perspective and for making science fun.
Mauricio and Tim, my BFFs OMG. Mauricio, it is largely because of you that I was able to run
Rob’s marathons. Thank you for being a constant source of support and fun during the last six
years. You have made the difficult times bearable and the good times unbelievable.
To all the members of the Rottapel lab for putting up with me and all my Western blots. Thank
you for your encouragement and sense of humor – it is you guys that made coming to lab every
day worth it, successful experiment or not. Also, thank you to the ladies from the Kislinger lab,
v
especially Lusia, for either keeping me sane in the office or making the choice to go insane with
me.
To my training partners and running friends, the Angels. Thank you for constantly reminding me
that there’s more to life than the lab (and for inspiring me to run real marathons). Nic, DocZ,
MamaK and Jebs, thank you for your patience, wisdom and guidance in all aspects of life.
To the others along the way that have inspired and encouraged me – Delilah (a.k.a. Topicoolis)
and my beautiful cousin Sarika – you are two of the most important people in my life and it’s
been so comforting knowing you were always there for me. You have each helped me in such
different but crucial ways and I can’t thank you enough.
Finally, I absolutely have to thank Goose for keeping me going during the last six years. You
taught me to relax, gave me the energy to keep going and were always there when I needed you.
Cheers.
vi
Table of Contents
Abstract ........................................................................................................................................... ii
Acknowledgments.......................................................................................................................... iv
Table of Contents ........................................................................................................................... vi
List of Tables ................................................................................................................................. ix
List of Figures ................................................................................................................................. x
List of Appendices ........................................................................................................................ xii
Appendix 1: Microarray Analysis of PANC-1 and H-RASV12
-Transformed Fibroblast Cells
Harboring Stable Arhgef2 Knockdown..................................................................................... xii
List of Abbreviations and Symbols.............................................................................................. xiv
Chapter 1 ....................................................................................................................................... 1
Introduction ..................................................................................................................................... 1
1.1 The RAS superfamily of small GTPases .............................................................................. 1
1.2 The RAS subfamily ............................................................................................................... 4
1.3 The Rho subfamily ................................................................................................................ 9
1.4 Guanine nucleotide exchange factors .................................................................................. 14
1.5 Arhgef2................................................................................................................................ 19
Chapter 2 ..................................................................................................................................... 25
Arhgef2 Provides a Positive Feedback Loop Required for Signaling Through the Oncogenic
RAS Pathway ................................................................................................................................ 25
2.1 Abstract ............................................................................................................................... 25
2.2 Introduction ......................................................................................................................... 26
2.3 Experimental Procedures..................................................................................................... 29
2.4 Results ................................................................................................................................. 36
vii
2.4.1 Arhgef2 protein expression is acutely induced by the RAS/MAPK pathway .............. 36
2.4.2 ARHGEF2 is a transcriptional target of the RAS/MAPK pathway ............................. 38
2.4.3 Arhgef2 is required for cell survival downstream of oncogenic RAS ......................... 40
2.4.4 Arhgef2 contributes to RASV12
-mediated cellular transformation in vitro and in vivo 43
2.4.5 Arhgef2 contributes to the increased proliferative capacity of RASV12
-transformed
fibroblasts in a GEF-independent manner ............................................................................. 45
2.4.6 Arhgef2 is required for MAPK pathway activation in response to oncogenic RAS .... 46
2.4.7 Arhgef2 is a component of the KSR-1 complex and is required for the
dephosphorylation of its negative regulatory site on S392.................................................... 50
2.4.8 Arhgef2 is required for PP2A-mediated dephosphorylation of KSR-1 on S392 ......... 54
2.5 Discussion ........................................................................................................................... 57
Chapter 3 ..................................................................................................................................... 62
Arhgef2 is Required for Primary Tumorigenesis and Promotes Mesenchymal Transition in
Pancreatic Ductal Adenocarcinoma .............................................................................................. 62
3.1 Abstract ............................................................................................................................... 62
3.2 Introduction ......................................................................................................................... 63
3.3 Experimental Procedures..................................................................................................... 67
3.4 Results ................................................................................................................................. 73
3.4.1 ARHGEF2 is essential across several human epithelial cancer cell lines and its protein
expression is regulated by the RAS/MAPK pathway ............................................................ 73
3.4.2 Arhgef2 is required for PDAC tumor growth in vivo ................................................... 74
3.4.3 Arhgef2 expression correlates with advanced tumor grade in human lung, colorectal
and pancreatic cancer ............................................................................................................. 78
3.4.4 Arhgef2 expression alters gene signatures associated with epithelial differentiation
state ........................................................................................................................................ 79
3.4.5 Arhgef2 suppresses the epithelial cell phenotype in RAS-independent human
adenocarcinoma cell lines ...................................................................................................... 82
3.4.6 Arhgef2 is required for TGF-induced epithelial-to-mesenchymal-transition in a
mammary epithelial cell model ............................................................................................. 86
viii
3.5 Discussion ........................................................................................................................... 93
Chapter 4 ..................................................................................................................................... 99
Future Perspectives ....................................................................................................................... 99
4.1 Abstract ............................................................................................................................... 99
4.2 Experimental Procedures................................................................................................... 100
4.3 Future Perspectives ........................................................................................................... 102
4.3.1 The role of Arhgef2 in metastases .............................................................................. 102
4.3.2 The cooperation of Arhgef2 with mutant p53 ............................................................ 104
4.3.3 The regulation of Arhgef2 by anti-mitotic chemotherapeutic agents ......................... 110
4.3.4 Arhgef2 as a therapeutic target ................................................................................... 112
Concluding Remarks ................................................................................................................... 116
Appendix ..................................................................................................................................... 117
Appendix 1: Microarray analysis of PANC-1 and H-RASV12
-Transformed Fibroblast Cells
Harboring Stable Arhgef2 Knockdown................................................................................... 117
Table I Functional annotation clustering of upregulated genes in Arhgef2-depleted PANC-1
cells.......................................................................................................................................... 117
Table II Upregulated gene lists in Arhgef2-depleted PANC-1 cells by functional annotation118
Table III Functional annotation clustering of downregulated genes in Arhgef2-depleted
PANC-1 cells........................................................................................................................... 123
Table IV Downregulated gene lists in Arhgef2-depleted PANC-1 cells by functional
annotation ................................................................................................................................ 125
Table V Functional annotation clustering of Significance Analysis of Microarray (SAM) genes
downregulated in Arhgef2-depleted NIH 3T3-H-RasV12
cells ................................................ 128
Table VI Downregulated gene lists in Arhgef2-depleted NIH 3T3-H-RASV12
cells by
functional annotation ............................................................................................................... 131
References ................................................................................................................................... 133
ix
List of Tables
Table 2.1 Murine and Human Arhgef2 shRNA and GFP shRNA Sequences
Table 3.1 Gene Target Primer Sequences
Table 4.1 RAS/MAPK and p53 mutations in ARHGEF2-essential cell lines
x
List of Figures
Figure 1.1 The RAS superfamily of small GTPases
Figure 1.2 Small GTPase domain organization
Figure 1.3 The GTPase cycle
Figure 1.4 RAS isoform mutations in human cancer
Figure 1.5 RAS effector pathways
Figure 1.6 Crystal structure of the DH-PH domain of Dbl’s big sister (Dbs) in complex with
RhoA
Figure 1.7 The diversity in Rho GEF domain organization
Figure 1.8 The domain organization of Arhgef2
Figure 2.1 Arhgef2 protein expression is acutely induced by oncogenic RAS
Figure 2.1 Arhgef2 protein expression is acutely induced by oncogenic RAS
Figure 2.2 H-RASV12
-induced Arhgef2 upregulation is dependent on MAPK pathway activation
Figure 2.3 ARHGEF2 is a transcriptional target of the RAS/MAPK pathway
Figure 2.4 Arhgef2 is required for cell survival downstream of oncogenic RAS
Figure 2.5 Arhgef2 contributes to RASV12
-mediated cellular transformation in vitro and in vivo
Figure 2.6 Arhgef2 protein expression is regained in a subset of Arhgef2-knockdown xenografts
Figure 2.7 Arhgef2 contributes to the proliferative capacity of RASV12
-transformed fibroblasts in
a GEF-independent manner
Figure 2.8 Arhgef2 is required for MAPK pathway activation in response to oncogenic RAS
Figure 2.9 Arhgef2 is a component of the KSR-1 complex and is required for the
dephosphorylation of the negative regulatory site Ser392 on KSR-1
Figure 2.10 Arhgef2 is required for plasma membrane translocation of KSR-1
Figure 2.11 Arhgef2 is required for PP2A-mediated dephosphorylation of KSR-1 on S392
Figure 2.12 The Arhgef2/PP2A complex provides a positive feedback loop to the KSR/MAPK
pathway in RASV12
-transformed cells
Figure 3.1 Multistep tumorigenesis in pancreatic ductal adenocarcinoma
xi
Figure 3.2 ARHGEF2 is essential across several human epithelial cancer cell lines
Figure 3.3 ARHGEF2 protein expression is regulated by the RAS/MAPK pathway in human
epithelial cell lines
Figure 3.4 Arhgef2 is required for pancreatic tumor growth in vivo
Figure 3.5 Arhgef2 is required for KSR-1 S392 dephosphorylation, ERK1/2 phosphorylation and
proliferation in PDAC cells
Figure 3.6 Arhgef2 expression correlates with advanced tumor grade in human lung, colon and
pancreatic tissue microarrays
Figure 3.7 Arhgef2 suppresses the epithelial cell phenotype in human adenocarcinoma cell lines
Figure 3.8 TGF induces epithelial-to-mesenchymal-transition in a normal mammary gland
epithelial cell model
Figure 3.9 Arhgef2 is required for TGF-induced epithelial-to-mesenchymal-transition in
NMuMG cells
Figure 3.10 Arhgef2 may promote EMT via its cooperative regulation by RASV12
, p53 and TGF
signaling pathways
Figure 4.1 Arhgef2 is highly expressed in serous ovarian carcinoma
Figure 4.2 Arhgef2 is essential for survival in OVCAR5 cells
Figure 4.3 Arhgef2 gene expression correlates with essentiality in serous ovarian carcinoma
Figure 4.4 Arhgef2 expression in ovarian carcinoma cell lines
xii
List of Appendices
Appendix 1: Microarray Analysis of PANC-1 and H-RASV12-Transformed
Fibroblast Cells Harboring Stable Arhgef2 Knockdown
Table I Functional annotation clustering of upregulated genes in Arhgef2-depleted PANC-1 cells
I.A Biological Process
I.B Molecular Function
I.C KEGG Pathway
Table II Upregulated gene lists in Arhgef2-depleted PANC-1 cells by functional annotation
II.A Regulation of Apoptosis
II.B Biological Adhesion
II.C Cell Motion
II.D Cell Junction
II.E Focal Adhesion
II.F ECM-Receptor Interaction
Table III Functional annotation clustering of downregulated genes in Arhgef2-depleted PANC-1
cells
III.A Biological Process
III.B Cellular Component
III.C Molecular Function
III.D KEGG Pathway
Table IV Downregulated gene lists in Arhgef2-depleted PANC-1 cells by functional annotation
IV.A Mesenchymal Cell Development/Differentiation
IV.B Anti-Apoptosis
IV.C Cell Migration
IV.D Cytoskeleton
IV.E Focal Adhesion
Table V Functional annotation clustering of Significance Analysis of Microarray (SAM) genes
downregulated in Arhgef2-depleted NIH 3T3-H-RASV12
cells
V.A Biological Process
V.B Cellular Component
xiii
V.C Molecular Function
V.D KEGG Pathway
Table VI Downregulated gene lists in Arhgef2-depleted NIH 3T3-H-RASV12
cells by functional
annotation
VI.A Response to Wounding
VI.B Epithelial Cell Differentiation
VI.C Fibroblast Growth Factor Receptor Signaling Pathway
VI.D Cell-Matrix Adhesion
VI.E Adherens Junctions
VI.F Cell Junction
VI.G Tight Junction
xiv
List of Abbreviations and Symbols Amino Acids
Ala/A/Alanine; Arg/R/Arginine; Asn/N/Asparagine; Asp/D/Aspartic Acid; Cys/C/Cysteine;
Glu/E/Glutamic Acid; Gln/Q/Glutamine; Gly/G/Glycine; His/H/Histidine; Ile/I/Isoleucine;
Leu/L/Leucine; Lys/K/Lysine; Met/M/Methionine; Phe/F/Phenylalanine; Pro/P/Proline;
Ser/S/Serine; Thr/T/Threonine; Trp/W/Tryptophan; Tyr/Y/Tyrosine; Val/V/Valine
Symbols
Alpha
Beta
Gamma
Epsilon
Zeta
Eta
3.14 (pi)
m milli, 1x10-3
micro, 1x10-6
n nano, 1x10-9
°C degrees Celcius
g gram
L litre
M Molar
U Units
GENE names denoted by upper case lettering
Abbreviations
ADC Adenocarcinoma
ADH Atypical Ductal Hyperplasia
AF-6 ALL Fusion partner 6
AKAP A-Kinase Anchoring Protein
Akt Ak thymoma
ALL Acute Lymphoblastic Leukemia
ALN-VSP ALNylam Vascular endothelial growth factor kinesin Spindle Protein
AMCD Anti-Mitotic Chemotherapeutic Drug
AML Acute Myeloid Leukemia
APC Adenomatous Polyposis Coli
AR Androgen Receptor
ASEF APC-Stimulated guanine nucleotide Exchange Factor
ATCC American Type Culture Collection
ATF2 Activating Transcription Factor 2
ATP Adenosine TriPhosphate
xv
AurkA Aurora kinase A
AurkB Aurora kinase B
B Protein phosphatase 2A, 55kDa regulatory subunit
B’ Protein phosphatase 2A, 56kDa regulatory subunit, alpha isoform
B56 Protein phosphatase 2A, 56kDa regulatory subunit, alpha isoform
BAC Bacterial Artificial Chromosome
Bcl B cell lymphoma
Bcl-2 B cell lymphoma-2
Bcl-XL B cell lymphoma eXtra Large
BCR Breakpoint Cluster Region
BFA BreFeldin A
BLAST Basic Local Alignment Search Tool
BLAT BLAST-Like Alignment Tool
BrdU BromodeoxyUridine
BSA Bovine Serum Albumin
C-terminal Carboxy-terminal
C1 Zinc finger domain or cysteine rich domain
C3 Clostridium Botulinum 3
C57BL/6 C57 BLack 6
CalPhos Calcium Phosphate
CAAX Cysteine-Alanine-Alanine-X amino acid
CC Coiled Coil
Cdc Cell division cycle protein
Cdc42 Cell division control protein 42
Cdk Cyclin-dependent kinase
cDNA complementary DNA
C. elegans Caenorhabditis elegans
CH Calponin Homology
CIP Calf Intestinal Phosphatase
CML Chronic Myelogenous Leukemia
CMML Chronic MyeloMonocytic Leukemia
CMV CytoMegaloVirus
CMV-Cre CytoMegaloVirus Type I topoisomerase
CO2 Carbon dioxide (O2)
COMe CarbOxyMethylation
CR Cysteine Rich
cRNA complementary RiboNucleic Acid
CST Cell Signaling Technology
CT Cycle Threshold
D2O Deuterium Oxide (heavy water)
DAG DiAcylGlycerol
DAVID Database for Annotation, Visualization and Integrated Discovery
DBL Diffuse B-cell Lymphoma
Dbs Diffuse B-cell Lymphoma’s big sister
DH Dbl Homology
DMEM Dulbecco’s Modified Eagles Medium
xvi
DMSO DiMethylSulfOxide
DNA DeoxyriboNucleic Acid
DOCK Dedicator Of CytoKinesis
dsDNA double stranded DeoxyriboNucleic Acid
DTT DithioThreiTol
E14K Adenovirus type 2 Early protein, 14KDa
ECAD E-CADherin
ECM ExtraCellular Matrix
ECT2 Epithelial Cell Transforming sequence 2
EDTA EthyleneDiamineTetraacetic Acid
eGFP enhanced Green Fluorescent Protein
EGF Epidermal Growth Factor
EMT Epithelial-to-Mesenchymal-Transition
EPEC EnteroPathogenic Escherichia Coli
ER Endoplasmic Reticulum
ER Estrogen Receptor
ERBB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2
ERK Extracellular signal-Regulated Kinase
ES Embryonic Stem
FBS Fetal Bovine Serum
FPKM Fragments Per Kilobase of exon per Million fragments mapped
FRET Fluorescence Resonance Energy Transfer
FTase Farnesyl Transferase
FTI Farnesyl Transferase Inhibitor
G418 Geneticin/Neomycin
GAP GTPase Activating Protein
GARP Gene Activity Rank Profile
GDI Guanine nucleotide Dissociation Inhibitor
G domain GDP/GTP binding domain
GDP Guanosine DiPhosphate
GDS Guanine nucleotide Dissociation Stimulator
GEF Guanine nucleotide Exchange Factor
GEF-H1 Guanine nucleotide Exchange Factor-H1
GOF Gain Of Function
GPCR G Protein Coupled Receptor
GRB2 Growth factor Receptor-Bound protein 2
GTP Guanosine TriPhosphate
GTPase Guanosine TriPhosphatase
GGTase GeranylGeranyl Transferase
H2O Hydrogen DiOxide (water)
H3K4me3 Histone 3 Lysine 4 trimethylation
HBSS Hank’s Buffered Saline Solution
HCC HepatoCellular Carcinoma
HEK Human Embryonic Kidney 293
HEPES 4-(2-HydroxyEthyl)-1-PiperazineEthaneSulfonic acid
hPTTG1 human Pituitary Transforming Gene 1
xvii
H-RAS Harvey RAt Sarcoma
HRP HorseRadish Peroxidase
Hsc70 Heat shock cognate protein 70
Hsp90 Heat shock protein 90
HSQC Heteronuclear Single Quantum Coherence
HV HyperVariable region
ICMT1 IsoprenylCysteine O-MethylTransferase 1
IF ImmunoFluorescence
IgG Immunoglobulin G
IHC ImmunoHistoChemistry
IKK I appa-B Kinase
IP ImmunoPrecipitate
kDa kiloDalton
i.v. intravenous
JNK c-Jun N-terminal Kinase
Kb Kilobase
KEGG Kyoto Encyclopedia of Genes and Genomes
K-RAS Kirsten RAt Sarcoma
K-RAS4A Kirsten RAt Sarcoma, isoform 4A
K-RAS4B Kirsten RAt Sarcoma, isoform 4B
KSP Kinesin Spindle Protein
KSR-1 Kinase Suppressor of RAS-1
KO KnockOut
LARG Leukemia Associated Rho GEF
LBC Lymphoid Blast Crisis
LCUC Large Cell Undifferentiated Carcinoma of the lung
LFC LBC’s First Cousin
LNP Lipid NanoParticle
loxP lox sequence derived from bacteriophage P1
LPA Lysophosphatidic Acid
LSC LBC’s Second Cousin
LY LY294002
MAP Microtubule Associated Protein
MAPK Mitogen Activated Protein Kinase
MAPKK Mitogen Activated Protein Kinase Kinase
MAPKKK Mitogen Activated Protein Kinase Kinase Kinase
MDR-1 MultiDrug Resistance-1
MEF Murine Embryonic Fibroblast
MEK Mitogen activated protein kinase ERK Kinase
Mg+2
Magnesium
MgCl2 Magnesium Chloride
MLL Mixed Lineage Leukemia
mRNA messenger RiboNucleic Acid
Myc MyeloCytomatosis
mTOR mammalian Target of Rapamycin
N-RAS Neuroblastoma RAt Sarcoma
xviii
N-terminal amino-terminal
NaCl sodium (Na) Chloride
NaF sodium (Na) Fluoride
Na3VO4 sodium (Na) orthovanadate (VO4)
NET1 NeuroEpithelial cell Transforming 1
NF-1 GAP NeuroFibromatosis-1 GTPase Activating Factor
NFB Nuclear Factor kappa () B
NIH National Institute of Health
NMR Nuclear Magnetic Resonance
NMuMG Normal Murine Mammary Gland
NSCLC Non Small-Cell Lung Cancer
OC Ovarian Carcinoma
OCT Optimal Cutting Temperature
OHT Hydroxy Tamoxifen
OVCAR OVarian CARcinoma
p120RASGAPRAS GTPase activating protein, 120kDa
p190RhoGAP Ras HOmology GTPase Activating Protein, 190kDa
p21 cyclin-dependent kinase inhibitor 1
p27 cyclin-dependent kinase inhibitor 1b
PAK P21 Activated Kinase
PanIN Pancreatic Intraepithelial Neoplasia
PBD P-21 Activated Kinase Binding Domain
PBS Phosphate Buffered Saline
PBST Phosphate Buffered Saline Tween
PCR Polymerase Chain Reaction
PD PD98059
PDAC Pancreatic Ductal AdenoCarcinoma
PDGF Platelet-Derived Growth Factor
PDZ Postsynaptic density protein (PSD95), Drosophila disc large tumor suppressor
(Dgl1), Zona Occludens protein-1 (ZO-1)
PH Pleckstrin Homology
Pi inorganic Phosphate
PI3K PhosphoInositide 3-Kinase
PIP PhosphatidylInositol Phosphate
PKA Protein Kinase A
PKB Protein Kinase B
PKC Protein Kinase C
PLC PhosphoLipase C
PMSF PhenylMethaneSulphonylFluoride
PP2A Protein Phosphatase 2A
PP2Ac Protein Phosphatase 2A catalytic subunit
PPP2R2A Protein Phosphatase 2A, 55kDa Regulatory subunit, alpha isoform
PPP2R5A Protein Phosphatase 2A, 56kDa Regulatory subunit, alpha isoform
PPP2R5B Protein Phosphatase 2A, 56kDa Regulatory subunit, beta isoform
PPP2R5E Protein Phosphatase 2A, 56kDa Regulatory subunit, eta isoform
PR55 Protein phosphatase 2A, 55kDa regulatory subunit
xix
PR65 Protein phosphatase 2A, 56kDa regulatory subunit, alpha isoform
P-REX Phosphatidylinositol 3,4,5-triphosphate-dependent Rac nucleotide Exchanger
pS phosphoSerine
PSA Prostate Specific Antigen
pT phosphoThreonine
PTase PalmitoylTransferase
PTEN Phosphatase and TENsin homolog
PVDF PolyVinyliDene Fluoride
qPCR quantitative Polymerase Chain Reaction
R2 Protein phosphatase 2A, 55kDa regulatory subunit
R5 Protein phosphatase 2A, 56kDa regulatory subunit, alpha isoform
Rac RAS-relAted C3 botulinum toxin substrate
RacGEF RAS-relAted C3 botulinum toxin substrate Guanine nucleotide Exchange Factor
RAS RAt Sarcoma
RASGEF RAt Sarcoma Guanine nucleotide Exchange Factor
RASGRF RAS Guanosine Releasing Factor
RASSF RAS ASSociation domain Family
RBD Rhotekin Binding Domain
RCE1 RAS-Converting Enzyme 1
RGS Regulator of G protein Signaling
Rho RAS homology
RhoA RAS homology, member A
RhoB RAS homology, member B
RhoC RAS homology, member C
RhoE RAS homology, member E
RhoGDI RAS homology Guanine nucleotide Dissociation Inhibitor
RhoGEF RAS homology Guanine nucleotide Exchange Factor
RIN-1 RAS and Rab INteractor – 1
RNA RiboNucleic Acid
RNAi RNA interference
RNASeq RiboNucleic Acid whole transcriptome shotgun Sequencing
ROCK RhO-associated Kinase
RPMI Roswell Park Memorial Institute medium
RTK Receptor Tyrosine Kinase
SAM Significance Analysis of Microarrays
SAP-1 Serum Response Factor Accessory Protein-1
SCID Severe Combined ImmunoDeficiency
SD Standard Deviation
SDS-PAGE Sodium Dodecyl Sulfate-PolyAcrylamide Gel Electrophoresis
SE Standard Error
Ser/Thr Serine/Threonine
SH2 Src Homology 2
SH3 Src Homology 3
shARP small hairpin Activity Ranking Profile
shGEF small hairpin against ArhGEF2
shGFP small hairpin against Green Fluorescent Protein
xx
shRNA small hairpin RiboNucleic Acid
SI Switch I
SII Switch II
siRNA small interfering RiboNucleic Acid
SMD1 Small nuclear ribonucleoprotein 1
SOC Serous Ovarian Carcinoma
SOS Son Of Sevenless
SQ SQuamous
SRC SaRComa
SRF Serum Response Factor
STRN3 Striatin, calmodulin binding protein 3 (Protein Phosphatase 2A B’’’ subunit)
TBK1 Tank-Binding Kinase 1
TBS-T Tris-Buffered Saline Tween
TCEP Tris[2-CarboxyEthyl]Phosphine
Tctex-1 T-complex testis-specific protein-1
TGF Transforming Growth Factor beta
TGH Toronto General Hospital
TIAM1 T-cell lymphoma Invasion and Metastasis-Inducing 1
TMA Tumor MicroArray
TNF Tumor Necrosis Factor alpha
TRC The Ribonucleic acid i Consortium
TRIO TRIple Functional dOmain protein
TrkBT1 Tyrosine-related kinase B Truncated I
Tris Tris(hydroxymethyl)aminomethane
TSS Transcription Start Site
UO UO126
UTR UnTranslated Region
VEGF Vascular Endothelial Growth Factor
VIM VIMentin
vs versus
VSV-g Vesicular Stomatitis Virus-glycoprotein
Waf1 Wild-type p53 activated fragment 1
WB Western Blot
WCL Whole Cell Lysate
WT Wild Type
ZEB-1 Zinc finger E-Box-binding homeobox 1
ZO Zona Occludens
ZONAB ZONa occludens Associated Y Box factor
1
Chapter 1
Introduction
1.1 The RAS superfamily of small GTPases
The RAS GTPases are pleiotropic signaling molecules that regulate most core biochemical
processes in the cell. They are binary switches that cycle between an inactive, GDP-bound state
and an active, GTP-bound state and function as signaling nodes, linking multiple extracellular
stimuli to a wide range of intracellular signaling pathways (Vetter and Wittinghofer, 2001). The
RAS superfamily comprises 156 members in humans that are divided into five main families
based on their sequence and functional similarities: RAS, Rho, Arf, Ran, and Rab (Figure 1.1).
Figure 1.1 The RAS superfamily of small GTPases. The RAS superfamily consists of 156 members in mammals,
divided into Arf (27 members), Rab (61 members), Rho (22 members), RAS (36 members) and Ran (1 member)
families.
The RAS family forms the phylogenetic root of the superfamily and regulates diverse cellular
processes including cell proliferation, differentiation, morphology and survival (Karnoub and
Weinberg, 2008). The Rho family is predominantly involved in the regulation of the actin
cytoskeleton, thereby affecting cell morphology, polarity and migration, and also influences gene
transcription and cell cycle progression (Heasman and Ridley, 2008). The Rab and Arf families
2
mainly participate in vesicular cargo trafficking, endocytosis and secretory pathways, however
Arf GTPases are distinguished by an additional functional role on microtubules (Zerial and
McBride, 2001, Wennerberg et al., 2005). The Ran family is primarily involved in nuclear
transport but can also regulate mitotic spindle organization (Clarke et al., 2008).
While functionally diverse, the RAS superfamily members display highly conserved GDP/GTP
binding domains, or G domains, which underly their structural similarities and common
biochemical properties (Bourne et al., 1991). The G domain is composed of five consensus
sequence elements involved in binding phosphate and magnesium or guanine. The GDP/GTP
switch mechanism involves a guanine nucleotide-dependent conformational change in two of the
G domain sequence elements known as switch I and switch II (Figure 1.2). The interaction with
GTP results in a shift in the switch I domain to a position favouring the binding of effector
molecules, thereby enabling the activation of downstream signaling pathways (Bishop and Hall,
2000).
Figure 1.2 Small GTPase domain organization. The RAS GTPases exhibit highly conserved G domains that are
involved in GTP binding and hydrolysis. The G domain is defined by five consensus sequence elements involved in
binding phosphate/Mg2+
(PM) or guanine (G). The switch I (SI) and switch II (SII) regions are critical for GDP/GTP
exchange and subsequent effector binding. RAS family members diverge in their C-terminal tails, with RAS and
Rho proteins containing hypervariable (HV) regions that dictate their posttranslational modifications. These include
prenylation (P), farnestylation (F) and geranylation (G) and subsequent carboxymethylation (C-OMe). The Rab
family is commonly modified by geranylation at its C-terminus, while Arf can be myristoylated at its N-terminus to
facilitate membrane interactions. Ran is not posttranslationally modified but contains a C-terminal extension
required for its activity. The Rho GTPases are distinguished by a 13 amino acid insert within the G domain that is
involved in its interaction with effectors (adapted from Vigil et al., 2010).
While small GTPases display high affinity for GDP and GTP, they exhibit low intrinsic GTP
hydrolysis and inefficient GDP/GTP exchange activities (Bernards and Settleman, 2004). The
GDP/GTP switch is determined by two main classes of regulating proteins; guanine nucleotide
3
exchange factors (GEFs), which catalyze the exchange of GDP for GTP, and GTPase activating
proteins (GAPs), which promote the intrinsic hydrolysis of GTP (Schmidt and Hall, 2002)
(Figure 1.3). The Rho and Rab families are subject to a third class of regulatory proteins known
as Rho guanine nucleotide dissociation inhibitors (RhoGDIs), which sequester GDP-bound
GTPases in the cytoplasm by masking their lipid membrane-targeting moieties (Olofsson, B,
1999). While the mechanism of action of GEFs, GAPs and GDIs is preserved within each
respective class, they display both distinct and shared selectivity for GTPases within each RAS
family. This specificity in regulation, combined with the pleiotropy in effectors activated by the
GTPases themselves, contributes to their diversity in cellular effects.
Figure 1.3 The GTPase cycle. RAS GTPases cycle between an active, GTP-bound state and an inactive, GDP-
bound state. GTPase-activating proteins (GAPs) stimulate their intrinsic hydrolysis of GTP, while guanine
nucleotide exchange factors (GEFs) catalyze the exchange of GDP for GTP. Guanine nucleotide dissociation
inhibitors (GDIs) act on the Rho and Rab families of RAS GTPases and sequester them in their GDP-bound state.
RAS-GTP can bind to its downstream effectors and influence a diverse array of biological processes, including cell
proliferation, survival, differentiation, morphogenesis, motility, migration, polarity, gene transcription, vesicle
trafficking, nuclear transport, endocytosis and microtubule dynamics.
4
1.2 The RAS subfamily
The Ras sarcoma (RAS) family of proteins constitute the founding members of the RAS
superfamily. They have been the subject of intense study since their discovery in the 1980s due
to their high frequency of mutations in human tumors (Bos et al., 1989). The H- and K-RAS
genes were first identified in rat cells as retrovirally-transduced oncogenes derived from Harvey
and Kirsten sarcoma viruses, respectively, and homologous forms in mouse and human were
isolated soon after (DeFeo et al., 1981, Ellis et al., 1982, Chang et al., 1982). Mutant forms of H-
and K-RAS were subsequently found in many human cancer cell lines, including those of the
bladder, colon and lung (Parada et al., 1982, Der et al., 1982, McBride et al., 1982). Sequencing
analysis revealed that the oncogenic forms of H- and K-RAS commonly harbored single point
mutations in codon 12, with mutations in codons 13 and 61 less frequently found (Reddy et al.,
1982, Taparowsky et al., 1982). A third RAS family member, N-RAS, was isolated in a
neuroblastoma cell line and found to contain parallel mutations in codon 12 in human tumors
(Hall et al., 1983, Brown et al., 1984).
Localized point mutations in codon 12 of the RAS genes predominantly results in the
substitution of a Glycine (G) for a Valine (V) or Aspartic acid (D) and the constitutive activation
of the GTPase (Tabin et al., 1982). Research performed in the McCormick laboratory revealed
that the active mutants exhibited a three hundred-fold lower GTPase activity compared to their
wild-type counterparts, thereby locking them in a GTP-bound state (Clark et al., 1985, Trahey et
al., 1987). The oncogenic capacity of RASV12/D12
mutants was demonstrated in focus-forming
assays in murine and rodent cells, which underwent morphological transformation in response to
their overexpression with cooperating oncogenes (Land et al., 1983, Newbold et al., 1983, Ruley
et al., 1983). The physiological significance of RASV12/D12
mutations was appreciated when they
were found endogenously in experimental models of carcinogenesis, with H-RASV12
identified in
carcinogen-induced mammary and skin tumors, N-RASD12
in thymomas and K-RASD12
in mice
exposed to ionizing radiation (Sukumar et al., 1983, Balmain et al., 1983, Guerrero et al., 1984a
and b). The most compelling evidence for the role of the RAS genes in human tumorigenesis,
however, came from the observation that identical mutations were found in human tumor
specimens. Moreover, specific RAS genes were associated with different tumor types: mutant K-
RAS was most often identified in pancreatic, colorectal and lung cancers, H-RAS in bladder
5
carcinomas and N-RAS in lymphoid malignancies and melanomas (Santos et al., 1984, Hirai et
al., 1985, Hand et al., 1984, Fujita et al., 1984, Gambke et al., 1984, Bos et al., 1985, Padua et
al., 1985). Together, these early studies unveiled the potential significance of mutant RAS in the
development of human malignancies.
Since then, oncogenic RAS mutations have been found in 33% of all human tumors and have
been shown to play a driving role in tumor initiation, maintenance and malignant conversion
(Karnoub et al., 2008). K-RAS is the most frequently mutated RAS gene and is most commonly
found in pancreatic ductal adenocarcinoma (PDAC), colorectal tumors, and non-small cell lung
carcinomas (NSCLC) (Parwani et al., 2003, Johnson et al., 1993, Rodrigues et al., 1990) (Figure
1.4). Oncogenic K-RAS is required at multiple stages of tumorigenic progression, as the
induction or ablation of K-RASD12
in the pancreas of transgenic mouse models results in the
initiation or regression of established tumors, respectively (Klimstra et al., 1994, Grippo et al.,
2003, Collins et al., 2012). Studies performed in K-RAS-mutant pancreatic and lung cancer cell
lines has revealed that K-RAS dependency is intimately linked to epithelial differentiation state,
as K-RAS-mutant cells retaining an epitheloid gene signature selectively require K-RAS for cell
viability (Singh et al., 2009). These findings suggest that epithelial-to-mesenchymal transition
subverts the requirement of K-RAS for its oncogenic potential, possibly due to the acquisition of
additional mutations or a shift in oncogenic gene dependencies. Further evidence supporting the
role of K-RAS in tumor initiation comes from the identification of K-RAS mutations in pre-
neoplastic lesions (Klimstra et al., 1994, Tada et al., 1996). Moreover, siRNA depletion of
oncogenic K-RAS reduces the growth and metastases of PDAC xenograft models (Zhu et al.,
2006, Fleming et al., 2005). A similar paradigm of early K-RAS oncogene activation and
malignant promotion has been observed in colorectal cancer and NSCLC (Vogelstein et al.,
1988, van Etten et al., 2002, Westra et al., 1996, Wang et al., 2006). N-RAS mutations, while not
as widespread as K-RAS mutations, occur with high frequency in hematologic malignancies and
correlate with poor prognosis (Neri et al., 1988, Lubbert et al., 1990) (Figure 1.4). Moreover, N-
RAS has been shown to drive the initiation and propagation of tumorigenesis in several
malignant myeloid subtypes (Padua et al., 1988, Byrne et al., 1998, Shen et al., 2011,
Auewarakul et al., 2006, Emanuel, PD, 2008). By distinction, H-RAS is rarely mutated in human
tumors, although cases with alterations in this factor have been found in bladder, kidney, thyroid
and breast cancers (Adjei et al., 2001) (Figure 1.4).
6
Figure 1.4 RAS isoform mutations in human cancer. K-RAS, N-RAS and H-RAS mutations account for 86%,
11% and 3% of total RAS mutations in human cancers, respectively (Downward, J, 2003). K-RAS mutations are
most commonly found in PDAC (>95%), colorectal (>50%) and NSCLC (>30%), while N-RAS is frequently
mutated in hematologic malignancies, including 20% of acute lymphoblastic leukemias (ALL), 30% of acute
myeloid leukemias (AML) and 60% of chronic myelomonocytic leukemias (CMML).
In order to be active, both wild-type and mutant forms of RAS must be anchored to the plasma
membrane. This is achieved through post-translational modifications in their hypervariable (HV)
C-terminii (Figure 1.2). These domains contain a CAAX membrane targeting sequence that is
farnesylated by the enzyme farnesyltransferase (FTase) (Schaber et al., 1990). RAS is
subsequently transported to the endoplasmic reticulum (ER) where the RAS-converting enzyme
1 (RCE1) recognizes the CAAX motif and cleaves the –AAX sequence, allowing for
isoprenylcysteine carboxymethyltransferase 1 (ICMT1) to carboxymethylate the final Cysteine
residue (Choy et al., 1999). The K-RAS-4B isoform contains a stretch of lysines that allow its
direct interaction with the plasma membrane, while H-, N- and K-RAS-4A must be
palmitoylated by palmitoyltransferase (PTase) in order to stabilize this interaction (Hancock et
al., 1990). K-RAS-4A and N-RAS may also undergo prenylation by geranylgeranyl transferase
(GGTase) in order to secure their association with the plasma membrane (Wright et al., 2006).
These numerous posttranslational processes provide the biochemical basis for why the first
chemotherapeutic inhibitors of the RAS GTPases, farnestyltransferase inhibitors (FTIs), were
ultimately ineffective. Although they efficiently prevented the farnestylation reaction, K-RAS
could undergo alternative prenylation reactions that rescued its plasma membrane localization
and oncogenic capacity (Whyte et al., 1997, Lobell et al., 2001).
7
Once at the membrane, wild-type RAS can be activated by a number of upstream regulators,
including receptor tyrosine kinases (RTKs), G-protein coupled receptors (GPCRs), integrins and
immune receptors. Activation of RAS was first described in response to epidermal growth-factor
(EGF) and was found to be a critical mediator of serum-induced mitogenic responses in murine
fibroblasts (Kamata et al., 1984, Mulcahy et al., 1985). Later it was found that membrane-
associated receptors initiated the GTP-loading of RAS by activating their respective GEFs,
including SOS1, SOS2 and RASGRF, or inactivating GAPs, such as p120RASGAP and NF1
GAP, via receptor-associated cytoplasmic proteins like growth factor receptor-bound protein-2
(Grb2) (Molloy et al., 1989, Xu et al., 1990, West et al., 1990, Gale et al., 1993, Li et al., 1993).
Once activated, the RAS GTPases bind a large number of effector molecules and elicit diverse
biological signals regulating gene transcription, cell proliferation, differentiation and survival.
The most thoroughly studied effectors of RAS include Raf, phosphatidyl inositol-3 kinase
(PI3K) and Ral-guanine nucleotide dissociation stimulators (Ral-GDS) (Figure 1.5). The
Serine/Threonine (Ser/Thr) kinase Raf was the first RAS effector identified and was established
as a critical mediator of RAS-induced mitogenic changes (Moodie et al., 1993, Warne et al.,
1993, Zhang et al., 1993, Vojtek et al., 1993). Raf signals through a kinase cascade involving the
sequential phosphorylation and activation of mitogen-activated extracellular signal-regulated
kinase (MEK1/2 or MAPKK) and extracellular signal-regulated kinase (ERK1/2 or MAPK).
Phosphorylation of ERK1/2 can result in the initiation of transcription via its nuclear
translocation, or signal transduction via the phosphorylation of its cytoplasmic targets (Leevers
and Marshall, 1992). The importance of the Raf/MAPK pathway was first observed when it was
found that Raf activation was critical for cellular transformation induced by oncogenic RAS
(Khosravi-Far et al., 1995). Overexpression of active Raf was also sufficient to induce
transformation in murine fibroblasts (White et al., 1995). Over the years the importance of the
MAPK pathway in RAS tumorigenesis has become increasingly clear, as MEK activity is
required for tumor growth in RAS-mutated pancreatic, colorectal, lung and breast tumors
(Engelman et al., 2008, Hoeflich et al., 2009). The identification of mutually exclusive B-Raf
and RAS mutations in human tumors has also emphasized the significance of aberrant
Raf/MAPK signaling in human oncogenesis (Rajagopalan et al., 2002).
8
Figure 1.5 RAS effector pathways. RAS has a number of known effectors, the best studied of which are PI3K,
PLC, Raf, TIAM1 and RalGDS. PI3K catalyzes the phosphorylation of phosphatidylinositol (4,5)-bisphosphate
(PIP2) to its (3,4,5)-triphosphate form (PIP3), which can activate AKT/PKB to mediate cell survival and protein
synthesis through IKK/NF-B and mTOR/S6K pathways, respectively. Phospholipase C epsilon (PLC) cleaves
PIP2 to generate diacylglycerol (DAG), which can activate protein kinase C (PKC). TIAM1 and Ral-GDS are Rac
and Ral GEFs, respectively, that can activate p21 activated kinases (PAKs) and tank-binding kinase 1 (TBK1). Each
of these effectors is required for full transformation downstream of oncogenic RAS. The central arm of the RAS
pathway is the mitogenic Raf/MEK/ERK cascade, which is a main determinant of RAS transformation.
Shortly after the characterization of the RAS/MAPK cascade, the PI3K and Ral-GDS RAS
effectors were identified (Rodriguez-Viciana et al., 1994, Hofer et al., 1994). PI3K activity was
shown to be required for RAS transformation in NIH 3T3 cells via its anti-apoptotic effects,
mediated by the Ser/Thr kinase AKT/protein kinase B (PKB) and the transcription factor nuclear
factor-kappa B (NF-B), both of which are potent regulators of cell survival (Rodriguez-Viciana
et al., 1997, Marte et al., 1997, Mayo et al., 1997). AKT can activate NF-B by inactivating its
inhibitor IKK through direct and mammalian target of rapamycin (mTOR)-dependent
9
phosphorylation (Ozes et al., 1999, Dan et al., 2008). However, NF-B can also be activated by
Raf and Ral-GDS-induced IKK phosphorylation in response to oncogenic RAS, thereby
increasing the complexity of the requirement for NF-B in RAS-mediated cellular
transformation (Norris et al., 1999). Like Raf, PI3K is critical for tumorigenesis in several RAS-
mutant human tumors, and together they are thought to be the principal contributors to the RAS-
transformed phenotype (Campbell et al., 2007, Engelman et al., 2008, Hoeflich et al., 2009). This
is supported by recent studies showing synergism in the anti-tumor effects exerted by the
combination of MEK and PI3K inhibitors in human PDAC, lung, colorectal and breast cancers
(Campbell et al., 2007, Engelman et al., 2008, Yu et al., 2008, Hoeflich et al., 2009 and 2012).
The Ral-GDS proteins, GEFs for RalA and RalB GTPases, contribute to RAS tumorigenesis in
human epithelial cell line models and are required for H-RAS-induced skin tumor formation
(White et al., 1996, Urano et al., 1996, Gonzalez-Garcia et al., 2005). Many other RAS effectors
shown to play functionally important roles downstream of oncogenic RAS include phospholipase
C (PLC), T-cell lymphoma invasion and metastasis-1 (TIAM1), Ras interaction/interference
protein-1 (RIN1), ALL (acute lymphoblastic leukaemia)-1 fused gene on chromosome 6 (AF-6)
and the RAS association domain-containing family (RASSF) proteins (Kelley et al., 2001,
Lambert et al., 2002, Kuriyama et al., 1996, Han et al., 1995) (Figure 1.5). The large number of
identified targets that contribute to RAS-mediated cellular transformation in vitro and in vivo has
led to the paradigm that many downstream effectors of RAS cooperate to induce a fully
transformed phenotype.
1.3 The Rho subfamily
The Rho GTPases are critical modulators of cell morphology and motility through their
regulation of the actin cytoskeleton. The Rho family is comprised of 22 members in humans and
includes Rho (A, B and C isoforms), Rac (1, 2 and 3 isoforms), Cdc42 (G25K and Cdc42Hs
isoforms), RhoD, RhoG, TC10, Rnd (1, 3 and 6 isoforms) and TTF (Wennerberg et al., 2005).
The best studied members include Rho, Rac, and Cdc42, which were identified by their abilities
to generate distinct actin structures in fibroblast cells. Activation of Rho by lysophosphatidic
acid (LPA) in serum-starved Swiss 3T3 fibroblasts resulted in the formation of long, parallel
10
bundles of polymerized actin known as stress fibres (Nobes and Hall, 1992). By distinction,
platelet-derived growth factor (PDGF) or EGF stimulation of Rac was observed to promote
actin-based membrane ruffling and lamellipodia formation at the cell periphery (Nobes and Hall,
1995). Activation of Cdc42 by the GPCR agonist bradykinin, in turn, produced finger-like
projections at the front edge of the cell known as filopodia (Kozma et al., 1995). Rho, Rac, and
Cdc42 also regulate the formation of focal adhesion complexes, which mediate cell-ECM
interactions and function as signaling hubs, connecting extracellular signals to the intracellular
space (Nobes and Hall, 1995, Hotchin and Hall, 1995). Together, these effects cooperate to
control many actin-based processes including cell motility, cell migration, cytokinesis,
phagocytosis, pinocytosis, morphogenesis and axon guidance (Nobes and Hall, 1999,
Prokopenko et al., 2000, Cox et al., 1997, Settleman, J, 1999, Luo et al., 1997). Rho GTPase
activation has been established as a critical requirement for growth factor-mediated cell
migration in fibroblast and epithelial cells (Takahashi et al., 1993 and 1995, Ridley et al., 1995).
Moreover, inhibition of Rho GTPases using the C3 toxin from Clostridium botulinum or
dominant negative mutants prevents the migration and invasion of tumor cells (Yoshioka et al.,
1995, Verschueren et al., 1997, Habets et al., 1994, Keely et al., 1997). Like the RAS GTPases,
these early studies were clear indicators of the potential role of Rho GTPases in tumor
progression.
The Rho family exhibits important actin-independent functions, including the regulation of gene
expression and cell proliferation. Rac1 and Cdc42, and in some cell types RhoA, can activate the
c-jun N-terminal kinase (JNK) and p38 MAPKs, which activate ATF-2 and Jun transcription
factors (Coso et al., 1995, Minden et al., 1995, Bagrodia et al., 1995a). RhoA, Rac1 and Cdc42
also activate the serum response factor (SRF) and NF-B transcription factors (Hill et al., 1995,
Perona et al., 1997). Rho GTPases regulate the transcription of a diverse collection of genes,
including those involved in cell cycle progression, apoptosis, cytoskeletal components and the
inflammatory response. The role of Rho GTPases in cell-cycle progression was established early
on with the elucidation that RhoA, Rac1 and Cdc42 are all required for progression through the
G1 phase of the cell-cycle in response to serum stimulation (Yamamoto et al., 1993). C3
treatment of Swiss 3T3 fibroblasts results in the accumulation of cells in G1 and an inhibition of
cell growth (Yamamoto et al., 1993). In support of these findings, microinjection of
constitutively active mutants of RAS, RhoA, Rac1 and Cdc42 causes G1 progression and
11
stimulation of DNA synthesis in quiescent 3T3 cells, which can be blocked by co-expression of
their respective dominant-negative mutants (Olson et al., 1995). The effects of Rho proteins on
cell proliferation can largely be attributed to gene expression changes in cell cycle-associated
genes including several cyclins (cyclin A, cyclin B1, cyclin D1, cyclin E, cyclin F and cyclin G),
cell division cycle (cdc) proteins (cdc20, cdc25c, cdc2a, cdc34 and cdc7), the mitotic spindle
regulators Aurora kinase A and B (AurkA and AurkB) and the cell cycle inhibitor p21
(Berenjeno et al., 2007, DeGregori et al., 1995, Westwick et al., 1997, Sahai et al., 2001, Hirai et
al., 1997). Transcriptional profiling of cells transformed by oncogenic forms of Rho GTPases
(RhoAQ63L
, RhoBQ63L
and RhoCQ63L
) revealed that they induce gene expression changes
associated with four main transcription factor networks: c-myc, E2F1, p53 and c-Jun (Berenjeno
et al., 2007). Although all of c-myc, E2F1 and c-Jun are all required for RhoQ63L
-mediated
cellular transformation, c-Jun and E2F1 are uniquely required to regulate the expression of genes
associated with cell proliferation, while c-myc regulates the expression of genes involved in
RhoQ63L
-dependent loss of contact inhibition (Berenjeno et al., 2007).
Mirroring the RAS GTPases, the Rho family is strongly implicated in cellular transformation.
Early evidence of this came from the observation that overexpression of constitutively active
RhoA, Rac1 and Cdc42 could induce morphological transformation of murine and rodent cells
(Qiu et al., 1995a and b, Khosravi-Far et al., 1995, Prendergast et al., 1995, Qiu et al., 1997). In
contrast to RAS, however, constitutively activated mutants of Rho have not been identified in
human tumors to date (Moscow et al., 1994, Rihet et al., 2001). A more common phenomenon
involves the overexpression of Rho family members or aberrant expression or activation of one
of their regulators. For example, Rho isoforms RhoA and/or RhoC are overexpressed in
malignancies of the breast, ovary, colon, pancreas, lung, liver and brain (Horiuchi et al., 2003,
Fritz et al., 1999, Suwa et al., 1998, Fukui et al., 2006, Gou et al., 2011). The overexpression of
RhoC correlates with advanced tumor grade and decreased survival in serous ovarian carcinoma
(SOC), colorectal cancer, pancreatic cancer and, most prominently, breast cancer (Horiuchi et al.,
2003, Fritz et al., 1999, Suwa et al., 1998, Yuan et al., 2007). Importantly, the intratumoral
injection of RhoA or RhoC siRNAs was shown to inhibit the growth and metastases of
xenografted breast cancer cells, demonstrating the functional significance of their upregulation
(Pille et al., 2005).
12
RhoA is associated with tumor progression in ovarian cancer, breast cancer, SCLC, HCC and
astrocytomas by mediating their increased migratory, invasive and/or metastastic phenotypes
(Horiuchi et al., 2003, Fritz et al., 1999, Varker et al., 2003, Fukui et al., 2006, Li et al., 2006).
The Rac GTPases are also dysregulated in human malignancies, however, their increased activity
is more commonly associated with the miss-expression of their respective GEFs, GAPs or GDIs.
For example, expression of the Rac GEF DOCK180 correlates with advanced tumor grade in
ovarian carcinoma (OC) and its silencing prevents the proliferation, motility and invasion of SK-
OV-3 OC cells (Zhao et al., 2011, Wang et al., 2010). The Rac GDI RhoGDI12 was found to
antagonize the growth, invasion and in vivo lung metastases of OC cells via the inactivation of
Rac1, providing further evidence of the importance of Rac activation for ovarian tumor
progression (Stevens et al., 2011). The Rac GEF TIAM1, originally found to mediate RAS-
induced skin carcinogenesis in mice, has also been shown to promote the migratory and invasive
properties of prostate, HCC, PDAC, colon and breast tumor cells (Malliri et al., 2002, Engers et
al., 2006, Chen et al., 2012, Cruz-Monserrate et al., 2008, Minard et al., 2006, Strumane et al.,
2009). To add to this expanding list are aberrations in expression of the Rac GEFs Vav1-3 and P-
Rex1 found in breast, lung and melanoma carcinomas, respectively, which exert their
transforming properties via the activation of Rac1 (Citterio et al., 2012, Lazer et al., 2009,
Lindsay et al., 2011).
Interestingly, there is a strong connection between RAS and Rho GTPases in cellular
transformation. RAS and Rho cross-talk was initially predicted based on the observation that
oncogenic RAS induces changes in stress fibres, lamellipodia and filopodia in fibroblast cells
(Bar Sagi and Feramisco, 1986). Subsequently, an inhibitory interaction between the RAS GAP
p120RASGAP and the Rho GAP p190RhoGAP was identified that resulted in increased RhoA
activity in RAS-transformed cells (Settleman et al., 1992). It wasn’t until microinjection studies
performed by Hall and colleagues using dominant-negative Rho GTPase mutants, however, that
it was established that Rho GTPases play a functional role downstream of oncogenic RAS
(Ridley and Hall, 1992). They showed that inhibition of RhoA or Rac1 blocked RASV12
-induced
stress fibre and membrane ruffle formation, respectively. Importantly, inhibition of RhoA, RhoB,
Rac1, Cdc42 or RhoG resulted in a significant reduction in the focus-forming ability of
oncogenic RAS (Ridley and Hall, 1992, Prendergast et al., 1995, Khosravi-Far et al., 1995,
Lebowitz et al., 1997). Conversely, overexpression of active mutants of RhoA, Rac1 and Cdc42
13
showed cooperative and synergistic focus-forming activity with active Raf1, suggesting that Rho
and RAS GTPases work together to promote the transformed phenotype (Khosravi-Far et al.,
1995, Whitehead et al., 1998).
The connection between RAS and Rho GTPases is conserved in human tumors expressing
endogenous mutations in RAS. In MCF-7 breast and HT-1080 fibrosarcoma cells, migration
induced by EGF or constitutively active MEK1 is prevented by dominant-negative RhoA or
chemical inhibition of its downstream effector ROCK (Jo et al., 2002). Here, inhibition of RhoA
failed to prevent the migratory phenotype induced by ERK-independent factors, suggesting that
RhoA is specifically activated by the RAS/MAPK pathway to promote tumor progression.
Moreover, upregulation of the RAS target TrkBT1, which sequesters a RhoGDI, promoted the
metastasis of PDAC cells by increasing RhoA activation (Li et al., 2009). Both B-Raf and RAS
oncogenes have been shown to regulate Rho GTPase pathways to induce migration and invasion
of human colon cancer cells (Makrodouli et al., 2011). The Rac1 GTPases have also been
implicated downstream of oncogenic RAS in human tumors. A classic example of this is in the
case of TIAM1, which is required for H-RAS-induced skin tumor growth but promotes the
metastatic conversion of established tumors (Malliri et al., 2002). Further studies showed that
TIAM1 is a direct effector of RAS via a bona fide RAS binding domain (RBD) in its N-terminus
(Lambert et al., 2002) (Figure 1.6). Mouse models of adenomatous polyposis coli (APC)-induced
colon cancer and ERBB2-induced mammary cancer parallel the dichotomy of TIAM1 function
in H-RAS-induced skin tumors, with reduced primary tumor formation but increased metastases
in the absence of TIAM1 (Malliri et al., 2006, Strumane et al., 2009). Its metastasis-suppressing
function is further supported by the inverse correlation between malignant progression and
TIAM1 protein expression in breast cancer (Stebel et al., 2009). These studies highlight the
complexity and evolution of the signaling interplay between RAS and Rho GTPases in different
contexts and suggest that the requirement of Rho GTPases in RAS-mediated cellular
transformation may depend on different stages of tumorigenic progression.
In contrast to the Rac family, the mechanisms connecting RAS to Rho remain largely unclear. As
the Rho GEFs are known to contribute to cancer progression, as I will describe in the next
section, it has long been thought that RAS may activate Rho GTPases via the regulation of Rho
14
GEFs. However, as of yet there is a lack of evidence to support this hypothesis; thus, the search
for mediators of RAS and Rho cross-talk continues to be an area of intense study.
1.4 Guanine nucleotide exchange factors
Guanine nucleotide exchange factors (GEFs) are critical regulators of GTPase activation in
mammalian cells. A striking feature of GEFs is that they outnumber their GTPase substrates by a
factor of 3 (Venter et al., 2001). This is exemplified by the mammalian Rho family, which
consists of 83 GEFs and only 22 GTPases. Although the reasons for this redundancy have not
been fully determined, it is thought that distinct GEFs dictate the precise cellular function of the
otherwise pleiotropic GTPases by connecting them with different upstream receptors and/or
signaling molecules in the cell.
The first identified GEF, the Rho GEF Dbl, was isolated as a transforming protein in NIH 3T3
fibroblasts derived from DNA from a diffuse B-cell lymphoma (Eva and Aaronson, 1985). It was
found to display significant homology to an activator of the GTPase Cdc42, Cdc24, and was
subsequently also shown to catalyze association with GTP (Ron et al., 1991, Hart et al., 1991).
The conserved domain shared by Cdc24 and Dbl was termed the Dbl homology (DH) domain
and is the site of catalytic exchange (Hart et al., 1994). Although DH domains are a structurally
conserved component of all GEFs, they display surprisingly low sequence homology (20%)
(Hart et al., 1994). However, their three dimensional structures are highly similar and consist of
11 alpha helices, two of which are exposed on the surface of the protein and participate in the
formation of the GTPase-interacting pocket (Cherfils and Chardin, 1999). GEFs activate their
substrates by binding to the GDP-bound form of GTPases and destabilizing the GDP-GTPase
interaction, favouring the formation of a nucleotide-free intermediate. Since the approximate
ratio of GTP to GDP at physiological conditions is 10:1, with GTP concentrations ranging from
200-500M, the binding of GTP and activation of the GTPase is favored (Traut, TW, 1994,
Cherfils and Chardin, 1999). A pleckstrin homology (PH) domain is typically located adjacent
and C-terminal to the DH domain and together they form the core catalytic module and minimal
structural unit required to promote in vivo nucleotide exchange. PH domains in other signaling
molecules are capable of binding phosphatidylinositol phospholipids (PIPs) and are thus
15
classically thought to function by mediating plasma membrane interactions (Rebecchi et al.,
1998, Lemmon et al., 2000). However, in the case of many GEFs the contribution of the PH
domain is multifaceted. Only in some GEFs can the PH domain be functionally replaced by a
membrane-targeting phospholipid; moreover, other studies have shown that the PH domain can
directly affect the catalytic activity of the DH domain by mediating inhibitory protein
interactions or through intramolecular binding (Figure 1.6).
Figure 1.6 Crystal structure of the DH-PH domain of Dbl’s big sister (Dbs) in complex with RhoA. The DH
(depicted in blue) and PH (depicted in yellow) domains of the Rho GEF Dbs contribute to the binding of the RhoA
GTPase (depicted in green). The 3 and 4 loops of the DH domain and the 6 helix of the PH domain form
significant interactions with RhoA and stabilize the conformation of the catalytic core. N designates N-terminal; C
designates C-terminal; designates alpha; designates beta (Worthylake et al., 2004).
In contrast to their shared catalytic domains, there is considerable structural diversity among
GEFs for a specific GTPase (Figure 1.7). This is especially striking for the Rho GEFs, which
contain a plethora of additional functional regions such as Src homology 2 and 3 (SH2 and SH3)
domains, phospholipid binding motifs, Ras-GEF domains, coiled-coil regions, cysteine-rich
domains, zinc finger binding motifs, Rho-GAP domains and PDZ and RGS domains, among
others. These flanking regions confer specificity in protein-protein or protein-lipid interactions,
second messenger binding and protein kinase phosphorylation in response to upstream stimuli,
thus mediating the selectivity of the GTPase response. These regions can also promote proper
localization or have autoregulatory functions, thereby regulating the spatial or temporal
16
activation of Rho GTPases, respectively. Moreover, the multitude of additional Rho GEF
domains suggests that GEFs may have functions independent of Rho GTPase activation.
Figure 1.7 The diversity in Rho GEF domain organization. In addition to the core DH and PH catalytic module,
Rho GEFs contain many other domains that are subject to diverse regulatory interactions. Vav is activated by src via
a consensus phospho-Tyrosine motif and contains additional src homology 2 and 3 (SH2 and SH3), calponin-
homology (CH) and Cysteine-rich (CR) domains. Arhgef12 (also known as Leukemia-Associated Rho GEF
(LARG) and KIAA0383) contains a regulator of G protein signaling (RGS) domain that is crucial for its activation
downstream of G protein coupled receptors (GPCRs) via the G family of heterotrimeric GTPases. APC influences
Arhgef4 (also known as APC-stimulated GEF (ASEF), STM6 and KIAA1112) migration and adhesion by binding
to a conserved APC binding region (ABR) in its N-terminus. TIAM1 is directly activated by RAS via a bona fide
RAS binding domain (RBD) and contains an additional N-terminal PH domain. TIAM1 and Arhgef12 also contain
PDZ domains, which mediate a wide spectrum of protein-protein interactions.
Evidence for the autoregulatory role of the sequences flanking the core DH-PH domains of Rho
GEFs was apparent in early studies showing that their truncated mutants exhibited increased
transforming capacity in focus-forming assays (Whitehead et al., 1997). Removal of the N-
terminal sequences of Dbl, Vav, Asef, TIAM1, Ect2 and Net1 or the C-terminal sequences of
p115RhoGEF and AKAPLbc resulted in their constitutive activation (Eva et al., 1985, Toksoz
and Williams, 1994, Chan et al., 1996, Whitehead et al., 1995b, Miki et al., 1993, Chan et al.,
1994). In most of these cases, genomic deletion of coding sequences was initiated by the
transfection procedure as opposed to genetic events in the cancer cells themselves; however, it
revealed their potential as oncogenes. The mechanism underlying the auto-inhibition exhibited
by some Rho GEFs is best characterized in the case of Vav, in which an N-terminal Tyrosine
(Tyr174) interacts directly with the DH domain and blocks its interaction with GTPases. Upon
17
receptor stimulation, Tyr174 is phosphorylated by src, inducing a conformational change in the
N-terminus and relieving steric hindrance of the DH domain (Salojin et al., 1999, Lopez-Lago et
al., 2000). In contrast, the N-terminus of Dbl interacts with its PH domain via heat shock cognate
protein 70 (Hsc70), thereby physically preventing GTPase substrate binding (Ron et al., 1989, Bi
et al., 2001, Kauppinen et al., 2005). Moreover, Hsp90 interacts with Hsc70 and the N-terminus
of proto-Dbl and induces its ubiquitination, such that deletion of this region results in both its
accumulation to high levels in the cell and its constitutive GEF activity. These mechanistic
studies elegantly account for the potent transforming activity of oncogenic Dbl and provide
insight into the diverse modes of Rho GEF regulation (Kamynina et al., 2007).
The importance of Rho GTPase-regulated pathways in cancer is highlighted by the identification
of genetic alterations in many Rho GEFs in human malignancies and complements the
observation that mutations in the Rho GTPases themselves are rare events. Indeed, growing
evidence supports a critical role for Rho GEFs in the dysregulation of GTPase signaling in
human cancers (described below). Aberrations in Rho GEFs found in human cancers include
rearrangements, deletions, overexpressions and mutations that confer increased catalytic activity
to the proteins. However, in some instances the contribution of Rho GEFs to tumorigenesis is
independent of its enzymatic activity, adding another layer of complexity to Rho GEF function
in human tumorigenesis.
Several Rac GEFs have been implicated in tumorigenesis, including TIAM-1, Vav1-3 and P-
Rex-1 and 2a. TIAM-1 is overexpressed in a number of human malignancies and is a direct
target of H-RAS (Chen et al., 2012, Lambert et al., 2002). TIAM-1 is required for the initiation
of tumorigenesis but contributes to the metastatic conversion of established tumors (Malliri et al.,
2002). The Vav1 Rac GEF is overexpressed in PDAC cells as a result of promoter demethylation
and is required to support anchorage-independent growth and xenograft growth in vivo; similar
observations have also been made in lung cancer cells (Fernandez-Zapico et al., 2005, Lazer et
al., 2009). Vav2 is hyperactivated in response to EGFR signaling and mediates invasion of tumor
cells in head-and-neck squamous cell carcinoma (HNSCC) (Patel et al., 2007). Vav3 is
overexpressed in glioblastoma, androgen-independent prostate cancer cell lines, and breast
tumors and contributes to the invasion of glioblastoma cells (Salhia et al., 2008, Lyons et al.,
2006, Lee et al., 2008). The phosphatidylinositol-3,4,5-triphosphate-dependent Rac exchange
18
factor 1 (P-Rex1) is overexpressed in metastatic prostate cancer patient samples and cell lines
and mediates the migration and invasiveness of these cells via the activation of Rac1 (Qin et al.,
2009). Interestingly, P-Rex2a was found to contribute to breast cancer progression by directly
interacting with and inhibiting the PTEN tumor suppressor independently of its GEF activity
(Fine et al., 2009). These studies provide evidence that Rho GEFs can modulate oncogenic
pathways in both GEF-dependent and independent manners.
In addition to being overexpressed or aberrantly activated by upstream regulators, Rho GEFs are
structurally altered in many human cancers. The BCR-ABL translocation is famous for its well-
described rearrangement in Philadelphia chromosome-positive leukemias, which comprise 90%
of chronic myelogenous leukemias (CMLs) (Heisterkamp et al., 1985, Laurent et al., 2001). The
9:22 chromosomal translocation results in the fusion of the N-terminal regulatory sequences of
the Rho GEF breakpoint cluster region (BCR) protein with the kinase domain of the non-receptor
tyrosine kinase ABL. Although BCR contains both a Rho GEF and Rho GAP domain, only the
Rho GEF domain is present in the chimera. The oncogenic capacity of the fusion protein is
predominantly mediated by the constitutive activation of ABL, however, it displays a partial
dependence on RhoA nucleotide exchange for anchorage-independent growth (Laurent et al.,
2001). The Rho GEF LARG was also identified as a rearranged gene with the mixed-lineage
leukemia (MLL) gene in a patient with acute myeloid leukemia (AML) (Kourlas et al., 2000).
The fusion protein retains the DH-PH catalytic core and loses the N-terminal auto-inhibitory
region of LARG, but whether it exhibits constitutive RhoA exchange in AML remains unclear.
Interestingly, while MLL-associated LARG acts as an oncogene, wild-type LARG has been
implicated as a tumor suppressor in human breast and colorectal cancer (Ong et al., 2009). Thus,
the presence of the PDZ domain in the N-terminus of LARG may mediate GEF-independent,
tumor-suppressive interactions. Another study, however, found that LARG induced foci
formation in fibroblasts but decreased invasion in lymphoma cells, both in GEF-dependent
manners, suggesting that wild-type LARG mirrors TIAM1 in its opposing roles in the initiation
and progression of cellular transformation (Jiang et al., 2010). These studies reinforce the need to
study the role of Rho GEFs at multiple stages of tumorigenic progression and in response to
diverse stimuli in order to gain a full understanding of their contribution to tumorigenesis.
19
Together, the mechanistically varied regulation of Rho GEFs and the evidence being compiled
concerning their functional roles across all tumor types mounts a strong argument for them as a
class of potent human oncogenes. Moreover, the reasons underlying the imbalance between the
number Rho GEFs and their catalytic substrates is becoming more obvious with the elucidation
of novel GEF-independent functions and as we learn more about the diversity in their upstream
regulators. With only a fraction of Rho GEFs studied in the context of cancer, however, it
remains to be established whether the remaining dysregulated GEFs in human tumors are
passengers or drivers of oncogenesis.
1.5 Arhgef2
The Rho GEF Arhgef2, also known as murine Lfc or human GEF-H1, is a guanine nucleotide
exchange factor for RhoA (Krendel et al., 2002). It was originally identified in a C-terminally
truncated form whose overexpression induced morphological transformation of NIH 3T3 cells
(Whitehead et al., 1995). An N-terminal mutant was also found to initiate tumor formation in
mouse xenograft models, supporting the paradigm that sequences surrounding the core DH-PH
module can exert a GEF-inhibiting effect (Brecht et al., 2004). Arhgef2 contains an N-terminal
C1, or zinc-finger, domain and two C-terminal coiled-coil motifs as well as several Ser/Thr
phosphorylation sites, which contribute to its regulation and function through a multitude of
established binding partners (Figure 1.8).
Figure 1.8 The domain organization of Arhgef2. Arhgef2 contains an N-terminal cystein rich (C1) domain and
two C-terminal coiled-coil (CC) domains that flank the DH-PH catalytic unit. Glutamate (E) and Lysine (K) amino
acids at residues 243 and 394, respectively, are critical for catalytic exchange. Serine 885 (S885) is a major negative
20
regulatory site that can be phosphorylated by AurA and B, PAK1 and 4, PKA and Cdk1, resulting in 14-3-3 binding
and Arhgef2 inhibition. A number of additional binding partners of Arhgef2 have been identified that functionally
interact with the CC, PH and N-terminus of Arhgef2, as indicated above.
Arhgef2 is unique among GEFs in that it associates with and regulates the microtubule array as
well as the actin cytoskeleton (Krendel et al., 2002). p190RhoGEF is currently the only other of
the 88 Rho GEFs that has been shown to bind microtubules (van Horck et al., 2001).
Microtubule dynamics are tightly coupled to the actin cytoskeleton during cell migration, where
microtubule depolymerisation and subsequent formation of actin stress fibers and actomyosin-
dependent cell contractility allows cells to dynamically propel themselves forward (Nobes and
Hall, 1992). Although the Rac and Rho GTPases have long been known to mediate the
succession in morphological changes linking these two cytoskeletal networks, neither GTPase
has shown localization to the microtubule array. Thus, the identification of Arhgef2’s association
with microtubules suggested a novel mechanism by which microtubule depolymerisation may be
linked to Rho GTPase-dependent actin stress fiber formation. A critical study by Krendel et al.
revealed that Arhgef2 interacts with microtubules via its N- and C-terminal ends, resulting in the
inhibition of its GEF activity toward RhoA (Krendel et al., 2002). Overexpression of full-length
Arhgef2 results in microtubule bundling and increased resistance against the microtubule
depolymerising agent nocodazole, demonstrating that Arhgef2 stabilizes the microtubule array.
Furthermore, deletion of N- and C-terminal portions of Arhgef2 results in its translocation from
microtubules to the actin cytoskeleton, where it initiates the formation of stress fibers in a RhoA-
dependent manner. Interestingly, although microtubule-associated Arhgef2 displays weak
exchange activity compared to the cytoplasmically-localized deletion mutants in cells, their in
vitro exchange activities are similar, showing that their inhibitory properties are conferred by in
vivo protein-protein or microtubule-dependent interactions rather than auto-inhibitory functions.
Indeed, recent work in our laboratory has shown that the inhibition of Arhgef2 is mediated
through T-complex testis-specific protein-1 (Tctex-1), a light chain of the dynein motor complex
that functions in microtubule transport (Meiri et al., 2012). Tctex-1 binds to amino acids 87-151
of Arhgef2, thereby linking Arhgef2 to the microtubule array and enabling its inhibition (Figure
1.8) (Meiri et al., 2012). Importantly, deletion of the Tctex-1 binding domain (Arhgef287-151
)
results in the release of Arhgef2 from microtubules, elevated GEF activity in the cytoplasm and
increased stress fiber formation. Together, these studies consolidate Arhgef2 as the first known
mediator connecting microtubule dynamics to actin polymerization.
21
Given its role as a critical regulator of microtubules and the actin cytoskeleton, it comes as no
surprise that Arhgef2 has been implicated in biological processes involving the maintenance of
cell structure, polarity, motility, migration and cell cycle progression. The first study looking at
Arhgef2 function in epithelial cells found that Arhgef2 is a tight junction-associated protein
(Benais-Pont et al., 2003). Tight junctions are one of four main junction types that link epithelial
cells together in order to form a compact epithelium, required to line and protect the organs of
the body. Tight junctions are the most apical of the intercellular junctions and regulate selective
paracellular diffusion and restrict the intermixing of apical and basolateral membrane
components, thereby maintaining cell polarity (Cereijido et al., 2000). Benais-Pont et al. found
that Arhgef2 is associated with tight junctions in interphase cells and promotes RhoA-dependent
increases in the paracellular permeability of small molecular weight proteins (Benais-Pont et al.,
2003). Later studies showed that Arhgef2 is recruited to tight junctions by the adaptor cingulin,
which mediates its inhibition in confluent cells (Aijaz et al., 2005). Moreover, cingulin depletion
results in the release of Arhgef2 from tight junctions, RhoA activation, and increased cell
proliferation (Aijaz et al., 2005). Later, members of the same laboratory found that Arhgef2
could also localize to apical junctions via a similar junctional adaptor protein, paracingulin,
which also resulted in a decrease of its GEF activity at confluency (Guillemot et al., 2008). In
calcium-depleted colonic epithelial cells, Arhgef2 activation induces the disassembly of the
epithelial barrier by disrupting apical junction complexes through the formation of contractile
actomyosin structures in RhoA-ROCK-dependent manner (Samarin et al., 2007). Since calcium
levels regulate microtubule dynamics, it was hypothesized that destabilization of the microtubule
array and subsequent release of Arhgef2 into the cytoplasm was the triggering event for RhoA-
mediated apical junctional dissolution (Samarin et al., 2007).
A role for Arhgef2 has also been established in endothelial cells, which form a semiselective
permeable barrier between the blood and interstitial space and regulate macromolecule and
leukocyte transport through the vessel wall. Birukova and colleagues found that depletion of
Arhgef2 or expression of dominant-negative mutants of Arhgef2 significantly attenuated
thrombin and nocodazole-induced vascular permeability increases and RhoA-mediated cellular
events (Birukova et al., 2005). Moreover, they later showed that Arhgef2 mediates increases in
vascular endothelial permeability associated with acute lung injury, thereby extending its
importance in endothelial barrier function to a disease context (Birukova et al., 2010).
22
Arhgef2 function is exploited by the bacteria Enteropathogenic Escherichia coli (EPEC), which
exerts its pathogenicity by inducing microtubule disruption and Arhgef2 activation, resulting in
increased paracellular permeability and degeneration of the colonic epithelium (Caron et al.,
2006, Matsuzawa et al., 2004). Arhgef2 is also activated in response to Shigella bacterial
invasion in the intestinal epithelium, where it enables cell entry and the activation of the innate
immune response via a RhoA-NFB pathway (Fukazawa et al., 2008). Arhgef2 mediates
increased kidney tubular epithelial cell permeability in response to the pro-inflammatory
cytokine TNF, implicating Arhgef2 in the disruption of tubular cell integrity associated with
kidney injury (Kakiashvili et al., 2009, Kakiashvili et al., 2011). Together, these studies
demonstrate an important role for Arhgef2 in the regulation of junctional integrity in multiple
epithelial cell types and disease contexts. Moreover, they suggest that Arhgef2 may play a role in
other diseases involving the abrogation of proper epithelial cell structure, such as cancer.
Arhgef2 also regulates cell cycle progression, as was initially demonstrated by Westwick et al.
who showed that C-terminally truncated Arhgef2 can induce cyclin D1 expression in NIH 3T3
cells (Westwick et al., 1998). In MCDK cells, depletion of the Arhgef2 inhibitor cingulin results
in the release of Arhgef2 from tight junctions and progression through G1 of the cell cycle (Aijaz
et al., 2005). The requirement of Arhgef2 for progression at multiple stages of mitosis has since
been shown in fibroblasts and epithelial cells (Bakal et al., 2005, Birkenfeld et al., 2007).
Arhgef2 is required for pro-metaphase/metaphase transition in Rat-2 cells (Bakal et al., 2005)
and for the localized activation of RhoA at the cleavage furrow during cytokinesis (Birkenfeld et
al., 2007). Moreover, Arhgef2 is a phosphorylation target of ERK1/2 and mediates cell
proliferation in response to phorbol 12-myristate 13-acetate (PMA) stimulation (Fujishiro et al.,
2008).
Early studies showing that Arhgef2 mutants deficient in microtubule binding induced stress
fibers and cell contractility were indicators of its potential role in the coordination of cell
migration (Krendel et al., 2002). Indeed, endogenous Arhgef2 was later shown to be required for
nocodazole-induced increases in actomyosin contractility in HeLa cells (Chang et al., 2008).
Elegant studies by Nalbant et al. using fluorescence resonance energy transfer (FRET)
biosensors to determine the spatial distribution of RhoA activity in migrating cells showed that
depletion of Arhgef2 suppresses RhoA activation at the leading edge, resulting in their decreased
23
migratory capacity (Nalbant et al., 2009). By contrast, studies by Heasman et al. in T cells during
transendothelial migration showed that Arhgef2 regulates the actomyosin-based contraction of
the uropod in the rear of the cell but has no effect on RhoA activation at the leading edge
(Heasman et al., 2010). These reports suggest that Arhgef2 activates distinct cellular pools of
RhoA in migrating cells and can regulate both their forward protrusion or tail retraction,
depending on cell type and/or context. Arhgef2 also affects focal adhesion turnover in migrating
cells and contributes to increased cell rigidity in response to integrin-mediated focal adhesion
kinase (FAK)/RAS/ERK activation (Nalbant et al., 2009, Guiluy et al., 2011).
The role of Arhgef2 in cell migration and attachment suggest that Arhgef2 may play a role in the
migratory and invasive properties of cancer cells. Several recent reports have demonstrated that
Arhgef2 contributes to the invasion and in vivo metastases of breast cancer cells and the
migration of HCC cells (Liao et al., 2012, Cheng et al., 2012). Arhgef2 is transcriptionally
upregulated in metastatic breast cancer cells by the oncogenic transcription factor hPTTG1 and is
activated by Heparanase in brain metastatic breast cancer (BMBC) cells (Liao et al., 2012,
Ridgway et al., 2012). There, the upregulation and activation of Arhgef2 resulted in increased
breast cancer cell metastases and transmigration through the blood-brain barrier, respectively,
demonstrating the functional significance of Arhgef2 dysregulation. Arhgef2 was also identified
as an irradiation-responsive gene in breast cancer cells harboring BRCA1/2 mutations,
suggesting that Arhgef2 expression may be a potential therapeutic marker in breast cancer
(Walker et al., 2008). In HCC, Arhgef2 undergoes genomic amplification, leading to increased
expression and increased cell migration (Cheng et al., 2012). Moreover, Arhgef2 was shown to
be transcriptionally upregulated by gain-of-function (GOF) mutants of p53 in NSCLC, thereby
contributing to their increased proliferative capacity (Mizuarai et al., 2006). Together, these
studies suggest that transformed cells can select for increased Arhgef2 expression or activity by
distinct mechanisms to promote tumor progression.
The aforementioned studies reveal critical functions for Arhgef2 as a regulator of cell
morphology, epithelial cell integrity, cell-cycle progression, migration and adhesion. These
functions are mediated via the regulated activation of RhoA and are intimately related to its
association to and release from the microtubule array. The important physiological activities of
Arhgef2 suggest that its dysregulation may contribute to tumorigenesis. Current research is
24
directed at addressing this question, as evidenced by recently published studies implicating
Arhgef2 in the progression and poor prognosis of breast and hepatocellular carcinoma (Liao et
al., 2012, Cheng et al., 2012).
In 2000, a report in Nature Genetics looked at the genome-wide transcriptional changes induced
by oncogenic H-RAS in rat fibroblast cells (Zuber et al., 2000). Arhgef2 was among several
hundred genes that were significantly upregulated in H-RASV12
-transformed cells compared to
their wild-type counterparts. I read this paper when I joined the lab in 2006 and immediately
sought to question the potential role of Arhgef2 downstream of oncogenic RAS. I hypothesized
that Arhgef2 may be the Rho GEF linking increased RAS activity to elevated levels of active
RhoA in tumor cells. Moreover, I predicted that Arhgef2 may contribute to the malignant
conversion of RAS-mutated cells via its dual role in epithelial cell junction formation and cell
migration. In the pages that follow, I will lead you through my six year quest to determine the
role of the Rho GEF Arhgef2 in RAS-induced tumorigenesis. I hope that you find my discoveries
as intriguing and exciting as I have experienced them to be at each stage of my scientific journey.
25
Chapter 2
Arhgef2 Provides a Positive Feedback Loop Required for
Signaling Through the Oncogenic RAS Pathway
2.1 Abstract
Activating mutations in RAS are one of the most common oncogenic events in human cancers,
however, as of yet they have proven to be pharmacologically intractable targets. Thus, the
identification of RAS effectors essential for tumor cell survival is critical to improve treatment
strategies in RAS-mutated malignancies. In this chapter, we find that ARHGEF2 is a
transcriptional target of the RAS/MAPK pathway. Increased protein expression of Arhgef2 in
RASV12
-transformed fibroblast cells contributes to cell proliferation, survival, and transformation
in vitro and in vivo xenograft models. Moreover, we find that Arhgef2 is required for the
activation of the MAPK pathway in response to oncogenic RAS. Importantly, this effect is
independent of its Rho GEF activity and instead relies on its novel function as an adaptor protein
for a molecular scaffold of the MAPK pathway, Kinase suppressor of RAS-1 (KSR-1). Arhgef2
facilitates the dephosphorylation of KSR-1 on a critical negative regulatory site, Ser392, by
recruiting the B’ subunit of protein phosphatase 2A (PP2A) to the KSR-1/MAPK complex.
Depletion of Arhgef2 prevents RASV12
-mediated MEK1/2 and ERK1/2 activation in a manner
that depends on KSR-1 dephosphorylation on Ser392. Together, these data place Arhgef2 in a
positive feedback loop where MAPK-dependent increases in Arhgef2 expression potentiate
MAPK signaling in RAS-transformed cells. These findings provide insight into mechanisms
underlying oncogenic RAS-mediated cell proliferation and survival and highlight the potential of
Arhgef2 as a therapeutic target in RAS-mutated cancers.
26
2.2 Introduction
Due to the high frequency of RAS mutations in human cancer, the signaling pathways regulated
by the RAS oncogenes (H-, K- and N-RAS) have been the subject of intense research (Thomas et
al., 2007). The RAS GTPases regulate diverse biological processes, including transcription,
translation, cell-cycle progression, apoptosis and cell survival (Macara et al., 1996). The
specificity of RAS signaling is determined by its interaction with over a dozen downstream
effector molecules, the most well-studied being Raf, PI3K and Ral-GDS (Vojtek et al., 1993,
Kodaki et al., 1994, Kikuchi et al., 1994). The Raf Ser/Thr kinases (A-Raf, B-Raf and c-Raf)
were the first RAS effectors discovered and are major mediators of cell proliferation and survival
via the activation of the MAPK cascade, involving the sequential phosphorylations of MEK1/2
and ERK1/2 (Moodie et al., 1993, Warne et al., 1993, Zhang et al., 1993, Vojtek et al., 1993,
Galmiche et al., 2010).
The Kinase Suppressor of RAS (KSR-1) was identified in genetic screens in Drosophila and C.
elegans designed to isolate mutations in genes that modified the signaling efficiency of
oncogenic RAS (Kornfeld et al., 1995, Therrien et al., 1995, Sundaram et al., 1995). Subsequent
studies showed that KSR-1 acts as a molecular scaffold to facilitate signal transmission through
the Raf/MAPK cascade (Therrien et al., 1996, Michaud et al., 1997, Cacace et al., 1999,
Morrison, 2001). KSR-1 is constitutively associated with MEK1/2 and interacts with ERK1/2
and Raf in response to RAS activation (Therrien et al., 1996, Michaud et al., 1997, Cacace et al.,
1999). KSR-1 was shown to be required for RASV12
-mediated ERK1/2 activation and cellular
transformation in mammalian cells in vitro and in vivo (Kortum et al., 2004, Joneson et al., 1998,
Razidlo et al., 2004, Nguyen et al., 2002, Lozano et al., 2003, Xing et al., 2003). Consistent with
its role as a scaffolding protein, KSR-1 function must be tightly regulated in order to ensure
optimal MAPK signaling downstream of RAS activation. In quiescent cells, KSR-1 is
phosphorylated on S297 and S392 and held inhibited in the cytosol by 14-3-3 proteins (Ory et
al., 2003). Upon RAS activation, KSR-1 is dephosphorylated at S392, the major 14-3-3 binding
site, and translocates to the plasma membrane where it can interact with Raf and ERK1/2 to
facilitate signal transduction (Ory et al., 2003).
27
Work by Ory et al. identified the protein phosphatase 2A (PP2A) as the critical phosphatase
required for dephosphorylation of KSR-1 on S392 in response to activated RAS (Ory et al.,
2003). The requirement of PP2A for KSR-1 function was supported by early genetic studies in
Drosophila and C. elegans showing that mutations in PP2A phenocopied a loss of KSR-1
function in a RAS-mutated background (Wassarman et al., 1996, Sieburth et al., 1999). PP2A is
a heterotrimeric S/T protein phosphatase composed of a catalytic (C), structural (A) and
regulatory (B) subunit. The catalytic and structural subunits constitutively interact to form a core
complex to which one of many B subunits can bind (Janssens et al., 2001). Four families of B
subunits exist in mammals (B, B’, B’’ and B’’’) that determine the localization and substrate
specificity of the holoenzyme (Janssens et al., 2001). While the A and C subunits constitutively
associate with KSR-1, the B subunit is induced only upon RAS activation (Ory et al., 2003).
However, the mechanism underlying the recruitment of the B subunit to the KSR-1/PP2A A + C
holoenzyme complex has not been elucidated.
Arhgef2 has been implicated in tumorigenesis since its discovery, when it was isolated as a
transforming protein in NIH 3T3 cells when overexpressed (Whitehead et al., 1995). An N-
terminal truncation mutant of Arhgef2 was also shown to induce tumor formation in nude mice
(Brecht et al., 2004). Arhgef2 is transcriptionally upregulated downstream of multiple
oncogenes, including gain-of-function mutants of p53, the metastasis-associated gene hPTTG1,
TGF, oncogenic RAS, and was recently identified as an amplified gene in hepatocellular
carcinoma (Mizuarai et al., 2006, Liao et al., 2012, Tsapara et al., 2010, Zuber et al., 2000,
Cheng et al., 2012). Arhgef2 was shown to mediate mutant p53-induced cell proliferation and
hPTTG1 and TGF-induced cell migration and motility via activation of its downstream effector
RhoA (Mizuarai et al., 2006, Cheng et al., 2012, Tsapara et al., 2010). The upregulation of
Arhgef2 downstream of oncogenic RAS, however, has not been validated nor has its functional
role downstream of RAS been investigated. Thus, we hypothesized that Arhgef2 may link
increased RAS signaling to RhoA activation, thereby potentiating the oncogenic potential of
RAS-mutated cells.
In this chapter, we confirm that ARHGEF2 is a transcriptional target of the RAS/MAPK
pathway and contributes to cell survival and transformation in RAS-transformed cells both in
vitro and in vivo xenograft models of RAS tumorigenesis. Importantly, we find that Arhgef2
28
contributes to RASV12
-mediated survival and proliferation in a GEF-independent manner. We
also uncover a novel role for Arhgef2 as an adaptor protein, linking the B’ subunit of PP2A to
KSR-1, thereby promoting the activating dephosphorylation of KSR-1 on S392 and potentiating
MAPK signaling in RAS-transformed cells.
29
2.3 Experimental Procedures
Derivation of ARHGEF2 knockout mice: A targeting construct was designed to insert a loxP site
upstream of exon 2, and a loxP-flanked neomycin resistance cassette (in reverse orientation)
downstream of exon 2 of the ARHGEF2 gene. The construct was electroporated into the E14K
embryonic stem cell (ES) cell line. Correctly targeted ES cells were injected into recipient
blastocysts and chimeric mice were bred to C57BL/6 females to establish the colony. The
ARHGEF2 floxed mice were then bred with CMV-Cre mice. The resulting mice lacking both
exon 2 and the floxed neomycin cassette were selectively bred to remove the CMV-Cre
transgene. Heterozygous mice were backcrossed for at least 4 generations and then bred together
to generate homozygous mice.
Cell lines and cell culture: MEFs derived from ARHGEF2-/-
embryos or wild-type littermates,
ER:H-RASV12
MEFs (from Julian Downward, London Research Institute, London, UK) and NIH
3T3 and HEK 293T (ATCC) cell lines were cultured in Dulbecco’s modified Eagle medium
(DMEM, Life Technologies Inc.) supplemented with 10% fetal bovine serum (FBS) (HyClone).
MEFs were transfected using Effectene (QIAGEN) and NIH 3T3 and HEK 293T cells using
Polyfect (QIAGEN) according to the manufacturer’s instructions. Stable H, K, and N-RASD12
-
expressing NIH 3T3 cells were established by culturing transfected cells in 400 g/mL G418
(Sigma). Stable ER:H-RASV12
-expressing MEFs and PP2A subunit-expressing HEK 293T cells
were kind gifts from Julian Downward and Anne Claude Gingras (Samuel Lunenfeld Research
Institute, Toronto, ON), respectively. Stable MEF, NIH 3T3-H-RASV12
and HEK 293T Arhgef2
knockdown cell lines were established by lentiviral infections of shRNA constructs. These
viruses were produced by co-transfecting the HEK 293T packaging cell line with lentiviral
shRNA hairpin plasmids targeting the murine or human ARHGEF2 gene and packaging
plasmids pPAX2 and VSV-g using the CalPhos Mammalian Transfection Kit (Clontech).
Lentiviral supernatants were collected, filtered and incubated with the target cells in the presence
of 8g/ml Polybrene (Sigma). After 48h cells were subjected to puromycin (Sigma) selection
(4g/ml for MEF and NIH 3T3-H-RASV12
cell lines and 2g/ml for HEK 293T cells) until all
nontransduced cells died. All cultures were maintained in a 5% CO2 environment at 37oC.
30
Expression constructs: Full-length (Arhgef2 or Arhgef21-985
), truncated (Arhgef287-151
,
Arhgef2236-572
, Arhgef2236-433
, Arhgef2473-572
, Arhgef2473-985
) and mutated (Arhgef2T243K
) versions
of murine and human ARHGEF2 cDNA (accession no. AF177032 and NM_004723.3,
respectively) were subcloned into the pFlag-CMV2 (Sigma) or pEGFP-C1 (Invitrogen) vectors.
Full-length murine p115RhoGEF cDNA (accession no. NM_001130150.1) was subcloned into
pFlag-CMV2 vector. Murine ARHGEF2 pLKO.1 lentiviral shRNA constructs were obtained
from The RNAi Consortium (TRC) and human ARHGEF2 shRNA sequences were cloned into
the EcoRI and AgeI restriction sites of pLKO.1 (Table 1). A hairpin targeting GFP was used as a
negative control (Table 1).
Table 2.1: Murine and Human Arhgef2 shRNA and GFP shRNA Sequences
Construct Forward sequence Reverse sequence
mArhgef2 shRNA 1 5’-
CCGGGCAGGAGATTTACAACCGAATCTCGA
GATTCGGTTGTAAATCTCCTGTTTTTG-3’
5’-
AATTCAAAAAGCAGGAGATTTACAACCGAATC
TCGAGATTCGGTTGTAAATCTCCTGTT-3’
mArhgef2 shRNA 2 5’-
CCGGCCCTCATTTGTCCTACATGTACTCGAG
TACATGTAGGACAAATGAGGGTTTTTG-3’
5’-
AATTCAAAAACCCTCATTTGTCCTACATGTACT
CGAGTACATGTAGGACAAATGAGGGTT-3’
hArhgef2 shRNA 1 5’-
CCGGAACCACGGAACTGGCATTACTCTCGA
GAGTAATGCCAGTTCCGTGGTTTTTTTG-3’
5’-
AATTCAAAAAAACCACGGAACTGGCATTACTC
TCGAGAGTAATGCCAGTTCCGTGGTT-3’
hArhgef2 shRNA 2 5’-
CCGGAATGTGACTATCCACAACCGCCTCGA
GGCGGTTGTGGATAGTCACATTTTTTTG-3’
5’-
AATTCAAAAAAATGTGACTATCCACAACCGCC
TCGAGGCGGTTGTGGATAGTCACATT-3’
GFP shRNA 5’-
CCGGTGCCCGACAACCACTACCTGACTCGA
GTCAGGTAGTGGTTGTCGGGCA TTTTTG-3’
5’-
AATTCAAAAATGCCCGACAACCACTACCTGAC
TCGAGTCAGGTAGTGGTTGTCGGGCA-3’
pCGT-H-, K-, N-RASV/D12
, pCMV-Flag-AKAPLbc and pCMV-Flag-PP2A constructs were kind
gifts from Dafna Bar Sagi (Langone Medical Centre, New York, NY), John Scott (Howard
Hughes Medical Institute, Seattle, WA) and Anne-Claude Gingras, respectively. pCDNA3-Pyo-
KSR-1 wild-type, mutant and truncated expression vectors were kind gifts from Deborah
Morrison (Centre for Cancer Research, Frederick, MD) and were generated as described in
Muller et al., 2001.
31
Cell treatments: ER:H-RASV12
MEFs were starved in DMEM containing 0% FBS for 16h and
treated with 100nm 4-hydroxytamoxifen (4-OHT, Sigma) diluted in 100% ethanol. For MEK and
PI3K inhibition experiments, MEFs and NIH 3T3-H-RASV12
cell lines were cultured in DMEM
supplemented with 10% FBS and incubated with PD98059, UO126 or LY294002 (Sigma)
diluted in DMSO (Sigma) for 48h. For immunofluorescence studies, MEFs were starved for 24h
in DMEM containing 0% serum and treated in DMEM containing 10mM HEPES and 0.5mg/mL
fatty acid-free bovine serum albumin (BSA) (A8806, Sigma). PDGF (Sigma) was suspended in
Hank’s buffered saline solution (HBSS) containing 0.5mg/mL fatty acid-free BSA and 20 mM
HEPES to a stock concentration of 1M.
Immunoprecipitations and Western blotting: For immunoprecipitation experiments, cells were
scraped into ice-cold lysis buffer (30mM Tris pH7.5, 150mM NaCl, 1% Triton X-100, 0.2%
sodium deoxycholate, 10mM NaF, 1mM Na3VO4 and 1mM PMSF) with Complete Protease
Inhibitor cocktail (Roche) and cleared extracts incubated with protein-G sepharose and
appropriate antibodies for 2h at 40C. Immunoprecipitates were washed three times with wash
buffer (30mM Tris pH7.5, 300mM NaCl, 5mM NaF and 0.1% Triton X-100), resuspended in 2X
sample buffer, boiled and protein complexes resolved by SDS-PAGE before transfer to PVDF
(Imobilon) membranes for immunoblotting. For Western blotting, cells were scraped into ice-
cold lysis buffer described above and incubated on ice for 20min, followed by centrifugation at
16,060xg at 4oC for 10min. Cleared lysates were resuspended in 2X sample buffer, boiled and
proteins resolved by SDS-PAGE before transfer to PVDF membranes for immunoblotting.
RhoA and Rac1 activity assays: For pulldown experiments, active RhoA and Rac1 were assessed
by incubation of cell lysates with GST-Rhotekin-RBD or GST-PAK-RBD, respectively
(Cytoskeleton, CO, USA). Sub-confluent NIH 3T3-H-RASV12
cells stably expressing shGFP or
shGEFm2 were serum-starved for 16h and lysed in ice cold HNMETG lysis buffer (50mM
HEPES pH 7.5, 150mM NaCl, 1.5mM MgCl2, 1mM EGTA, 1% Triton-X 100 and 10%
glycerol). Lysates were clarified by centrifugation at 16,060xg at 4oC, equalized for total volume
loading and rotated for 60min at 4oC with 20g of purified GST-RBD bound to glutathione
Sepharose beads. The beads were washed three times with HNMETG wash buffer (50mM
HEPES pH 7.5, 300mM NaCl, 1.5mM MgCl2, 1mM EGTA, 0.1% Triton-X 100 and 10%
glycerol) and processed for SDS-PAGE. For RhoA-GTP quantitation using RhoA G LISA kit
32
(Cytoskeleton, CO, USA), sub-confluent NIH 3T3-H-RASV12
cells stably expressing shGFP,
shGEFm1 or shGEFm2 were serum-starved for 16h, washed, lysed in ice cold lysis buffer,
cleared, snap-frozen in liquid nitrogen and stored at -70oC. Equal levels of total RhoA was
confirmed with the Precision Red Advanced Protein Assay Reagent (Cytoskeleton) and lysates
were processed for RhoA-GTP quantitation according to manufacturer’s protocol. Total GTP-
bound RhoA was determined from cell lysates in triplicate and mean values from two
independent experiments are shown +/- SD.
Antibodies: Polyclonal sheep anti-Arhgef2 murine antibodies were raised as described previously
(Bakal et al., 2005). Monoclonal mouse anti-Arhgef human antibodies 3C5 and 14B11 were
designed using N- and C-terminal human Arhgef2 peptides, respectively, and produced by
hybridoma. Texas Red anti-mouse IgG (T-862) was obtained from Invitrogen. Western blotting
and immunofluorescence were performed using the following primary antibodies: anti-RhoA
(CST, 2117), anti-RAS (CST, 3965), anti-p44/42 MAPK (ERK1/2) (CST, 9102), anti-phospho-
p44/42 MAPK (pERK1/2) Thr202/Tyr204 (CST, 9106), anti-MEK1/2 (CST, 9122), anti-
phospho-MEK1/2 Ser217/221 (CST, 9154), anti-caspase 3 (CST, 9662), anti-cleaved caspase 3
(CST, 9661), anti-KSR-1 (gift from Deborah Morrison, see Cacace et al., 1999 for description of
KSR-1 antibody generation), anti-phospho-KSR-1 S392 (CST, 2502), anti-PP2Ac (Millipore,
05-421), anti-RhoA (CST, 2117), anti-Rac1 (CST, 2465), anti-alpha tubulin (Molecular Probes),
anti-Flag (M2, F3165, Sigma), anti-GFP (Invitrogen, G10362) and anti-Pyo (CST, 2448s). HRP-
conjugated anti-mouse or anti-rabbit secondary antibodies were from GE Healthcare.
Quantitative PCR: RNA was extracted from NIH 3T3 or NIH 3T3-H-RASV12
cell lines using the
RNeasy mini kit (QIAGEN). 100ng of RNA was converted into double-stranded cDNA at 42oC
with SuperScript II RNase H-reverse transcription kit (Invitrogen). Quantitative PCR was
performed with 50ng of template cDNA mixture from each cell line and murine Taqman gene
expression assays for ARHGEF2 (Mm00434757_m1, Applied Biosystems) and TUBULIN
(Mm00846967_g1, Applied Biosystems). Gene expression levels in the samples were calculated
relative to control using the comparative CT method: CT = CTsample – CTcontrol, fold change =
2-CT
. TUBULIN expression was used to normalize ARHGEF2 expression levels.
Luciferase reporter assays: The regulatory sequence of murine ARHGEF2 (nucleotides -62 to -
1968 upstream of the transcription start site (TSS)) was PCR-amplified from mouse BAC clones
33
and inserted into the pGL3 luciferase vector (pGL3pARHGEF2) (Promega, E1910). MEFs were
co-transfected with pGL3pARHGEF2 and empty vector, pCGT-H-RASV12
or pCGT-K-RASD12
expression plasmids using LipoD293 (SignaGen, SL100668) and the luciferase activities were
measured 24h after transfection using the Dual-Luciferase Reporter System (Promega) according
to the manufacturer’s instructions.
Anchorage-independent growth: 60mm dishes were coated with bottom agar consisting of 0.6%
ultra-pure agarose (Sigma), 2X DMEM, and 25% FBS and allowed to solidify at 40C for 30min.
1x105 cells were resuspended in top agar consisting of 0.4% agarose, 2X DMEM and 25% FBS
at 370C and poured over the bottom agar. After 24h at 37
oC/5%CO2, 2ml of growth medium was
added to the top agar and was refreshed every 3 days. Cells were maintained at 370C/5% CO2 for
10 days. For visualization, growth medium was removed and dishes were stained with 1ml of
0.0005% crystal violet in 70% ethanol for 4h at room temperature. Plates were washed with 70%
ethanol and imaged at 10X or 40X on a dissecting microscope. Colonies greater than 2mm in
diameter were counted manually at 10X magnification in triplicate. Results represent the mean of
3 independent experiments.
BrdU incorporation: NIH 3T3, NIH 3T3-H-RASV12
, NIH 3T3-H-RASV12
shGFP and NIH 3T3-
H-RASV12
shGEF1 and shGEF2 stable cell lines were plated at 1x103 cells/per well in a 96-well
microplate in quadruplicate. BrdU reagent (Roche) was added to cells after 24h and
incorporation was measured after 24h by colorimetric detection as per manufacturer’s protocol
(Roche, 11647229001). Values reflect percentage BrdU incorporation relative to shGFP-
expressing cells and represent the mean of three independent experiments.
Immunofluorescence imaging: Cells grown on glass coverslips were treated as indicated in the
corresponding figure legends and fixed with 4% PFA for ten minutes, washed three times with
1X PBS, and permeabilized with 0.1% Triton X-100 for 5min. The coverslips were blocked with
0.5% w/v BSA in 1X PBS for 1h at room temperature and then incubated with primary antibody
(anti-KSR-1 1:100) in 0.5% BSA/1X PBS at 37oC for 30 min or at 4
oC overnight. Coverslips
were washed three times with 1X PBS and incubated with secondary antibody (1:500) at 37oC
for 1h. Slides were mounted using GelTol mounting medium (Shandon Immunon, Thermo
Electron Corporation). Confocal imaging was performed with an Olympus IX81 inverted
microscope using a 60X zoom x3(1.4 NA; PlanApo, Nikon) objective, and FluoView software
34
(Olympus, Tokyo, Japan). Resolution was 512x512 with 12 bits/pixel. The following excitation
wavelengths were used for enhanced GFP (473 nm) and Texas Red (559 nm). All images in each
set of experiments were acquired with the same microscope sensitivity settings. All images
compared within each figure panel were acquired on the same day, with identical staining
conditions, gain and contrast setting, and same magnification. All statistical analyses were
derived from 60 or more images from three independent experiments for each treatment
condition.
Animal studies: All animal studies were carried out using protocols approved by the UHN
Animal Care Committee. Xenograft studies in nude mice with NIH 3T3 cell lines were
performed using 8-week old athymic NCr nude mice (Taconic Laboratories, Hudson, NY). Mice
were allowed to acclimatize for one week in our institution’s animal care facility before being
injected subcutaneously in the hip flank with 1 x 106 cells resuspended in 40ul of 1:1 PBS (Life
Technologies) and growth factor-reduced matrigel (BD Biosciences). Mice were housed 3-4 to a
cage and tumors were allowed to grow until they reached a maximum of 1.5cm in diameter or
became ulcerated, at which point mice were sacrificed by carbon dioxide asphyxiation. Tumors
were removed, weighed, measured, and fixed in OCT medium for histologic processing
(described below). Five injections were performed per condition over four independent
experiments. Tumor measurements were taken with a calliper and tumor volume was calculated
by the ellipsoid formula V=/6 x (l x w2), where l and w denote the longest and shortest
diameter, respectively.
Immunohistochemistry: For NIH 3T3 xenograft studies, tumor sections were fixed in Optimal
Cutting Temperature (OCT) medium, flash frozen in methylbutanol, and stored at -80oC before
being sent for immunohistological processing at Toronto General Hospital’s (TGH) Pathology
Department. Tumor sections were probed for caspase 3 cleavage using anti-cleaved caspase 3
(Asp 175) antibody (CST 9661).
NMR-Based GEF assay: To quantify GEF activity in lysates of mammalian cells, nuclear
magnetic resonance (NMR) was measured as described in Marshall et al., 2012 and Marshall et
al., 2009. This assay monitors the heights of 1H-
15N Heteronuclear Single Quantum Coherence
(HSQC) peaks of 15
N RhoA protein that are specific to either the GDP-bound or GTP-bound
form. To measure nucleotide exchange, 2 mM GTPγS and 3.5 μl cleared lysate were added to a
35
35 μl sample of 0.2 mM 15
N RhoA-GDP (residues 1–181) in NMR buffer (20 mM HEPES,
100 mM NaCl, 5 mM MgCl2, 2 mM Tris [2-carboxyethyl] phosphine [TCEP], 10% D2O [pH
7.0]). Nucleotide exchange was monitored by collecting successive 1H-
15N HSQC spectra at
20°C using 4 or 8 scans (10 or 20 min/spectrum), depending on the reaction rate. Ten pairs of
GDP/GTPγS-specific peaks (R5, V9, Q29, I46, A56, S73, Y74, D87, W158, T163) were used to
evaluate the fraction of GDP-bound RhoA present at each time point, and the data were fitted to
a single-phase exponential decay function to obtain the exchange rate, as described previously
(Gasmi-Searbrook et al., 2010). To measure RhoA activity of truncated Flag-Arhgef287-151
and
mutated Flag-Arhgef2T243K
, plasmids containing these sequences were transfected into HEK
293T cells using Polyfect (QIAGEN) and NMR analysis was performed on lysates as described
above.
Promoter analysis of ARHGEF2: Phylogenetic footprinting analysis was performed using mouse
and human sequences for ARHGEF2 (NM_1162383.1 and NM_004723.3, respectively) (Zhang
et al., 2003). Sequences were aligned to the genome with BLAT, where the TSS was ascertained
and DNA 1kb downstream (3’) and 5kb upstream (5’) was pulled from the database. The 5kb
and 1kb segments were analyzed separately using the Consite tool (Sandelin et al., 2004),
employing all matrices found in the publicly-available Jaspar database. 3 and 1 cluster(s) of
orthologous sequence areas were found in the 5kb and 1kb regions, respectively. In the 1kb
region, sites were primarily linked to NFB transcription factor binding sites. When this region
was expanded to include all Theria, 100% conservation was maintained. In the 5kb portion, the
region just upstream of the TSS was linked to MYF, c-FOS and SAP-1 binding sites and were
similarly well conserved across all Theria. H3K4me3 histone modifications were also analyzed
by pull-down chip-seq data and showed a peak around the TSS in both mouse and human
sequences. This peak overlaps with the putative NFB and MYF, c-FOS and SAP-1 binding sites
present just downstream and upstream of the TSS, respectively, providing further evidence that
these areas constitute the promoter region of ARHGEF2 (Ernst et al., 2011).
Statistical analyses: Values are expressed as means +/- standard deviation (SD) or +/- standard
error (SE) as indicated. Paired Student’s t-tests (Kirkman, 2006) were performed to determine
statistical significance between samples. Experiments were performed at least three times and
means with p < 0.05 were considered statistically significant.
36
2.4 Results
2.4.1 Arhgef2 protein expression is acutely induced by the RAS/MAPK
pathway
ARHGEF2 was identified as an upregulated gene in two independent studies looking at genome-
wide transcriptional changes induced by oncogenic H-RAS and K-RAS in mouse fibroblast cells
and human PDAC cells, respectively (Zuber et al., 2000, Qian et al., 2005). To discern whether
Arhgef2 protein expression was increased in cells transformed by each RAS family member, we
examined Arhgef2 levels in stable cell lines expressing H-RASV12
, K-RASD12
and N-RASD12
compared to non-transformed isogenic fibroblasts (Figures 2.1A and 2.1B). Arhgef2 protein
levels were upregulated in response to expression of each RAS family member and in proportion
to RAS/MAPK pathway activation, as assessed by ERK1/2 phosphorylation (Figure 2.1B). We
next determined whether Arhgef2 expression was a direct result of activated RAS or the
secondary result of the transformed state. We used a murine embryonic fibroblast (MEF) cell
line expressing a hydroxytamoxifen (4-OHT)-inducible form of H-RASV12
(ER:H-RASV12
)
(Gupta et al., 2007) that allowed us to examine Arhgef2 expression following the acute
expression of H-RASV12
. Arhgef2 expression increased within 2 hours of 4-OHT treatment
compared to cells treated with vehicle control (Figure 2.1C). These data show that Arhgef2 is a
direct target of H-RASV12
.
To assess which RAS pathway regulates Arhgef2 expression, we treated RASV12
-transformed
fibroblasts with chemical inhibitors of the main branches of RAS signaling, the MAPK pathway
and PI3K pathway. Treatment of H-RASV12
-transformed mouse fibroblasts with the MEK
inhibitors PD98059 (Figure 2.2A) or UO126 (Figure 2.2B) resulted in decreased Arhgef2 protein
expression, whereas treatment with the PI3 kinase inhibitor LY294002 had no effect (Figure
2.2C), suggesting that Arhgef2 protein expression is regulated in response to MAPK pathway
activation by oncogenic RAS.
37
Figure 2.1 Arhgef2 protein expression is acutely induced by oncogenic RAS. (A) Representative cell
morphologies of mouse fibroblasts stably expressing empty vector or T7-H-RASV12
, K-RASD12
or N-RASD12
family
members. (B) Immunoblot analysis of Arhgef2 expression in mouse fibroblasts depicted in (A). RAS and
phosphorylated ERK1/2 (pERK) levels represent RAS expression and pathway activation, respectively. Total
ERK1/2 (ERK) and tubulin expression serve as protein loading controls. Data are representative of three
independent experiments. (C) Immunoblot analysis of Arhgef2 expression following acute induction of H-RASV12
.
Mouse fibroblast cells stably expressing an estrogen receptor-tagged form of H-RASV12
(ER:H-RASV12
) were serum
starved for 16h followed by treatment with 100nM of 4-hydroxytamoxifen (4-OHT, upper panel) or vehicle control
(EtOH, lower panel) over the indicated time periods. RAS induction and equal protein loading were confirmed by
immunoblotting RAS and ERK1/2, respectively.
38
Figure 2.2 H-RASV12
-induced Arhgef2 upregulation is dependent on MAPK pathway activation. (A) Mouse
fibroblasts stably expressing T7-H-RASV12
were treated with DMSO or the MEK inhibitor PD98059 at the indicated
concentrations for 48h. Changes in Arhgef2 expression were assessed by immunoblotting. Phosphorylated ERK1/2
represents the degree of RAS/MAPK pathway activation and total ERK1/2 and tubulin serve as protein loading
controls. (B) H-RASV12
-transformed fibroblast cells were treated with DMSO or the MEK inhibitor UO126 at the
indicated concentrations for 48h and Arhgef2 protein expression was assessed by Western blot. Phosphorylated
ERK1/2 levels represent the level of MEK inhibition and total ERK1/2 protein levels serve as gel loading controls.
(C) H-RASV12
-transformed fibroblast cells were treated with DMSO or the PI3K inhibitor LY294002 at the
indicated concentrations for 48h and Arhgef2 protein expression was assessed by Western blot. Phosphorylated
AKT (pAKT) denotes the level of PI3K inhibition and total AKT serves as a protein loading control.
2.4.2 ARHGEF2 is a transcriptional target of the RAS/MAPK pathway
To discern whether RASV12
-mediated Arhgef2 upregulation occurred at the transcriptional level,
we measured ARHGEF2 transcripts by quantitative PCR and found that they were elevated by
two-fold in RASV12
-transformed fibroblasts relative to wild-type cells (Figure 2.3A). To
determine whether ARHGEF2 is a direct transcriptional target of RAS we identified a 1.9kb
region upstream of the first exon of ARHGEF2 predicted to contain the putative promoter
region, based on phylogenetic footprinting and CpG island enrichment, and cloned this region
into a luciferase reporter (Figure 2.3B). Expression of H-RASV12
induced a 7-fold increase in
ARHGEF2 promoter-mediated luciferase activity compared to cells expressing the ARHGEF2
promoter alone (Figure 2.3C, lanes 1 and 2). A similar level of the ARHGEF2 promoter
activation was measured in response to K-RASD12
(Figure 2.3D, lanes 1 and 2). ARHGEF2
promoter activity was quenched with the MEK inhibitor PD98059 (Figure 2.3C), indicating that
transcriptional activation of Arhgef2 requires MAPK pathway activation (Figure 2.3C, lanes 3
39
and 4). Together, these data show that Arhgef2 is a direct transcriptional target of the
RAS/MAPK pathway.
40
Figure 2.3 ARHGEF2 is a transcriptional target of the RAS/MAPK pathway. (A) ARHGEF2 transcripts were
quantified by real-time PCR in mouse fibroblasts stably expressing vector or T7-H-RASV12
. Transcript levels were
normalized to GAPDH and are represented as fold change over results from vector-only-expressing cells. Data
represent the mean of three independent experiments +/- SD (p=0.00018). (B) Schematic representation of the
putative promoter region of ARHGEF2. A 1907bp region upstream of the predicted transcription start site (TSS) was
cloned into the pGL3 luciferase reporter for subsequent luciferase assays. (C) The ARHGEF2 luciferase reporter
(pARHGEF2Luc) was co-expressed with empty vector or T7-H-RASV12
(lanes 1 and 2, respectively) and treated
with the indicated concentrations of PD98059 for 16h (lanes 3 and 4, respectively). Luciferase activity was
normalized to renilla expression and is represented as fold change over vector-expressing cells (upper graph). Data
are representative of three independent experiments +/- SE. Cell lysates were assayed for RAS expression and
MAPK pathway activity by immunoblotting for RAS and phosphorylated ERK1/2, respectively, and total ERK1/2
served as a protein loading control (lower panel). (D) Empty vector or T7-K-RASD12
expression plasmid was co-
transfected with pARHGEF2Luc and harvested for luciferase reporter assays. Luciferase activity was normalized to
renilla expression and is represented as fold change over results from vector-only-expressing cells (upper graph).
Data are representative of three independent experiments +/- SE with p=0.00028. RAS expression and
phosphorylated ERK1/2 were assessed by immunoblot as measures of RAS expression and RAS/MAPK activity,
respectively, and total ERK1/2 served as a gel loading control (lower panel).
2.4.3 Arhgef2 is required for cell survival downstream of oncogenic RAS
To discern the functional significance of Arhgef2 in RAS-mediated cellular transformation, we
stably knocked down Arhgef2 in murine fibroblasts transformed by RASV12
using two distinct
ARHGEF2-directed lentiviral hairpins (Figure 2.4B, lanes 4 and 5). Depletion of Arhgef2
induced an apoptotic cell phenotype (Figure 2.4A), which was confirmed by immunoblotting for
cleaved caspase-3 (Figure 2.4B). Moreover, Arhgef2 knockdown efficiency correlated with the
degree of cell death in RASV12
-transformed cells (Figure 2.4C).
In order to provide genetic support for the synthetic lethal interaction between Arhgef2 and
RASV12
, we examined the behaviour of RAS
V12 expression in murine embryonic fibroblasts
(MEFs) derived from ARHGEF2-/-
mice. Extensive cell death was observed in the Arhgef2-/-
fibroblasts following RASV12
expression, whereas wild-type fibroblasts expressing RASV12
exhibited a refractile, transformed morphology with little change in cell viability (Figure 2.4D,
columns 1 and 2). Moreover, re-expression of Arhgef2 in the ARHGEF2-/-
fibroblasts expressing
RASV12
restored cell survival, indicating that Arhgef2 is required for cell survival downstream of
RASV12
(Figure 2.4D, column 3).
41
Figure 2.4 Arhgef2 is required for cell survival downstream of oncogenic RAS. (A) Representative cell
morphologies of murine fibroblasts stably expressing H-RASV12
infected with a non-targeting hairpin (shGFP) or
two distinct ARHGEF2 shRNAs (shGEF1 and shGEF2) and selected with puromycin for 48h. Arrowheads show
rounded, pro-apoptotic cell morphologies of H-RASV12
transformed cells depleted of Arhgef2. (B) Cells described in
(A) were lysed 5 days after infection and Arhgef2 depletion and caspase 3 cleavage were analysed by Western
blotting with anti-Arhgef2 and anti-cleaved caspase 3 antibodies, respectively. Tubulin served as a protein loading
control. (C) Murine fibroblasts stably expressing H-RASV12
were infected with shGFP, shGEF1 or shGEF2 and cell
viability was determined by Alamar Blue staining after 72h (upper graph). Data are presented as percent viability
compared to shGFP-expressing cells and represent the mean of four independent experiments +/- SE. ** denotes
p<0.01 and * denotes p<0.05. 1000 cells were used per assay. Western blot analysis showing Arhgef2 expression in
shGFP and shGEF-expressing cells quantified by Alamar Blue is shown (lower panel), with GAPDH serving as a
protein loading control.
Expression of a cytoplasmically localized mutant of Arhgef2 exhibiting increased GEF exchange
activity (Arhgef287-151
, described in Meiri et al., 2012 and Figure 2.4E) with RASV12
rescued
cell survival in an ARHGEF2-/-
background (Figure 2.4D, column 4). However, expression of a
catalytically inactive form of Arhgef2 (Arhgef2T247D
, Meiri et al., 2012) also restored cell
42
viability in ARHGEF2-/-
fibroblasts expressing RASV12
, suggesting that the requirement for
Arhgef2 for RASV12
-mediated cell survival is independent of its enzymatic activity (Figure 2.4D,
column 5). Furthermore, expression of p115RhoGEF (ARHGEF1), a close homologue to
Arhgef2, and RASV12
in ARHGEF2-/-
fibroblasts was unable to compensate for a loss of Arhgef2
expression, despite exhibiting high RhoA exchange activity by NMR analysis (Figure 2.4E).
Together, these data demonstrate that RASV12
requires Arhgef2 expression, but not its RhoGEF
activity, for cell survival.
Figure 2.4 Arhgef2 is required for cell survival downstream of oncogenic RAS. (D) Representative images of
wild-type (ARHGEF2+/+
, top row) and ARHGEF2 knockout (ARHGEF2-/-
, bottom row) mouse fibroblasts
transfected with free eGFP (vector, column 1), eGFP-H-RASV12
(column 2), eGFP-H-RASV12
and Flag-Arhgef2
43
(column 3), eGFP-H-RASV12
and Flag-Arhgef287-151
(column 4), eGFP-H-RASV12
and Flag-Arhgef2T247F
(column
5) or eGFP-H-RASV12
and Flag-p115RhoGEF (column 6). Images were taken 4 days after transfection, following
selection of plasmid-expressing cells with G418. (E) Real-time NMR measurement of RhoA nucleotide exchange in
the presence of lysates from HEK 293T cells expressing eGFP, eGFP-Arhgef2, eGFP-Arhgef287-151
, eGFP-
Arhgef2E243K
or eGFP-p115RhoGEF. As rate of nucleotide exchange for p115RhoGEF was 9.4-fold over Arhgef2
(r=0.132 vs r=0.014), its graphical representation is not to scale, as indicated by the breaks in the graph. Error bars
represent +/- SD of a single experiment and data are representative of three independent experiments.
2.4.4 Arhgef2 contributes to RASV12-mediated cellular transformation in
vitro and in vivo
To determine whether Arhgef2 was required for RASV12
-mediated cell transformation, we
measured the ability of RASV12
-transformed fibroblasts to support anchorage-independent
growth in soft agar following knockdown of Arhgef2 (Figures 2.5A and 2.5B). Stable expression
of RASV12
stimulated the growth of NIH 3T3 cells in soft agar with a mean number of 95
colonies/1000 cells whereas stable knockdown of Arhgef2 with one of two distinct shRNAs,
reduced the number of colonies by 90% (n=9 colonies/1000 cells) compared to those cells
expressing a non-targeting hairpin (82 colonies/1000 cells) (Figures 2.5A and 2.5C). To address
the requirement of Arhgef2 in supporting tumor formation in RASV12
-transformed fibroblasts,
we generated subcutaneous xenografted tumors in NCr nude mice (Figure 2.5D). Parental and
shGFP-expressing cells formed tumors reaching mean volumes of 600mm3 and 530mm
3,
respectively, within 10 days of injection (Figure 2.5D, left graph) whereas Arhgef2-depleted
cells grew to a mean volume of 250mm3 and 200mm
3 for shGEF1 and shGEF2, respectively. A
two-fold-decrease in mean tumor weight was also measured in Arhgef2-depleted RASV12
xenografts compared to parental and hairpin controls (0.2g vs 0.5g, respectively) (Figure 2.5D,
right graph). Moreover, Arhgef2-depleted tumors exhibited increased caspase 3 cleavage relative
to parental and hairpin controls (Figure 2.5E). These data show that Arhgef2 is required for
RASV12
-mediated cell viability in vitro and in vivo.
The isolation of tumor cells derived from xenografts expressing Arhgef2 shRNAs revealed that
in a subset of tumors, Arhgef2 expression was regained (Figure 2.6E, lanes 8 and 9 and Figure
2.6F, lane 8). We found that 3 of 9 tumors stably infected with Arhgef2 shRNA exhibited
increased Arhgef2 protein levels compared to fibroblasts prior to injection. These data suggest
that selective pressures may promote the acquisition of mutations or epigenetic changes at the
44
site of shRNA integration that result in promoter inactivation, resulting in the reconstitution of
Arhgef2 expression. Alternately, contaminating macrophages or epithelial cells that contribute to
tumor growth in murine xenografts may account for the presence of Arhgef2 protein expression.
Figure 2.5 Arhgef2 contributes to RASV12
-mediated cellular transformation in vitro and in vivo. (A) Western
blot analysis of Arhgef2 and RAS expression in murine fibroblast cell lines stably expressing empty vector, H-
45
RASV12
, H-RASV12
and a hairpin control (shGFP, lane 3) or H-RASV12
and two distinct shRNAs targeting murine
ARHGEF2 (shGEF1 and shGEF2, lanes 4 and 5 respectively). Total ERK1/2 served as a protein loading control. (B)
Representative images of cell lines described in (A) resuspended in 0.3% agar to assess anchorage independent
growth. (C) Mean colony number is depicted graphically and represents total number of colonies greater than 2mm
in diameter per 60mm dish. Each experiment was performed in triplicate and results are the mean of three
independent experiments +/- SE; Student’s t-test was used to generate p-values with p=7.6E-5 (shGEF1 vs shGFP)
and p=1.0E-4 (shGEF2 vs shGFP) (** denotes p<0.01); 10000 cells were used per assay. (D) Representative images
of NCr nude mice injected subcutaneously with 1x106 cells described in (A). Tumors were harvested when control
tumors reached 1.5cm in diameter. Final tumor volumes and weights are depicted graphically and are the
combination of four independent experiments and a total of n=21 tumors per condition. Error bars indicate +/- SE;
Student’s t-test was used to generate p-values with p=0.0015 and p=0.0026 (shGFP vs shGEF1 and shGEF2 tumor
volumes, respectively) and p=0.0078 and p=0.034 (shGFP vs shGEF1 and shGEF2 tumor weights, respectively)
(**p<0.01, *p<0.05). (E) Representative images of immunohistochemical staining for cleaved caspase 3 in tumor
sections derived from parental, shGFP, shGEF1 and shGEF2-expressing NIH 3T3-H-RASV12
xenografts. Images
represent four tumors sampled from two independent experiments (n=8 per condition).
This highlights the requirement of Arhgef2 for RASV12
-mediated tumor growth and suggests that
tumors expressing mutant RAS positively select for high levels of Arhgef2 expression.
Figure 2.6 Arhgef2 protein expression is regained in a subset of Arhgef2-knockdown xenografts. (A, B)
Western blot analysis of Arhgef2 expression in stable cell lines (described in Figure 2.5A) before injection into nude
mice (lanes 1-5) and after harvesting from engrafted tumors (lanes 6-9). Each panel represents an independent
experiment from n=4 experiments. Actin served as a protein loading control.
2.4.5 Arhgef2 contributes to the increased proliferative capacity of RASV12-
transformed fibroblasts in a GEF-independent manner
Arhgef2 plays a role at several stages of cell-cycle progression in multiple cell types and is
localized to the mitotic spindle of dividing cells (Aijaz et al., 2005, Bakal et al., 2005, Birkenfeld
et al., 2007). Thus, we sought to determine whether Arhgef2 contributed to RASV12
-mediated
cell proliferation. Stable depletion of Arhgef2 in RASV12
-transformed fibroblasts with both
46
hairpins resulted in a 20% decrease in cell proliferation as assessed by BrdU incorporation
(Figure 2.7A). Expression analysis of cell cycle-associated genes in Arhgef2-depleted cells
expressing RASV12
revealed that cyclin A expression was significantly reduced (Figure 2.7B).
However, the expression of all other cyclins probed were unchanged, including the RhoA target
cyclin D1. Moreover, expression of the cell cycle inhibitor p21/WAF1, known to be negatively
regulated by RASV12
-induced RhoA signaling (Sahai et al., 2002), was reduced in Arhgef2-
depleted cells expressing RASV12
(Figure 2.7B, row 9). These results suggest that RhoA activity
may not be significantly altered in RASV12
-transformed fibroblasts depleted of Arhgef2 and that
Arhgef2 may contribute to RASV12
function in a GEF-independent manner. This hypothesis was
further supported by our earlier observations that a catalytically-inactive mutant of Arhgef2 was
able to rescue RASV12
-mediated cell survival in an Arhgef2-/-
background (Figure 2.4D). To
determine the effect of Arhgef2 depletion on Rho GTPase activity in RASV12
-transformed cells,
we probed for differences in the activities of RhoA and Rac1 in Arhgef2 knockdown cells
compared to hairpin control-expressing cells using Rhotekin-Rho binding domain (Rhotekin-
RBD) pulldown, RhoA G LISA and PAK-Rac binding domain (PAK-RBD) pulldown (Figures
2.7C-E). RhoA and Rac1-GTP levels were not significantly altered in Arhgef2 knockdown cells,
demonstrating that changes in the downstream activation of Rho GTPases can not account for the
requirement of Arhgef2 in RAS-mediated cellular transformation.
2.4.6 Arhgef2 is required for MAPK pathway activation in response to
oncogenic RAS
To understand the mechanism underlying the contribution of Arhgef2 to RAS-mediated cellular
transformation, we investigated whether elevated levels of Arhgef2 affected the signaling
characteristics of upstream components of the RAS/MAPK pathway as part of a potential
positive feedback mechanism. To that end, we expressed RASV12
in fibroblasts harboring stable
knockdown of Arhgef2 and probed lysates for phosphorylated forms of MEK1/2 and ERK1/2 to
assess MAPK pathway activity (Figure 2.8A). Both MEK1/2 and ERK1/2 were highly
phosphorylated in RASV12
-transformed fibroblasts expressing a non-targeting hairpin, while
MEK1/2 and ERK1/2 phosphorylation was significantly reduced when Arhgef2 was depleted in
these cells. A similar defect in RASV12
-mediated ERK1/2 phosphorylation was seen in Arhgef2-/-
47
fibroblasts relative to wild-type fibroblasts (Figure 2.8B). Expression of an shRNA-resistant
Arhgef2 cDNA (rArhgef2) or wild-type Arhgef2 restored MEK1/2 and ERK1/2 phosphorylation
in response to RASV12
in Arhgef2 knockdown and Arhgef2-/-
fibroblast cells, respectively,
demonstrating that Arhgef2 is required for RASV12
-induced activation of the MAPK pathway
(Figure 2.8A, lane 7 and Figure 2.8B, lane 5).
48
Figure 2.7 Arhgef2 contributes to the proliferative capacity of RASV12
-transformed fibroblasts in a GEF-
independent manner. (A) NIH 3T3, NIH 3T3-H-RASV12
or NIH 3T3-H-RASV12
cell lines stably expressing
shGFP, shGEF1 or shGEF2 were plated at 1000 cells/well in quadruplicate in 96-well plates and BrdU incorporation
was measured over 24h. Results represent the percentage of BrdU incorporation relative to NIH 3T3-H-RASV12
cells
and are the mean of three independent experiments +/- SE. (B) Western blot analysis of cell cycle-associated genes
in uninfected H-RASV12
-tansformed fibroblast cells (lane 1) or transformed cells stably infected with shGFP (lane
2), shGEF1 (lane 3) or shGEF2 (lane 4). Actin serves as a protein loading control. (C) Lysates derived from murine
H-RASV12
-transformed fibroblast cells stably expressing shGFP or shGEF2 were incubated with GST-tagged
Rhotekin-Rho binding domain (RBD). Active RhoA-GTP in pulldowns (lanes 1 and 3) and total cellular RhoA
(lanes 2 and 4) were detected by immunoblotting with anti-RhoA antibody. RhoA bound to RBD was normalized to
total cellular RhoA for each condition (lower graph). Data are representative of three independent experiments. (D)
Quantitation of RhoA-GTP levels in NIH 3T3-H-RASV12
-transformed cells expressing shGFP, shGEF1 or shGEF2
by RhoA G LISA. Data are representative of two independent experiments +/- SD. (E) Lysates derived from murine
H-RASV12
-transformed fibroblast cells stably expressing shGFP, shGEF1 or shGEF2 were incubated with GST-
tagged PAK-Rac binding domain. Active Rac1-GTP in pulldowns (first row) and total cellular Rac1 (second row)
were detected by immunoblotting with anti-Rac1 antibody. Data are representative of two independent experiments.
To determine the specificity of Arhgef2-mediated MAPK pathway activation, we attempted to
rescue the Arhgef2 knock down phenotype by expression of either AKAP-Lbc, the closest GEF
family member to Arhgef2, or p115 RhoGEF, another RhoGEF family. Neither AKAP-Lbc
(Figure 2.8A, lane 8) nor p115 RhoGEF (Figure 2.8B, lane 7 and Figure 2.4E) rescued MEK1/2
and ERK1/2 phosphorylation in response to acute RASV12
expression despite exhibiting high
GEF activity, showing that Arhgef2 is uniquely required to mediate RAS-dependent activation of
the MAPK pathway.
To determine whether Arhgef2-mediated MAPK pathway activation was dependent on its GEF
activity, we co-expressed a catalytically inactive, shRNA-resistant form of Arhgef2
49
(rArhgef2T243K
, Figure 2.4E) with RASV12
in fibroblasts depleted of endogenous Arhgef2 and
found that MEK1/2 and ERK1/2 phosphorylation was fully restored (Figure 2.8A, lane 8). These
findings were confirmed in Arhgef2-/-
fibroblasts (Figure 2.8B, lane 6). These data show that
Arhgef2 provides positive feedback loop for the RASV12
/MAPK pathway in a manner
independent of its GEF activity.
Figure 2.8 Arhgef2 is required for MAPK pathway activation in response to oncogenic RAS. (A) Mouse
fibroblasts stably expressing shGFP, shGEF1 or shGEF2 were transfected with empty vector (lanes 1, 3 and 5) or H-
RASV12
(lanes 2, 4 and 6) and assayed for ERK1/2 and MEK1/2 phosphorylation by Western blot. Rescue
experiments were performed in shGEF2-expressing cells by co-transfecting H-RASV12
with Flag-rArhgef2 (shRNA
resistant), Flag-Arhgef2E243K
or Flag-AKAPLbc (lanes 7, 8 and 9, respectively). Expression of plasmids was
confirmed by immunoblotting with anti-Arhgef2, anti-RAS and anti-Flag (AKAPLbc) antibodies and total levels of
ERK1/2 and MEK1/2 served as protein loading controls. (B) ARHGEF2+/+
or ARHGEF2-/-
MEFs were transfected
with eGFP (lanes 1 and 3), eGFP-H-RASV12
(lanes 2 and 4) or co-transfected with eGFP-H-RASV12
and Flag-
Arhgef2 (lane 5), eGFP-H-RASV12
and Flag-Arhgef2E243K
(lane 6) or eGFP-H-RASV12
and Flag-p115RhoGEF (lane
7) and assayed for ERK1/2 activation by Western blot. Blots were probed with Arhgef2, Flag and RAS antibodies to
confirm the expression from the transfected plasmids and total ERK1/2 and actin served as protein loading controls.
50
2.4.7 Arhgef2 is a component of the KSR-1 complex and is required for the
dephosphorylation of its negative regulatory site on S392
Given that Arhgef2 catalytic activity is dispensable for RASV12
-dependent MAPK pathway
activation, we hypothesized that Arhgef2 may be providing a scaffold function for components
of the MAPK pathway. First, we investigated whether Arhgef2 could form a complex with KSR-
1, a conserved MAPK scaffold that assembles pathway components into a large multiprotein
complex required for efficient signal transduction. Analysis of Flag-Arhgef2 immune complexes
from cells that expressed full-length or a series of Pyo-tagged KSR-1 deletions (Figure 2.9A)
revealed that full-length KSR-1, KSR-1(1-539), KSR-1(1-424) and to a lesser extent KSR-
1(542-873), could interact with full-length Arhgef2 (Figure 2.9B, lanes 3, 4, 5 and 8). These data
show that the C1 domain within the N-terminal half and the kinase domain of KSR-1 contribute
to Arhgef2 binding.
We next sought to determine whether the regulation of ERK1/2 activation by Arhgef2 depended
on KSR-1 or signals to ERK1/2 through an alternative pathway. The microtubule unbound form
of Arhgef2, Arhgef287-151
, was expressed in wild-type or KSR1-/-
fibroblasts (Figure 2.9C).
Arhgef287-151
induced strong ERK1/2 phosphorylation in wild-type MEFs even in the absence
of RASV12
expression (Figure 2.9C, lane 2), however, KSR-1-/-
fibroblasts were resistant to
Arhgef287-151
-induced ERK1/2 phosphorylation (Figure 2.9C, lane 4). Co-expression of
Arhgef287-151
and KSR-1, but not KSR-1 alone, restored ERK1/2 phosphorylation in KSR-1-/-
cells (Figure 2.9C, lanes 5 and 6, respectively), demonstrating that Arhgef2 requires KSR-1 to
positively regulate ERK1/2 activation.
Next, we investigated whether Arhgef2/KSR-1 binding affected the function of KSR-1. Growth
factor or RASV12
-induced KSR-1 function requires dephosphorylation of KSR-1 at 14-3-3
binding site S392 and subsequent translocation from the cytoplasm to the plasma membrane
(Ory et al., 2003). We queried the requirement for Arhgef2 in growth factor-mediated KSR-1
translocation by stimulating wild-type or ARHGEF2-/-
fibroblasts with PDGF and visualizing
endogenous KSR-1 localization by immunofluorescence (Figure 2.10A). In 21.65% (21 of 97) of
wild-type cells, KSR-1 translocated from the cytoplasm to the plasma membrane in a PDGF-
51
dependent manner (Figure 2.10A, columns 1 and 2 and Figure 2.10B). In contrast, in the absence
of Arhgef2 only 3.45% of cells (3 of 87) underwent PDGF-dependent membrane translocation
(Figure 2.10A, columns 3 and 4 and Figure 2.10B), a defect which was rescued by the expression
of wild-type Arhgef2, with 29.59% of cells (29 of 98) showing KSR-1 plasma membrane
localization (Figure 2.10A, columns 5 and 6 and Figure 2.10B).
Figure 2.9 Arhgef2 is a component of the KSR-1 complex and is required for the dephosphorylation of the
negative regulatory site S392 on KSR-1. (A) Schematic representation of Pyo-tagged KSR-1 deletion constructs
used to probe Arhgef2 binding in (B). (B) Pyo-tagged KSR-1 fragments depicted in (A) were co-expressed with
Flag-Arhgef2 in HEK 293T cells. Complexes were immunoprecipitated with anti-Flag antibodies and proteins were
detected by immunoblotting with anti-KSR-1 or anti-Flag (Arhgef2). (C) Immunoblot analysis of wild-type (WT) or
KSR-1 deficient (KSR-1-/-)
MEFs transfected with empty vector (lanes 1 and 3) or eGFP-Arhgef287-151
(lanes 2 and
4) and KSR-1-/-
MEFs co-transfected with eGFP-Arhgef287-151
and Pyo-KSR-1 (lane 5) or Pyo-KSR-1 alone (lane
6). Lysates were assayed for activating phosphorylations of ERK1/2 by immunoblotting. Expression of endogenous
and overexpressed proteins was determined by probing with anti-Arhgef2 and anti-KSR-1 antibodies and total
ERK1/2 served as a protein loading control.
52
Since KSR-1 plasma membrane translocation requires dephosphorylation of S392 (Ory et al.,
2003), we next determined if the non-phosphorylatable S392A point mutant form of KSR-1
could rescue the dependence on Arhgef2 for membrane translocation. We tested the capacity of
wild-type or KSR-1S392A
to translocate to the plasma membrane in ARHGEF2-/-
fibroblasts.
Whereas wild-type KSR-1 was largely unable to translocate to the plasma membrane (8.70% or
6 of 69 cells, Figure 2.10C and Figure 2.10D), KSR-1S392A
underwent greatly increased plasma
membrane localization even in the absence of Arhgef2 (36.84% or 28 of 76 cells) (Figure 2.10C,
columns 1 and 2 and Figure 2.10D). These data show that Arhgef2 is required for translocation
of KSR-1 to the plasma membrane in a manner that depends on the dephosphorylation of KSR-
1S392
. Lastly, we showed that re-expression of Arhgef2 and KSR-1 in Arhgef2-/-
fibroblasts was
insufficient to induce membrane translocation of KSR-1 in the absence of PDGF treatment
(5.97% or 4 of 67 cells) (Figure 2.10C, column 3 and Figure 2.10D). Moreover, the requirement
for growth factor stimulated KSR-1 translocation to the plasma membrane could be subverted by
the expression of Arhgef2∆87-151
, with 29.58% of cells (21 of 71) exhibiting KSR-1 plasma
membrane localization (Figure 2.10C, column 4 and Figure 2.10D) (Meiri et al., 2012). Both
Arhgef2∆87-151
and KSR-1 localized to the plasma membrane in the absence of PDGF stimulation
(Figure 2.10C, column 4, lower and upper panels, respectively). These data suggest that the
growth factor dependence of KSR-1 translocation may be conferred by the release of Arhgef2
from the microtubule array.
To determine whether Arhgef2 regulation of the RASV12
/MAPK cascade is coupled to the
dephosphorylation of KSR-1, we asked whether wild-type KSR-1 or KSR-1S392A
could restore
RASV12
-induced ERK1/2 phosphorylation in the absence of Arhgef2. We expressed shRNA-
resistant Arhgef287-151
, (rArhgef287-151
) together with either wild-type KSR-1 or KSR-1S392A
in
Arhgef2 knockdown fibroblasts (Figure 2.10E). As previously shown, RASV12
expression
induced ERK1/2 phosphorylation in hairpin control-expressing fibroblasts but not fibroblasts
depleted of Arhgef2 (Figure 2.10E, lanes 2 and 4). High expression of rArhgef2 in Arhgef2-
depleted cells greatly enhanced ERK1/2 activation in response to RASV12
, supporting the model
that increased levels of Arhgef2 results in amplification of the ERK1/2 cascade (Figure 2.10E,
lane 5). Importantly, expression of KSR-1S392A
was able to restore RASV12
-mediated ERK1/2
phosphorylation in Arhgef2 knockdown cells (Figure 2.10E, lane 6). However, wild-type KSR-1
was unable to fully restore ERK1/2 activation to the same extent as KSR-1S392A
despite similar
53
Figure 2.10 Arhgef2 is required for plasma membrane translocation of KSR-1. (A) Immunofluorescence
analysis of endogenous KSR-1 localization and eGFP or eGFP-Arhgef2 expression in ARHGEF2+/+
(columns 1 and
54
2) or ARHGEF2-/-
MEFs (columns 3-6) transfected with free eGFP (columns 2 and 4) or eGFP-Arhgef2 (column 6)
and treated with vehicle control (BSA, columns 1 and 3) or 25ng/ml PDGF for 10 min (columns 2, 4 and 6). Arrows
indicate plasma membrane localization of KSR-1 (columns 2 and 6, top row) and eGFP-Arhgef2 (column 6, bottom
row) in the transfected cells. Images are representative of four independent experiments. (B) Quantification of the
number of cells exhibiting KSR-1 membrane translocation in response to BSA, PDGF and/or eGFP-Arhgef2 in
ARHGEF2+/+
or ARHGEF2-/-
MEFs. Data are represented as percentage of cells analyzed in each condition and are
the combination of three independent experiments. (C) Immunofluorescence analysis of ARHGEF2-/-
MEFs co-
transfected with wild-type KSR-1 (columns 1, 3 and 4) or KSR-1S392A
(column 2) and free eGFP (columns 1 and 2),
eGFP-Arhgef2 (column 3) or eGFP-Arhgef287-151
(column 4). Cells were fixed and stained for KSR-1 (top row) or
eGFP (bottom row). Arrows indicate plasma membrane localization of KSR-1 (columns 2 and 4) and eGFP-Arhgef2
(column 4). Images are representative of four independent experiments. (D) Quantification of the number of cells
exhibiting KSR-1 membrane translocation in response to pyo-KSR-1, pyo-KSR-1S392A
, pyo-KSR-1 + eGFP-Arhgef2
or pyo-KSR-1 + eGFPArhgef287-151
in ARHGEF2-/-
MEFs. Data are represented as percentage of cells analyzed in
each condition and are the combination of three independent experiments. (E) Western blot analysis of murine
fibroblasts stably expressing shGFP, shGEF1 or shGEF2 transfected with empty vector (lanes 1 and 3) or H-RASV12
(lanes 2 and 4) or co-transfected with H-RASV12
and Flag-rArhgef2 (lane 5), Pyo-KSR-1S392A
(lane 6) and wild-type
Pyo-KSR-1 (lane 7). Inhibitory phosphorylation of KSR-1 on S392 was assessed using a phospho-KSR-1S392
-
specific antibody (KSR-1pS392) and ERK1/2 activation was detected with anti-phospho-ERK1/2. Anti-Arhgef2,
KSR-1 and RAS antibodies detected the expression of transfected plasmids and total ERK1/2 served as a loading
control.
expression levels (Figure 2.10E, lane 7). These data show that dephosphorylation of S392 of
KSR-1 is sufficient to overcome the Arhgef2 dependence of RASV12
-mediated ERK1/2
activation in fibroblasts.
2.4.8 Arhgef2 is required for PP2A-mediated dephosphorylation of KSR-1
on S392
We have identified Arhgef2 as a PP2A interacting partner in a proteomic screen designed to
probe for proteins that bound to the PP2A catalytic subunit (Meiri et al., manuscript in
submission) and we found that Arhgef2 interacts with the B’ regulatory PP2A subunits
(PPP2R5A, PPP2R5B and PPP2R5E). To determine the mechanism underlying the dependence
of KSR-1S392
dephosphorylation on Arhgef2, we hypothesized that Arhgef2 may act as a bridge
between KSR-1 and PP2A, since S392 dephosphorylation by PP2A in response to growth factor
stimulation has previously been described (Ory et al., 2003).
First, we confirmed the previously published data showing an interaction between KSR-1 with
the B’ regulatory PP2A subunits (Figure 2.11A) (Ory et al., 2003). We observed that Arhgef2
55
bound the same PP2A subunits that interact with KSR-1 (Figure 2.11A). We evaluated the
regions of Arhgef2 involved in PP2A and KSR-1 binding by expressing deletion mutants of
Arhgef2 and probing for the catalytic subunit of PP2A and KSR-1 in Arhgef2 immune
complexes (Figure 2.11B). Analysis of Arhgef2 immunoprecipitates revealed that endogenous
KSR-1 interacted with full-length Arhgef2, Arhgef2(236-572) and Arhgef2(236-433). These
results localize the binding site for KSR-1 to the DH domain of Arhgef2 (Figure 2.11C), while
PP2Ac binds to the Arhgef2 PH domain (Figure 2.11C). These data show that KSR-1 and PP2A
bind to distinct sites on Arhgef2 and suggest a model by which Arhgef2 may link KSR-1 to
PP2A.
To determine whether Arhgef2 is a scaffold that links KSR-1 to PP2A, we assessed the
requirement of Arhgef2 for the KSR-1/PP2A interaction. To that end, we stably infected PP2A B
subunit-expressing cells with Arhgef2 shRNA and probed PP2A immune complexes for KSR-1
(Figure 2.11D). Knockdown of Arhgef2 was confirmed by immunoblotting total cell lysates
(Figure 2.11D, fourth row). KSR-1 was detected in PPP2R5A, PPP2R5B and PPP2R5E (B’
subunit), but not PPP2R2A (B subunit) immune complexes. However, in Arhgef2-depleted cells,
KSR-1 could not be detected in any of the PP2A B’ subunit complexes. These data show that the
interaction between KSR-1 and PP2A is dependent on Arhgef2, providing a model whereby
Arhgef2 serves as a scaffold to recruit the PP2A B’ subunits required for the dephosphorylation
of the negative regulatory S392 site on KSR-1 and activation of the MAPK pathway.
56
Figure 2.11 Arhgef2 is required for PP2A-mediated dephosphorylation of KSR-1 on S392. (A) Flag-tagged
PP2A catalytic (lane 1) and regulatory (lanes 2-5) subunits were stably expressed in HEK 293T cells and PP2A
immune complexes were isolated using anti-Flag antibodies (row 1). PP2A complexes were probed for endogenous
Arhgef2 and KSR-1 (rows 2 and 3). Expression levels of Arhgef2 and KSR-1 in whole cell lysates are indicated in
rows 4 and 5. (B) Schematic representation of Arhgef2 constructs used in (C). (C) Flag-tagged Arhgef2 fragments
were expressed in HEK 293T cells and complexes were immunoprecipitated with anti-Flag antibody. Complexed
proteins were detected by immunoblotting with anti-KSR-1 or anti-PP2Ac antibodies and whole cell lysates were
probed for KSR-1 and PP2Ac expression. (D) HEK 293T cells stably expressing Flag-tagged PP2A regulatory
subunits PPP2R5A, PPP2R5B, PPP2R5E and PPP2R2A were infected with a hairpin control (shGFP) or shRNA
against human ARHGEF2 (shGEF). PP2A subunits were immunopurified with anti-Flag (row 1) and probed for the
presence of endogenous KSR-1 (row 2). Arhgef2 knockdown and PP2A subunit expression was confirmed by
immunoblotting whole cell lysates with anti-Arhgef2 and anti-Flag, respectively.
57
2.5 Discussion
In this chapter, we have uncovered a positive feedback loop in which MAPK-dependent
increases in Arhgef2 expression potentiate the MAPK cascade in RASV12
-transformed cells
(Figure 2.12). We found that Arhgef2 is transcriptionally upregulated by the RAS/MAPK
pathway and in turn positively regulates MAPK activation by facilitating the PP2A-mediated
dephosphorylation and activation of the MAPK scaffold, KSR-1, in response to RASV12
.
Arhgef2 functions independently of its GEF activity and acts as an adaptor molecule between the
PP2A B’ subunit family and KSR-1. Ablation of Arhgef2 prevents RASV12
- and KSR-1-
mediated MEK1/2 and ERK1/2 activation, induces apoptosis and reduces the growth of RASV12
-
induced xenografts. Together, these data provide mechanistic insight into the regulation of
MAPK signaling downstream of oncogenic RAS and propose a novel mechanism by which RAS
mutated cancers may select for increased MAPK survival signaling.
Figure 2.12 The Arhgef2/PP2A complex provides a positive feedback loop to the KSR/MAPK pathway in
RASV12
-transformed cells. Schematic model showing the induction of ARHGEF2 transcripts in response to MAPK
activation by oncogenic RAS. In the presence of RASV12
Arhgef2 can recruit the B’ subunit of PP2A to the inactive
58
KSR-1 complex, thereby facilitating its dephosphorylation on S392. KSR-1 can then translocate to the plasma
membrane, bringing Raf/MEK/ERK into close proximity and enhancing RASV12
-induced MAPK signaling.
The precise mechanism of ARHGEF2 transcriptional regulation downstream of the RAS/MAPK
pathway remains to be elucidated. One possibility is modulation via the transcription factor
hPTTG1, previously shown to regulate ARHGEF2 in breast cancer, as several studies have
indicated that activation or inhibition of the MAPK pathway can induce or repress hPTTG1
expression, respectively (Liao et al., 2012, Vlotides, 2006, Hernandez, 2008). Since the putative
promoter region of ARHGEF2 used in this study contains the hPTTG1 binding region, it is
possible that RAS/MAPK activation upregulates ARHGEF2 through an indirect mechanism
involving hPTTG1. Analysis of the promoter region of ARHGEF2 by phylogenetic footprinting,
however, revealed three conserved clusters of alternative transcription factor binding sites
(described in Experimental Procedures). One region lies immediately in front of, and another
downstream of, the transcription start site and contains putative myf, c-fos and SAP-1 and NFB
binding sites, respectively. c-fos, SAP-1 and NFB are activated by the RAS/MAPK pathway
and are therefore potential mediators of RASV12
-induced ARHGEF2 upregulation (Wang et al.,
2000, Galanis et al., 2001, Schulze-Osthoff et al., 1997).
Arhgef2 has been implicated in cell survival in several contexts. Arhgef2 is activated by TNF
in tubular epithelial cells and was shown to mediate cell survival in response to TNF,
hyperosmotic shock, taxol and EGF by inducing the post-translational stabilization of p21
(Kakiashvili et al., 2011, Nie et al., 2012). Lung cancer cells harboring mutations in p53
exhibited dose-dependent decreases in cell viability in response to Arhgef2 depletion (Mizuarai
et al., 2006). In the aforementioned studies, Arhgef2 was shown to affect cell survival and/or
proliferation via its GEF activity toward RhoA. Although RASV12
activates RhoA, we did not
detect a significant change in RhoA activity upon stable depletion of Arhgef2 in RASV12
-
expressing fibroblasts (Qiu et al., 1995). These data show that oncogenic RAS induces RhoA-
GTP independently of Arhgef2 and that Arhgef2 is likely not contigent on RASV12
-mediated
survival signaling by altering Rho GTPase levels. This is in agreement with Chen et al., who
found that increased RhoA-GTP levels induced by RASV12
were due to a decrease in
p190RhoGAP activity, with little change in total cellular Rho GEF activity or Rho-Rho GDI
immune complexes (Chen et al., 2003). Instead, oncogenic RAS promotes the adaptor function
of Arhgef2, perhaps by inducing its re-localization from RhoA to PP2A B’ subunit and KSR-1
59
pools in the cell through yet unidentified mechanisms. One interesting possibility is that
oncogenic RAS perturbs microtubule dynamics, resulting in the release of Arhgef2 from the
microtubule array. This hypothesis is supported by our observations that co-expression of KSR-1
and an Arhgef2 mutant incapable of binding microtubules (Arhgef287-151
) can potentiate MAPK
activation in the absence of growth factor stimulation or oncogenic RAS. Moreover, these data
implicate Arhgef2 in the interaction between anti-mitotic chemotherapeutic drugs (AMCDs) and
the inhibition of RAS/MAPK signaling. These agents are widely used for the treatment of solid
malignancies and act by interfering with microtubule dynamics, resulting in cell cycle arrest and
apoptosis (Jordan and Wilson, 2004, Wilson et al., 1999). MAPK signaling has been shown to be
modulated by AMCDs and is implicated in AMCD resistance (Shinoharah-Gotoh et al., 1991,
Orr et al., 2005). Thus, one might speculate that AMCD-induced Arhgef2 release from
microtubules may contribute to the acquired resistance of cancer cells harboring RAS mutations.
Alternately, Arhgef2 may contribute to inhibition of MAPK signaling in AMCD-responsive
tumor cells. This is highly dependent on whether the AMCD in question induces the
sequestration or release of Arhgef2 from the microtubule array, as different classes of AMCDs
can act by destabilizing or stabilizing microtubules and would thereby impinge on Arhgef2
regulation in opposing manners. Ascertaining the relationship between oncogenic RAS,
microtubule regulation and different AMCDs would therefore be an interesting area of future
study.
Although we cannot exclude the possible contribution of subtle Arhgef2-mediated changes in
RhoA activity to increased cell survival downstream of oncogenic RAS, Arhgef2-dependent
KSR-1 regulation can account for the discrepancy between a mild decrease in RhoA activity and
strong inhibition of cell survival and transformation in Arhgef2-depleted cells. KSR-1 is critical
for cell survival in EGFR and oncogenic RAS-dependent tumors via activation of the MAPK
pathway (Xiao et al., 2010). Furthermore, KSR-1 is required for cellular transformation in
response to oncogenic RAS and this is strictly dependent on the dephosphorylation of KSR-1 at
S392 by PP2A (Kortum et al., 2004, Joneson et al., 1998, Razidlo et al., 2004, Nguyen et al.,
2002, Ory et al., 2003). KSR-1 has also been shown to mediate TNF-induced cell survival in
intestinal epithelial cells through the activation of ERK1/2, suggesting that Arhgef2 and KSR-1
may cooperate in other cellular contexts (Yan et al., 2001, Yan et al., 2004).
60
Until now, the mechanism of growth-factor induced recruitment of the regulatory subunit of
PP2A to KSR-1 in mammalian cells was unknown (Ory et al., 2003). Here, we provide evidence
that Arhgef2 functions as an adaptor protein, linking the PP2A B’/PR61/B56/R5 subunit to the
KSR-1/PP2A complex in response to RAS activation, thereby potentiating oncogenic signaling.
The functional significance of these interactions is supported by genetic evidence in C. elegans,
where the regulatory subunit of PP2A was found to be a critical activator of PP2A-mediated
RAS signaling (Sieburth et al., 1999, Kao et al., 2003). These data therefore place Arhgef2 at a
critical point in the regulation of KSR-1. Although PP2A has been shown to negatively regulate
MAPK signaling at the level of MEK1/2 and ERK1/2, it is unlikely that Arhgef2 mediates these
interactions since it has been shown to require the B/PR55/R2 family of regulatory PP2A
subunits and not the B’/PR61/B56/R5 subunit family shown to bind Arhgef2 and KSR-1 in this
study (Zhou et al., 2002, Sontag et al., 1993, Silverstein et al., 2002 and Meiri et al., in
submission). In support of this observation, only depletion of the B subunit of PP2A was shown
to activate ERK1/2 signaling in Drosophila Schneider 2 cells, while depletion of the B’ alpha
and beta subunits induced apoptosis (Silverstein et al., 2002). These data further substantiate a
role for Arhgef2-mediated KSR-1 function in cell survival downstream of RASV12
and suggest
that by initiating the formation of PP2A/B’ subunit complexes, increased Arhgef2 expression
may favor the positive regulation of the MAPK cascade in RASV12
-transformed cells.
The recruitment of PP2A to KSR-1 by Arhgef2 may also explain the requirements of the PH and
DH domain of Arhgef2 for cellular transformation (Whitehead et al., 1995). It was originally
speculated that the PH domain is responsible for targeting Arhgef2 to the plasma membrane,
where it could exert its exchange activity on RhoA; however, subsequent studies have not
substantiated a requirement for plasma membrane localization of Arhgef2 for its catalytic
activity. Considering that the PH domain and DH domains of Arhgef2 are required for its
interaction with PP2A and KSR-1, respectively, one may speculate that Arhgef2 partially elicits
its classical transforming ability via the activation of KSR-1. This is in agreement with the
observation that while wild-type KSR-1 is unable to transform fibroblasts independently,
moderate overexpression of a double S392/T274 mutant of KSR-1 can induce anchorage-
independent growth in the absence of RASV12
(Razidlo et al., 2004).
61
The results presented in this chapter unveil an essential role for Arhgef2 in RASV12
-mediated
cellular transformation in fibroblast cells. A critical question that remains, however, is whether
the function of Arhgef2 in RASV12
-induced fibroblast transformation is paralleled in human
epithelial tumors harboring endogenous RAS mutations. Moreover, it is of considerable interest
to determine if Arhgef2 contributes to the malignant conversion of RAS-mutated tumors, where
current therapies are most ineffective. To begin to answer these questions, in the next chapter I
will query the role of Arhgef2 in human epithelial models of RAS tumorigenesis and its effect on
their epithelial-to-mesenchymal (EMT) conversion.
62
Chapter 3
Arhgef2 is Required for Primary Tumorigenesis and
Promotes Mesenchymal Transition in Pancreatic Ductal
Adenocarcinoma
3.1 Abstract
Mutations in K-RAS are present in 20% of human solid malignancies, including 95% of
pancreatic ductal adenocarcinomas (PDACs), 50% of colorectal tumors and 30% of non-small-
cell lung cancers (NSCLCs) (Maitra et al., 2003, Johnson et al., 1993, Rodrigues et al., 1990).
PDAC has one of the shortest five-year survival rates, exhibiting overwhelming resistance to
currently available therapies (Coz et al., 2002). In this chapter, we find that Arhgef2 is required
for proliferation and survival across several RAS-mutated human epithelial cancer cell lines.
Arhgef2 contributes to primary tumorigenesis in PDAC xenograft models and potentiates MAPK
signaling in these cells by a parallel mechanism to that observed in fibroblasts. Furthermore,
analysis of human tumor microarrays (TMAs) revealed that Arhgef2 protein expression
correlates with progressive tumor grade in PDAC, colorectal and NSCLC cancers, implicating
Arhgef2 in the malignant conversion of RAS-mutated tumors. Indeed, we find that Arhgef2
promotes a mesenchymal morphology in PDAC and NSCLCs harboring RAS mutations.
Arhgef2 depletion results in a reversion to an epithelioid gene signature, cell morphology and
increased E-cadherin protein expression. Moreover, Arhgef2 is required for epithelial-to-
mesenchymal transition (EMT) in a murine mammary epithelial cell model of TGF-induced
EMT. Together, these data implicate Arhgef2 at multiple stages of RAS tumorigenesis and
suggest that Arhgef2 may be an effective therapeutic target in PDAC and other cancers.
63
3.2 Introduction
Over 85% of human cancers arise from epithelial cells, making them pertinent model systems to
study the mechanisms contributing to human tumorigenesis. Epithelial cells are cuboidal,
polarized cells that associate closely together to form an organized, compact epithelium that lines
the cavities and surfaces of structures throughout the body. The epithelium is held together
through several types of interactions, including zona occludens-1 (ZO-1) containing tight
junctions, E-cadherin-based adherens junctions, desmosomes and gap junctions (Radisky, 2005).
Together, these epithelial sheets form protective barriers against external environmental hazards
and foster physiologically defined subdomains within different organs of the body.
Epithelial cancers, or carcinomas, progress in a multistep fashion via the sequential accumulation
of genetic lesions within an epithelial cell (Figure 3.1) (Weinberg, RA, 1989). According to this
paradigm, each oncogenic event confers the tumor cell with transforming properties that
culminate in a fully malignant tumor. In colorectal and pancreatic cancer, this step-wise genetic
model has been phenotypically aligned with graded yet distinct neoplastic changes in the tissue
with progressive stages of tumorigenesis (Fearon et al., 1990, Hruban et al., 2001). The
consecutive pre-invasive stages of pancreatic tumorigenesis have been morphologically
categorized as pancreatic intraepithelial neoplasias 1A, 1B, 2, 3 (PanIN-1A, -1B, PanIN-2,
PanIN-3) and advanced pancreatic ductal adenocarcinoma (PDAC), and are genetically defined
by the sequential gain or loss-of-function mutations of K-RAS, p16/INK4, p53 and smad4,
respectively (Hruban et al., 2001, Schneider et al., 2003, Apple et al., 1999, Wilentz et al., 1998,
DiGiuseppe et al., 1994, Wilentz et al., 2000). K-RAS mutations are considered the primary
initiating event in PDAC, as they are commonly found in pre-neoplastic tissues (Klimstra et al.,
1994, Tada et al., 1996). p53 overexpression and smad4 loss, however, are detected late in
PDAC progression and drive its malignant conversion (DiGiuseppe et al., 1994, Wilentz et al.,
1998).
Epithelial-to-mesenchymal-transition (EMT) is a defining feature of late-stage tumorigenesis, as
it enables the invasion of tumor cells through the basement membrane and to distant organs of
the body. EMT is characterized by the dissolution of epithelial cell junctions, a loss of cell
64
Figure 3.1 Multistep tumorigenesis in pancreatic ductal adenocarcinoma. Progressive changes in pancreatic
ductal epithelial cell growth and architecture are demonstrated schematically (above) and immunohistologically
(below, with epithelial cell layer stained with keratin in dark blue). PanIN-1A predominantly develops following
mutations in K-RAS, with subsequent losses in p21, p16, p53 and SMAD4 tumor suppressors contributing to
neoplastic progression (PanIN-1B-PanIN-3) and ultimately, malignant conversion (ADC) (adapted from Ma et al.,
2011).
adhesion and polarity, and the acquisition of a motile, mesenchymal phenotype (Guarino et al.,
2007). At the molecular level, mesenchymal conversion involves the downregulation or
delocalization of junctional proteins such as E-cadherin and ZO-1 and the upregulation of
mesenchyme-defining genes like vimentin (Peinado et al., 2004). E-cadherin loss is the most
prominent feature of EMT and is sufficient to induce the full mesenchymal transition of an
epithelial cell by decreasing cell-cell adhesion and promoting invasion and motility (Lehembre et
al., 2008, Thompson et al., 1994). Mesenchyme-specific transcription factors are also induced,
resulting in widespread gene expression changes to sustain the mesenchymal phenotype (Taube
et al., 2010, Kim et al., 2010, Hoshida et al., 2009).
Transforming growth factor- (TGF) regulates a diverse number of processes including cell
proliferation, differentiation, apoptosis, and EMT (Shi et al., 2003). TGF ligands function by
binding type I TGF serine/threonine kinase receptors, triggering their dimerization with type II
receptors, and the subsequent phosphorylation and activation of smad proteins. Membrane-
associated smad7 activates the cytoplasmic smads 2 and 3, which then cooperatively activate
65
smad4, resulting in its nuclear translocation and the transcription of target genes (Shi et al.,
2003). TGF has been shown to drive EMT via smad-dependent and independent pathways, the
latter of which include RAS, JNK, p38, ERK, PI3K and RhoA signaling (Oft et al., 1996, Atfi et
al., 1997, Hartsough et al., 1995, Bakin et al., 2000, Bhowmick et al., 2001). TGF can drive
mesenchymal transition through the reorganization of cytoskeletal components and breakdown
of cell-ECM interactions and through the activation of EMT-inducing transcription factors such
as NFB, snail, and slug (Janda et al., 2002, Ozdamar et al., 2005, Huber et al., 2004, Peinado et
al., 2003, Peinado et al., 2004).
The Rho GTPases have been linked to EMT via TGF-dependent and independent mechanisms.
Rho proteins positively regulate motility, migration and invasion by modulating the actin
cytoskeleton and by regulating cell adhesion in fibroblast cells (Ridley et al., 1992, Kaibuchi et
al., 1999). In addition, RhoA regulates the formation of cadherin-based cell-cell contacts in
epithelial cells (Braga et al., 1999). RhoA activation has been established in the reversion of an
epitheloid phenotype toward a migratory, fibroblastoid phenotype in NIH 3T3 cells and is
required for TGF-induced mesenchymal transition in a mammary epithelial cell model of EMT
(Sander et al., 1999, Bhowmick et al., 2001). RhoA promotes the invasive phenotypes of tumor
cells and contributes to metastases in xenograft tumor models, highlighting its essential role in
tumor progression (Yoshioka et al., 1998, Yoshioka et al., 1999).
Arhgef2 activates RhoA and has been shown to localize to and regulate the permeability of
epithelial and endothelial tight junctions (Benais-Pont et al., 2003, Birukova et al., 2006,
Guillemot et al., 2008). Increased expression of Arhgef2 at the apical junctions of epithelial cells
results in junctional disassembly, thereby compromising epithelial barrier function (Samarin et
al., 2007). In fibroblast cells, Arhgef2 initiates stress fiber and focal adhesion formation via its
exchange activity on RhoA, thereby regulating migration and cell adhesion (Krendel et al., 2002,
Callow et al., 2005, Nalbant et al., 2009, Guilluy et al., 2011). Furthermore, Arhgef2 is a
transcriptional target of TGF and mediates TGF-induced migration in retinal epithelial cells in
a RhoA-dependent manner (Tsapara et al., 2010). Arhgef2 has also been shown to promote the
metastatic potential of breast cancer cells overexpressing hPTTG1 by increasing their invasive
properties (Liao et al., 2012).
66
In chapter 2, we identified ARHGEF2 as a transcriptional target of oncogenic RAS in fibroblast
cells that was essential for RAS-mediated survival and transformation. Given the high proportion
of RAS mutations in PDAC, we hypothesized that Arhgef2 levels may be elevated in pancreatic
tumors and contribute to primary tumorigenesis. Moreover, we predicted that Arhgef2 may
contribute to EMT by promoting the dissolution of cell junctions and increasing their migratory
properties.
67
3.3 Experimental Procedures
Cell lines and cell culture: HEK 293T, PANC-1, HPAF-II, PL-45, (from ATCC), H1264, DLD1,
DK04 (from Ming Sound-Tsao, Princess Margaret Hospital, Toronto, ON) and NMuMG (from
Jeff Wrana, Samuel Lunenfeld Research Institute, Toronto, ON) cell lines were cultured in
Dulbecco’s modified Eagle medium (DMEM, Life Technologies Inc.) supplemented with 10%
fetal bovine serum (FBS) (HyClone). SK-OV-3 (from Gordon Mills, The University of Texas,
MD Andersen Centre, Houston, Texas), BxPC3, H727, A549 (ATCC) and H520 (from Ming
Sound-Tsao) cell lines were cultured in RPMI 1640 (Life Technologies Inc.) supplemented with
10% FBS. CFPAC-1 and HCT116 cell lines were cultured in Iscove’s Modified Dulbecco’s
Medium (Life Technologies Inc.) and McCoy’s 5A Modified Medium (Life Technologies Inc.)
supplemented with 10% FBS, respectively. Panc04_03 and Panc02_03 (from Troy Ketela,
Donnelly Centre and Banting & Best Department of Medical Research, Toronto, ON) were
cultured in RPMI 1640 supplemented with 10 Units/ml human insulin (85%) and 15% FBS.
NMuMG cells were transfected using Effectene (QIAGEN) according to the manufacturer’s
instructions. Stable HEK 293T, PANC-1, HPAF-II, BxPC3, A549, H727 (human) and NMuMG
(murine) ARHGEF2 knockdown cell lines were established by co-transfecting the packaging cell
line HEK 293T with human or murine ARHGEF2 lentiviral hairpin plasmids and packaging
plasmids pPAX2 and VSV-g using the CalPhos Mammalian Transfection Kit (Clontech).
Lentiviral supernatants were collected, filtered and incubated with the target cells in the presence
of 8g/ml Polybrene (Sigma). After 48h cells were subjected to puromycin (Sigma) selection
(6g/ml for PANC-1, 3g/ml for HPAF-II, 2g/ml for HEK 293T and BxPC3 and 4g/ml for
NMuMG cells) until all untransduced cells died. For proliferation assays, Panc04_03, Panc02_03
and PL-45 cells were selected with 2.5g/ml, 2g/ml and 4g/ml puromycin, respectively. All
cultures were maintained in a 5% CO2 environment at 37oC.
Expression constructs: Full-length (Arhgef2 or Arhgef21-985
) and mutated (Arhgef2T247F
)
versions of murine and human ARHGEF2 cDNA (accession no. AF177032 and NM_004723.3,
respectively) were subcloned into the pFlag-CMV2 vector (Sigma) or pEGFP-C1 (Invitrogen).
Full-length murine p115RhoGEF cDNA (accession no. NM_001130150.1) was subcloned into
pFlag-CMV2 vector. Murine and human ARHGEF2 pLKO.1 lentiviral shRNA constructs are as
68
described in Chapter 2 (Section 2.3, Table 1). pCDNA3-Pyo-KSR-1 wild-type and mutant
expression vectors were kind gifts from Deborah Morrison and were generated as described in
Muller et al., 2001.
Cell treatments: For MEK and PI3K inhibition experiments OV-90, CFPAC-1, SK-OV-3,
HCT116 or PANC-1 cell lines were cultured in full medium and incubated with PD98059,
UO126 or LY294002 (Sigma) diluted in DMSO (Sigma) for 48h. For ROCK inhibition
experiments, NMuMG cells were cultured in full medium and treated with 10M Y27632
(Sigma) for 48h. For TGF induction experiments, human TGF1 (Cell Signaling, CN 8915)
was diluted in 20M Citrate at a pH of 3.0 to a stock concentration of 100g/ml. TGF1 was
added to complete cell culture medium at a final concentration of 10nm/l over indicated time
periods and was replaced every 24h.
Western blotting: Cells were scraped into ice-cold lysis buffer (30mM Tris pH7.5, 150mM NaCl,
1% Triton X-100, 0.2% sodium deoxycholate, 10mM NaF, 1mM Na3VO4 and 1mM PMSF) with
Complete Protease Inhibitor cocktail (Roche) and incubated on ice for 20min, followed by
centrifugation at 16,060xg at 4oC for 10min. Cleared lysates were resuspended in 2X sample
buffer, boiled and protein resolved by SDS-PAGE before transfer to PVDF membranes and
immunoblotting. For experiments analysing epithelial cell marker expression, cells were lysed
directly in 2X sample buffer containing 62.5mM Tris-HCl pH 6.8, 2.5% SDS, 10% glycerol, 5%
-mercaptoethanol and 0.02% bromophenol blue, boiled and resolved by SDS-PAGE as
described above.
Antibodies: Polyclonal sheep anti-Arhgef2 murine antibodies were raised as described previously
(Bakal et al., 2005). Monoclonal mouse anti-Arhgef human antibodies 3C5 and 14B11 were
designed using N- and C-terminal human Arhgef2 peptides, respectively, and generated by
hybridoma. Texas Red anti-mouse IgG (T-862) was obtained from Invitrogen. Western blotting
and immunofluorescence were performed using the following primary antibodies: anti-RAS
(CST, 3965), anti-p44/42 MAPK (pERK1/2) (CST, 9102), anti-phospho-p44/42 MAPK
(ERK1/2) Thr202/Tyr204 (CST, 9106), anti-cleaved caspase 3 (CST, 9661), anti-KSR-1 (gift
from Deborah Morrison, see Cacace et al., 1999 for description of KSR-1 antibody generation),
anti-phospho-KSR-1 S392 (CST, 2502), anti-E-cadherin (CST, 3915), anti-vimentin (Santa Cruz
69
Biotechnology, V9, SC 6260), anti-Zeb1 (Santa Cruz Biotechnology, H-102, SC 25388), anti-
alpha tubulin (Molecular Probes), anti-actin (Sigma), anti-GAPDH (Invitrogen), anti-Flag (M2,
F3165, Sigma) and anti-GFP (Invitrogen, G10362). HRP-conjugated anti-mouse or anti-rabbit
secondary antibodies were from GE Healthcare.
Quantitative real-time reverse transcription PCR: Total cellular RNA was extracted from
PANC-1shGFP or PANC-1shGEF1 cell lines using the RNeasy Plus Mini Kit (QIAGEN). 1g
of RNA was converted into double-stranded cDNA at 42oC using ImProm-II
TM Reverse
Transcription System (Promega, Madison, USA) following the manufacturer’s instructions.
Quantitative PCR was performed with 50ng of template cDNA mixture from each cell line with
SYBR Green human ARHGEF2, CDH1 and GAPDH primers (Primer Bank) (Table 2).
Table 3.1: Gene Target Primer Sequences
GENE Forward primer Reverse primer
ARHGEF2 5'-CAGGCATGACCATGTGCTATG-
3'
5’-TTTACAGCGGTTGTGGATAGTC-
3’
CDH1 5’- CGAGAGCTACACGTTCACGG-
3’
5’- GGGTGTCGAGGGAAAAATAGG-
3’
GAPDH 5’-ACCACAGTCCATGCCATCAC-3’ 5’-TCCACCACCCTGTTGCTGT-3’
Quantitative PCR was performed using the CFX96 Real-Time PCR Detection System from Bio-
Rad, and results were analyzed using the software Bio-Rad CFX. Gene expression levels in the
samples were calculated relative to control using the comparative CT method: CT = CTsample –
CTcontrol, fold change = 2-CT
. GAPDH expression was used to normalize target gene
expression levels.
Proliferation assays: Panc02_03, Panc04_03 and PL-45 cells were plated in the appropriate
growth medium containing 8ug/ml polybrene and infected with lentiviral expression contructs
encoding two distinct shRNAs targeting human ARHGEF2 (shGEF1 and shGEF2), shGFP
(negative control) or shPSMD1 (positive control). After 24h the cell culture medium was
replaced with fresh medium containing puromycin. 48h later infected cells were harvested by
70
trypsinization, counted and re-plated at 3000 cells/well on a 96-well plate in quadruplicate for
phenotypic analysis. 72h later cells were washed with 1X PBS, fixed in 4% PFA, permeabilized
with 0.1% Triton X-100 and stained with Hoechst. Nuclei were imaged using a GE IN Cell
Analyzer 2000 and nuclei were counted using IN Cell Developer Toolbox 1.9 software. Results
were plotted as percent proliferation relative to the shGFP control-expressing cells.
BrdU incorporation: PANC-1-shGFP, PANC-1-shGEF1 and PANC-1-shGEF2 stable cell lines
were plated at 1x103 cells per well in a 96-well microplate in quadruplicate. BrdU reagent
(Roche) was added to cells after 24h and incorporation was measured after 24h by colorimetric
detection as per the manufacturer’s protocol (Roche, 11647229001). Values reflect percentage
BrdU incorporation relative to shGFP-expressing cells and represent the mean of three
independent experiments.
Immunofluorescence imaging: Cells grown on glass coverslips were treated as indicated in the
corresponding figure legends and fixed with 4% PFA for ten minutes, washed three times with
1X PBS and permeabilized with 0.1% Triton X-100 for 5min. The coverslips were blocked with
0.5% w/v BSA in 1X PBS for 1h at room temperature and incubated with primary antibody
(anti-rabbit anti-E-cadherin 1:100, anti-mouse anti-vimentin 1:50) in 0.5% BSA/1X PBS at 37oC
for 30 min or at 4oC overnight. Coverslips were washed three times with 1X PBS and incubated
with secondary antibody (1:500) at 37oC for 1h. Slides were washed once with 1X PBS,
incubated with DAPI stain (Invitrogen) at a final concentration of 1:30000 in PBS for 5min at
20oC and washed a final time with 1X PBS. Slides were mounted using GelTol mounting
medium (Shandon Immunon, Thermo Electron Corporation). Confocal imaging was performed
with an Olympus IX81 inverted microscope using a 60X zoom x3(1.4 NA; PlanApo, Nikon)
objective, and FluoView software (Olympus, Tokyo, Japan). Resolution was 512x512 with 12
bits/pixel. The following excitation wavelengths were used for green (473 nm), Texas Red (559
nm) and blue (358nm). All images in each set of experiments were acquired with the same
microscope sensitivity settings. All images compared within each figure panel were acquired on
the same day, with identical staining conditions, gain and contrast settings, and the same
magnification.
Animal studies: All animal studies were carried out using protocols that have been approved by
the UHN Animal Care Committee. Xenograft studies in severe combined immunodeficient
71
(SCID) mice with PANC-1, HPAF-II and BxPC3 cell lines were performed with 2x105 cells
resuspended in serum-free medium and injected subcutaneously into the abdominal tissue of the
mice. The mice were kept for up to 3 months and tumor measurements were taken bi-weekly.
When tumors reached a diameter of 1.5cm or became ulcerated, the mice were sacrificed by
carbon dioxide asphyxiation. The tumors were removed, weighed, measured and fixed in 10%
buffered formalin for histologic processing or flash-frozen in liquid nitrogen for protein and/or
RNA analysis. 5 injections were performed per condition and each cell line was performed in
duplicate. Tumor measurements were taken with a calliper and tumor volume was calculated by
the ellipsoid formula V=/6 x (l x w2), where l and w denote the longest and shortest diameter,
respectively.
Immunohistochemistry: For human pancreatic tissue analysis, tissue microarrays (TMA) of
normal pancreatic ducts, pancreatic intraepithelial neoplasia (PanIN) lesions and adenocarcinoma
were constructed from paraffin blocks of Whipple resection specimens, as described previously
(Al-Aynati et al., 2004), and following a study protocol approved by the UHN Research Ethics
Board. TMAs from normal colon, primary and metastatic colorectal tumors or from normal lung
and primary lung adenocarcinomas (ADC) harboring wild-type K-RAS or K-RASD12
mutations
were similarly derived. Immunohistochemistry was performed using the Biotin-Streptavidin-
HRP detection system and a human Arhgef2 antibody (14B11 mouse monoclonal antibody) at a
1:500 dilution. To evaluate the expression levels of Arhgef2, staining intensity in the ductal,
epithelial cells or lesions were judged by two pathologists and scored as 3 (strong staining), 2
(moderate staining) or 1 (weak staining). As staining was observed to be diffuse in the tumors
analyzed, percentage of tumor cell stained was not recorded. Tumor sections derived from
PANC-1shGFP and shGEF1 xenografts were derived as described under Animal Studies and
were probed for caspase 3 cleavage using anti-cleaved caspase 3 (Asp 175) antibody (CST,
9661) using the Biotin-Streptavidin-HRP detection system.
RNA preparation and microarray: Total RNA was isolated from cultured cells using the RNeasy
Mini kit (QIAGEN). The quality of RNA was verified using agarose gel and the Agilent
bioanalyzer (Agilent technologies, Palo Alto, CA). 200ng of RNA were labeled using Illumina
TotalPrep-96 RNA Amplification kit (Ambion, lot 1107026) as per the amplification protocol.
750ng of cRNA (PANC-1shGFP and PANC-1shArhgef2 cell lines) generated from amplification
72
and labeling were hybridized into 1 Human HT-12 v4.0 BeadChip and 1.5ug cRNA (NIH 3T3-
H-RASV12
shGFP and NIH 3T3-H-RASV12
shArhgef2 cell lines) was used for mouse WG-6 v2.
The BeadChip was incubated at 58oC at rotation speed 5 for 18h for the hybridization. The
BeadChips were washed and stained as per the Illumina protocol and scanned on the iScan
(Illumina). The data files were quantified in GenomeStudio Version 2011.1 (Illumina). All
samples passed Illumina’s sample dependent and independent QC metrics. Sample preparation
and hybridization were done at the UHN Microarray Centre at the MaRS Centre (Toronto,
Ontario, Canada). Comparative analysis was performed between PANC-1shGFP and PANC-
1shArhgef2 and NIH 3T3-H-RASV12
shGFP and NIH 3T3-H-RASV12
shArhgef2 cell lines.
Functional annotation of gene sets was performed using the DAVID Bioinformatics resource
website (http://david.abcc.ncifcrf.gov/) Functional Annotation tool. In PANC-1shGFP vs PANC-
1shArhgef2 cell lines, the 416 most downnregulated genes (<-1.52fold change or <-0.6 DF(log2))
and 399 most upregulated genes (>1.52 fold change or >0.6 DF(log2)) relative to PANC-1shGFP
cells were selected for analysis by Biological Process, Molecular Function and KEGG Pathway.
For NIH 3T3-H-RASV12
shGFP and NIH 3T3-H-RASV12
shArhgef2 cell lines, Significance
Analysis of Microarrays (SAM) was performed on differentially regulated genes in triplicate
RNA samples from each cell line. Thirty-three upregulated and 170 downregulated genes were
found to be statistically significant across all samples (p<0.05).
EMT induction: NMuMG or PANC-1 cells were infected with LVGFP and/or LVArhgef2 and
selected in puromycin-containing medium for 3 days prior to TGF treatment. For rescue
experiments, cells were transfected with expression plasmids 16h prior to TGF treatment.
NMuMG cells were trypsinized and plated in 6-well plates to achieve 60-80% confluence the
day of treatment. Cells were treated with DMEM supplemented with 10% FBS and containing
10ng/ml TGF1; medium was refreshed every 24h. For immunofluorescence studies, NMuMG
cells were plated directly on coverslips in a 6-well format and treatments carried out as described
under Immunofluorescence studies.
Statistical analyses: Values are expressed as means +/- SD or +/- SE as indicated. Paired
Student’s t-tests (Kirkman, 2006) were performed to determine statistical significance between
samples. Experiments were performed at least three times and means with p < 0.05 were
considered statistically significant.
73
3.4 Results
3.4.1 ARHGEF2 is essential across several human epithelial cancer cell
lines and its protein expression is regulated by the RAS/MAPK pathway
Considering the role of Arhgef2 in RAS-mediated cell survival in fibroblast cells, we sought to
determine if Arhgef2 was important for cell viability in human epithelial adenocarcinoma cell
lines exhibiting more varied mutatomes. To that end, we analyzed publicly-available gene
essentiality data derived from a genome-wide pooled shRNA screen designed to distinguish
genes that are essential for cancer cell survival in human breast, colon, lung, ovarian and
pancreatic cell lines (Marcotte et al., 2012). ARHGEF2 was found to be highly essential (p <
0.05) across 13 of 72 cell lines, including 4 ovarian, 5 pancreatic, 2 breast, 1 colon and 1 lung
cell line (Figure 3.2A). For further validation, we selected four cell lines that displayed the
highest statistical significance for ARHGEF2 essentiality. We stably infected these cells with an
ARHGEF2 hairpin distinct from those contained in The RNAi Consortium (TRC) screening pool
and found that cells depleted of Arhgef2 protein exhibited increased cell death relative to hairpin
control-expressing cells (Figures 3.2B and 3.2C). These data suggest that Arhgef2 is essential
for cell survival in human cell lines derived from different tumor types.
Of the 13 proposed ARHGEF2-essential cell lines, 8 have gain-of-function mutations in
components of the Ras/MAPK pathway, including H-RAS (Hs578T), K-RAS (CFPAC-1,
HCT116, Panc02_03, PaTu_8988T, IMIM-PC-1, RWP-1) and B-Raf (OV-90), suggesting that
ARHGEF2 essentiality has a preference for cells with elevated MAPK activity (Hollestelle et al.,
2007, Moore et al., 2001, Shirasawa et al., 1993, Jaffee et al., 1998, Shen et al., 2008, Estep et
al., 2007). To assess whether Arhgef2 expression was dependent on MAPK activation, we
treated OV-90, CFPAC-1, SK-OV-3 and HCT116 cells with two MEK1/2 inhibitors, PD98059
and UO126, and found that Arhgef2 protein expression decreased with MEK1/2 inhibition
(Figure 3.3). These data demonstrate that Arhgef2 protein expression is regulated by the MAPK
pathway in human epithelial cell models bearing endogenous mutations in the Ras/MAPK
pathway and is a critical mediator of cell survival in these cells, in agreement with our studies in
murine fibroblast cells.
74
Figure 3.2 ARHGEF2 is essential across several human epithelial cancer cell lines. (A) 72 breast, ovarian and
pancreatic cell lines were infected with 78,432 shRNAs targeting 16,056 genes for an average of 5 shRNAs per gene
(for method see Moffat et al., 2012). Gene dropout signatures were determined by calculating the shRNA Rank
Profile (shARP) of each gene. Gene essential shARP scores for ARHGEF2 were significant (p<0.05) in 13 cell
lines, including 2 (13.3%) breast, 1 (6.6%) colon), 1 (6.6%) lung, 4 (26.6%) ovarian and 5 (33.3%) pancreatic. P-
values for each cell line are depicted schematically in order of significance and cancer cell types are grouped by
color. (B) Representative cell densities of 4 ARHGEF2-essential cell lines 6 days following infection with a hairpin
control (shGFP) or a lentiviral shRNA targeting human ARHGEF2 (shGEF). (C) Western blot analysis validating
Arhgef2 protein knockdown in HEK 293T cells expressing shGFP or shGEF with tubulin serving as a protein
loading control.
3.4.2 Arhgef2 is required for PDAC tumor growth in vivo
We sought to determine whether Arhgef2 was required for tumor growth in human epithelial cell
models harboring endogenous RAS mutations. Over 95% of human pancreatic cancers harbor
75
Figure 3.3 ARHGEF2 protein expression is regulated by the RAS/MAPK pathway in human epithelial cell
lines. Immunoblot analysis of Arhgef2 expression after 48h of DMSO or MEK inhibitor treatment with PD98059
(30M) or UO126 (10M) in 4 ARHGEF2-essential cell lines. Activating phosphorylations of ERK1/2 kinases
indicate MEK1/2 inhibition and total ERK1/2 protein levels are shown as gel loading controls. Data are
representative of two independent experiments.
endogenous activating mutations in K-RAS, making them ideal model systems to study the
mechanisms contributing to aberrant RAS signaling (Smit et al., 1988, Almoguera et al., 1988,
Grunewald et al., 1989). Thus, we examined the requirement of Arhgef2 for pancreatic tumor
growth of three PDAC cell lines, PANC-1 (K-RASD12
), HPAF-II (K-RASD12
) and BxPC3 (wild-
type K-RAS) in immunodeficient mice (Moore et al., 2001, Aoki et al., 1997). Arhgef2 was
knocked down in each of these cell lines using two distinct hairpins and Arhgef2 protein
depletion was confirmed by immunoblotting (Figures 3.4A, 3.4C and 3.4E, insets). PANC-1 and
HPAF-II cells exhibited a 90% (PANC-1) and 70% (HPAF-II) decrease in mean tumor volume
and weight relative to hairpin control cells (Figures 3.4A-D) with increased tumor-associated
caspase 3 cleavage in PANC-1 cells as assessed by immunostaining (Figure 3.4G). By
distinction, tumor growth of the K-RAS wild-type BxPC3 cells showed no dependence on
Arhgef2 expression (Figures 3.4E and 3.4F). These data show that cell lines bearing activating
mutations in RAS require Arhgef2 expression for tumor growth.
We sought to determine the role of Arhgef2 for KSR-1-MAPK activation in pancreatic
adenocarcinoma cells by monitoring the phosphorylation state of KSR-1 and ERK1/2 in Arhgef2
knockdown PANC-1 cells. In cells stably depleted of Arhgef2, we observed increased
phosphorylation of KSR-1 on S392 and a corresponding decrease in phosphorylation of ERK1/2
compared to hairpin control-expressing cells (Figure 3.5A). Expression of an shRNA-resistant
active form of Arhgef2 (rArhgef287-151
) or KSR-1S392A
, but not wild-type KSR-1, restored basal
levels of phosphorylated KSR-1 and ERK1/2 in Arhgef2-depleted PANC-1 cells. These data
76
indicate that Arhgef2 is both necessary and sufficient for KSR-1 S392 dephosphorylation and
subsequent ERK1/2 activation in pancreatic cells harboring mutations in endogenous RAS.
Figure 3.4 Arhgef2 is required for pancreatic tumor growth in vivo. (A-F) PANC-1, HPAF-II and BxPC3 cells
were infected with a hairpin control (shGFP) or two distinct hairpins targeting human ARHGEF2 (shGEF1 and
shGEF2). Arhgef2 protein expression was assayed by Western blot and tubulin served as a protein loading control
(A, C, E, inset). 2x105 shGFP, shGEF1 and shGEF2 cells were injected subcutaneously into SCID mice and allowed
to form xenografts over the indicated time periods (growth curves depicted in A, C and E). Tumors were harvested
once control tumors reached a diameter of 1.5cm. Final tumor volumes were determined for each cell line and are
depicted graphically in B, D and F. Representative images of dissected tumors are shown (below bar graphs) from
one of two experiments performed per cell line. Error bars represent SD of one representative experiment from n=5
tumors (**p<0.01, *p<0.05). (G) Representative immunohistochemical images of xenografts derived from shGFP or
shGEF2-expressing PANC-1 cells stained for cleaved caspase 3. Cleaved caspase 3 expression is depicted in brown.
40 images derived from 5 PANC-1-shGFP tumors and 40 images 5 PANC-1-shGEF2 tumors were analyzed.
77
Furthermore, knockdown of Arhgef2 in PANC-1, Panc02_03, Panc05_04 and PL-45 PDAC cell
lines resulted in a 30-70% decrease in cell growth relative to hairpin control-expressing cells
(Figures 3.5B and 3.5C). These data show that Arhgef2 affects cell growth in several PDAC cell
line models harboring mutant RAS and demonstrate that the requirement of Arhgef2 for
RAS/MAPK signaling is conserved across these cell types.
Figure 3.5 Arhgef2 is required for KSR-1 S392 dephosphorylation, ERK1/2 phosphorylation and
proliferation in PDAC cells. (A) PANC-1 cells were infected with a hairpin control (shGFP, lane 1) or hairpin
targeting human ARHGEF2 (shGEF, lanes 2-5). Arhgef2-depleted cells were subsequently transfected with Flag-
Arhgef287-151
(lane 3), Pyo-KSR-1S392A
(lane 4) or wild-type Pyo-KSR-1 (lane 5). Total cell lysates were probed for
ERK1/2 phosphorylation and KSR-1 S392 phosphorylation (KSR-1 pS392) by immunoblotting (rows 3 and 4).
Arhgef2 expression was probed using endogenous Arhgef2 antibody and Pyo-KSR-1 was detected using anti-KSR-1
antibody. Levels of RAS and ERK1/2 were probed to control for total protein levels. (B) PANC-1 cells stably
expressing shGFP, shGEF1 or shGEF2 were plated at 1x103 cells/well in quadruplicate in a 96-well plate and BrdU
incorporation was measured after 24h by colorimetric detection. Data are depicted as percent BrdU incorporation
compared to shGFP-expressing cells and are the mean of three independent experiments +/- SE. (C) Panc04_03,
Panc02_03 and PL-45 cells were infected with shGFP (negative control), shPSMD1 (positive control) or two
distinct hairpins targeting human ARHGEF2 (shGEF1 and shGEF2). 3x103 hairpin-expressing cells were plated in
quadruplicate in 96-well plates and cell number was determined after 72h by nuclei staining. Data are represented as
percent proliferation relative to shGFP-expressing cells +/- SD.
78
3.4.3 Arhgef2 expression correlates with advanced tumor grade in human
lung, colorectal and pancreatic cancer
K-RAS mutations most frequently occur in PDAC, colorectal and NSCLC tumors (Almoguera et
al., 1988, Moskaluk et al., 1997, Andreyev et al., 2001, Bardelli et al., 2005). We sought to
evaluate whether Arhgef2 expression was increased in these tumor types by performing
immunohistochemistry on lung, colorectal and pancreatic tissue microarrays (TMAs) (Figure
3.6A-C). Normal lung TMAs expressed weak immunostaining for Arhgef2 that was significantly
increased in primary adenocarcinoma (ADC) and further enhanced in ADCs harboring mutations
in K-RAS (Figure 3.6A). Of 63 normal lung sections analyzed, 49.21% (31/63), 34.92% (22/63)
and 15.87% (10/63) stained weakly, moderately, and strongly for Arhgef2, respectively (Figure
3.6A, side graph). By contrast, 11.11% (7/63), 36.51% (23/63) and 53.97% (34/63) primary
ADCs stained weakly, moderately, and strongly for Arhgef2. A similar difference in expression
trends was observed in large cell undifferentiated carcinomas of the lung (LCUL) (71.43% (5/7)
vs 14.3% (1/7) weakly staining, 28.57% (2/7) vs 28.57% (2/7) moderately staining and 0% (0/7)
vs 57.14% (4/7) strongly staining for normal and LCUL samples, respectively), while the
differences were less pronounced but still correlative in squamous cell lung carcinomas (SQ)
(60% (18/30) vs 36.67% (11/30) weakly staining, 26.67% (8/30) vs 40% (12/30) moderately
staining and 13.33% (4/30) vs 23.33% (7/30) strongly staining for normal and SQ samples,
respectively). In colorectal TMAs, 62.1% (18/29) of normal tissues were absent for Arhgef2
staining, 31.0% (9/29) showed weak staining and 6.9% (2/29) showed strong staining. By
distinction, 19.4% (13/67) primary and 22.9% (8/35) metastatic colon ADCs stained moderately
for Arhgef2 while 80.6% (54/67) primary and 77.1% (27/35) metastatic lesions exhibited strong
Arhgef2 staining (Figure 3.6B, side graph). Moreover, analysis of 14 normal pancreatic ducts, 32
PanIN1 (A and B) lesions, 9 PanIN2 and I3 lesions and 14 advanced PDAC samples for Arhgef2
expression revealed that in all normal pancreatic ducts, PanIN1 and PanIN2 lesions exhibited
weak Arhgef2 immunostaining (Figure 3.6C). 77.8% (7/9) pre-invasive PanIN2 and 3 lesions
showed moderate to strong Arhgef2 staining, with the majority (71.4%, 5 of 7) showing lesser
intensity than those observed in the majority of advanced PDAC cases (Figure 3.6C, side graph).
All 14 PDAC cases stained for Arhgef2, with 71.4% (10/14) exhibiting strong staining. These
data demonstrate that Arhgef2 expression is elevated in primary RAS-mutated tumors and is
79
increased with advanced tumor grade, suggesting that Arhgef2 may play a role in more advanced
stages of tumorigenesis.
3.4.4 Arhgef2 expression alters gene signatures associated with epithelial
differentiation state
Given that Arhgef2 expression is increased with advanced tumor grade in RAS-mutated cancers,
we addressed if Arhgef2 may contribute to the acquisition of migratory phenotypes associated
with late stages of tumorigenesis and EMT. A key feature of cells that have undergone EMT is
the acquisition of new transcriptional programs to maintain their mesenchymal phenotypes
(Radisky, 2005). Mesenchymal gene expression signatures have been used to distinguish tumor
subtypes and often correlate with even poorer overall survival (Kim et al., 2010, Hoshida et al.,
2009).
In order to gain broader insight into ARHGEF2-regulated gene signatures in epithelial tumor
cells, we compared gene expression profiles of PANC-1 cells stably expressing a hairpin control
to those expressing an ARHGEF2 shRNA. Gene ontology analysis of the 399 most upregulated
genes in ARHGEF2-depleted PANC-1 cells revealed that biological adhesion/cell adhesion
(p<0.00005) and cell motion/migration (p=0.0012) were among the biological processes most
significantly perturbed, according to the DAVID algorithm (Dennis et al., 2003) (See Appendix,
Table IA). Categorizing genes by cellular component showed that there was a significant
alteration in genes localized to cell junctions (Appendix, Table IB, p=0.0011). KEGG pathway
analysis further confirmed these trends, identifying an enrichment in genes regulating focal
adhesions (p=0.0003) and ECM-receptor interactions (p=0.0077) (Appendix, Table ID). Among
80
Figure 3.6 Arhgef2 expression correlates with advanced tumor grade in human lung, colon and pancreatic
tissue microarrays. (A) Representative images of lung TMAs showing Arhgef2 protein expression in normal lung
tissue (first panel), a lung adenocarcinoma (ADC) expressing wild-type K-RAS (second panel) and a lung ADC with
a K-RASD12
mutation. Arhgef2 expression was detected with a monoclonal antibody against human Arhgef2 and is
depicted in brown. Staining was scored as weak (1), moderate (2) or strong (3) by two pathologists. The distribution
of Arhgef2 immunoscores across tumor groups is shown in the adjacent bar graph. (B) TMAs showing
representative Arhgef2 protein expression in the normal colon (first panel), a primary colorectal tumor (second
panel) and a metastatic colorectal lesion (third panel). 29 normal tissues, 67 primary and 35 metastatic colorectal
tumors were stained for Arhgef2 and quantified as in (A). (C) Arhgef2 protein expression in PDAC. Representative
images of TMAs of pancreatic ducts (normal), pancreatic intraepithelial neoplasia (PanIN-1B and PanIN-3) lesions
and adenocarcinoma (ADC) probed for Arhgef2 expression. Staining intensity in the ductal cells or lesions was
81
scored as described in (A). Distribution of Arhgef2 immunoscores for 14 normal, 18 PanIN-1A, 14 PanIN-1B, 3
PanIN-2, 6 PanIN-3 and 14 ADC TMA samples is shown graphically (right).
the genes found to be induced were genes encoding E-cadherin, claudins 1,10 and 12, integrins
alpha 2, 5 and beta 1, laminin gamma 2, collagens type I, alpha 1, type V, alpha 2, and type XI,
alpha 1 and PAK1 and 6 proteins (Appendix, Tables IIB-F). Functional annotation of the 416
most downregulated genes in ARHGEF2-depleted PANC-1 cells, in turn, showed that
mesenchymal differentiation/development was one of the most significant biological processes
perturbed (Appendix, Table IIIA, p<0.00005). Significant gene enrichment in focal adhesion
(p=0.0288) and adherens junction (p=0.0470) cellular components were also identified
(Appendix, Table IIIB). KEGG pathway analysis of the gene set showed that genes involved in
the regulation of focal adhesions was also significantly altered (Appendix, Table III, p=0.0209).
The genes associated with each process are listed in Table IV. These data demonstrate that stable
depletion of ARHGEF2 results in the perturbation of epithelial adhesion, motility and
differentiation gene signatures, suggesting that Arhgef2 may functionally contribute to these
biological processes in vivo.
In order to probe the effect of ARHGEF2 on established mesenchymal gene signatures, we
performed microarray on RASV12
-transformed fibroblast cells stably depleted of ARHGEF2 used
in our previous studies (Appendix, Table VA). Significance Analysis of Microarrays (SAM)
revealed 202 genes whose expression was significantly perturbed following ARHGEF2
knockdown (31 upregulated, 171 downregulated). Gene ontology analysis of the downregulated
gene set according to biological process showed that a subset of genes regulating epithelial cell
differentiation were suppressed, including fibroblast growth factor 10 (FGF10), fibroblast growth
factor receptor 2 (FGFR2), keratin 14 (KRT14) and transforming growth factor beta 1 (TGF1)
(p=0.0101) (Appendix, Tables VA and VIB). Pathways controlling motility and migration were
also downregulated, including response to wounding, chemotaxis and the regulation of
morphogenesis (p=0.0026, p=0.0066 and p=0.0126, respectively) (Appendix, Table VA).
Grouping genes by cellular component showed that genes involved in the regulation of adherens
junctions, anchoring junctions, cell junctions and focal adhesions were most significantly
suppressed following depletion of ARHGEF2 (p=0.0007, p=0.0014, p=0.0042 and p=0.0066,
respectively) (Appendix, Table VIB). Likewise, KEGG Pathway analysis revealed a significant
concentration of genes regulated by ARHGEF2 involved in tight junction formation (p=0.0056)
82
(Appendix, Table VID). Together, these data demonstrate that ARHGEF2 depletion results in the
upregulation of epitheloid genes in PDAC cells and the downregulation of mesenchymal genes
in RASV12
-transformed fibroblast cells and suggests that Arhgef2 may functionally contribute to
both the induction and maintenance of a mesenchymal cell phenotype.
3.4.5 Arhgef2 suppresses the epithelial cell phenotype in RAS-independent
human adenocarcinoma cell lines
We found a number of genes positively associated with epithelial differentiation state
upregulated in Arhgef2-depleted PANC-1 cells, including the epithelial cell adhesion molecule
EPCAM (2.41-fold change), the tight junction-associated membrane proteins CLDN10 and
CLDN12 (2.33 and 1.52-fold changes, respectively), alpha and beta subunits of the adhesion-
mediating integrin transmembrane receptors ITG2, ITG5 and ITG1 (2.30, 1.78 and 1.70-fold
changes, respectively), the intercellular adhesion-promoting transmembrane receptors TSPAN3,
13 and 18 (2.21, 2.01 and 2.15 fold-change, respectively), the laminin gamma 2 chain LAMC2
(1.91 fold-change), a component of anchoring filaments that connect epithelial cells to the
basement membrane, the intermediate filament protein KRT19 (1.73 fold-change) and the
adhesion-promoting receptor tyrosine kinase EPHB2 (1.68 fold-change) (Kubota et al., 1999,
Witkowski et al., 1993, Yanez-Mo et al., 2001, Pakkala et al., 2002, Pfaff et al., 2008) (Figure
3.7A). The positive role for many of these molecules in the regulation of epithelial cell integrity
is supported by the observation that their downregulation has been implicated in increased
migration, invasion and metastasis in human tumors, as has been found with the claudin, laminin,
integrin and ephrin families of proteins (Ip et al., 2007, Karamitropoulou et al., 2011, Witkowski
et al., 1993, Dong Li Guo et al., 2005).
The loss of the epithelial adhesion molecule E-cadherin is an essential step regulating the
dissemination of cell-cell junctions and promoting EMT (Lehembre et al., 2008). We found that
E-cadherin mRNA was elevated by 2.2-fold in ARHGEF2-depleted PANC-1 cells by
microarray, suggesting that Arhgef2 may positively regulate EMT by suppressing E-cadherin
transcription (Figure 3.7A). To confirm that E-cadherin was upregulated in epithelial cells
lacking ARHGEF2 expression, we performed quantitative PCR on PANC-1 cells expressing a
83
hairpin control or an ARHGEF2 shRNA (Figure 3.7B). We found that E-cadherin transcripts
were elevated by over 18-fold in ARHGEF2-depleted cells relative to GAPDH expression
(p=0.0099). Immunoblot analysis of PANC-1 cells harboring stable Arhgef2 knockdown
confirmed that the elevation of E-cadherin expression was maintained at the protein level (Figure
3.7C). Furthermore, we found a slight decrease in expression of the mesenchymal marker
vimentin (Figure 3.7C). Together, these results demonstrate that Arhgef2 regulates the
expression of genes associated with epithelial differentiation state.
Figure 3.7 Arhgef2 suppresses the epithelial cell phenotype in human adenocarcinoma cell lines. (A) List of
genes associated with epithelial differentiation state shown to be upregulated by at least 1.52-fold (DF log2 of > 0.6)
in ARHGEF2-depleted PANC-1 cells relative to shGFP-expressing cells by microarray analysis. Fold change is
indicated for each gene. (B) Validation of E-cadherin gene (CDH1) upregulation by real-time quantitative PCR.
Transcript levels of ARHGEF2 and CDH1 were normalized to GAPDH expression and are represented as fold
decrease and increase of PANC-1shGEF over PANC-1shGFP-expressing cells, respectively. Data are the mean of
four independent experiments for ARHGEF2 (p1=0.011) and two independent experiments for CDH1 (p2=0.0099)
+/- SE. (C) Validation of E-cadherin protein upregulation in Arhgef2-depleted PANC-1 cells compared to shGFP-
expressing cells by Western blot. Arhgef2 expression shows level of knockdown and vimentin expression is shown
as a mesenchymal marker, with total ERK1/2 serving as a protein loading control.
E-cadherin is functional when it is localized to cell-cell junctions of epithelial cells, where it
regulates cell adhesion and polarization. We therefore assessed the localization of E-cadherin in
Arhgef2-depleted cells by immunofluorescence staining (Figure 3.7D). PANC-1 cells expressing
a non-targeting hairpin exhibited low levels of E-cadherin expression that was localized diffusely
throughout the cytoplasm (Figure 3.7D, row 1 column 1). In contrast, the cells expressed high
levels of vimentin, in agreement with previous reports that PANC-1 cells represent a poorly
84
differentiated PDAC, exhibiting mesenchymal-like properties (Singh et al., 2009) (Figure 3.7D,
row 1 column 3, arrowhead). In PANC-1 cells lacking Arhgef2 expression, however, E-cadherin
staining was prominently localized to the cell periphery and cells adopted a rounder,
cobblestone-like morphology characteristic of epithelial cells (Figure 3.7D, row 2 column 1,
arrowhead). Vimentin expression was reduced and localized diffusely throughout the cytoplasm,
in contrast to the pools of vimentin seen at specific subcellular sites in hairpin control-expressing
PANC-1 cells (Figure 3.7D, row 1 column 3 vs row 2 column 3, arrowhead). Higher
magnification images of individual hairpin control and Arhgef2 shRNA-expressing cells are
shown in second and third rows, respectively. These data show that Arhgef2 expression
contributes to the mesenchymal properties of PANC-1 cells by modulating both the expression
and proper localization of E-cadherin and vimentin.
We sought to determine if Arhgef2 suppressed E-cadherin expression in other human
adenocarcinoma cell lines exhibiting mesenchymal-like properties. To that end, we compared
Arhgef2-dependent changes in E-cadherin and vimentin expression in four cell lines categorized
as epithelioid or mesenchymal-like (Singh et al., 2009). These included the mesenchymal-like
A549 (lung ADC) and PANC-1 (PDAC) cell lines and the epithelial-like H727 (lung ADC) and
HPAF-II (PDAC) cell lines. Biochemical analysis of lysates derived from each cell line
confirmed that H727 and HPAF-II cells expressed high levels of E-cadherin and low levels of
vimentin, while A549 and PANC-1 cells expressed low levels of E-cadherin and high levels of
vimentin, consistent with their previously characterized differentiation states (Singh et al., 2009)
(Figure 3.7E). Moreover, low levels of E-cadherin were associated with Zeb1 expression, a
transcriptional repressor of E-cadherin (Figure 3.7E) (Sanchez-Tillo et al., 2011). Stable
depletion of Arhgef2 in A549 cells potently induced the expression of E-cadherin with two
distinct Arhgef2 shRNAs, as was observed in PANC-1 cells (Figures 3.7F and 3.7C,
respectively). Importantly, in H727 and HPAF-II cells already expressing E-cadherin, there was
no further induction of E-cadherin protein levels, although a decrease in vimentin expressed was
observed in the HPAF-II cell line (Figures 3.7G and 3.7H, respectively). Together, these studies
demonstrate that Arhgef2 promotes the mesenchymal phenotype of human epithelial cancer cells
through the downregulation of E-cadherin expression or the induction of vimentin expression
depending on the stage of mesenchymal differentiation of adenocarcinoma cell lines.
85
86
Figure 3.7 Arhgef2 suppresses the epithelial cell phenotype in human adenocarcinoma cell lines. (D)
Immunofluorescence analysis of PANC-1 cells stably expressing shGFP (rows 1 and 3) or Arhgef2 shRNA (shGEF,
rows 2 and 4) for endogenous E-cadherin (column 1) or vimentin expression (column 3). Larger magnification
images are shown in rows 3 and 4. Arrowheads show areas of increased E-cadherin junctional localization or
cytoplasmic vimentin localization. Images are representative of three independent experiments. (E) Western blot
analysis of human epithelial tumor cell lines H727, A549 (ADC), HPAF-II and PANC-1 (PDAC) for E-cadherin,
vimentin and Zeb1 expression. Arhgef2 expression levels are shown cross cell lines and tubulin serves as a protein
loading control. (F-H) A549, H727 and HPAF-11 cells were stably infected with hairpin control (shGFP) or two
distinct shRNAs targeting human ARHGEF2 (shGEF1 and shGEF2) and lysates were probed for E-cadherin and/or
vimentin expression. Level of Arhgef2 knockdown is indicated by protein expression of endogenous Arhgef2;
GAPDH or tubulin serve as protein loading controls.
3.4.6 Arhgef2 is required for TGF-induced epithelial-to-mesenchymal-
transition in a mammary epithelial cell model
To directly address the role of Arhgef2 in the regulation of EMT, we employed a murine
mammary epithelial cell model, NMuMG, that undergoes mesenchymal transformation in
response to TGF. Treatment of NMuMG cells with TGF for 48 hours resulted in the
progressive downregulation of E-cadherin and upregulation of vimentin expression (Figure
3.8A) and paralleled the acquisition of an elongated, mesenchymal-like phenotype from an
epithelioid morphology (Figure 3.8B). We also observed an increase of Arhgef2 expression after
24 hours of TGF treatment; however, its expression was reduced to basal levels after 48 hours
(Figure 3.8A). Immunofluorescence staining of NMuMG cells before and after 48 hours of
TGF treatment showed a prominent decrease in the staining intensity and junctional localization
of E-cadherin and a simultaneous increase in the intensity of vimentin staining in the cytoplasm,
demonstrating that NMuMG cells functionally transform into mesenchymal cells (Figure 3.8C).
To assess the requirement of Arhgef2 in TGF-mediated EMT we stably knocked down murine
Arhgef2 in native NMuMG cells with two distinct hairpins and treated cells with TGF for 48
87
Figure 3.8 TGF induces epithelial-to-mesenchymal-transition in a normal mammary gland epithelial cell
model. (A) Western blot analysis of NMuMG cells treated with 10ng/ml TGF1 for 24h or 48h. Expression of
Arhgef2, E-cadherin and vimentin are shown and GAPDH serves as a protein loading control. (B) Phase-contrast
images of NMuMG cells untreated (first panel) or treated with 10ng/ml TGF1 for 24h (panel 2) or 48h. Images are
representative of four independent experiments. (C) Immunofluorescence analysis of NMuMG cells treated with
TGF1 as in (A) and (B). Cells were fixed and stained for E-cadherin (ECAD, column 1), vimentin (VIM, column
3) or DAPI (columns 2 and 4) after 48h of treatment with vehicle control (first row) or 10ng/ml TGF1 (second
row).
hours (Figures 3.9A and 3.9B). Although Arhgef2 expression was highly suppressed with both
shRNAs, shGEF1 showed greater knockdown efficiency than shGEF2 (Figure 3.9A, fourth row).
Since the downstream effector of Arhgef2, ROCK, has shown to be required for TGF-induced
EMT in this cell system, we compared the effects of ROCK and Arhgef2 inhibition by co-
88
treating cells with the ROCK inhibitor Y27632 and TGF (Figure 3.9A, lanes 7 and 8 and Figure
3.9B, column 4) (Bhowmick et al., 2001). Immunoblot analysis for E-cadherin and vimentin
Figure 3.9 Arhgef2 is required for TGF-induced epithelial-to-mesenchymal-transition in NMuMG cells. (A)
Western blot analysis of NMuMG cells stably expressing a hairpin control (shGFP) or two distinct shRNAs
targeting murine Arhgef2 (shGEF1 and shGEF2) and treated with vehicle control (lanes 1, 3, and 5), 10ng/ml
TGF1 (lanes 2, 4 and 6), or 10M of the ROCK inhibitor Y27632 alone or with TGF1 (lanes 7 and 8,
respectively) for 48h. Total cell lysates were probed for Arhgef2, E-cadherin and vimentin expression levels and
GAPDH serves as a protein loading control. (B) Phase-contrast images of NMuMG cells described in (A). Images
are representative of three independent experiments.
89
showed that Arhgef2 depletion and ROCK inhibition did not prevent the TGF-induced
downregulation of E-cadherin expression and did not significantly alter vimentin expression
(Figure 3.9A). However, the morphological transition to a mesenchymal phenotype was strongly
inhibited in Arhgef2-depleted cells in response to TGF in a manner that correlated with the
level of Arhgef2 knockdown (Figure 3.9B, columns 2 and 3). Moreover, ROCK inhibition
partially suppressed the development of a fibroblastoid phenotype in response to TGF, although
the effect was not as strong compared to Arhgef2 depletion with either hairpin (Figure 3.9B,
column 4). Visualization of E-cadherin and vimentin expression by immunofluorescence staining
showed that although the intensity of E-cadherin expression decreased in both hairpin control
and Arhgef2 hairpin-expressing cells in response to TGF, some peripheral E-cadherin
expression was maintained in the absence of Arhgef2 (Figure 3.9C, column 1, rows 2 and 4).
90
Figure 3.9 Arhgef2 is required for TGF-induced epithelial-to-mesenchymal-transition in NMuMG cells. (C)
Immunofluorescence analysis of NMuMG cells stably expressing a hairpin control (shGFP) or Arhgef2 shRNA
(shGEF1) treated with vehicle control (rows 1 and 3) or 10ng/ml TGF1 (rows 2 and 4) for 48h. Cells were fixed
and stained for E-cadherin (column 1), vimentin (column 3) and DAPI (columns 2 and 4).
Furthermore, the cells failed to adopt an elongated, spindle-shaped morphology and instead
remained round and flattened. Arhgef2-depleted NMuMG cells exhibited a decrease in vimentin
staining intensity in response to TGF compared to hairpin control-expressing cells (Figure
3.9C, column 3, rows 2 and 4). Together, these data show that Arhgef2 is required for the full
transition from an epithelial to a mesenchymal cell state in response to TGF.
91
Figure 3.9 Arhgef2 is required for TGF-induced epithelial-to-mesenchymal-transition in NMuMG cells. (D)
Phase-contrast images of NMuMG cells stably expressing shGFP, shGEF1 and shGEF2 and treated with 10ng/ml
TGF1 for 48h. Cells were transfected with Arhgef287-151
(column 2) or p115RhoGEF (column 3) 24h prior to
TGF1 treatment.
To discern the mechanism by which Arhgef2 is required for TGF-induced EMT, we expressed
active Arhgef287-151
and p115RhoGEF in NMuMG cells depleted of Arhgef2 (Figures 3.9D and
3.9E). Expression of either GEF was unable to fully rescue the mesenchymal phenotype induced
by TGF; however, both induced similar intermediate fibroblastoid morphologies in an Arhgef2-
depleted background (Figure 3.9D, columns 2 and 3 and rows 2 and 3). These data suggest that
increased Rho activity can partially compensate for a loss of Arhgef2 expression and that
Arhgef2 may promote EMT – at least in part - via its exchange activity on RhoA.
92
Figure 3.9 Arhgef2 is required for TGF-induced epithelial-to-mesenchymal-transition in NMuMG cells. (E)
Western blot analysis showing Arhgef287-151
(upper panel) and p115RhoGEF (lower panel) expression in
transfected NMuMG cells described in (D). GAPDH and actin serve as protein loading controls in each respective
panel.
93
3.5 Discussion
Pancreatic ductal adenocarcinoma (PDAC) is one of the most fatal human malignancies, with a
5-year survival rate of less than 5% (Warshaw et al., 1992). Its poor prognosis is largely
attributed to the advanced stage of the disease usually presented at the time of diagnosis and the
refractory nature of PDAC to current therapies (Warshaw et al., 1992, Jemal et al., 2005).
Although mutant K-RAS plays a causal role in pancreatic tumorigenesis, drugs targeting RAS
have yet to be clinically effective (Van Cutsem et al., 2004). Thus, the identification of RAS
effectors that are essential for tumor cell survival is critical in order to improve treatment
strategies against this disease.
In this chapter we found that Arhgef2 is required for cell survival and transformation in RAS-
mutated human epithelial pancreatic xenograft models and contributes to RAS signaling in these
cells by a parallel mechanism to that observed in fibroblasts. Furthermore, analysis of Arhgef2
expression at progressive stages of human lung, colon and pancreatic tumorigenesis revealed that
Arhgef2 levels are dramatically increased with advanced tumor grade. Increased Arhgef2
expression promotes the genetic and morphological transition from an epithelial to a
mesenchymal cell phenotype and maintains low E-cadherin levels in mesenchymal-like mutant
RAS cell lines. Finally, Arhgef2 is required for mesenchymal transition in a murine mammary
model of TGF-induced EMT, suggesting that Arhgef2 may contribute to invasion and
metastases in human tumors in vivo.
The identification of Arhgef2 as an essential gene in different tumor types demonstrates that
Arhgef2 can mediate cell survival in varied genetic contexts. This idea is supported by the
observation that Arhgef2 was not exclusively or inclusively essential in all RAS-mutated cell
lines analyzed (Marcotte et al., 2012). This could be explained by the fact that human epithelial
tumor cell lines contain diverse genetic aberrations that may confer differential oncogenic
dependencies for survival. Such bifurcation of survival dependencies has been shown in
pancreatic and lung cell lines, in which the dependence on K-RAS for cell viability is associated
with epithelial differentiation state (Singh et al., 2009). In well-differentiated PDAC and lung
cell lines, K-RAS expression is required for cell survival. Upon EMT, K-RAS dependency is
lost; however, it can be re-gained by MET (Singh et al., 2009). This phenomenon may be
94
explained by the acquisition of additional mutations during the process of EMT that relieve the
cell’s dependency on RAS signaling for survival, otherwise known as ‘RAS oncogene
addiction’. Since Arhgef2 has been shown to mediate survival and/or proliferation downstream
of several pathways including EGF, TNF, taxol, mutant Huntingtin and mutant p53, it is
possible that Arhgef2 essentiality may be linked to the relative contribution of one or more of
these pathways in addition to mutations in the RAS pathway for cell viability (Kakiashvili et al.,
2011, Nie et al., 2012, Varma et al., 2010, Mizuarai et al., 2006). By contrast, our studies in
murine fibroblast cells focused on the overexpression of an isolated mutant RAS gene, allowing
us to question the dependency of RAS on Arhgef2 expression in a more genetically defined
manner. The relative importance of Arhgef2 in cell survival in the context of multiple oncogenic
pathways activated in human epithelial cancers, therefore, must be more rigorously tested.
An alternate explanation for the differential survival of Arhgef2-depleted human epithelial cell
lines is the efficiency of Arhgef2 knockdown across cell lines used in the shRNA screen. Many
of the hairpins used in the study have not been validated for their efficacy and cell line-
dependent differences in gene knockdown with identical shRNA sequences has been well
documented (Lebbink et al., 2011). It is therefore possible that the significantly essential RAS-
mutated cell lines were more sensitive to Arhgef2 knockdown, resulting in the reduction of
Arhgef2 transcripts below a threshold required to maintain cell viability. It is unlikely, however,
that the reduction in cell survival was the result of off-target effects, since the gene essentiality
score (GARP) is the combination of two highest scoring independent shRNAs and we validated
the top scoring cell lines with a distinct shRNA sequence that efficiently suppresses Arhgef2
expression levels (Koh et al., 2012).
We also observed a correlation between progressive tumor grade and Arhgef2 expression in
human TMAs from lung, colon and pancreatic tumors, malignancies that most frequently harbor
RAS mutations (Aguirre et al., 2003, Haigis et al., 2008, Johnson et al., 2001). Although we
established that the RAS/MAPK pathway can regulate Arhgef2 expression, the enhanced
expression of Arhgef2 observed in late-staged tumorigenesis in vivo may be a result of co-
operative oncogenic events involving K-RAS and p53. Gain-of-function mutants of p53 V157F,
R175H and R248Q have been shown to transcriptionally upregulate Arhgef2 in NSCLC cell
lines and are found in over 50% of late-stage PDAC, NSCLC and colorectal tumors in vivo
95
(Mizuarai et al., 2006, Maitra et al., 2003, Johnson et al., 1993, Rodrigues et al., 1990).
Oncogenic K-RAS and p53 are both required for the malignant conversion of PDAC, suggesting
that their co-operative upregulation of Arhgef2 may be one mechanism by which they work
together to promote a more malignant phenotype.
Another potential influence of Arhgef2 expression involves the transcriptional induction of
Arhgef2 by TGF (Tsapara et al., 2010). Interestingly, approximately half of pancreatic
adenocarcinomas undergo homozygous deletion of the TGF signaling component smad4 at late
stages of neoplastic progression and Arhgef2 upregulation was found to be smad-dependent
(Hezel et al., 2006, Tsapara et al., 2010). However, previous reports have also shown that smad4
is required for TGF-induced EMT in a subset of PDAC and that those tumors that lose smad4
expression retain a well differentiated histopathology (Bardeesy et al., 2006). These data suggest
that Arhgef2 upregulation by TGF may co-operate with oncogenic RAS to induce malignant
conversion and that Arhgef2 may not contribute to EMT in tumors lacking smad4. However, this
idea is challenged by the fact that known effectors of Arhgef2, RhoA and ERK, represent smad-
independent pathways that are required for TGF-induced EMT in mammary epithelial cell
models and in PDAC models (Bhowmick et al., 2001, Xie et al., 2004, Ellenrieder et al., 2001,
Kusama et al., 2001). Moreover, although smad4 is commonly lost, TGF receptors are often
overexpressed in PDAC and enhanced TGF signaling correlates with decreased survival (Friess
et al., 1993). The contribution of Arhgef2 to the interplay of RAS and TGF signaling pathways
in EMT is likely a complex process and whether or not smad signaling is required for Arhgef2-
mediated EMT remains to be determined. Ultimately, the cross-talk between Ras, p53 and TGF
signaling in the context of pancreatic tumorigenesis and the regulation of Arhgef2 expression
suggest that several mechanisms may contribute to the amplification of Arhgef2 expression and
attest to the multiple roles of Arhgef2 at different stages of tumor progression (Figure 3.10).
96
Figure 3.10 Arhgef2 may promote EMT via its cooperative regulation by RASV12
, p53 and TGF signaling
pathways. Arhgef2 transcripts are induced by oncogenic RAS/MAPK pathway and mutant p53. Increased TGF
signaling in the absence of smad4 may result in the enhanced activation of smad-independent pathways, including
RAS, ERK1/2 and RhoA. Arhgef2 may (represented as dotted black arrow) mediate TGF-induced RhoA activation
and potentiate RASV12
/KSR-1/MAPK signaling simultaneously due to elevated expression levels and/or specific
activation by both TGF and oncogenic RAS. Increased ERK1/2 and RhoA activity results in increased cell
survival, cell migration, gene transcription and ultimately, EMT.
Work by Singh et al. showed that RAS-mutated cell lines retaining epithelial characteristics were
dependent on RAS for survival, whereas those with mesenchymal properties are insensitive to
RAS depletion (Singh et al., 2009). In our study, we showed that Arhgef2 depletion in two
mesenchymal-like, or K-RAS independent, cell lines (PANC-1 and A549) induced their
reversion to an epithelioid morphology and the re-expression of E-cadherin, whereas Arhgef2
depletion produced little effect on cell lines retaining an epithelial cell morphology (HPAF-II
and H727). These data suggest that inhibition of Arhgef2 is able to influence the switch from K-
RAS-independency to dependency, thereby re-sensitizing them to K-RAS depletion and
97
subsequent cell death. Thus, the concomitant silencing of Arhgef2 and K-RAS dependent genes
may offer novel a mechanism to target K-RAS-independent NSCLC and PDAC tumors.
Although we found that the expression of a distinct RhoA activator could partially compensate
for a loss of Arhgef2 expression in TGF-induced EMT, the precise mechanism underlying the
requirement of Arhgef2 in this process has not been fully resolved. Both MAPK and RhoA
activation are required for TGF-induced EMT in NMuMG cells and our work has shown that
Arhgef2 can potentiate both signaling pathways, albeit in context-specific manners (Bhowmick
et al., 2001, Xie et al., 2004). Since increased RhoA activity does not fully rescue the
mesenchymal phenotype in Arhgef2-depleted cells, it is possible that Arhgef2 impinges on both
signaling pathways to promote EMT. Further studies must determine if Arhgef2 mediates TGF-
induced ERK1/2 activation, since we have only established a role for Arhgef2 in MAPK
pathway activation in the context of oncogenic RAS signaling or PDGF stimulation, and in a
KSR-1-dependent manner. Observations that TGF can activate RAS and is dependent on
mutated RAS for EMT in some cellular contexts, however, suggests that TGF could indirectly
impinge on Arhgef2/KSR-1 signaling in the context of a mutant RAS gene (Hartsough et al.,
1996, Frey et al., 1997). Furthermore, both ERK1/2 and RhoA activation have been shown to
contribute to EMT in PDAC, where a role for Arhgef2 in ERK activation has been elucidated
(Ellenrieder et al., 2001, Kusama et al., 2001). Previous reports have also shown that MEK
inhibition induces a partial reversion TGF-induced EMT, as we observed with the ROCK
inhibitor Y27632 (Xie et al., 2004). However, we noted a robust prevention of TGF-induced
EMT with our most efficient Arhgef shRNA, supporting the notion that Arhgef2 may block
several pathways contributing to mesenchymal conversion.
The mechanism by which Arhgef2 mediates the suppression of E-Cadherin expression remains
to be resolved. We have shown that Arhgef2 inhibits E-cadherin functionally by preventing its
membrane localization, and/or at the molecular level by reducing its gene expression, in a cell
type-dependent manner (PDAC/ADC and NMuMG, respectively). It is possible that in
mesenchymal cells, depletion of Arhgef2 affects the expression or activation of a mesenchyme-
specific transcription factor that suppresses E-cadherin expression, such as snail or slug (snail2).
Snail and slug are potent repressors of E-cadherin transcription and inducers of EMT (Batlle et
al., 2000, Cano et al., 2000, Nieto et al., 2002). Moreover, snail expression is regulated via the
98
cooperation of ERK and RhoA pathways (via NFB transcription factors) and in response to
oncogenic RAS, all of which are regulated by or impinge on Arhgef2 activity (Barbera et al.,
2004, Broders-Bondon et al., 2007). While the minimal ERK binding region of the snail
promoter was sufficient to maintain a mesenchymal phenotype in epithelial tumor cells,
expression levels of snail did not reach those in cells containing the full promoter, demonstrating
that both pathways cooperate to induce snail expression (Barbera et al., 2004). In differentiated
epithelial cells, however, Arhgef2 may promote EMT by decreasing the integrity and
adhesiveness of tight junctions, an effect that has been previously reported (Benais-Pont et al.,
2003, Birukova et al., 2006, Guillemot et al., 2008). This branching of Arhgef2 function
depending on differentiation state is supported by the observation that Arhgef2 depletion does
not affect E-Cadherin expression in well-differentiated PDAC and ADC cell lines HPAF-II and
H727 (Figures 3.7G and 3.7H) as well as NMuMG epithelial cells (Figure 3.9A). Thus, targeting
Arhgef2 may prevent both the EMT and the malignant progression of a poorly differentiated
tumor by suppressing distinct pathways.
Considering the essential role of Arhgef2 in RAS-driven primary tumorigenesis and EMT,
Arhgef2 may be an effective therapeutic target in both early and advanced stages of tumor
progression. Given the potential for Arhgef2 to revert RAS-independent tumors back to RAS-
dependency by initiating their morphologic de-differentiation, Arhgef2 depletion in conjunction
with the inhibition of RAS-essential genes may result in improved therapeutic response in
metastatic disease. Ultimately, the development of Arhgef2-directed therapeutics has potential to
reduce the malignancy of late-staged PDAC, in which Arhgef2 expression is highest and where
current strategies are most ineffective.
99
Chapter 4
Future Perspectives
4.1 Abstract
We have gained considerable mechanistic insights into the cooperation of Arhgef2 and RAS in
tumorigenesis; however, many questions remain unanswered. These questions offer exciting new
avenues of research for future students, post-doctoral fellows and/or research associates in our
laboratory. While the following suggestions are by no means exhaustive, they are key concepts
to address in order to attain a more comprehensive understanding of the role of Arhgef2 in
human cancer. First, we must determine the role of Arhgef2 in metastases in vivo, as this is a
critical measure of cancer-associated lethality. In addition to PDAC, NSCLC and/or colorectal
cancer models should be assessed, since they harbor a high frequency of K-RAS mutations and
exhibit elevated Arhgef2 expression with advanced tumor grade. Second, given the
transcriptional regulation of Arhgef2 by gain-of-function mutants of p53, it would be of interest
to dissect the potential cooperation of these oncogenes in human tumors. A third prospect would
be to determine whether Arhgef2 can modify a tumor’s response to established anti-cancer drugs
by studying the regulation of Arhgef2 by microtubule-regulating chemotherapeutic agents.
Lastly, in order for basic research on the oncogenic function of Arhgef2 to be clinically valuable,
we must validate the tractability of Arhgef2 as a therapeutic target.
100
4.2 Experimental Procedures
Cell lines and cell culture: OVCAR5, OVCAR8, OVCA420, OVCA429, OVCA432, OVCA433,
OCC-1, HOC-1, OVCAR3, CaOV3, CaOV3d3, IOSE80, IOSE29, ES-2, DOV13, A2780,
IGROVI, A1847, SK-OV-3IP38, SK-OV-3Bcl2 and SK-OV-3 cell lines were obtained from
Gordon Mills and cultured in RPMI 1640 (Life Technologies Inc.) supplemented with 10% FBS
(OVCAR5, OVCAR8, DOV13, IOSE80, IOSE29, A1847), McCoy’s 5A Modified Medium
(Life Technologies Inc.) supplemented with 10% FBS (OVCA420, OVCA432, OVCAR433,
IGROVI), DMEM (Life Technologies Inc.) supplemented with 10% FBS (CaOV3, CaOV3d3,
A2780, SK-OV-3, SK-OV-3IP38, SK-OV-3Bcl2) or Alpha Modified Eagle’s Medium (Life
Technologies Inc.) supplemented with 10% FBS (OVCA429, OCC1, HOC1, OVCAR3, ES-2).
Stable human ARHGEF2 depletion in OVCAR5 cells were generated as described in Chapter 3
and selected with 4g/ml puromycin.
Western blotting: Cells were lysed directly in 2X sample buffer containing 62.5mM Tris-HCl pH
6.8, 2.5% SDS, 10% glycerol, 5% -mercaptoethanol and 0.02% bromophenol blue, boiled and
resolved by SDS-PAGE.
Antibodies: Western blotting was performed using monoclonal anti-Arhgef2 antibody 3C5, anti-
tubulin (Molecular Probes) and anti-actin (Sigma). Immunohistochemistry studies were
performed using anti-Arhgef2 3C5 and anti-p53 (CST, 4937) at 1:500 dilutions.
Immunohistochemistry: Tumor sections derived from normal ovarian tissue and clear cell,
mucinous, endometrioid and serous ovarian tumors were prepared and stained as described in
Chapter 3. Tumors were given two scores based on intensity of staining and percentage of total
tumor stained, with 0 being weak, 1 moderate and 3 strong. Immunoscores were combined to
generate scores of 0-6 with 0-2 classified as weak, 3-4 as moderate and 5-6 as high. A total of 4
normal, 22 and 15 clear cell, 17 and 13 mucinous, 26 and 14 endometrioid and 128 and 100
serous tumors were analyzed for Arhgef2 and p53 expression, respectively.
Genome-wide shRNA screen: as described in Marcotte et al., 2012.
Genomic RNA isolation, fragmentation, reverse transcription and amplification in SOC cell
lines: mRNA was extracted from OC cell lines using RNeasy plus mini kit (QIAGEN, CN
101
74134). mRNA was quantified using QubitRNA broad range and quality control was assessed
with bioanalyzer total RNA nano chip.1ug of mRNA was fragmented to an average length of
200bp by incubation 5min at 94°C with 5X fragmentation buffer (Illumina, CN RS-100-0801).
Efficiency of the fragmentation was defined on Bioanalyzer RNA Pico Chip. The fragmented
mRNA was randomly primed and reverse transcribed using Super Script II cDNA synthesis kit
(Invitrogen, CN 18064-014). After second-strand synthesis, the cDNA went through end-repair
and ligation reactions according to the Illumina mRNA-Seq Sample Prep Kit protocol.
The cDNA library was size-fractioned on a 2% TBE agarose gel. Material in the 350-400bp
range was excise and purify (Zymo Research, CN D4001). Half of the eluted cDNA library was
used as a template for amplification according mRNA-Seq Sample Prep Kit protocol. The PCR
product was purified using the PureLink PCR micro purification kit (invitrogen, catalog no.
K310050). The library size (350-400bp) was validated on a Bioanalyzer DNA 1000 Chip and the
concentration was estimated using Qubit fluorometer and Quant-iT dsDNA BR Assay Kit
(invitrogen, catalog no.Q32850). The library was then used to build clusters on the Illumina flow
cell and analysis was done using Illumina Hiseq 2000.
Mapping cDNA fragments and Arhgef2 transcript abundance estimation: Basecalls files were
converted to sequences in FASTQ format using BCLToFastq CASAVA 1.8.2. Fragments were
mapped to build GRCh37 of the human genome using TopHat 1.4.1 and Bowtie 1.0. Transcript
abundance was determined using cufflinks 1.3.0 in Fragment Per Kilobase per Million reads
(FPKM). Because alignment was done on a genome version including random chromosomes a
correction was applied to the genes present several times. The corrected FPKM values were
defined by multiplying the FPKM value of the nonrandom chromosome by the number of times
the gene was represented.
102
4.3 Future Perspectives
4.3.1 The role of Arhgef2 in metastases
Like the multistep model of primary tumorigenesis, the process of metastasis can be divided into
distinct and genetically defined stages (Chiang et al., 2008). The initiation of metastasis involves
the invasion of tumor cells through the basement membrane and intravasation through capillary
walls into the circulation. Metastatic progression is defined by the survival and extravasian of
cancers cells through vessel walls and into distant organs. Finally, in order for metastatic tumors
to form, cancer cells must be able to seed and grow at their target sites, a process deemed
metastatic virulence (Chiang et al., 2008). EMT promotes the malignant conversion of primary
tumor cells and thus is a metastasis initiating event. As such, genes implicated in EMT do not
necessarily predict the full metastatic potential of a cancer cell. In order to ascertain the role of
Arhgef2 in metastases, therefore, several additional parameters of metastatic progression must be
assessed.
We observed that depletion of Arhgef2 resulted in the reversion of the mesenchymal phenotypes
associated with metastatic conversion in human lung and pancreatic adenocarcinoma cell lines.
In vitro studies should discern whether this results in decreased migration and/or invasion of
tumor cells bearing RAS mutations. Following this, an in vivo model of PDAC metastases is
required. This can be achieved by allowing primary PDAC xenograft growth to proceed for
longer periods of time and assessing whether Arhgef2-depleted tumors have a decreased
incidence of evasion from the primary tumor site. Given that Arhgef2 depletion at the time of
initiation largely prevents primary tumor growth, however, an inducible Arhgef2 knockdown
system could be employed to test the effect of Arhgef2 depletion subsequent to tumor
establishment. In this way, we can discern whether silencing Arhgef2 results in tumor regression
and/or the prevention of metastases. The potential for acute depletion of Arhgef2 to revert tumor
growth and prevent metastases is supported by reports showing that delivery of KSR-1 antisense
oligonucleotides in PANC-1 cells prevents primary tumor growth and effects regression of
established tumors upon continuous infusion (Xing et al., 2003). Given that Arhgef2 may
interfere with both RAS/KSR-1/MAPK and TGF/RhoA and/or TGF/ERK1/2 signaling
pathways, the effect of Arhgef2 depletion on tumor regression may be more pronounced.
103
To test the role of Arhgef2 in the progression and virulence of metastasis, tail vein injections of
PDAC cells stably expressing a hairpin control or Arhgef2 shRNA could be performed. Injecting
cancer cells in the tail vein of mice circumvents the steps of invasion-metastasis and directly
measures their colonizing potential. This parameter of cancer growth is especially critical since
recent studies have shown that cells can metastasize at early stages of tumor development,
thereby challenging the traditional multistep progression model of solid tumor growth
(Husemann et al., 2008, Podsypanina et al., 2008). In these studies, mouse models with atypical
ductal hyperplasia (ADH, a benign stage) in the mammary glands displayed dissemination to the
bone marrow (Podsypanina et al., 2008, Husemann et al., 2008). These data argue that metastatic
conversion may occur continually throughout the course of primary tumor development,
generating a genetically and morphologically diverse spectrum of disseminated cells. In the case
of PDAC, the phenomenon of early dissemination would explain its high rate of metastases,
refractility to therapeutics and early mortality. Moreover, these studies imply that genes involved
in multiple stages of tumorigenic progression would have the most potential as therapeutic
targets and thus highlight the importance of elucidating the role of Arhgef2 at later stages of
tumorigenic progression.
In addition to ascertaining the biological role of Arhgef2 in malignant progression, we must gain
a greater understanding of the biochemical mechanism underlying the contribution of Arhgef2 to
EMT and/or PDAC metastases. Arhgef2 can activate Rho GTPases and MAPK signaling, two
important promoters of metastatic conversion. Determining the relative importance of these
pathways in Arhgef2-mediated EMT and/or malignant progression would provide insight on the
metastatic dependencies of PDAC at the molecular level. It is possible that at high expression
levels caused by the cooperative upregulation of Arhgef2 by oncogenic RAS and p53, Arhgef2
could efficiently activate both the MAPK and Rho GTPase signaling pathways. In conjunction or
alternatively to this idea, the additional TGF and/or mutant p53 signals often seen in advanced
stage PDAC may direct Arhgef2 to different substrate pools in the cell. To tease out the Arhgef2-
dependent signaling pathways in PDAC cells, TGF and mutant p53-mediated RhoA and
ERK1/2 activation must be measured with and without oncogenic RAS and in the presence or
absence of Arhgef2 expression. In this way, we will be able to discern whether mutant p53,
104
TGF and RAS induce a bifurcation of Arhgef2-mediated signaling events or cooperatively
enrich one arm of Arhgef2 signaling.
Lastly, genetic models of RAS-induced tumorigenesis would provide more robust insight into
the role of Arhgef2 in RAS tumorigenesis and metastases. A PDAC mouse model has been
developed that conditionally expresses oncogenic K-RAS in the pancreas of mice and where
90% of resultant tumors harbor RAS mutations (Hingorani et al., 2003). These mice develop
intraepithelial neoplasias at high penetrance and can progress to invasive and metastatic
adenocarcinomas. In addition, Tyler Jack’s laboratory has engineered a conditional mutation in
the endogenous mouse K-RAS locus that can be activated by ectopic expression of a Cre
recombinase (Jackson et al., 2001). AdenoCre infection of mice harboring two copies of the
oncogenic allele results in highly efficient induction of lung tumors within 200 days. Mice with
one copy of K-RASD12
have a longer survival rate and display tumors of variable stage, spanning
mild hyperplasia to overt carcinoma and closely recapitulating human NSCLC. Given the
elevated expression of Arhgef2 we observed in late stage NSCLC, this would be a highly
relevant model in which to study the role of Arhgef2 in primary lung tumor growth and
metastases. Thus, genetic crosses of K-RASD12
PDAC and NSCLC mice with our ARHGEF2
knockout mice would provide excellent model systems to formally test the requirements of
ARHGEF2 in K-RAS-mediated tumor induction, growth, metastasis and survival.
4.3.2 The cooperation of Arhgef2 with mutant p53
p53 is a pleiotriopic transcription factor that plays a critical role in preventing tumor cell growth.
It lies at the heart of stress response pathways induced by DNA damage, telomere attrition,
oncogene activation, hypoxia and aberrant growth signals and functions to restore proper cell
function by inducing cell cycle arrest, DNA repair and/or apoptosis (Oren and Rotter, 2010). It is
the only gene to surpass the RAS genes in frequency of genetic aberrations in human cancer,
with over 50% of all tumors exhibiting loss-of-function or missense mutations in p53 (Hollstein
et al., 1991). Moreover, there is mounting evidence that missense p53 mutations not only lose
wild-type p53 function but also acquire gain-of-function (GOF) transcriptional and biological
activities, thus endowing cancer cells with a double oncogenic hit (Oren and Rotter, 2010).
105
ARHGEF2 was identified as a transcriptional target of GOF mutants of p53 (p53V157F
, p53R175H
and p53R248Q
) and promotes the proliferation of NSCLC cells harboring these mutations
(Mizuarai et al., 2006). These data suggests that Arhgef2 may cooperate with mutant p53 in
cellular transformation and present a powerful new avenue of Arhgef2 research.
Ovarian cancer (OC) encompasses a diverse set of tumor types that exhibit distinct
morphological and genetic features. These include clear cell, mucinous, endometrioid and serous
ovarian carcinomas (SOC) subtypes, the latter of which account for two-thirds of all ovarian
cancers and displays the highest mortality rate (Bernardini et al, 2010). Like PDAC, SOC is
often diagnosed at a very late stage when metastases are already present. p53 mutations occur in
60-70% of SOCs, in contrast to the other OC subtypes that exhibit a much lower incidence of
p53 mutations and commonly present at an early stage (Havrilesky et al., 2003, Leitao et al.,
2004). Although the combined frequency of p53 GOF and null mutations between early and late
stages of SOC is comparable, the fraction of missense mutations is significantly higher at
advanced stages of tumor progression. Moreover, missense p53 mutations in advanced stage
SOC correlate with decreased survival (Bernardini et al., 2010). These studies suggest that gain-
of-function mutations in p53 play a driving role in the malignant conversion and associated
lethality of SOC.
Given the transcriptional regulation of Arhgef2 by GOF mutants of p53, we sought to determine
whether Arhgef2 protein levels were increased in SOC tumors. To that end, we analyzed TMAs
derived from human clear cell, mucinous, endometrioid and serous ovarian carcinomas for both
Arhgef2 and p53 expression by immunohistostaining (Figure 4.1A). Overexpression of p53 is
considered a surrogate for mutant p53 expression, as normal cells express low levels of wild-type
p53 and cancer cells are most commonly p53 null or express high levels of the mutant form.
Both the staining intensity and percentage of tumor stained were given scores of 0-3 and
combined to yield immunoscores ranging from 0-6 for each tumor. Scores of 0-2 were
considered weak, 3-4 moderate and 5-6 high. Importantly, we found that Arhgef2 was markedly
and specifically upregulated in SOC and stained weakly in all other OC subtypes. Only 5/22
(22.73%) of clear cell, 2/17 (11.76%) of mucinous and 5/26 (19.23%) of endometrioid tumors
stained highly for Arhgef2, while 77/128 (60.16%) of SOC tumors displayed high Arhgef2
staining (Figure 4.1B). Moreover, p53 expression exhibited a similar trend, with 2/15 (13.33%)
106
clear cell, 4/13 (30.77%) mucinous and 3/14 (21.43%) endometrioid tumors staining highly for
p53 and 62/100 (62%) of SOC tumors showing high levels of p53 staining. These data show a
strong correlation between Arhgef2 and p53 expression and suggest that Arhgef2 may
functionally contribute to p53-mediated tumor progression in SOC.
Figure 4.1 Arhgef2 is highly expressed in serous ovarian carcinoma. (A) Representative images of tumor
microarrays derived from normal ovarian tissue and clear cell, mucinous, endometrioid and serous ovarian
carcinomas stained for Arhgef2 expression using a monoclonal antibody against human Arhgef2. Staining is
depicted in brown. (B) Distribution of Arhgef2 (left) and p53 (right) immunoscores in OC subtypes represented in
(A). Immunoscores were determined based on staining intensity (0-3) and percentage of tumor stained (0-3) to
107
generate combined histoscores ranging from 0-6, with 0-2 classified as weak, 3-4 as moderate and 5-6 as strong. n
indicates the number of tumors analyzed within each OC subtype.
Interestingly, 4 out of the 14 Arhgef2-essential cell lines identified in the genome-wide shRNA
screen described in Chapter 3 (Figure 3.4.2A) were of ovarian origin, closely following the 5/14
PDAC cell lines that were essential for Arhgef2. Together, OC and PDAC constituted 64.29% of
the cancer types that require Arhgef2 for survival. Moreover, all OC cell lines (4/4) carry
mutations in p53 (Table 4.1) with 10 of all 14 Arhgef2-essential cell lines (71.43%) harboring
p53 mutations (Samouelian et al., 2004, Redston et al., 1994, O’Connor et al., 1997, Letourneau
et al., 2012, Gelfi et al., 1997, Schumacher et al., 1999, Berrozpe et al., 1994, Wasielewski et al.,
2006). OV-90 and CFPAC-1, the ovarian and pancreatic cell lines most significantly essential for
Arhgef2 (p<0.001 and p=0.003, respectively), carry GOF mutations in both Raf and p53 and K-
RAS and p53, respectively (Estep et al., 2007, Samouelian et al., 2004, Kita et al., 1991, Redston
et al., 1994). These data suggest that both mutant p53 and RAS require Arhgef2 for survival and
that mutation of both oncogenes results in an enhanced dependence on Arhgef2. Moreover,
preliminary studies have shown that stable depletion of Arhgef2 in the SOC cell line OVCAR5,
harboring wild-type RAS and a mutation in codon 224 of p53 (p53224Q
) results in a pronounced
decrease in cell viability relative to hairpin control-expressing cells, showing that Arhgef2
essentiality can be validated in at least one model of SOC (Figure 4.2) (O’Connor et al., 1997).
Table 4.1. RAS/MAPK and p53 mutations in ARHGEF2-essential cell lines
Cell line Cancer type *RAS/MAPK status p53 status zGARP p-value
OV-90 Ovarian B-RafV600E 1p53S215R -1.49 <0.001
CFPAC-1 Pancreatic K-RASD12 2p35C242R -0.45 0.003
SK-OV-3 Ovarian WT 3p53H179R -0.48 0.006
HCT116 Colorectal K-RASD13 3WT -0.25 0.006
TOV-3133G Ovarian WT 4p53C574T -0.78 0.014
OVCA432 Ovarian WT 5p53C277F -0.89 0.015
Hs578T Breast H-RASV61 6p53V157F -0.42 0.016
Panc 02_03 Pancreatic K-RASD12 DNF -0.7 0.022
PaTu_8988T Pancreatic K-RASD12 7p53C282T -0.31 0.025
IMIMPC-1 Pancreatic K-RASD12 8p53L130V -0.37 0.029
RWP-1 Pancreatic K-RASD12 8p53R175H -0.54 0.032
HRE1 Lung WT DNF -3.05 0.044
SUM1315 Breast WT 9p53C135F -0.05 0.045 1Samouelian et al., 2004,
2Redston et al., 1994,
3O’Connor et al., 1997,
4Letourneau et al., 2012,
5Gelfi et al., 1997,
6Kovach et al., 1991,
7Schumacher et al., 1999,
8Berrozpe et al., 1994,
9Wasielewski et al., 2006
*References stated in Section 3.4.1.
DNF = data not found
108
Figure 4.2 Arhgef2 is essential for survival in OVCAR5 cells. OVCAR5 cells were stably infected with a hairpin
control (shGFP) or hairpin targeting human ARHGEF2 (shGEF) and selected with puromycin for 48h.
Representative cell densities are depicted (left) and Arhgef2 protein depletion was confirmed by Western blot
(right). Tubulin serves as a protein loading control.
Figure 4.3 Arhgef2 gene expression correlates with essentiality in serous ovarian carcinoma. Arhgef2 gene-
essentiality (zGARP) scores obtained from The RNAi Consortium (TRC) across 30 serous ovarian cancer cell lines
were plotted against ARHGEF2 transcript levels determined by RNA-Seq analysis.
To discern the potential relationship between mutant p53-mediated Arhgef2 upregulation and
Arhgef2 essentiality in SOC cells, we compared the gene essentiality scores (zGARP) with the
mRNA expression profiles (FPKM) of ARHGEF2 across 30 SOC cell lines contained within the
109
shRNA screen (Figure 4.3). We found a significant correlation between ARHGEF2 RNA
expression and essentiality (R=0.72), suggesting that Arhgef2 transcript upregulation may
contribute to increased cell survival in SOC. Together, these data support the hypothesis that
ARHGEF2 may be an essential gene in p53-mutated SOC and provide a solid foundation on
which to build a future project that could potentially be developed in a parallel manner to our
studies investigating Arhgef2 essentiality in K-RAS mutant cell lines and xenograft models. We
have analyzed Arhgef2 protein expression in a panel of OC cell lines (Figure 4.4), a cohort of
which could be employed to complete further in vitro and in vivo studies to validate the role of
Arhgef2 in SOC. Importantly, comparing the effects of OC lines expressing wild-type/null
versus GOF mutations in p53 may reveal the potential Arhgef2-dependency of GOF mutants of
p53.
Figure 4.4 Arhgef2 expression in human ovarian carcinoma cell lines. Whole cell lysates derived from ovarian
carcinoma cell lines were probed for Arhgef2 protein expression by Western blot. Actin serves as a protein loading
control.
110
4.3.3 The regulation of Arhgef2 by anti-mitotic chemotherapeutic agents
The microtubule cytoskeleton is an effective and validated target for cancer chemotherapeutic
drugs. A wide range of structurally distinct molecules can interact with microtubules and
interfere with their dynamics, leading to cell cycle arrest and apoptosis (Wilson et al., 1999).
Two main classes of anti-mitotic chemotherapeutic drugs (AMCDs) exist: those that bind to
and tubulin heterodimers and prevent their polymerization (vinca alkaloids), and those that
bind polymerized microtubules and stabilize them (taxanes). Nocodazole and taxol (paclitaxel)
are prototypical members of each class and are widely used in the treatment of haematological
and solid malignancies, respectively (Jordan and Wilson, 2004). Although they have
demonstrated potent antitumor activity across many cancer types, they display variable
sensitivity in the clinic due to inherent or acquired chemotherapeutic resistance. Thus, the
development of agents that can circumvent AMCD resistance is critical to achieve therapeutic
efficacy.
There are many mechanisms that may lead to AMCD resistance, including overexpression of
drug transporters in the cell, altered drug metabolism, decreased sensitivity to apoptotic stimuli,
altered binding of the drug to its target and alterations in microtubule dynamics (Gottesman,
2002). Proteins that regulate microtubule dynamics by interacting with tubulin dimers or
polymerized microtubules have been shown to modulate the sensitivity of cells to taxol and/or
nocodazole. The most well-studied examples are microtubule-associated proteins (MAPs) such
as stathmin and MAP4, which promote microtubule destabilization and stabilization, respectively
(Belmont and Mitchison, 1996, Chapin et al., 1995). The downregulation of stathmin sensitizes
leukemia cells to taxol and increases their resistance to the vinca alkaloid vinblastine (Iancu et
al., 2000 and 2001). In contrast, overexpression of stathmin in lung carcinoma cells sensitizes
them to the vinca alkaloid vincristine and has no effect on their sensitivity to taxol (Nishio et al.,
2001). Moreover, stathmin inhibited in vitro taxol-induced polymerization of microtubules
(Larsson et al., 1999). Conversely, overexpression of MAP4 induces microtubule polymerization
and is associated with increased and decreased sensitivity to paclitaxel and vinca alkaloids,
respectively (Zhang et al., 1998).
111
The net microtubule stabilizing or de-stabilizing effect of microtubule regulating proteins can not
necessarily predict its sensitivity to each class of AMCDs, however, since the microtubule
stabilizing protein Tau was shown to mediate resistance to paclitaxel in breast cancer (Wagner et
al., 2005). Depletion of Tau increased the sensitivity of breast cancer cells to paclitaxel and low
Tau expression correlated with enhanced sensitivity to paclitaxel in breast cancer patients
(Wagner et al., 2005). Wagner et al. found that the binding of Tau to polymerized microtubules
interfered with the binding of paclitaxel, suggesting that reduced interaction of paclitaxel with
microtubules results in its decreased efficacy. By contrast, MAP4 and paclitaxel do not interfere
with each other’s binding, leading to increased microtubule stability and enhanced paclitaxel
sensitivity. To increase this complexity, microtubule targeted drugs can synergize with one
another despite having overlapping binding sites on tubulin, suggesting that competitive
displacement is not the mechanism underlying binding interference (Martello et al., 2000). These
studies show that the contribution of microtubule regulating proteins to AMCD sensitivity is a
complex process and must be tested directly to ascertain whether they mediate sensitivity or
resistance.
In addition to the miss-expression of microtubule regulating proteins, oncogenic signaling
pathways can confer AMCD resistance. The RAS/MAPK pathway is a well-established mediator
of AMCD resistance through its regulation of microtubule stability, multidrug-1 resistance
(MDR-1) gene induction and survival signaling via the upregulation of the Bcl-2 family of pro-
survival proteins (Orr et al., 2005). ERK1/2 is activated in response to microtubule disruption
(Shinoharah-Gotoh et al., 1991, Schmid-Alliana et al., 1998) and MEK1/2 inhibition increases
taxol sensitivity in breast, ovarian, lung, colorectal and prostate cancer cells (Katayama et al.,
2007, Qiu et al., 2005, McDaid et al., 2005, McDaid and Horwitz, 2001, Mhaidat et al., 2009,
Zelivianski et al., 2003). Although some studies attribute the enhanced sensitivity of MEK and
taxol-treated tumors to the MEK-dependent up- and down-regulation of MDR-1 and Bcl-2,
respectively (Katayama et al., 2007, McCubrey et al., 2006), others have found that apoptosis
was induced independently of these factors (Bartling et al., 2008).
Arhgef2 is localized to the microtubule array and enhances microtubule stability as evidenced by
the presence of increased acetylated beta tubulin and microtubule bundling (Krendel et al., 2002,
Schiff and Horwitz, 1980). Importantly, overexpression of Arhgef2 results in increased
112
resistance to the microtubule depolymerising effects of nocodazole and is sequestered to
microtubules in response to taxol treatment, demonstrating that Arhgef2 can modulate the effect
of these chemotherapeutic drugs (Krendel et al., 2002). Thus, it would be of great interest to
discern the effect of Arhgef2 depletion on the sensitivity of cancer cells to both classes of
AMCDs. Moreover, given our studies implicating Arhgef2 as a critical mediator of RAS/MAPK
signaling in RAS-mutated cancer cells, it is tempting to speculate that Arhgef2 may mediate
AMCD resistance by linking microtubule disruption to activation of MAPK signaling. Indeed,
our data showing that a cytoplasmically-localized mutant of Arhgef2 can mediate MAPK
activation in the absence of oncogenic RAS show that the release of Arhgef2 from microtubules
is sufficient to enhance MAPK survival signaling. These observations suggest that Arhgef2
inhibition may sensitize cancer cells to AMCDs and suggest a novel way in which Arhgef2 may
serve as a therapeutic target. Given that AMCDs are known to exhibit additive or synergistic
effects despite similar mechanisms of action, there is reason to believe that combined inhibition
of Arhgef2 with taxol and/or nocodazole may improve therapeutic response. We have obtained
preliminary data showing that Arhgef2 is required for nocodazole-induced activation of ERK1/2,
thus implicating Arhgef2 in AMCD-mediated activation of MAPK signaling (data not shown).
These data greatly strengthen our hypotheses and support the potential of this research to be an
exciting future project.
4.3.4 Arhgef2 as a therapeutic target
In our studies we have provided evidence that Arhgef2 may be an effective therapeutic in human
cancers harboring RAS mutations. Moreover, the preliminary studies revealed in this chapter
suggest that Arhgef2 may also show therapeutic benefit in cancers harboring mutations in p53
and in conjunction with chemotherapeutic agents targeting the microtubule array. In order for
these arguments to stand, however, we must ascertain whether Arhgef2 is therapeutically
tractable given current technology.
GEFs are not classically considered “druggable,” as they lack the small pockets and grooves
required for small molecule interactions (Wells et al., 2007). The elucidation of several GEF-
GTPase structures has revealed large and undefined protein-protein interfaces required to
113
facilitate the structural changes of the small GTPase upon binding. This contrasts the small and
highly structured catalytic sites of efficiently targeted ATP-binding enzymes. However, the
current limitations we face in identifying small molecule inhibitors of GEFs does not mean that it
is an impossible feat. In fact, small molecule inhibitors of some GEFs have been identified,
supporting the argument that targeting GEFs is achievable. Brefeldin A (BFA), for example, is a
drug derived from the fungus Eupenicillium brefeldianum that inhibits Arf GEF by binding to its
catalytic domain complexed with Arf-GDP, thereby stabilizing their interaction and preventing
subsequent nucleotide exchange (Peyroche et al., 1999, Robineau et al., 2000). This type of
inhibition has been termed ‘interfacial inhibition’ and is characterized by the stabilization of
protein complexes at or near sites of contact. Moreover, screens have been used to identify
peptides that bind to the DH domains of GEFs, exemplified by a peptide targeting the oncogenic
GEF TRIO that effectively reduced TRIO-induced tumor formation in xenograft models
(Schmidt et al., 2002). Inhibitors of LARG have also been identified, further supporting the
notion that GEFs can be targeted by small molecules (Evelyn et al., 2009).
In the case of Arhgef2, one might assume that screens directed at isolating inhibitors of its GEF
activity may not be the most desirable since Arhgef2 can activate MAPK signaling
independently of its catalytic activity. However, we have demonstrated that Arhgef2 interacts
with KSR-1 via its DH domain; therefore, drugs resulting in the inhibition of its GTPase
exchange activity may also prevent its interaction with KSR-1 and activation of MAPK
signaling. In this way, small molecule inhibitors of the DH domain of Arhgef2 may reduce both
MAPK and RhoA signaling and serve as potent chemotherapeutic agents in tumors harboring
RAS mutations. Yeast-3-hybrid screens could be performed in which the binding of RhoA to
Arhgef2 is assessed in the presence or absence of libraries of small peptides, as was done for
TRIO (Schmidt et al., 2002). Positive hits could be subsequently tested for interference of the
KSR-1-Arhgef2 interaction to ensure that Arhgef2’s oncogenic GEF-independent functions were
also inhibited. These studies would have to be validated in vitro and in vivo for their functional
effects and assessed for undesirable off-target effects. Developing an inhibitor for Arhgef2
would undoubtedly be a challenging process; however, with the advancement of high through-
put screening methods and improved mechanistic and structural understanding of our desired
gene targets, it may be feasible in the years to come.
114
While the development of a small molecule inhibitor against Arhgef2 may be attainable,
however, it may not reproduce the magnitude of biological effects we observed in our shRNA
studies. This possibility is likely given that currently available GEF inhibitors display low
potency. Moreover, genetic ablation can differ greatly from pharmacologic inhibition of a target,
as evidenced by studies showing that preventing the interaction of RAS and PI3K but not
pharmacological inhibition of PI3K is effective in preventing K-RAS-induced lung tumor growth
(Gupta et al., 2007).
An alternative strategy to target Arhgef2 in the clinic is through the use of RNA interference
(RNAi). Although RNAi has not yet been approved for cancer treatment in humans, it has the
potential to be a potent and selective therapeutic modality, as it offers gene-specific targeting.
The major barrier to achieving the medicinal potential of RNAi in the form of siRNA lies in its
delivery to the cell, as siRNA often display poor stability and non-targeted biodistribution,
thereby initiating unwanted immune responses. Recent advances in siRNA delivery methods,
however, suggest that siRNA-targeting of Arhgef2 may be a successful means of therapy. A
recent publication in the Cullis laboratory showed effective silencing of the androgen receptor
(AR) in prostate cancer xenografts via the intravenous (i.v.) injection of lipid nanoparticle
(LNP)-encapsulated AR siRNA (Lee et al., 2012). Silencing of AR using shRNA was previously
shown to reduce prostate tumor growth and decrease serum prostate specific antigen (PSA)
production, thereby implicating AR in prostate tumorigenesis. Importantly, Lee et al. showed
that delivery of AR siRNA resulted in efficient endocytosis of the LNP, silencing of AR and
decreased serum PSA levels in vivo, demonstrating the feasibility of LNP delivery of siRNA for
the efficient silencing of oncogenes in tumors (Lee et al., 2012). Future research investigating the
effect of encapsulating Arhgef2 siRNA into LNP systems (Arhgef2LNP) and measuring the
initiation and/or regression of pancreatic xenografts following i.v. injection would help unveil
the therapeutic potential of Arhgef2.
Current siRNA treatments are largely directed at diseases of the liver, since it is a site of high
LNP accumulation. Significantly, the siRNA chemotherapeutic ALN-VSP, containing siRNA
directed at kinesin spindle protein (KSP) and vascular endothelial growth factor (VEGF), has
shown effect in hepatocellular carcinoma and has recently been promoted to Phase II clinical
trials (www.alnylam.com). Given that Arhgef2 was shown to contribute to the malignant
115
progression of HCC, an HCC model of tumorigenesis would serve as an ideal proof-of-concept
model to test the efficacy of an Arhgef2LNP (Cheng et al., 2012). A Cullis-Cullis collaboration
may therefore put an anti-Arhgef2 chemotherapeutic within clinical reach, and is an essential
next step!
116
Concluding Remarks
Since the discovery of the RAS genes in the 1980s, we have gained remarkable insight into the
molecular complexity of human tumorigenesis. One unifying concept that emerges is that
oncogenic signaling is highly context-specific and can evolve throughout the course of
tumorigenic progression. While this may seem daunting from a therapeutic perspective, the more
we understand these complexities the better we will be at attacking them. New strategies such as
combinatorial therapies to target multiple oncogenes in a single tumor and changing therapeutic
approaches based on the genetic makeup of a cancer cell – termed personalized medicine –
reflect the intellectual advances we have made and are likely to yield improved therapeutic
responses in the years to come.
For these reasons, whether or not Arhgef2 is indeed an important determinant of tumorigenic
progression does not dictate the value of these studies to the development of effective cancer
therapies. The more we understand the subtleties of oncogenic signaling, the closer we will get to
achieving curative therapy. From this perspective, I hope to take the knowledge I have gained in
the last six years and continue to help the advancement medicinal science in the next phase of
my scientific journey.
117
Appendix
Appendix 1: Microarray analysis of PANC-1 and H-RASV12-Transformed
Fibroblast Cells Harboring Stable Arhgef2 Knockdown
Table I Functional annotation clustering of upregulated genes in Arhgef2-depleted PANC-1 cells
A. Biological Process Count % Enrichment p-value
response to organic substance 40 9.80 0.0000
regulation of apoptosis 40 9.80 0.0000
regulation of programmed cell death 40 9.80 0.0000
regulation of cell death 40 9.80 0.0000
response to protein stimulus 13 3.19 0.0000
regulation of cell proliferation 37 9.07 0.0000
biological adhesion 34 8.33 0.0000
anti-apoptosis 16 3.92 0.0001
response to oxidative stress 14 3.43 0.0001
cell adhesion 33 8.09 0.0001
response to inorganic substance 15 3.68 0.0002
response to reactive oxygen species 9 2.21 0.0002
negative regulation of apoptosis 20 4.90 0.0003
negative regulation of programmed cell death 20 4.90 0.0004
negative regulation of cell death 20 4.90 0.0004
negative regulation of cell proliferation 20 4.90 0.0004
regulation of smooth muscle cell proliferation 7 1.72 0.0005
regulation of locomotion 13 3.19 0.0011
cell migration 16 3.92 0.0012
response to mechanical stimulus 7 1.72 0.0014
cell motion 22 5.39 0.0019
cellular response to oxidative stress 6 1.47 0.0024
protein localization at cell surface 3 0.74 0.0028
negative regulation of transcription factor activity 6 1.47 0.0029
response to hormone stimulus 18 4.41 0.0031
cell motility 16 3.92 0.0033
localization of cell 16 3.92 0.0033
response to steroid hormone stimulus 12 2.94 0.0035
positive regulation of chemotaxis 5 1.23 0.0035
regulation of cell migration 11 2.70 0.0042
positive regulation of smooth muscle cell
proliferation 5 1.23 0.0045
regulation of chemotaxis 5 1.23 0.0045
response to unfolded protein 7 1.72 0.0046
118
negative regulation of DNA binding 6 1.47 0.0051
positive regulation of locomotion 8 1.96 0.0058
positive regulation of behavior 5 1.23 0.0063
cellular homeostasis 20 4.90 0.0072
response to hydrogen peroxide 6 1.47 0.0076
negative regulation of biosynthetic process 23 5.64 0.0079
extracellular matrix organization 8 1.96 0.0079
blood vessel development 13 3.19 0.0080
negative regulation of cell migration 6 1.47 0.0081
leukocyte migration 6 1.47 0.0081
response to endogenous stimulus 18 4.42 0.0082
regulation of leukocyte migration 4 0.98 0.0091
negative regulation of macromolecule biosynthetic
process 22 5.39 0.0093
sequestering of metal ion 3 0.74 0.0094
negative regulation of binding 6 1.47 0.0094
vasculature development 13 3.19 0.0096
extracellular structure organization 10 2.45 0.0099
B. Molecular Function Count % Enrichment p-value
kinase binding 12 2.94 0.0025
antioxidant activity 6 1.47 0.0040
oxidoreductase activity, acting on peroxide as
acceptor 5 1.23 0.0056
peroxidase activity 5 1.23 0.0056
collagen binding 5 1.23 0.0085
C. KEGG Pathway Count % Enrichment p-value
Focal adhesion 16 3.92 0.0003
ECM-receptor interaction 8 1.96 0.0077
NOD-like receptor signaling pathway 6 1.47 0.0264
Bladder cancer 5 1.23 0.0268
Epithelial cell signaling in Helicobacter pylori
infection 6 1.47 0.0374
Leukocyte transendothelial migration 8 1.96 0.0418
Table II Upregulated gene lists in Arhgef2-depleted PANC-1 cells by functional annotation
A. Regulation of Apoptosis (40) (Biological Process)
ENTREZ Gene ID Gene Name
119
694 B-cell translocation gene 1, anti-proliferative
4671 NLR family, apoptosis inhibitory protein
6502 S-phase kinase-associated protein 2 (p45)
51282 SCAN domain containing 1
55437 STE20-related kinase adaptor beta
51499 TP53 regulated inhibitor of apoptosis 1
301 annexin A1
317 apoptotic peptidase activating factor 1
999 cadherin 1, type 1, E-cadherin (epithelial)
837 caspase 4, apoptosis-related cysteine peptidase
6347 chemokine (C-C motif) ligand 2
162989 death effector domain containing 2
1611 death-associated protein
2073
excision repair cross-complementing rodent repair deficiency,
group 5
51083 galanin prepropeptide
3336 heat shock 10kDa protein 1 (chaperonin 10)
3304, 3303 heat shock 70kDa protein 1A; heat shock 70kDa protein 1B
7184 heat shock protein 90kDa beta (Grp94), member 1
3162 heme oxygenase (decycling) 1
348 hypothetical LOC100129500; apolipoprotein E
3399
inhibitor of DNA binding 3, dominant negative helix-loop-helix
protein
3482 insulin-like growth factor 2 receptor
9445 integral membrane protein 2B
3570 interleukin 6 receptor
4318 matrix metallopeptidase 9
5601 mitogen-activated protein kinase 9
4487 msh homeobox 1
27018 nerve growth factor receptor (TNFRSF16) associated protein 1
26471 nuclear protein, transcriptional regulator, 1
7001 peroxiredoxin 2
10935 peroxiredoxin 3
5051 platelet-activating factor acetylhydrolase 2
5621 prion protein
5578 protein kinase C, alpha
9616 ring finger protein 7
6609 sphingomyelin phosphodiesterase 1
10628 thioredoxin interacting protein
7057 thrombospondin 1
7009 transmembrane BAX inhibitor motif containing 6
7428 von Hippel-Lindau tumor suppressor
120
B. Biological Adhesion (32) (Biological Process)
ENTREZ Gene ID Gene Name
83692 CD99 molecule-like 2
8857 Fc fragment of IgG binding protein
9289 G protein-coupled receptor 56
5754 PTK7 protein tyrosine kinase 7
999 cadherin 1, type 1, E-cadherin (epithelial)
1000 cadherin 2, type 1, N-cadherin (neuronal)
1001 cadherin 3, type 1, P-cadherin (placental)
56265 carboxypeptidase X (M14 family), member 1
6347 chemokine (C-C motif) ligand 2
9076 claudin 1
9071 claudin 10
9069 claudin 12
1301 collagen, type XI, alpha 1
1829 desmoglein 2
285761 discoidin, CUB and LCCL domain containing 1
131566 discoidin, CUB and LCCL domain containing 2
10979 fermitin family homolog 2 (Drosophila)
3673 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
3678 integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
3688 integrin, beta 1 (fibronectin receptor, beta polypeptide)
9235 interleukin 32
3918 laminin, gamma 2
10446 leucine rich repeat neuronal 2
9404 leupaxin
4478 moesin
29780 parvin, beta
5796 protein tyrosine phosphatase, receptor type, K
10076 protein tyrosine phosphatase, receptor type, U
8082 sarcospan (Kras oncogene-associated gene)
113675 serine dehydratase-like
140885 signal-regulatory protein alpha
6695 sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1
7057 thrombospondin 1
7045 transforming growth factor, beta-induced, 68kDa
C. Cell Motion (22) (Biological Process)
ENTREZ Gene ID Gene Name
694 B-cell translocation gene 1, anti-proliferative
2048 EPH receptor B2
121
301 annexin A1
1000 cadherin 2, type 1, N-cadherin (neuronal)
800 caldesmon 1
6347 chemokine (C-C motif) ligand 2
1839 heparin-binding EGF-like growth factor
3397
inhibitor of DNA binding 1, dominant negative helix-loop-helix
protein
3673 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
3678 integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
3688 integrin, beta 1 (fibronectin receptor, beta polypeptide)
3570 interleukin 6 receptor
3576 interleukin 8
4478 moesin
5420 podocalyxin-like
5578 protein kinase C, alpha
5796 protein tyrosine phosphatase, receptor type, K
6695 sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1
7057 thrombospondin 1
7171 tropomyosin 4
7424 vascular endothelial growth factor C
7428 von Hippel-Lindau tumor suppressor
D. Cell Junction (24) (Cellular Component)
ENTREZ Gene ID Gene Name
83692 CD99 molecule-like 2
153562 MARVEL domain containing 2
999 cadherin 1, type 1, E-cadherin (epithelial)
1000 cadherin 2, type 1, N-cadherin (neuronal)
1001 cadherin 3, type 1, P-cadherin (placental)
9076 claudin 1
9071 claudin 10
9069 claudin 12
1829 desmoglein 2
57669 erythrocyte membrane protein band 4.1 like 5
10979 fermitin family homolog 2
2560 gamma-aminobutyric acid (GABA) A receptor, beta 1
3673 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
3678 integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
3688 integrin, beta 1 (fibronectin receptor, beta polypeptide)
5058 p21 protein (Cdc42/Rac)-activated kinase 1
24145 pannexin 1
122
29780 parvin, beta
23362 pleckstrin and Sec7 domain containing 3
5796 protein tyrosine phosphatase, receptor type, K
10076 protein tyrosine phosphatase, receptor type, U
8082 sarcospan (Kras oncogene-associated gene)
26872 six transmembrane epithelial antigen of the prostate 1
127262 tumor protein p63 regulated 1-like
E. Focal Adhesion (16) (KEGG Pathway)
ENTREZ Gene ID Gene Name
1277 collagen, type I, alpha 1
1290 collagen, type V, alpha 2
1301 collagen, type XI, alpha 1
2316 filamin A, alpha (actin binding protein 280)
3673 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
3678 integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
3688 integrin, beta 1 (fibronectin receptor, beta polypeptide)
3918 laminin, gamma 2
5601 mitogen-activated protein kinase 9
10398 myosin, light chain 9, regulatory
5058 p21 protein (Cdc42/Rac)-activated kinase 1
56924 p21 protein (Cdc42/Rac)-activated kinase 6
29780 parvin, beta
5578 protein kinase C, alpha
7057 thrombospondin 1
7424 vascular endothelial growth factor C
F. ECM-Receptor Interaction (8) (KEGG Pathway)
ENTREZ Gene ID Gene Name
1277 collagen, type I, alpha 1
1290 collagen, type V, alpha 2
1301 collagen, type XI, alpha 1
3673 integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor)
3678 integrin, alpha 5 (fibronectin receptor, alpha polypeptide)
3688 integrin, beta 1 (fibronectin receptor, beta polypeptide)
3918 laminin, gamma 2
7057 thrombospondin 1
123
Table III Functional annotation clustering of downregulated genes in Arhgef2-depleted PANC-1
cells
A. Biological Process Count % Enrichment p-value
positive regulation of organelle organization 10 2.88 0.0000
mesenchymal cell development 8 2.31 0.0000
mesenchymal cell differentiation 8 2.31 0.0000
mesenchyme development 8 2.31 0.0000
regulation of organelle organization 15 4.32 0.0000
M phase 18 5.19 0.0001
positive regulation of cytoskeleton organization 7 2.02 0.0002
regulation of transcription from RNA polymerase II
promoter 29 8.36 0.0002
cell cycle phase 20 5.76 0.0002
negative regulation of cellular biosynthetic process 24 6.92 0.0003
negative regulation of biosynthetic process 24 6.92 0.0004
regulation of phosphorylation 21 6.05 0.0004
cell cycle 29 8.36 0.0005
regulation of nuclear division 7 2.02 0.0005
regulation of mitosis 7 2.02 0.0005
regulation of anti-apoptosis 6 1.73 0.0006
regulation of phosphate metabolic process 21 6.05 0.0006
regulation of phosphorus metabolic process 21 6.05 0.0006
cell cycle process 23 6.63 0.0007
regulation of cytoskeleton organization 10 2.88 0.0009
regulation of kinase activity 17 4.90 0.0009
organelle fission 13 3.75 0.0011
negative regulation of macromolecule biosynthetic
process 22 6.34 0.0011
cell proliferation 19 5.48 0.0011
mitotic cell cycle 17 4.90 0.0013
regulation of transferase activity 17 4.90 0.0014
negative regulation of nitrogen compound metabolic
process 21 6.05 0.0014
establishment of organelle localization 7 2.02 0.0016
regulation of protein kinase activity 16 4.61 0.0018
blood vessel morphogenesis 12 3.46 0.0018
positive regulation of cellular component
organization 11 3.17 0.0019
negative regulation of transcription 19 5.48 0.0020
negative regulation of macromolecule metabolic
process 26 7.49 0.0021
chromosome localization 4 1.15 0.0024
124
establishment of chromosome localization 4 1.15 0.0024
negative regulation of gene expression 20 5.76 0.0024
negative regulation of transcription, DNA-dependent 16 4.61 0.0024
mitosis 12 3.45 0.0025
nuclear division 12 3.46 0.0025
regulation of endothelial cell proliferation 5 1.45 0.0026
negative regulation of RNA metabolic process 16 4.61 0.0028
cytoskeleton organization 18 5.19 0.0028
M phase of mitotic cell cycle 12 3.46 0.0029
negative regulation of nucleobase, nucleoside,
nucleotide and nucleic acid metabolic process 20 5.76 0.0029
neural crest cell development 5 1.44 0.0030
neural crest cell differentiation 5 1.44 0.0030
regulation of transcription, DNA-dependent 49 14.12 0.0033
regulation of apoptosis 27 7.78 0.0035
positive regulation of protein complex assembly 5 1.44 0.0037
ectoderm development 11 3.17 0.0037
regulation of programmed cell death 27 7.78 0.0040
epithelial to mesenchymal transition 4 1.15 0.0041
regulation of cell death 27 7.78 0.0042
regulation of cellular component size 13 3.75 0.0043
embryonic organ development 10 2.88 0.0045
skeletal system morphogenesis 8 2.31 0.0045
regulation of cellular component biogenesis 9 2.59 0.0046
negative regulation of cellular component
organization 9 2.59 0.0046
regulation of cell cycle process 8 2.31 0.0050
regulation of RNA metabolic process 49 14.12 0.0051
regulation of cell proliferation 26 7.49 0.0052
blood vessel development 12 3.45 0.0056
muscle organ development 11 3.17 0.0056
positive regulation of molecular function 21 6.05 0.0057
angiogenesis 9 2.59 0.0059
skeletal system development 14 4.03 0.0060
regulation of protein complex assembly 7 2.02 0.0062
cellular macromolecular complex subunit
organization 15 4.32 0.0062
vasculature development 12 3.46 0.0067
organelle localization 7 2.02 0.0069
epidermis development 10 2.88 0.0069
regulation of mitotic cell cycle 9 2.59 0.0070
transcription, DNA-dependent 13 3.75 0.0077
regulation of protein polymerization 6 1.73 0.0081
125
regulation of cell cycle 14 4.04 0.0082
RNA biosynthetic process 13 3.75 0.0086
regulation of locomotion 10 2.88 0.0090
B. Cellular Component Count % Enrichment p-value
chromosome, centromeric region 10 2.88 0.0002
kinetochore 8 2.31 0.0003
condensed chromosome kinetochore 7 2.02 0.0004
chromosome 19 5.48 0.0008
cytoskeleton 40 11.53 0.0008
condensed chromosome, centromeric region 7 2.02 0.0008
non-membrane-bounded organelle 64 18.44 0.0010
intracellular non-membrane-bounded organelle 64 18.44 0.0010
chromosomal part 16 4.61 0.0023
spindle pole 5 1.44 0.0024
spindle 9 2.59 0.0034
condensed chromosome 8 2.31 0.0061
C. Molecular Function Count % Enrichment p-value
transcription cofactor activity 20 5.76 0.0000
transcription factor binding 24 6.92 0.0001
transcription regulator activity 49 14.12 0.0001
transcription factor activity 35 10.09 0.0002
enzyme binding 23 6.63 0.0002
transcription activator activity 17 4.90 0.0033
GTPase binding 8 2.31 0.0036
GTP-Rho binding 3 0.86 0.0047
Rho GTPase binding 5 1.44 0.0048
protein serine/threonine kinase activity 17 4.90 0.0052
transcription coactivator activity 11 3.17 0.0056
Ras GTPase binding 7 2.02 0.0061
protein kinase activity 21 6.05 0.0070
protein tyrosine kinase activator activity 3 0.86 0.0085
D. KEGG Pathway Count % Enrichment p-value
MAPK signaling pathway 12 3.46 0.0054
Oocyte meiosis 7 2.02 0.0109
Focal adhesion 9 2.59 0.0209
Table IV Downregulated gene lists in Arhgef2-depleted PANC-1 cells by functional annotation
126
A. Mesenchymal Cell Development/Differentiation (8) (Biological Process)
ENTREZ Gene ID Gene Name
6275 S100 calcium binding protein A4
6662 SRY (sex determining region Y)-box 9
6899 T-box 1
1906 endothelin 1
8320 eomesodermin homolog
3911 laminin, alpha 5
3084 neuregulin 1
4772
nuclear factor of activated T-cells, cytoplasmic, calcineurin-
dependent 1
B. Anti-Apoptosis (6) (Biological Process)
ENTREZ Gene ID Gene Name
581 BCL2-associated X protein
133 adrenomedullin
857 caveolin 1
1843 dual specificity phosphatase 1
6242 rhotekin
23411 sirtuin (silent mating type information regulation 2 homolog) 1
C. Cell Migration (9) (Biological Process)
ENTREZ Gene ID Gene Name
10370
Cbp/p300-interacting transactivator, with Glu/Asp-rich
carboxy-terminal domain, 2
7070 Thy-1 cell surface antigen
2152 coagulation factor III
1906 endothelin 1
3486 insulin-like growth factor binding protein 3
3911 laminin, alpha 5
5594 mitogen-activated protein kinase 1
5155 platelet-derived growth factor beta polypeptide
5879 ras-related C3 botulinum toxin substrate 1 (Rac1)
D. Cytoskeleton (4) (Cellular Component)
127
ENTREZ Gene ID Gene Name
9590 A kinase (PRKA) anchor protein 12
148170 CDC42 effector protein (Rho GTPase binding) 5
10160 FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1
3005 H1 histone family, member 0
9181 Rho/Rac guanine nucleotide exchange factor (GEF) 2
11078 TRIO and F-actin binding protein
60312 actin filament associated protein 1
83543 allograft inflammatory factor 1-like
23299 bicaudal D homolog 2
274 bridging integrator 1
55450 calcium/calmodulin-dependent protein kinase II inhibitor 1
801 calmodulin 3 (phosphorylase kinase, delta)
1062 centromere protein E, 312kDa
1063 centromere protein F, 350/400ka (mitosin)
22995 centrosomal protein 152kDa
1808 dihydropyrimidinase-like 2
9787 discs, large (Drosophila) homolog-associated protein 5
2037 erythrocyte membrane protein band 4.1-like 2
79187 fibronectin type III and SPRY domain containing 1
2318 filamin C, gamma
284085 hypothetical protein FLJ40504
149501 keratin 8 pseudogene 9; similar to keratin 8
144501 keratin 80
55329 meiosis-specific nuclear structural 1
5594 mitogen-activated protein kinase 1
4644 myosin VA (heavy chain 12, myoxin)
25924 myosin VIIA and Rab interacting protein
140465 myosin, light chain 6B, alkali, smooth muscle and non-muscle
84276 nicolin 1
54820 nudE nuclear distribution gene E homolog 1
4957 outer dense fiber of sperm tails 2
5062 p21 protein (Cdc42/Rac)-activated kinase 2
5347 polo-like kinase 1 (Drosophila)
5516
protein phosphatase 2 (formerly 2A), catalytic subunit, beta
isoform
5925 retinoblastoma 1
10174 sorbin and SH3 domain containing 3
3925 stathmin 1
11013 thymosin beta 15a
7138 troponin T type 1
347733 tubulin, beta 2B
128
E. Focal Adhesion (9) (KEGG Pathway)
ENTREZ Gene ID Gene Name
857 caveolin 1
858 caveolin 2
2318 filamin C, gamma
3911 laminin, alpha 5
10319 laminin, gamma 3
5594 mitogen-activated protein kinase 1
5062 p21 protein (Cdc42/Rac)-activated kinase 2
5155 platelet-derived growth factor beta polypeptide
5879 ras-related C3 botulinum toxin substrate 1 (Rac1)
Table V Functional annotation clustering of Significance Analysis of Microarray (SAM) genes
downregulated in Arhgef2-depleted NIH 3T3-H-RasV12
cells
A. Biological Process Count
%
Enrichment p-value
positive regulation of ERK1 and ERK2 cascade 3 2.46 0.0013
regulation of ERK1 and ERK2 cascade 3 2.46 0.0020
response to wounding 9 7.38 0.0026
inflammatory response 7 5.74 0.0044
taxis 5 4.10 0.0066
chemotaxis 5 4.10 0.0066
epithelial cell differentiation 5 4.10 0.0101
transmembrane receptor protein tyrosine kinase signaling
pathway 6 4.92 0.0102
regulation of morphogenesis of a branching structure 3 2.46 0.0126
mammary gland bud formation 2 1.64 0.0136
branch elongation involved in salivary gland
morphogenesis 2 1.64 0.0136
fibroblast growth factor receptor signaling pathway 3 2.46 0.0178
salivary gland development 3 2.46 0.0189
mammary gland bud morphogenesis 2 1.64 0.0204
behavior 8 6.56 0.0210
response to organic substance 9 7.38 0.0222
positive regulation of endocytosis 3 2.46 0.0226
lacrimal gland development 2 1.64 0.0271
exocrine system development 3 2.46 0.0320
defense response 8 6.56 0.0338
response to endogenous stimulus 5 4.10 0.0375
129
epithelium development 6 4.92 0.0383
enzyme linked receptor protein signaling pathway 6 4.92 0.0393
lung development 4 3.28 0.0405
positive regulation of MAPKKK cascade 3 2.46 0.0411
electron transport chain 4 3.28 0.0415
respiratory tube development 4 3.28 0.0424
cell-matrix adhesion 3 2.46 0.0459
gland development 5 4.10 0.0462
prostate glandular acinus morphogenesis 2 1.64 0.0469
prostate epithelial cord arborization in prostate glandular
acinus morph. 2 1.64 0.0469
regulation of branching involved in prostate gland
morphogenesis 2 1.64 0.0469
epithelial cell proliferation involved in salivary gland
morphogenesis 2 1.64 0.0469
regulation of endocytosis 3 2.46 0.0493
B. Cellular Component Count % Enrichment p-value
adherens junction 6 4.92 0.0007
anchoring junction 6 4.92 0.0014
cell junction 10 8.20 0.0042
focal adhesion 4 3.28 0.0066
cell-substrate adherens junction 4 3.28 0.0080
cell-substrate junction 4 3.28 0.0099
actin cytoskeleton 6 4.92 0.0122
muscle thin filament tropomyosin 2 1.64 0.0134
extracellular region part 12 9.84 0.0142
contractile fiber part 4 3.28 0.0201
contractile fiber 4 3.28 0.0260
microsome 5 4.10 0.0307
vesicular fraction 5 4.10 0.0341
extrinsic to membrane 8 6.56 0.0391
organelle membrane 11 9.02 0.0441
striated muscle thin filament 2 1.64 0.0461
cell fraction 9 7.38 0.0464
mitochondrial inner membrane 6 4.92 0.0489
C. Molecular Function Count % Enrichment p-value
pattern binding 6 4.92 0.0015
polysaccharide binding 6 4.92 0.0015
chemokine activity 4 3.28 0.0019
chemokine receptor binding 4 3.28 0.0021
130
D. KEGG Pathway Count % Enrichment p-value
Metabolism of xenobiotics by cytochrome P450 5 4.10 0.0023
Chemokine signaling pathway 7 5.74 0.0042
Tight junction 6 4.92 0.0056
Glutathione metabolism 4 3.28 0.0096
Drug metabolism 4 3.28 0.0257
Table VI Downregulated gene lists in Arhgef2-depleted NIH 3T3-H-RASV12
cells by functional
annotation
A. Response to Wounding (9) (Biological Process)
ENTREZ Gene ID Gene Name
20296 chemokine (C-C motif) ligand 2
20306 chemokine (C-C motif) ligand 7
14825 chemokine (C-X-C motif) ligand 1
80859
nuclear factor of kappa light polypeptide gene enhancer in B-
cells inh z
100044702 similar to LPS-induced CXC chemokine; chemokine ligand 5
20848 signal transducer and activator of transcription 3
20512
solute carrier family 1 (glial high affinity glutamate transporter),
member 3
21859 tissue inhibitor of metalloproteinase 3
21898 toll-like receptor 4
B. Epithelial Cell Differentiation (5) (Biological Process)
ENTREZ Gene ID Gene Name
22433 X-box binding protein 1
14165 fibroblast growth factor 10
14183 fibroblast growth factor receptor 2
16664 keratin 14
21804 transforming growth factor beta 1 induced transcript 1
C. Fibroblast Growth Factor Receptor Signaling Pathway (3) (Biological Process)
glycosaminoglycan binding 5 4.10 0.0066
growth factor binding 4 3.28 0.0117
heparin binding 4 3.28 0.0171
carbohydrate binding 7 5.74 0.0177
cytokine activity 5 4.10 0.0304
131
ENTREZ Gene ID Gene Name
14219 connective tissue growth factor
14165 fibroblast growth factor 10
14183 fibroblast growth factor receptor 2
D. Cell-Matrix Adhesion (3) (Biological Process)
ENTREZ Gene ID Gene Name
14219 connective tissue growth factor
16419 integrin beta 5
19261 signal-regulatory protein alpha
E. Adherens Junctions (5) (Cellular Component)
ENTREZ Gene ID Gene Name
65970 LIM domain and actin binding 1
109711 actinin, alpha 1
17356 mixed-lineage leukemia; translocated to, 4
19294 poliovirus receptor-related 2
21753 testis derived transcript
21804 transforming growth factor beta 1 induced transcript 1
F. Cell Junction (10) (Cellular Component)
ENTREZ Gene ID Gene Name
65970 LIM domain and actin binding 1
109711 actinin, alpha 1
13823 erythrocyte protein band 4.1-like 3
17356 mixed-lineage leukemia; translocated to, 4
93737 par-6 partitioning defective 6 homolog gamma
19294 poliovirus receptor-related 2
52398 septin 11
21753 testis derived transcript
60409 trafficking protein particle complex 4
21804 transforming growth factor beta 1 induced transcript 1
G. Tight Junction (6) (KEGG Pathway)
ENTREZ Gene ID Gene Name
109711 actinin, alpha 1
13823 erythrocyte protein band 4.1-like 3
132
17356 mixed-lineage leukemia; translocated to, 4
98932 myosin, light polypeptide 9, regulatory
93737 par-6 partitioning defective 6 homolog gamma
23797 thymoma viral proto-oncogene 3
Tables I-IV. Microarray analysis of Arhgef2-depleted PANC-1 cells. Table I: Gene ontology analysis of the 399
most upregulated genes in PANC-1shGFP vs PANC-1shGEF cells (greater than DF log2 of 0.6 or 1.52 fold-change)
showing gene classification based on biological process (Table IA), cellular component (Table IB), molecular
function (Table IC) and KEGG pathway (Table ID). Table II: upregulated genes of interest are listed by functional
annotation category in Tables IIA-F. Table III: The 416 most downregulated genes in PANC-1shGFP vs PANC-
1shGEF cells (less than DF log2 of -0.6 or -1.52 fold-change) were classified as in Table I in Tables IIIA-D. Table
IV: downregulated genes of interest are listed by functional annotation in Tables IVA-E. Count reveals number of
genes perturbed within each annotated group, % enrichment denotes the fraction of genes associated with its
respective group that are enriched in the dataset. P-values of less than 0.01 or 0.05 are shown.
Tables V and VI. Microarray analysis of Arhgef2-depleted NIH 3T3-H-RASV12
cells. Table V: Gene ontology
analysis of 170 significantly downregulated genes in Arhgef2-depleted NIH 3T3-H-RASV12
cells as measured by
SAM analysis. Gene enrichment according to biological process, cellular component, molecular function and KEGG
pathway are shown in Tables VA-D, respectively. Count, % enrichment and p-values are as stated for Tables I-IV.
Table VI: genes of interest are listed by functional annotation in Tables VIA-G.
133
References
(1) Adjei, A. A. Ras signaling pathway proteins as therapeutic targets. Curr. Pharm. Des. 2001,
7, 1581-1594.
(2) Aguirre, A. J.; Bardeesy, N.; Sinha, M.; Lopez, L.; Tuveson, D. A.; Horner, J.; Redston, M.
S.; DePinho, R. A. Activated Kras and Ink4a/Arf deficiency cooperate to produce metastatic
pancreatic ductal adenocarcinoma. Genes Dev. 2003, 17, 3112-3126.
(3) Aijaz, S.; D'Atri, F.; Citi, S.; Balda, M. S.; Matter, K. Binding of GEF-H1 to the tight
junction-associated adaptor cingulin results in inhibition of Rho signaling and G1/S phase
transition. Dev. Cell.2005, 8, 777-786.
(4) Almoguera, C.; Shibata, D.; Forrester, K.; Martin, J.; Arnheim, N.; Perucho, M. Most human
carcinomas of the exocrine pancreas contain mutant c-K-ras genes. Cell 1988, 53, 549-554.
(5) Apple, S. K.; Hecht, J. R.; Lewin, D. N.; Jahromi, S. A.; Grody, W. W.; Nieberg, R. K.
Immunohistochemical evaluation of K-ras, p53, and HER-2/neu expression in hyperplastic,
dysplastic, and carcinomatous lesions of the pancreas: evidence for multistep
carcinogenesis. Hum. Pathol. 1999, 30, 123-129.
(6) Atfi, A.; Djelloul, S.; Chastre, E.; Davis, R.; Gespach, C. Evidence for a role of Rho-like
GTPases and stress-activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK) in
transforming growth factor beta-mediated signaling. J. Biol. Chem. 1997, 272, 1429-1432.
(7) Auewarakul, C. U.; Lauhakirti, D.; Tocharoentanaphol, C. Frequency of RAS gene mutation
and its cooperative genetic events in Southeast Asian adult acute myeloid leukemia. Eur. J.
Haematol.2006, 77, 51-56.
(8) Bagrodia, S.; Derijard, B.; Davis, R. J.; Cerione, R. A. Cdc42 and PAK-mediated signaling
leads to Jun kinase and p38 mitogen-activated protein kinase activation. J. Biol.
Chem. 1995, 270, 27995-27998.
(9) Bakal, C. J.; Finan, D.; LaRose, J.; Wells, C. D.; Gish, G.; Kulkarni, S.; DeSepulveda, P.;
Wilde, A.; Rottapel, R. The Rho GTP exchange factor Lfc promotes spindle assembly in
early mitosis. Proc. Natl. Acad. Sci. U. S. A. 2005, 102, 9529-9534.
(10) Bakin, A. V.; Tomlinson, A. K.; Bhowmick, N. A.; Moses, H. L.; Arteaga, C. L.
Phosphatidylinositol 3-kinase function is required for transforming growth factor beta-
mediated epithelial to mesenchymal transition and cell migration. J. Biol. Chem. 2000, 275,
36803-36810.
(11) Balmain, A.; Pragnell, I. B. Mouse skin carcinomas induced in vivo by chemical
carcinogens have a transforming Harvey-ras oncogene. Nature 1983, 303, 72-74.
134
(12) Barbera, M. J.; Puig, I.; Dominguez, D.; Julien-Grille, S.; Guaita-Esteruelas, S.; Peiro, S.;
Baulida, J.; Franci, C.; Dedhar, S.; Larue, L.; Garcia de Herreros, A. Regulation of Snail
transcription during epithelial to mesenchymal transition of tumor cells. Oncogene 2004, 23,
7345-7354.
(13) Bardeesy, N.; Cheng, K. H.; Berger, J. H.; Chu, G. C.; Pahler, J.; Olson, P.; Hezel, A. F.;
Horner, J.; Lauwers, G. Y.; Hanahan, D.; DePinho, R. A. Smad4 is dispensable for normal
pancreas development yet critical in progression and tumor biology of pancreas
cancer. Genes Dev. 2006, 20, 3130-3146.
(14) Bar-Sagi, D.; Feramisco, J. R. Induction of membrane ruffling and fluid-phase pinocytosis
in quiescent fibroblasts by ras proteins. Science 1986, 233, 1061-1068.
(15) Bartling, B.; Hofmann, H. S.; Silber, R. E.; Simm, A. Differential impact of fibroblasts on
the efficient cell death of lung cancer cells induced by paclitaxel and cisplatin. Cancer. Biol.
Ther. 2008, 7, 1250-1261.
(16) Batlle, E.; Sancho, E.; Franci, C.; Dominguez, D.; Monfar, M.; Baulida, J.; Garcia De
Herreros, A. The transcription factor snail is a repressor of E-cadherin gene expression in
epithelial tumour cells. Nat. Cell Biol. 2000, 2, 84-89.
(17) Belmont, L. D.; Mitchison, T. J. Identification of a protein that interacts with tubulin dimers
and increases the catastrophe rate of microtubules. Cell 1996, 84, 623-631.
(18) Benais-Pont, G.; Punn, A.; Flores-Maldonado, C.; Eckert, J.; Raposo, G.; Fleming, T. P.;
Cereijido, M.; Balda, M. S.; Matter, K. Identification of a tight junction-associated guanine
nucleotide exchange factor that activates Rho and regulates paracellular permeability. J. Cell
Biol. 2003, 160, 729-740.
(19) Benais-Pont, G.; Punn, A.; Flores-Maldonado, C.; Eckert, J.; Raposo, G.; Fleming, T. P.;
Cereijido, M.; Balda, M. S.; Matter, K. Identification of a tight junction-associated guanine
nucleotide exchange factor that activates Rho and regulates paracellular permeability. J. Cell
Biol. 2003, 160, 729-740.
(20) Bender, A.; Pringle, J. R. Multicopy suppression of the cdc24 budding defect in yeast by
CDC42 and three newly identified genes including the ras-related gene RSR1. Proc. Natl.
Acad. Sci. U. S. A.1989, 86, 9976-9980.
(21) Berenjeno, I. M.; Nunez, F.; Bustelo, X. R. Transcriptomal profiling of the cellular
transformation induced by Rho subfamily GTPases. Oncogene 2007, 26, 4295-4305.
(22) Bernardini, M. Q.; Baba, T.; Lee, P. S.; Barnett, J. C.; Sfakianos, G. P.; Secord, A. A.;
Murphy, S. K.; Iversen, E.; Marks, J. R.; Berchuck, A. Expression signatures of TP53
mutations in serous ovarian cancers. BMC Cancer 2010, 10, 237.
135
(23) Bernards, A.; Settleman, J. GAP control: regulating the regulators of small GTPases. Trends
Cell Biol. 2004, 14, 377-385.
(24) Berrozpe, G.; Schaeffer, J.; Peinado, M. A.; Real, F. X.; Perucho, M. Comparative analysis
of mutations in the p53 and K-ras genes in pancreatic cancer. Int. J. Cancer 1994, 58, 185-
191.
(25) Bhowmick, N. A.; Ghiassi, M.; Bakin, A.; Aakre, M.; Lundquist, C. A.; Engel, M. E.;
Arteaga, C. L.; Moses, H. L. Transforming growth factor-beta1 mediates epithelial to
mesenchymal transdifferentiation through a RhoA-dependent mechanism. Mol. Biol.
Cell 2001, 12, 27-36.
(26) Bi, F.; Debreceni, B.; Zhu, K.; Salani, B.; Eva, A.; Zheng, Y. Autoinhibition mechanism of
proto-Dbl. Mol. Cell. Biol. 2001, 21, 1463-1474.
(27) Birkenfeld, J.; Nalbant, P.; Bohl, B. P.; Pertz, O.; Hahn, K. M.; Bokoch, G. M. GEF-H1
modulates localized RhoA activation during cytokinesis under the control of mitotic
kinases. Dev. Cell. 2007, 12, 699-712.
(28) Birukova, A. A.; Adyshev, D.; Gorshkov, B.; Bokoch, G. M.; Birukov, K. G.; Verin, A. D.
GEF-H1 is involved in agonist-induced human pulmonary endothelial barrier
dysfunction. Am. J. Physiol. Lung Cell. Mol. Physiol. 2006, 290, L540-8.
(29) Birukova, A. A.; Fu, P.; Xing, J.; Yakubov, B.; Cokic, I.; Birukov, K. G.
Mechanotransduction by GEF-H1 as a novel mechanism of ventilator-induced vascular
endothelial permeability. Am. J. Physiol. Lung Cell. Mol. Physiol. 2010, 298, L837-48.
(30) Bos, J. L. Ras Oncogenes in Human Cancer: a Review. Cancer Res. 1989, 49, 4682-4689.
(31) Bos, J. L.; Toksoz, D.; Marshall, C. J.; Verlaan-de Vries, M.; Veeneman, G. H.; van der Eb,
A. J.; van Boom, J. H.; Janssen, J. W.; Steenvoorden, A. C. Amino-acid substitutions at
codon 13 of the N-ras oncogene in human acute myeloid leukaemia. Nature 1985, 315, 726-
730.
(32) Bourne, H. R.; Sanders, D. A.; McCormick, F. The GTPase superfamily: conserved
structure and molecular mechanism. Nature 1991, 349, 117-127.
(33) Braga, V. M. Small GTPases and regulation of cadherin dependent cell-cell adhesion. Mol.
Pathol. 1999, 52, 197-202.
(34) Braga, V. M.; Del Maschio, A.; Machesky, L.; Dejana, E. Regulation of cadherin function
by Rho and Rac: modulation by junction maturation and cellular context. Mol. Biol.
Cell 1999, 10, 9-22.
136
(35) Brecht, M.; Steenvoorden, A. C.; Collard, J. G.; Luf, S.; Erz, D.; Bartram, C. R.; Janssen, J.
W. Activation of gef-h1, a guanine nucleotide exchange factor for RhoA, by DNA
transfection. Int. J. Cancer 2005, 113, 533-540.
(36) Broders-Bondon, F.; Chesneau, A.; Romero-Oliva, F.; Mazabraud, A.; Mayor, R.; Thiery, J.
P. Regulation of XSnail2 expression by Rho GTPases. Dev. Dyn. 2007, 236, 2555-2566.
(37) Brown, R.; Marshall, C. J.; Pennie, S. G.; Hall, A. Mechanism of activation of an N-ras
gene in the human fibrosarcoma cell line HT1080. EMBO J. 1984, 3, 1321-1326.
(38) Byrne, J. L.; Marshall, C. J. The molecular pathophysiology of myeloid leukaemias: Ras
revisited. Br. J. Haematol. 1998, 100, 256-264.
(39) Cacace, A. M.; Michaud, N. R.; Therrien, M.; Mathes, K.; Copeland, T.; Rubin, G. M.;
Morrison, D. K. Identification of constitutive and ras-inducible phosphorylation sites of
KSR: implications for 14-3-3 binding, mitogen-activated protein kinase binding, and KSR
overexpression. Mol. Cell. Biol. 1999, 19, 229-240.
(40) Callow, M. G.; Zozulya, S.; Gishizky, M. L.; Jallal, B.; Smeal, T. PAK4 mediates
morphological changes through the regulation of GEF-H1. J. Cell. Sci. 2005, 118, 1861-
1872.
(41) Campbell, P. M.; Groehler, A. L.; Lee, K. M.; Ouellette, M. M.; Khazak, V.; Der, C. J. K-
Ras promotes growth transformation and invasion of immortalized human pancreatic cells
by Raf and phosphatidylinositol 3-kinase signaling. Cancer Res. 2007, 67, 2098-2106.
(42) Cano, A.; Perez-Moreno, M. A.; Rodrigo, I.; Locascio, A.; Blanco, M. J.; del Barrio, M. G.;
Portillo, F.; Nieto, M. A. The transcription factor snail controls epithelial-mesenchymal
transitions by repressing E-cadherin expression. Nat. Cell Biol. 2000, 2, 76-83.
(43) Caron, E.; Crepin, V. F.; Simpson, N.; Knutton, S.; Garmendia, J.; Frankel, G. Subversion
of actin dynamics by EPEC and EHEC. Curr. Opin. Microbiol. 2006, 9, 40-45.
(44) Cereijido, M.; Shoshani, L.; Contreras, R. G. Molecular physiology and pathophysiology of
tight junctions. I. Biogenesis of tight junctions and epithelial polarity. Am. J. Physiol.
Gastrointest. Liver Physiol. 2000, 279, G477-82.
(45) Chan, A. M.; McGovern, E. S.; Catalano, G.; Fleming, T. P.; Miki, T. Expression cDNA
cloning of a novel oncogene with sequence similarity to regulators of small GTP-binding
proteins. Oncogene1994, 9, 1057-1063.
(46) Chan, A. M.; Takai, S.; Yamada, K.; Miki, T. Isolation of a novel oncogene, NET1, from
neuroepithelioma cells by expression cDNA cloning. Oncogene 1996, 12, 1259-1266.
137
(47) Chang, E. H.; Gonda, M. A.; Ellis, R. W.; Scolnick, E. M.; Lowy, D. R. Human genome
contains four genes homologous to transforming genes of Harvey and Kirsten murine
sarcoma viruses. Proc. Natl. Acad. Sci. U. S. A. 1982, 79, 4848-4852.
(48) Chang, Y. C.; Nalbant, P.; Birkenfeld, J.; Chang, Z. F.; Bokoch, G. M. GEF-H1 couples
nocodazole-induced microtubule disassembly to cell contractility via RhoA. Mol. Biol.
Cell 2008, 19, 2147-2153.
(49) Chapin, S. J.; Lue, C. M.; Yu, M. T.; Bulinski, J. C. Differential expression of alternatively
spliced forms of MAP4: a repertoire of structurally different microtubule-binding
domains. Biochemistry1995, 34, 2289-2301.
(50) Chen, B.; Ding, Y.; Liu, F.; Ruan, J.; Guan, J.; Huang, J.; Ye, X.; Wang, S.; Zhang, G.;
Zhang, X.; Liang, Z.; Luo, R.; Chen, L. Tiam1, overexpressed in most malignancies, is a
novel tumor biomarker. Mol. Med. Report 2012, 5, 48-53.
(51) Chen, J. C.; Zhuang, S.; Nguyen, T. H.; Boss, G. R.; Pilz, R. B. Oncogenic Ras leads to Rho
activation by activating the mitogen-activated protein kinase pathway and decreasing Rho-
GTPase-activating protein activity. J. Biol. Chem. 2003, 278, 2807-2818.
(52) Chen, J. S.; Su, I. J.; Leu, Y. W.; Young, K. C.; Sun, H. S. Expression of T-cell lymphoma
invasion and metastasis 2 (TIAM2) promotes proliferation and invasion of liver cancer. Int.
J. Cancer 2012, 130, 1302-1313.
(53) Cheng, I. K.; Tsang, B. C.; Lai, K. P.; Ching, A. K.; Chan, A. W.; To, K. F.; Lai, P. B.;
Wong, N. GEF-H1 over-expression in hepatocellular carcinoma promotes cell motility via
activation of RhoA signalling. J. Pathol. 2012.
(54) Cherfils, J.; Chardin, P. GEFs: structural basis for their activation of small GTP-binding
proteins. Trends Biochem. Sci. 1999, 24, 306-311.
(55) Chiang, A. C.; Massague, J. Molecular basis of metastasis. N. Engl. J. Med. 2008, 359,
2814-2823.
(56) Choy, E.; Chiu, V. K.; Silletti, J.; Feoktistov, M.; Morimoto, T.; Michaelson, D.; Ivanov, I.
E.; Philips, M. R. Endomembrane trafficking of ras: the CAAX motif targets proteins to the
ER and Golgi. Cell1999, 98, 69-80.
(57) Citterio, C.; Menacho-Marquez, M.; Garcia-Escudero, R.; Larive, R. M.; Barreiro, O.;
Sanchez-Madrid, F.; Paramio, J. M.; Bustelo, X. R. The rho exchange factors vav2 and vav3
control a lung metastasis-specific transcriptional program in breast cancer cells. Sci.
Signal. 2012, 5, ra71.
(58) Clark, R.; Wong, G.; Arnheim, N.; Nitecki, D.; McCormick, F. Antibodies specific for
amino acid 12 of the ras oncogene product inhibit GTP binding. Proc. Natl. Acad. Sci. U. S.
A. 1985, 82, 5280-5284.
138
(59) Clarke, P. R.; Zhang, C. Spatial and temporal coordination of mitosis by Ran GTPase. Nat.
Rev. Mol. Cell Biol. 2008, 9, 464-477.
(60) Collins, M. A.; Bednar, F.; Zhang, Y.; Brisset, J. C.; Galban, S.; Galban, C. J.; Rakshit, S.;
Flannagan, K. S.; Adsay, N. V.; Pasca di Magliano, M. Oncogenic Kras is required for both
the initiation and maintenance of pancreatic cancer in mice. J. Clin. Invest. 2012, 122, 639-
653.
(61) Coso, O. A.; Chiariello, M.; Yu, J. C.; Teramoto, H.; Crespo, P.; Xu, N.; Miki, T.; Gutkind,
J. S. The small GTP-binding proteins Rac1 and Cdc42 regulate the activity of the
JNK/SAPK signaling pathway. Cell 1995, 81, 1137-1146.
(62) Cox, D.; Chang, P.; Zhang, Q.; Reddy, P. G.; Bokoch, G. M.; Greenberg, S. Requirements
for both Rac1 and Cdc42 in membrane ruffling and phagocytosis in leukocytes. J. Exp.
Med. 1997, 186, 1487-1494.
(63) Cruz-Monserrate, Z.; O'Connor, K. L. Integrin alpha 6 beta 4 promotes migration, invasion
through Tiam1 upregulation, and subsequent Rac activation. Neoplasia 2008, 10, 408-417.
(64) Dan, H. C.; Cooper, M. J.; Cogswell, P. C.; Duncan, J. A.; Ting, J. P.; Baldwin, A. S. Akt-
dependent regulation of NF-{kappa}B is controlled by mTOR and Raptor in association
with IKK. Genes Dev.2008, 22, 1490-1500.
(65) DeFeo, D.; Gonda, M. A.; Young, H. A.; Chang, E. H.; Lowy, D. R.; Scolnick, E. M.; Ellis,
R. W. Analysis of two divergent rat genomic clones homologous to the transforming gene of
Harvey murine sarcoma virus. Proc. Natl. Acad. Sci. U. S. A. 1981, 78, 3328-3332.
(66) DeGregori, J.; Kowalik, T.; Nevins, J. R. Cellular targets for activation by the E2F1
transcription factor include DNA synthesis- and G1/S-regulatory genes. Mol. Cell.
Biol. 1995, 15, 4215-4224.
(67) Dennis, G.,Jr; Sherman, B. T.; Hosack, D. A.; Yang, J.; Gao, W.; Lane, H. C.; Lempicki, R.
A. DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome
Biol. 2003, 4, P3.
(68) Der, C. J.; Krontiris, T. G.; Cooper, G. M. Transforming genes of human bladder and lung
carcinoma cell lines are homologous to the ras genes of Harvey and Kirsten sarcoma
viruses. Proc. Natl. Acad. Sci. U. S. A. 1982, 79, 3637-3640.
(69) DiGiuseppe, J. A.; Hruban, R. H.; Goodman, S. N.; Polak, M.; van den Berg, F. M.; Allison,
D. C.; Cameron, J. L.; Offerhaus, G. J. Overexpression of p53 protein in adenocarcinoma of
the pancreas.Am. J. Clin. Pathol. 1994, 101, 684-688.
(70) Ellenrieder, V.; Hendler, S. F.; Boeck, W.; Seufferlein, T.; Menke, A.; Ruhland, C.; Adler,
G.; Gress, T. M. Transforming growth factor beta1 treatment leads to an epithelial-
139
mesenchymal transdifferentiation of pancreatic cancer cells requiring extracellular signal-
regulated kinase 2 activation. Cancer Res. 2001, 61, 4222-4228.
(71) Ellis, R. W.; DeFeo, D.; Furth, M. E.; Scolnick, E. M. Mouse cells contain two distinct ras
gene mRNA species that can be translated into a p21 onc protein. Mol. Cell. Biol. 1982, 2,
1339-1345.
(72) Emanuel, P. D. RAS pathway mutations in juvenile myelomonocytic leukemia. Acta
Haematol. 2008, 119, 207-211.
(73) Engelman, J. A.; Chen, L.; Tan, X.; Crosby, K.; Guimaraes, A. R.; Upadhyay, R.; Maira,
M.; McNamara, K.; Perera, S. A.; Song, Y.; Chirieac, L. R.; Kaur, R.; Lightbown, A.;
Simendinger, J.; Li, T.; Padera, R. F.; Garcia-Echeverria, C.; Weissleder, R.; Mahmood, U.;
Cantley, L. C.; Wong, K. K. Effective use of PI3K and MEK inhibitors to treat mutant Kras
G12D and PIK3CA H1047R murine lung cancers. Nat. Med. 2008, 14, 1351-1356.
(74) Engers, R.; Mueller, M.; Walter, A.; Collard, J. G.; Willers, R.; Gabbert, H. E. Prognostic
relevance of Tiam1 protein expression in prostate carcinomas. Br. J. Cancer 2006, 95, 1081-
1086.
(75) Estep, A. L.; Palmer, C.; McCormick, F.; Rauen, K. A. Mutation analysis of BRAF, MEK1
and MEK2 in 15 ovarian cancer cell lines: implications for therapy. PLoS One 2007, 2,
e1279.
(76) Eva, A.; Aaronson, S. A. Isolation of a new human oncogene from a diffuse B-cell
lymphoma. Nature 1985, 316, 273-275.
(77) Evelyn, C. R.; Ferng, T.; Rojas, R. J.; Larsen, M. J.; Sondek, J.; Neubig, R. R. High-
throughput screening for small-molecule inhibitors of LARG-stimulated RhoA nucleotide
binding via a novel fluorescence polarization assay. J. Biomol. Screen. 2009, 14, 161-172.
(78) Fearon, E. R.; Vogelstein, B. A genetic model for colorectal tumorigenesis. Cell 1990, 61,
759-767.
(79) Fernandez-Zapico, M. E.; Gonzalez-Paz, N. C.; Weiss, E.; Savoy, D. N.; Molina, J. R.;
Fonseca, R.; Smyrk, T. C.; Chari, S. T.; Urrutia, R.; Billadeau, D. D. Ectopic expression of
VAV1 reveals an unexpected role in pancreatic cancer tumorigenesis. Cancer. Cell. 2005, 7,
39-49.
(80) Fine, B.; Hodakoski, C.; Koujak, S.; Su, T.; Saal, L. H.; Maurer, M.; Hopkins, B.; Keniry,
M.; Sulis, M. L.; Mense, S.; Hibshoosh, H.; Parsons, R. Activation of the PI3K pathway in
cancer through inhibition of PTEN by exchange factor P-REX2a. Science 2009, 325, 1261-
1265.
140
(81) Frey, R. S.; Mulder, K. M. Involvement of extracellular signal-regulated kinase 2 and stress-
activated protein kinase/Jun N-terminal kinase activation by transforming growth factor beta
in the negative growth control of breast cancer cells. Cancer Res. 1997, 57, 628-633.
(82) Friess, H.; Yamanaka, Y.; Buchler, M.; Ebert, M.; Beger, H. G.; Gold, L. I.; Korc, M.
Enhanced expression of transforming growth factor beta isoforms in pancreatic cancer
correlates with decreased survival. Gastroenterology 1993, 105, 1846-1856.
(83) Fritz, G.; Just, I.; Kaina, B. Rho GTPases are over-expressed in human tumors. Int. J.
Cancer 1999, 81, 682-687.
(84) Fujishiro, S. H.; Tanimura, S.; Mure, S.; Kashimoto, Y.; Watanabe, K.; Kohno, M. ERK1/2
phosphorylate GEF-H1 to enhance its guanine nucleotide exchange activity toward
RhoA. Biochem. Biophys. Res. Commun. 2008, 368, 162-167.
(85) Fujita, J.; Yoshida, O.; Yuasa, Y.; Rhim, J. S.; Hatanaka, M.; Aaronson, S. A. Ha-ras
oncogenes are activated by somatic alterations in human urinary tract tumours. Nature 1984,
309, 464-466.
(86) Fukazawa, A.; Alonso, C.; Kurachi, K.; Gupta, S.; Lesser, C. F.; McCormick, B. A.;
Reinecker, H. C. GEF-H1 mediated control of NOD1 dependent NF-kappaB activation by
Shigella effectors. PLoS Pathog. 2008, 4, e1000228.
(87) Fukui, K.; Tamura, S.; Wada, A.; Kamada, Y.; Sawai, Y.; Imanaka, K.; Kudara, T.;
Shimomura, I.; Hayashi, N. Expression and prognostic role of RhoA GTPases in
hepatocellular carcinoma. J. Cancer Res. Clin. Oncol. 2006, 132, 627-633.
(88) Galanis, A.; Yang, S. H.; Sharrocks, A. D. Selective targeting of MAPKs to the ETS domain
transcription factor SAP-1. J. Biol. Chem. 2001, 276, 965-973.
(89) Gale, N. W.; Kaplan, S.; Lowenstein, E. J.; Schlessinger, J.; Bar-Sagi, D. Grb2 mediates the
EGF-dependent activation of guanine nucleotide exchange on Ras. Nature 1993, 363, 88-92.
(90) Galmiche, A.; Ezzoukhry, Z. Regulation of cell survival by RAF kinases. Med. Sci.
(Paris) 2010, 26, 729-733.
(91) Gambke, C.; Hall, A.; Moroni, C. Activation of an N-ras gene in acute myeloblastic
leukemia through somatic mutation in the first exon. Proc. Natl. Acad. Sci. U. S. A. 1985,
82, 879-882.
(92) Gelfi, C.; Righetti, S. C.; Zunino, F.; Della Torre, G.; Pierotti, M. A.; Righetti, P. G.
Detection of p53 point mutations by double-gradient, denaturing gradient gel
electrophoresis. Electrophoresis1997, 18, 2921-2927.
141
(93) Gonzalez-Garcia, A.; Pritchard, C. A.; Paterson, H. F.; Mavria, G.; Stamp, G.; Marshall, C.
J. RalGDS is required for tumor formation in a model of skin carcinogenesis. Cancer.
Cell. 2005, 7, 219-226.
(94) Gotoh, Y.; Nishida, E.; Matsuda, S.; Shiina, N.; Kosako, H.; Shiokawa, K.; Akiyama, T.;
Ohta, K.; Sakai, H. In vitro effects on microtubule dynamics of purified Xenopus M phase-
activated MAP kinase. Nature 1991, 349, 251-254.
(95) Gottesman, M. M. Mechanisms of cancer drug resistance. Annu. Rev. Med. 2002, 53, 615-
627.
(96) Gou, L.; Wang, W.; Tong, A.; Yao, Y.; Zhou, Y.; Yi, C.; Yang, J. Proteomic identification
of RhoA as a potential biomarker for proliferation and metastasis in hepatocellular
carcinoma. J. Mol. Med. (Berl) 2011, 89, 817-827.
(97) Grippo, P. J.; Nowlin, P. S.; Demeure, M. J.; Longnecker, D. S.; Sandgren, E. P.
Preinvasive pancreatic neoplasia of ductal phenotype induced by acinar cell targeting of
mutant Kras in transgenic mice. Cancer Res. 2003, 63, 2016-2019.
(98) Guarino, M.; Rubino, B.; Ballabio, G. The role of epithelial-mesenchymal transition in
cancer pathology. Pathology 2007, 39, 305-318.
(99) Guerrero, I.; Villasante, A.; Corces, V.; Pellicer, A. Activation of a c-K-ras oncogene by
somatic mutation in mouse lymphomas induced by gamma radiation. Science 1984, 225,
1159-1162.
(100) Guerrero, I.; Villasante, A.; D'Eustachio, P.; Pellicer, A. Isolation, characterization, and
chromosome assignment of mouse N-ras gene from carcinogen-induced thymic
lymphoma. Science 1984, 225, 1041-1043.
(101) Guillemot, L.; Paschoud, S.; Jond, L.; Foglia, A.; Citi, S. Paracingulin regulates the
activity of Rac1 and RhoA GTPases by recruiting Tiam1 and GEF-H1 to epithelial
junctions. Mol. Biol. Cell 2008, 19, 4442-4453.
(102) Guilluy, C.; Swaminathan, V.; Garcia-Mata, R.; O'Brien, E. T.; Superfine, R.; Burridge, K.
The Rho GEFs LARG and GEF-H1 regulate the mechanical response to force on
integrins. Nat. Cell Biol.2011, 13, 722-727.
(103) Guo, D. L.; Zhang, J.; Yuen, S. T.; Tsui, W. Y.; Chan, A. S.; Ho, C.; Ji, J.; Leung, S. Y.;
Chen, X. Reduced expression of EphB2 that parallels invasion and metastasis in colorectal
tumours.Carcinogenesis 2006, 27, 454-464.
(104) Gupta, S.; Ramjaun, A. R.; Haiko, P.; Wang, Y.; Warne, P. H.; Nicke, B.; Nye, E.; Stamp,
G.; Alitalo, K.; Downward, J. Binding of ras to phosphoinositide 3-kinase p110alpha is
required for ras-driven tumorigenesis in mice. Cell 2007, 129, 957-968.
142
(105) Habets, G. G.; Scholtes, E. H.; Zuydgeest, D.; van der Kammen, R. A.; Stam, J. C.; Berns,
A.; Collard, J. G. Identification of an invasion-inducing gene, Tiam-1, that encodes a protein
with homology to GDP-GTP exchangers for Rho-like proteins. Cell 1994, 77, 537-549.
(106) Haigis, K. M.; Kendall, K. R.; Wang, Y.; Cheung, A.; Haigis, M. C.; Glickman, J. N.;
Niwa-Kawakita, M.; Sweet-Cordero, A.; Sebolt-Leopold, J.; Shannon, K. M.; Settleman, J.;
Giovannini, M.; Jacks, T. Differential effects of oncogenic K-Ras and N-Ras on
proliferation, differentiation and tumor progression in the colon. Nat. Genet. 2008, 40, 600-
608.
(107) Hall, A.; Marshall, C. J.; Spurr, N. K.; Weiss, R. A. Identification of transforming gene in
two human sarcoma cell lines as a new member of the ras gene family located on
chromosome 1. Nature1983, 303, 396-400.
(108) Han, L.; Colicelli, J. A human protein selected for interference with Ras function interacts
directly with Ras and competes with Raf1. Mol. Cell. Biol. 1995, 15, 1318-1323.
(109) Hancock, J. F.; Paterson, H.; Marshall, C. J. A polybasic domain or palmitoylation is
required in addition to the CAAX motif to localize p21ras to the plasma
membrane. Cell 1990, 63, 133-139.
(110) Hand, P. H.; Thor, A.; Wunderlich, D.; Muraro, R.; Caruso, A.; Schlom, J. Monoclonal
antibodies of predefined specificity detect activated ras gene expression in human mammary
and colon carcinomas. Proc. Natl. Acad. Sci. U. S. A. 1984, 81, 5227-5231.
(111) Hart, M. J.; Eva, A.; Evans, T.; Aaronson, S. A.; Cerione, R. A. Catalysis of guanine
nucleotide exchange on the CDC42Hs protein by the dbl oncogene product. Nature 1991,
354, 311-314.
(112) Hart, M. J.; Eva, A.; Zangrilli, D.; Aaronson, S. A.; Evans, T.; Cerione, R. A.; Zheng, Y.
Cellular transformation and guanine nucleotide exchange activity are catalyzed by a
common domain on the dbl oncogene product. J. Biol. Chem. 1994, 269, 62-65.
(113) Hartsough, M. T.; Mulder, K. M. Transforming growth factor beta activation of p44mapk
in proliferating cultures of epithelial cells. J. Biol. Chem. 1995, 270, 7117-7124.
(114) Havrilesky, L.; Darcy, M.; Hamdan, H.; Priore, R. L.; Leon, J.; Bell, J.; Berchuck, A.;
Gynecologic Oncology Group Study Prognostic significance of p53 mutation and p53
overexpression in advanced epithelial ovarian cancer: a Gynecologic Oncology Group
Study. J. Clin. Oncol. 2003, 21, 3814-3825.
(115) Heasman, S. J.; Carlin, L. M.; Cox, S.; Ng, T.; Ridley, A. J. Coordinated RhoA signaling at
the leading edge and uropod is required for T cell transendothelial migration. J. Cell
Biol. 2010, 190, 553-563.
143
(116) Heasman, S. J.; Ridley, A. J. Mammalian Rho GTPases: new insights into their functions
from in vivo studies. Nat. Rev. Mol. Cell Biol. 2008, 9, 690-701.
(117) Heisterkamp, N.; Stam, K.; Groffen, J.; de Klein, A.; Grosveld, G. Structural organization
of the bcr gene and its role in the Ph' translocation. Nature 1985, 315, 758-761.
(118) Hernandez, A.; Lopez-Lluch, G.; Bernal, J. A.; Navas, P.; Pintor-Toro, J. A. Dicoumarol
down-regulates human PTTG1/Securin mRNA expression through inhibition of
Hsp90. Mol. Cancer. Ther.2008, 7, 474-482.
(119) Hezel, A. F.; Kimmelman, A. C.; Stanger, B. Z.; Bardeesy, N.; Depinho, R. A. Genetics
and biology of pancreatic ductal adenocarcinoma. Genes Dev. 2006, 20, 1218-1249.
(120) Hill, C. S.; Wynne, J.; Treisman, R. The Rho family GTPases RhoA, Rac1, and CDC42Hs
regulate transcriptional activation by SRF. Cell 1995, 81, 1159-1170.
(121) Hingorani, S. R.; Petricoin, E. F.; Maitra, A.; Rajapakse, V.; King, C.; Jacobetz, M. A.;
Ross, S.; Conrads, T. P.; Veenstra, T. D.; Hitt, B. A.; Kawaguchi, Y.; Johann, D.; Liotta, L.
A.; Crawford, H. C.; Putt, M. E.; Jacks, T.; Wright, C. V.; Hruban, R. H.; Lowy, A. M.;
Tuveson, D. A. Preinvasive and invasive ductal pancreatic cancer and its early detection in
the mouse. Cancer. Cell. 2003, 4, 437-450.
(122) Hirai, A.; Nakamura, S.; Noguchi, Y.; Yasuda, T.; Kitagawa, M.; Tatsuno, I.; Oeda, T.;
Tahara, K.; Terano, T.; Narumiya, S.; Kohn, L. D.; Saito, Y. Geranylgeranylated rho small
GTPase(s) are essential for the degradation of p27Kip1 and facilitate the progression from
G1 to S phase in growth-stimulated rat FRTL-5 cells. J. Biol. Chem. 1997, 272, 13-16.
(123) Hirai, H.; Okabe, T.; Anraku, Y.; Fujisawa, M.; Urabe, A.; Takaku, F. Activation of the c-
K-ras oncogene in a human pancreas carcinoma. Biochem. Biophys. Res. Commun. 1985,
127, 168-174.
(124) Hoeflich, K. P.; O'Brien, C.; Boyd, Z.; Cavet, G.; Guerrero, S.; Jung, K.; Januario, T.;
Savage, H.; Punnoose, E.; Truong, T.; Zhou, W.; Berry, L.; Murray, L.; Amler, L.; Belvin,
M.; Friedman, L. S.; Lackner, M. R. In vivo antitumor activity of MEK and
phosphatidylinositol 3-kinase inhibitors in basal-like breast cancer models. Clin. Cancer
Res. 2009, 15, 4649-4664.
(125) Hofer, F.; Fields, S.; Schneider, C.; Martin, G. S. Activated Ras interacts with the Ral
guanine nucleotide dissociation stimulator. Proc. Natl. Acad. Sci. U. S. A. 1994, 91, 11089-
11093.
(126) Hollestelle, A.; Elstrodt, F.; Nagel, J. H.; Kallemeijn, W. W.; Schutte, M.
Phosphatidylinositol-3-OH kinase or RAS pathway mutations in human breast cancer cell
lines. Mol. Cancer. Res. 2007, 5, 195-201.
144
(127) Hollstein, M.; Sidransky, D.; Vogelstein, B.; Harris, C. C. P53 Mutations in Human
Cancers. Science 1991, 253, 49-53.
(128) Horiuchi, A.; Imai, T.; Wang, C.; Ohira, S.; Feng, Y.; Nikaido, T.; Konishi, I. Up-
regulation of small GTPases, RhoA and RhoC, is associated with tumor progression in
ovarian carcinoma. Lab. Invest. 2003, 83, 861-870.
(129) Hoshida, Y.; Nijman, S. M.; Kobayashi, M.; Chan, J. A.; Brunet, J. P.; Chiang, D. Y.;
Villanueva, A.; Newell, P.; Ikeda, K.; Hashimoto, M.; Watanabe, G.; Gabriel, S.; Friedman,
S. L.; Kumada, H.; Llovet, J. M.; Golub, T. R. Integrative transcriptome analysis reveals
common molecular subclasses of human hepatocellular carcinoma. Cancer Res. 2009, 69,
7385-7392.
(130) Hotchin, N. A.; Hall, A. The assembly of integrin adhesion complexes requires both
extracellular matrix and intracellular rho/rac GTPases. J. Cell Biol. 1995, 131, 1857-1865.
(131) Hruban, R. H.; Adsay, N. V.; Albores-Saavedra, J.; Compton, C.; Garrett, E. S.; Goodman,
S. N.; Kern, S. E.; Klimstra, D. S.; Kloppel, G.; Longnecker, D. S.; Luttges, J.; Offerhaus,
G. J. Pancreatic intraepithelial neoplasia: a new nomenclature and classification system for
pancreatic duct lesions. Am. J. Surg. Pathol. 2001, 25, 579-586.
(132) Huber, M. A.; Azoitei, N.; Baumann, B.; Grunert, S.; Sommer, A.; Pehamberger, H.;
Kraut, N.; Beug, H.; Wirth, T. NF-kappaB is essential for epithelial-mesenchymal transition
and metastasis in a model of breast cancer progression. J. Clin. Invest. 2004, 114, 569-581.
(133) Husemann, Y.; Geigl, J. B.; Schubert, F.; Musiani, P.; Meyer, M.; Burghart, E.; Forni, G.;
Eils, R.; Fehm, T.; Riethmuller, G.; Klein, C. A. Systemic spread is an early step in breast
cancer. Cancer. Cell. 2008, 13, 58-68.
(134) Iancu, C.; Mistry, S. J.; Arkin, S.; Atweh, G. F. Taxol and anti-stathmin therapy: a
synergistic combination that targets the mitotic spindle. Cancer Res. 2000, 60, 3537-3541.
(135) Iancu, C.; Mistry, S. J.; Arkin, S.; Wallenstein, S.; Atweh, G. F. Effects of stathmin
inhibition on the mitotic spindle. J. Cell. Sci. 2001, 114, 909-916.
(136) Ip, Y. C.; Cheung, S. T.; Lee, Y. T.; Ho, J. C.; Fan, S. T. Inhibition of hepatocellular
carcinoma invasion by suppression of claudin-10 in HLE cells. Mol. Cancer. Ther. 2007, 6,
2858-2867.
(137) Jackson, E. L.; Willis, N.; Mercer, K.; Bronson, R. T.; Crowley, D.; Montoya, R.; Jacks,
T.; Tuveson, D. A. Analysis of lung tumor initiation and progression using conditional
expression of oncogenic K-ras. Genes Dev. 2001, 15, 3243-3248.
(138) Jaffee, E. M.; Schutte, M.; Gossett, J.; Morsberger, L. A.; Adler, A. J.; Thomas, M.;
Greten, T. F.; Hruban, R. H.; Yeo, C. J.; Griffin, C. A. Development and characterization of
145
a cytokine-secreting pancreatic adenocarcinoma vaccine from primary tumors for use in
clinical trials. Cancer J. Sci. Am. 1998, 4, 194-203.
(139) Janda, E.; Lehmann, K.; Killisch, I.; Jechlinger, M.; Herzig, M.; Downward, J.; Beug, H.;
Grunert, S. Ras and TGF[beta] cooperatively regulate epithelial cell plasticity and
metastasis: dissection of Ras signaling pathways. J. Cell Biol. 2002, 156, 299-313.
(140) Janssens, V.; Goris, J. Protein phosphatase 2A: a highly regulated family of
serine/threonine phosphatases implicated in cell growth and signalling. Biochem. J. 2001,
353, 417-439.
(141) Jemal, A.; Murray, T.; Ward, E.; Samuels, A.; Tiwari, R. C.; Ghafoor, A.; Feuer, E. J.;
Thun, M. J. Cancer statistics, 2005. CA Cancer. J. Clin. 2005, 55, 10-30.
(142) Jiang, X.; Lu, X.; McNamara, G.; Liu, X.; Cubedo, E.; Sarosiek, K. A.; Sanchez-Garcia, I.;
Helfman, D. M.; Lossos, I. S. HGAL, a germinal center specific protein, decreases
lymphoma cell motility by modulation of the RhoA signaling pathway. Blood 2010, 116,
5217-5227.
(143) Jo, M.; Thomas, K. S.; Somlyo, A. V.; Somlyo, A. P.; Gonias, S. L. Cooperativity between
the Ras-ERK and Rho-Rho kinase pathways in urokinase-type plasminogen activator-
stimulated cell migration. J. Biol. Chem. 2002, 277, 12479-12485.
(144) Johnson, B. E.; Kelley, M. J. Overview of genetic and molecular events in the
pathogenesis of lung cancer. Chest 1993, 103, 1S-3S.
(145) Johnson, B. E.; Kelley, M. J. Overview of genetic and molecular events in the
pathogenesis of lung cancer. Chest 1993, 103, 1S-3S.
(146) Johnson, L.; Mercer, K.; Greenbaum, D.; Bronson, R. T.; Crowley, D.; Tuveson, D. A.;
Jacks, T. Somatic activation of the K-ras oncogene causes early onset lung cancer in
mice. Nature 2001, 410, 1111-1116.
(147) Joneson, T.; Fulton, J. A.; Volle, D. J.; Chaika, O. V.; Bar-Sagi, D.; Lewis, R. E. Kinase
suppressor of Ras inhibits the activation of extracellular ligand-regulated (ERK) mitogen-
activated protein (MAP) kinase by growth factors, activated Ras, and Ras effectors. J. Biol.
Chem. 1998, 273, 7743-7748.
(148) Kaibuchi, K.; Kuroda, S.; Amano, M. Regulation of the cytoskeleton and cell adhesion by
the Rho family GTPases in mammalian cells. Annu. Rev. Biochem. 1999, 68, 459-486.
(149) Kakiashvili, E.; Dan, Q.; Vandermeer, M.; Zhang, Y.; Waheed, F.; Pham, M.; Szaszi, K.
The epidermal growth factor receptor mediates tumor necrosis factor-alpha-induced
activation of the ERK/GEF-H1/RhoA pathway in tubular epithelium. J. Biol. Chem. 2011,
286, 9268-9279.
146
(150) Kakiashvili, E.; Speight, P.; Waheed, F.; Seth, R.; Lodyga, M.; Tanimura, S.; Kohno, M.;
Rotstein, O. D.; Kapus, A.; Szaszi, K. GEF-H1 mediates tumor necrosis factor-alpha-
induced Rho activation and myosin phosphorylation: role in the regulation of tubular
paracellular permeability. J. Biol. Chem. 2009, 284, 11454-11466.
(151) Kamata, T.; Feramisco, J. R. Epidermal growth factor stimulates guanine nucleotide
binding activity and phosphorylation of ras oncogene proteins. Nature 1984, 310, 147-150.
(152) Kamynina, E.; Kauppinen, K.; Duan, F.; Muakkassa, N.; Manor, D. Regulation of proto-
oncogenic dbl by chaperone-controlled, ubiquitin-mediated degradation. Mol. Cell.
Biol. 2007, 27, 1809-1822.
(153) Kao, G.; Tuck, S.; Baillie, D.; Sundaram, M. V. C. elegans SUR-6/PR55 cooperates with
LET-92/protein phosphatase 2A and promotes Raf activity independently of inhibitory Akt
phosphorylation sites. Development 2004, 131, 755-765.
(154) Karnoub, A. E.; Weinberg, R. A. Ras oncogenes: split personalities. Nat. Rev. Mol. Cell
Biol. 2008, 9, 517-531.
(155) Katayama, K.; Yoshioka, S.; Tsukahara, S.; Mitsuhashi, J.; Sugimoto, Y. Inhibition of the
mitogen-activated protein kinase pathway results in the down-regulation of P-
glycoprotein. Mol. Cancer. Ther. 2007, 6, 2092-2102.
(156) Kauppinen, K. P.; Duan, F.; Wels, J. I.; Manor, D. Regulation of the Dbl proto-oncogene
by heat shock cognate protein 70 (Hsc70). J. Biol. Chem. 2005, 280, 21638-21644.
(157) Keely, P. J.; Westwick, J. K.; Whitehead, I. P.; Der, C. J.; Parise, L. V. Cdc42 and Rac1
induce integrin-mediated cell motility and invasiveness through PI(3)K. Nature 1997, 390,
632-636.
(158) Kelley, G. G.; Reks, S. E.; Ondrako, J. M.; Smrcka, A. V. Phospholipase C(epsilon): a
novel Ras effector. EMBO J. 2001, 20, 743-754.
(159) Kerkhoff, E.; Rapp, U. R. Cell cycle targets of Ras/Raf signalling. Oncogene 1998, 17,
1457-1462.
(160) Khosravi-Far, R.; Solski, P. A.; Clark, G. J.; Kinch, M. S.; Der, C. J. Activation of Rac1,
RhoA, and mitogen-activated protein kinases is required for Ras transformation. Mol. Cell.
Biol. 1995, 15, 6443-6453.
(161) Kikuchi, A.; Demo, S. D.; Ye, Z. H.; Chen, Y. W.; Williams, L. T. ralGDS family
members interact with the effector loop of ras p21. Mol. Cell. Biol. 1994, 14, 7483-7491.
(162) Kim, J.; Hong, S. J.; Park, J. Y.; Park, J. H.; Yu, Y. S.; Park, S. Y.; Lim, E. K.; Choi, K.
Y.; Lee, E. K.; Paik, S. S.; Lee, K. G.; Wang, H. J.; Do, I. G.; Joh, J. W.; Kim, D. S.; Korea
147
Cancer Biomarker Consortium Epithelial-mesenchymal transition gene signature to predict
clinical outcome of hepatocellular carcinoma. Cancer. Sci. 2010, 101, 1521-1528.
(163) Klimstra, D. S.; Longnecker, D. S. K-ras mutations in pancreatic ductal proliferative
lesions. Am. J. Pathol. 1994, 145, 1547-1550.
(164) Kodaki, T.; Woscholski, R.; Hallberg, B.; Rodriguez-Viciana, P.; Downward, J.; Parker, P.
J. The activation of phosphatidylinositol 3-kinase by Ras. Curr. Biol. 1994, 4, 798-806.
(165) Koh, J. L.; Brown, K. R.; Sayad, A.; Kasimer, D.; Ketela, T.; Moffat, J. COLT-Cancer:
functional genetic screening resource for essential genes in human cancer cell lines. Nucleic
Acids Res. 2012, 40, D957-63.
(166) Kornfeld, K.; Hom, D. B.; Horvitz, H. R. The ksr-1 gene encodes a novel protein kinase
involved in Ras-mediated signaling in C. elegans. Cell 1995, 83, 903-913.
(167) Kourlas, P. J.; Strout, M. P.; Becknell, B.; Veronese, M. L.; Croce, C. M.; Theil, K. S.;
Krahe, R.; Ruutu, T.; Knuutila, S.; Bloomfield, C. D.; Caligiuri, M. A. Identification of a
gene at 11q23 encoding a guanine nucleotide exchange factor: evidence for its fusion with
MLL in acute myeloid leukemia. Proc. Natl. Acad. Sci. U. S. A. 2000, 97, 2145-2150.
(168) Kozma, R.; Ahmed, S.; Best, A.; Lim, L. The Ras-related protein Cdc42Hs and bradykinin
promote formation of peripheral actin microspikes and filopodia in Swiss 3T3
fibroblasts. Mol. Cell. Biol.1995, 15, 1942-1952.
(169) Krendel, M.; Zenke, F. T.; Bokoch, G. M. Nucleotide exchange factor GEF-H1 mediates
cross-talk between microtubules and the actin cytoskeleton. Nat. Cell Biol. 2002, 4, 294-
301.
(170) Kubota, K.; Furuse, M.; Sasaki, H.; Sonoda, N.; Fujita, K.; Nagafuchi, A.; Tsukita, S.
Ca(2+)-independent cell-adhesion activity of claudins, a family of integral membrane
proteins localized at tight junctions. Curr. Biol. 1999, 9, 1035-1038.
(171) Kuriyama, M.; Harada, N.; Kuroda, S.; Yamamoto, T.; Nakafuku, M.; Iwamatsu, A.;
Yamamoto, D.; Prasad, R.; Croce, C.; Canaani, E.; Kaibuchi, K. Identification of AF-6 and
canoe as putative targets for Ras. J. Biol. Chem. 1996, 271, 607-610.
(172) Kusama, T.; Mukai, M.; Iwasaki, T.; Tatsuta, M.; Matsumoto, Y.; Akedo, H.; Nakamura,
H. Inhibition of epidermal growth factor-induced RhoA translocation and invasion of human
pancreatic cancer cells by 3-hydroxy-3-methylglutaryl-coenzyme a reductase
inhibitors. Cancer Res. 2001, 61, 4885-4891.
(173) Lambert, J. M.; Lambert, Q. T.; Reuther, G. W.; Malliri, A.; Siderovski, D. P.; Sondek, J.;
Collard, J. G.; Der, C. J. Tiam1 mediates Ras activation of Rac by a PI(3)K-independent
mechanism. Nat. Cell Biol. 2002, 4, 621-625.
148
(174) Land, H.; Parada, L. F.; Weinberg, R. A. Tumorigenic conversion of primary embryo
fibroblasts requires at least two cooperating oncogenes. Nature 1983, 304, 596-602.
(175) Larsson, N.; Segerman, B.; Howell, B.; Fridell, K.; Cassimeris, L.; Gullberg, M.
Op18/stathmin mediates multiple region-specific tubulin and microtubule-regulating
activities. J. Cell Biol. 1999, 146, 1289-1302.
(176) Laurent, E.; Talpaz, M.; Kantarjian, H.; Kurzrock, R. The BCR gene and philadelphia
chromosome-positive leukemogenesis. Cancer Res. 2001, 61, 2343-2355.
(177) Lazer, G.; Idelchuk, Y.; Schapira, V.; Pikarsky, E.; Katzav, S. The haematopoietic specific
signal transducer Vav1 is aberrantly expressed in lung cancer and plays a role in
tumourigenesis. J. Pathol. 2009, 219, 25-34.
(178) Lebbink, R. J.; Lowe, M.; Chan, T.; Khine, H.; Wang, X.; McManus, M. T. Polymerase II
promoter strength determines efficacy of microRNA adapted shRNAs. PLoS One 2011, 6,
e26213.
(179) Lebowitz, P. F.; Du, W.; Prendergast, G. C. Prenylation of RhoB is required for its cell
transforming function but not its ability to activate serum response element-dependent
transcription. J. Biol. Chem. 1997, 272, 16093-16095.
(180) Lee, J. B.; Zhang, K.; Tam, Y. Y.; Tam, Y. K.; Belliveau, N. M.; Sung, V. Y.; Lin, P. J.;
LeBlanc, E.; Ciufolini, M. A.; Rennie, P. S.; Cullis, P. R. Lipid nanoparticle siRNA systems
for silencing the androgen receptor in human prostate cancer in vivo. Int. J. Cancer 2012,
131, E781-90.
(181) Lee, K.; Liu, Y.; Mo, J. Q.; Zhang, J.; Dong, Z.; Lu, S. Vav3 oncogene activates estrogen
receptor and its overexpression may be involved in human breast cancer. BMC
Cancer 2008, 8, 158.
(182) Leevers, S. J.; Marshall, C. J. MAP kinase regulation--the oncogene connection. Trends
Cell Biol. 1992, 2, 283-286.
(183) Lehembre, F.; Yilmaz, M.; Wicki, A.; Schomber, T.; Strittmatter, K.; Ziegler, D.; Kren, A.;
Went, P.; Derksen, P. W.; Berns, A.; Jonkers, J.; Christofori, G. NCAM-induced focal
adhesion assembly: a functional switch upon loss of E-cadherin. EMBO J. 2008, 27, 2603-
2615.
(184) Leitao, M. M.; Soslow, R. A.; Baergen, R. N.; Olvera, N.; Arroyo, C.; Boyd, J. Mutation
and expression of the TP53 gene in early stage epithelial ovarian carcinoma. Gynecol.
Oncol. 2004, 93, 301-306.
(185) Lemmon, M. A.; Ferguson, K. M. Signal-dependent membrane targeting by pleckstrin
homology (PH) domains. Biochem. J. 2000, 350 Pt 1, 1-18.
149
(186) Letourneau, I.; Quinn, M. C.; Wang, L. L.; Portelance, L.; Caceres, K. Y.; Cyr, L.;
Delvoye, N.; Meunier, L.; de Ladurantaye, M.; Shen, Z.; Arcand, S. L.; Tonin, P. N.;
Provencher, D.; Mes-Masson, A. M. Derivation and characterization of matched cell lines
from primary and recurrent serous ovarian cancer. BMC Cancer 2012, 12, 379.
(187) Li, B. Q.; Subleski, M.; Shalloway, D.; Kung, H. F.; Kamata, T. Mitogenic activation of
the Ras guanine nucleotide exchange factor in NIH 3T3 cells involves protein tyrosine
phosphorylation. Proc. Natl. Acad. Sci. U. S. A. 1993, 90, 8504-8508.
(188) Li, X. R.; Ji, F.; Ouyang, J.; Wu, W.; Qian, L. Y.; Yang, K. Y. Overexpression of RhoA is
associated with poor prognosis in hepatocellular carcinoma. Eur. J. Surg. Oncol. 2006, 32,
1130-1134.
(189) Li, Z.; Chang, Z.; Chiao, L. J.; Kang, Y.; Xia, Q.; Zhu, C.; Fleming, J. B.; Evans, D. B.;
Chiao, P. J. TrkBT1 induces liver metastasis of pancreatic cancer cells by sequestering Rho
GDP dissociation inhibitor and promoting RhoA activation. Cancer Res. 2009, 69, 7851-
7859.
(190) Liao, Y. C.; Ruan, J. W.; Lua, I.; Li, M. H.; Chen, W. L.; Wang, J. R.; Kao, R. H.; Chen, J.
H. Overexpressed hPTTG1 promotes breast cancer cell invasion and metastasis by
regulating GEF-H1/RhoA signalling. Oncogene 2012, 31, 3086-3097.
(191) Lindsay, C. R.; Lawn, S.; Campbell, A. D.; Faller, W. J.; Rambow, F.; Mort, R. L.;
Timpson, P.; Li, A.; Cammareri, P.; Ridgway, R. A.; Morton, J. P.; Doyle, B.; Hegarty, S.;
Rafferty, M.; Murphy, I. G.; McDermott, E. W.; Sheahan, K.; Pedone, K.; Finn, A. J.;
Groben, P. A.; Thomas, N. E.; Hao, H.; Carson, C.; Norman, J. C.; Machesky, L. M.;
Gallagher, W. M.; Jackson, I. J.; Van Kempen, L.; Beermann, F.; Der, C.; Larue, L.; Welch,
H. C.; Ozanne, B. W.; Sansom, O. J. P-Rex1 is required for efficient melanoblast migration
and melanoma metastasis. Nat. Commun. 2011, 2, 555.
(192) Lobell, R. B.; Omer, C. A.; Abrams, M. T.; Bhimnathwala, H. G.; Brucker, M. J.; Buser,
C. A.; Davide, J. P.; deSolms, S. J.; Dinsmore, C. J.; Ellis-Hutchings, M. S.; Kral, A. M.;
Liu, D.; Lumma, W. C.; Machotka, S. V.; Rands, E.; Williams, T. M.; Graham, S. L.;
Hartman, G. D.; Oliff, A. I.; Heimbrook, D. C.; Kohl, N. E. Evaluation of farnesyl:protein
transferase and geranylgeranyl:protein transferase inhibitor combinations in preclinical
models. Cancer Res. 2001, 61, 8758-8768.
(193) Lopez-Lago, M.; Lee, H.; Cruz, C.; Movilla, N.; Bustelo, X. R. Tyrosine phosphorylation
mediates both activation and downmodulation of the biological activity of Vav. Mol. Cell.
Biol. 2000, 20, 1678-1691.
(194) Lozano, J.; Xing, R.; Cai, Z.; Jensen, H. L.; Trempus, C.; Mark, W.; Cannon, R.;
Kolesnick, R. Deficiency of kinase suppressor of Ras1 prevents oncogenic ras signaling in
mice. Cancer Res. 2003, 63, 4232-4238.
150
(195) Lubbert, M.; Mirro, J.,Jr; Miller, C. W.; Kahan, J.; Isaac, G.; Kitchingman, G.;
Mertelsmann, R.; Herrmann, F.; McCormick, F.; Koeffler, H. P. N-ras gene point mutations
in childhood acute lymphocytic leukemia correlate with a poor prognosis. Blood 1990, 75,
1163-1169.
(196) Luo, L.; Jan, L. Y.; Jan, Y. N. Rho family GTP-binding proteins in growth cone
signalling. Curr. Opin. Neurobiol. 1997, 7, 81-86.
(197) Lyons, L. S.; Burnstein, K. L. Vav3, a Rho GTPase guanine nucleotide exchange factor,
increases during progression to androgen independence in prostate cancer cells and
potentiates androgen receptor transcriptional activity. Mol. Endocrinol. 2006, 20, 1061-
1072.
(198) Macara, I. G.; Lounsbury, K. M.; Richards, S. A.; McKiernan, C.; Bar-Sagi, D. The Ras
superfamily of GTPases. FASEB J. 1996, 10, 625-630.
(199) Maitra, A.; Adsay, N. V.; Argani, P.; Iacobuzio-Donahue, C.; De Marzo, A.; Cameron, J.
L.; Yeo, C. J.; Hruban, R. H. Multicomponent analysis of the pancreatic adenocarcinoma
progression model using a pancreatic intraepithelial neoplasia tissue microarray. Mod.
Pathol. 2003, 16, 902-912.
(200) Makrodouli, E.; Oikonomou, E.; Koc, M.; Andera, L.; Sasazuki, T.; Shirasawa, S.; Pintzas,
A. BRAF and RAS oncogenes regulate Rho GTPase pathways to mediate migration and
invasion properties in human colon cancer cells: a comparative study. Mol. Cancer. 2011,
10, 118.
(201) Malliri, A.; Rygiel, T. P.; van der Kammen, R. A.; Song, J. Y.; Engers, R.; Hurlstone, A.
F.; Clevers, H.; Collard, J. G. The rac activator Tiam1 is a Wnt-responsive gene that
modifies intestinal tumor development. J. Biol. Chem. 2006, 281, 543-548.
(202) Malliri, A.; van der Kammen, R. A.; Clark, K.; van der Valk, M.; Michiels, F.; Collard, J.
G. Mice deficient in the Rac activator Tiam1 are resistant to Ras-induced skin
tumours. Nature 2002, 417, 867-871.
(203) Marcotte, R.; Brown, K. R.; Suarez, F.; Sayad, A.; Karamboulas, K.; Krzyzanowski, P. M.;
Sircoulomb, F.; Medrano, M.; Fedyshyn, Y.; Koh, J. L.; van Dyk, D.; Fedyshyn, B.;
Luhova, M.; Brito, G. C.; Vizeacoumar, F. J.; Vizeacoumar, F. S.; Datti, A.; Kasimer, D.;
Buzina, A.; Mero, P.; Misquitta, C.; Normand, J.; Haider, M.; Ketela, T.; Wrana, J. L.;
Rottapel, R.; Neel, B. G.; Moffat, J. Essential gene profiles in breast, pancreatic, and ovarian
cancer cells. Cancer. Discov. 2012, 2, 172-189.
(204) Marshall, M. Interactions between Ras and Raf: key regulatory proteins in cellular
transformation. Mol. Reprod. Dev. 1995, 42, 493-499.
151
(205) Marte, B. M.; Rodriguez-Viciana, P.; Wennstrom, S.; Warne, P. H.; Downward, J. R-Ras
can activate the phosphoinositide 3-kinase but not the MAP kinase arm of the Ras effector
pathways.Curr. Biol. 1997, 7, 63-70.
(206) Martello, L. A.; McDaid, H. M.; Regl, D. L.; Yang, C. P.; Meng, D.; Pettus, T. R.;
Kaufman, M. D.; Arimoto, H.; Danishefsky, S. J.; Smith, A. B.,3rd; Horwitz, S. B. Taxol
and discodermolide represent a synergistic drug combination in human carcinoma cell
lines. Clin. Cancer Res. 2000, 6, 1978-1987.
(207) Matsuzawa, T.; Kuwae, A.; Yoshida, S.; Sasakawa, C.; Abe, A. Enteropathogenic
Escherichia coli activates the RhoA signaling pathway via the stimulation of GEF-
H1. EMBO J. 2004, 23, 3570-3582.
(208) Mayo, M. W.; Wang, C. Y.; Cogswell, P. C.; Rogers-Graham, K. S.; Lowe, S. W.; Der, C.
J.; Baldwin, A. S.,Jr Requirement of NF-kappaB activation to suppress p53-independent
apoptosis induced by oncogenic Ras. Science 1997, 278, 1812-1815.
(209) McBride, O. W.; Swan, D. C.; Santos, E.; Barbacid, M.; Tronick, S. R.; Aaronson, S. A.
Localization of the normal allele of T24 human bladder carcinoma oncogene to
chromosome 11. Nature1982, 300, 773-774.
(210) McCubrey, J. A.; Steelman, L. S.; Abrams, S. L.; Lee, J. T.; Chang, F.; Bertrand, F. E.;
Navolanic, P. M.; Terrian, D. M.; Franklin, R. A.; D'Assoro, A. B.; Salisbury, J. L.;
Mazzarino, M. C.; Stivala, F.; Libra, M. Roles of the RAF/MEK/ERK and
PI3K/PTEN/AKT pathways in malignant transformation and drug resistance. Adv. Enzyme
Regul. 2006, 46, 249-279.
(211) McDaid, H. M.; Horwitz, S. B. Selective potentiation of paclitaxel (taxol)-induced cell
death by mitogen-activated protein kinase kinase inhibition in human cancer cell lines. Mol.
Pharmacol. 2001, 60, 290-301.
(212) McDaid, H. M.; Lopez-Barcons, L.; Grossman, A.; Lia, M.; Keller, S.; Perez-Soler, R.;
Horwitz, S. B. Enhancement of the therapeutic efficacy of taxol by the mitogen-activated
protein kinase kinase inhibitor CI-1040 in nude mice bearing human
heterotransplants. Cancer Res. 2005, 65, 2854-2860.
(213) Meiri, D.; Marshall, C. B.; Greeve, M. A.; Kim, B.; Balan, M.; Suarez, F.; Bakal, C.; Wu,
C.; Larose, J.; Fine, N.; Ikura, M.; Rottapel, R. Mechanistic insight into the microtubule and
actin cytoskeleton coupling through dynein-dependent RhoGEF inhibition. Mol. Cell 2012,
45, 642-655.
(214) Mhaidat, N. M.; Alali, F. Q.; Matalqah, S. M.; Matalka, I. I.; Jaradat, S. A.; Al-Sawalha, N.
A.; Thorne, R. F. Inhibition of MEK sensitizes paclitaxel-induced apoptosis of human
colorectal cancer cells by downregulation of GRP78. Anticancer Drugs 2009, 20, 601-606.
152
(215) Michaud, N. R.; Therrien, M.; Cacace, A.; Edsall, L. C.; Spiegel, S.; Rubin, G. M.;
Morrison, D. K. KSR stimulates Raf-1 activity in a kinase-independent manner. Proc. Natl.
Acad. Sci. U. S. A. 1997, 94, 12792-12796.
(216) Miki, T.; Smith, C. L.; Long, J. E.; Eva, A.; Fleming, T. P. Oncogene ect2 is related to
regulators of small GTP-binding proteins. Nature 1993, 362, 462-465.
(217) Minard, M. E.; Ellis, L. M.; Gallick, G. E. Tiam1 regulates cell adhesion, migration and
apoptosis in colon tumor cells. Clin. Exp. Metastasis 2006, 23, 301-313.
(218) Minden, A.; Lin, A.; Claret, F. X.; Abo, A.; Karin, M. Selective activation of the JNK
signaling cascade and c-Jun transcriptional activity by the small GTPases Rac and
Cdc42Hs. Cell 1995, 81, 1147-1157.
(219) Mizuarai, S.; Yamanaka, K.; Kotani, H. Mutant p53 induces the GEF-H1 oncogene, a
guanine nucleotide exchange factor-H1 for RhoA, resulting in accelerated cell proliferation
in tumor cells.Cancer Res. 2006, 66, 6319-6326.
(220) Molloy, C. J.; Bottaro, D. P.; Fleming, T. P.; Marshall, M. S.; Gibbs, J. B.; Aaronson, S. A.
PDGF induction of tyrosine phosphorylation of GTPase activating protein. Nature 1989,
342, 711-714.
(221) Moodie, S. A.; Willumsen, B. M.; Weber, M. J.; Wolfman, A. Complexes of Ras.GTP
with Raf-1 and mitogen-activated protein kinase kinase. Science 1993, 260, 1658-1661.
(222) Moore, P. S.; Sipos, B.; Orlandini, S.; Sorio, C.; Real, F. X.; Lemoine, N. R.; Gress, T.;
Bassi, C.; Kloppel, G.; Kalthoff, H.; Ungefroren, H.; Lohr, M.; Scarpa, A. Genetic profile of
22 pancreatic carcinoma cell lines. Analysis of K-ras, p53, p16 and DPC4/Smad4. Virchows
Arch. 2001, 439, 798-802.
(223) Morrison, D. K. KSR: a MAPK scaffold of the Ras pathway? J. Cell. Sci. 2001, 114, 1609-
1612.
(224) Morton, J. P.; Timpson, P.; Karim, S. A.; Ridgway, R. A.; Athineos, D.; Doyle, B.;
Jamieson, N. B.; Oien, K. A.; Lowy, A. M.; Brunton, V. G.; Frame, M. C.; Evans, T. R.;
Sansom, O. J. Mutant p53 drives metastasis and overcomes growth arrest/senescence in
pancreatic cancer. Proc. Natl. Acad. Sci. U. S. A. 2010, 107, 246-251.
(225) Moscow, J. A.; He, R.; Gnarra, J. R.; Knutsen, T.; Weng, Y.; Zhao, W. P.; Whang-Peng,
J.; Linehan, W. M.; Cowan, K. H. Examination of human tumors for rhoA
mutations. Oncogene 1994, 9, 189-194.
(226) Moskaluk, C. A.; Hruban, R. H.; Kern, S. E. p16 and K-ras gene mutations in the
intraductal precursors of human pancreatic adenocarcinoma. Cancer Res. 1997, 57, 2140-
2143.
153
(227) Mulcahy, L. S.; Smith, M. R.; Stacey, D. W. Requirement for ras proto-oncogene function
during serum-stimulated growth of NIH 3T3 cells. Nature 1985, 313, 241-243.
(228) Nakayama, N.; Nakayama, K.; Yeasmin, S.; Ishibashi, M.; Katagiri, A.; Iida, K.;
Fukumoto, M.; Miyazaki, K. KRAS or BRAF mutation status is a useful predictor of
sensitivity to MEK inhibition in ovarian cancer. Br. J. Cancer 2008, 99, 2020-2028.
(229) Nalbant, P.; Chang, Y. C.; Birkenfeld, J.; Chang, Z. F.; Bokoch, G. M. Guanine nucleotide
exchange factor-H1 regulates cell migration via localized activation of RhoA at the leading
edge. Mol. Biol. Cell 2009, 20, 4070-4082.
(230) Neri, A.; Knowles, D. M.; Greco, A.; McCormick, F.; Dalla-Favera, R. Analysis of RAS
oncogene mutations in human lymphoid malignancies. Proc. Natl. Acad. Sci. U. S. A. 1988,
85, 9268-9272.
(231) Newbold, R. F.; Overell, R. W. Fibroblast immortality is a prerequisite for transformation
by EJ c-Ha-ras oncogene. Nature 1983, 304, 648-651.
(232) Nguyen, A.; Burack, W. R.; Stock, J. L.; Kortum, R.; Chaika, O. V.; Afkarian, M.; Muller,
W. J.; Murphy, K. M.; Morrison, D. K.; Lewis, R. E.; McNeish, J.; Shaw, A. S. Kinase
suppressor of Ras (KSR) is a scaffold which facilitates mitogen-activated protein kinase
activation in vivo. Mol. Cell. Biol. 2002, 22, 3035-3045.
(233) Nguyen, D. X.; Bos, P. D.; Massague, J. Metastasis: from dissemination to organ-specific
colonization. Nat. Rev. Cancer. 2009, 9, 274-284.
(234) Nie, M.; Balda, M. S.; Matter, K. Stress- and Rho-activated ZO-1-associated nucleic acid
binding protein binding to p21 mRNA mediates stabilization, translation, and cell
survival. Proc. Natl. Acad. Sci. U. S. A. 2012, 109, 10897-10902.
(235) Nishio, K.; Nakamura, T.; Koh, Y.; Kanzawa, F.; Tamura, T.; Saijo, N. Oncoprotein 18
overexpression increases the sensitivity to vindesine in the human lung carcinoma
cells. Cancer 2001, 91, 1494-1499.
(236) Nobes, C. D.; Hall, A. Rho GTPases control polarity, protrusion, and adhesion during cell
movement. J. Cell Biol. 1999, 144, 1235-1244.
(237) Nobes, C. D.; Hall, A. Rho, rac, and cdc42 GTPases regulate the assembly of
multimolecular focal complexes associated with actin stress fibers, lamellipodia, and
filopodia. Cell 1995, 81, 53-62.
(238) Norris, J. L.; Baldwin, A. S.,Jr Oncogenic Ras enhances NF-kappaB transcriptional
activity through Raf-dependent and Raf-independent mitogen-activated protein kinase
signaling pathways. J. Biol. Chem. 1999, 274, 13841-13846.
154
(239) O'Connor, P. M.; Jackman, J.; Bae, I.; Myers, T. G.; Fan, S.; Mutoh, M.; Scudiero, D. A.;
Monks, A.; Sausville, E. A.; Weinstein, J. N.; Friend, S.; Fornace, A. J.,Jr; Kohn, K. W.
Characterization of the p53 tumor suppressor pathway in cell lines of the National Cancer
Institute anticancer drug screen and correlations with the growth-inhibitory potency of 123
anticancer agents. Cancer Res.1997, 57, 4285-4300.
(240) Oft, M.; Peli, J.; Rudaz, C.; Schwarz, H.; Beug, H.; Reichmann, E. TGF-beta1 and Ha-Ras
collaborate in modulating the phenotypic plasticity and invasiveness of epithelial tumor
cells. Genes Dev.1996, 10, 2462-2477.
(241) Olofsson, B. Rho guanine dissociation inhibitors: pivotal molecules in cellular
signalling. Cell. Signal. 1999, 11, 545-554.
(242) Olson, M. F.; Ashworth, A.; Hall, A. An essential role for Rho, Rac, and Cdc42 GTPases
in cell cycle progression through G1. Science 1995, 269, 1270-1272.
(243) Ong, D. C.; Ho, Y. M.; Rudduck, C.; Chin, K.; Kuo, W. L.; Lie, D. K.; Chua, C. L.; Tan,
P. H.; Eu, K. W.; Seow-Choen, F.; Wong, C. Y.; Hong, G. S.; Gray, J. W.; Lee, A. S. LARG
at chromosome 11q23 has functional characteristics of a tumor suppressor in human breast
and colorectal cancer. Oncogene 2009, 28, 4189-4200.
(244) Oren, M.; Rotter, V. Mutant p53 gain-of-function in cancer. Cold Spring Harb Perspect.
Biol. 2010, 2, a001107.
(245) Orr, G. A.; Verdier-Pinard, P.; McDaid, H.; Horwitz, S. B. Mechanisms of Taxol
resistance related to microtubules. Oncogene 2003, 22, 7280-7295.
(246) Ory, S.; Zhou, M.; Conrads, T. P.; Veenstra, T. D.; Morrison, D. K. Protein phosphatase
2A positively regulates Ras signaling by dephosphorylating KSR1 and Raf-1 on critical 14-
3-3 binding sites. Curr. Biol. 2003, 13, 1356-1364.
(247) Ozdamar, B.; Bose, R.; Barrios-Rodiles, M.; Wang, H. R.; Zhang, Y.; Wrana, J. L.
Regulation of the polarity protein Par6 by TGFbeta receptors controls epithelial cell
plasticity. Science 2005, 307, 1603-1609.
(248) Ozes, O. N.; Mayo, L. D.; Gustin, J. A.; Pfeffer, S. R.; Pfeffer, L. M.; Donner, D. B. NF-
kappaB activation by tumour necrosis factor requires the Akt serine-threonine
kinase. Nature 1999, 401, 82-85.
(249) Padua, R. A.; Barrass, N. C.; Currie, G. A. Activation of N-ras in a human melanoma cell
line. Mol. Cell. Biol. 1985, 5, 582-585.
(250) Padua, R. A.; Carter, G.; Hughes, D.; Gow, J.; Farr, C.; Oscier, D.; McCormick, F.; Jacobs,
A. RAS mutations in myelodysplasia detected by amplification, oligonucleotide
hybridization, and transformation. Leukemia 1988, 2, 503-510.
155
(251) Pakkala, T.; Virtanen, I.; Oksanen, J.; Jones, J. C.; Hormia, M. Function of laminins and
laminin-binding integrins in gingival epithelial cell adhesion. J. Periodontol. 2002, 73, 709-
719.
(252) Parada, L. F.; Tabin, C. J.; Shih, C.; Weinberg, R. A. Human EJ bladder carcinoma
oncogene is homologue of Harvey sarcoma virus ras gene. Nature 1982, 297, 474-478.
(253) Parwani, A. V.; Geradts, J.; Caspers, E.; Offerhaus, G. J.; Yeo, C. J.; Cameron, J. L.;
Klimstra, D. S.; Maitra, A.; Hruban, R. H.; Argani, P. Immunohistochemical and genetic
analysis of non-small cell and small cell gallbladder carcinoma and their precursor
lesions. Mod. Pathol. 2003, 16, 299-308.
(254) Patel, V.; Rosenfeldt, H. M.; Lyons, R.; Servitja, J. M.; Bustelo, X. R.; Siroff, M.; Gutkind,
J. S. Persistent activation of Rac1 in squamous carcinomas of the head and neck: evidence
for an EGFR/Vav2 signaling axis involved in cell invasion. Carcinogenesis 2007, 28, 1145-
1152.
(255) Peinado, H.; Marin, F.; Cubillo, E.; Stark, H. J.; Fusenig, N.; Nieto, M. A.; Cano, A. Snail
and E47 repressors of E-cadherin induce distinct invasive and angiogenic properties in
vivo. J. Cell. Sci.2004, 117, 2827-2839.
(256) Peinado, H.; Quintanilla, M.; Cano, A. Transforming growth factor beta-1 induces snail
transcription factor in epithelial cell lines: mechanisms for epithelial mesenchymal
transitions. J. Biol. Chem. 2003, 278, 21113-21123.
(257) Perona, R.; Montaner, S.; Saniger, L.; Sanchez-Perez, I.; Bravo, R.; Lacal, J. C. Activation
of the nuclear factor-kappaB by Rho, CDC42, and Rac-1 proteins. Genes Dev. 1997, 11,
463-475.
(258) Peyroche, A.; Antonny, B.; Robineau, S.; Acker, J.; Cherfils, J.; Jackson, C. L. Brefeldin A
acts to stabilize an abortive ARF-GDP-Sec7 domain protein complex: involvement of
specific residues of the Sec7 domain. Mol. Cell 1999, 3, 275-285.
(259) Pfaff, D.; Heroult, M.; Riedel, M.; Reiss, Y.; Kirmse, R.; Ludwig, T.; Korff, T.; Hecker,
M.; Augustin, H. G. Involvement of endothelial ephrin-B2 in adhesion and transmigration of
EphB-receptor-expressing monocytes. J. Cell. Sci. 2008, 121, 3842-3850.
(260) Pille, J. Y.; Denoyelle, C.; Varet, J.; Bertrand, J. R.; Soria, J.; Opolon, P.; Lu, H.;
Pritchard, L. L.; Vannier, J. P.; Malvy, C.; Soria, C.; Li, H. Anti-RhoA and anti-RhoC
siRNAs inhibit the proliferation and invasiveness of MDA-MB-231 breast cancer cells in
vitro and in vivo. Mol. Ther. 2005, 11, 267-274.
(261) Podsypanina, K.; Du, Y. C.; Jechlinger, M.; Beverly, L. J.; Hambardzumyan, D.; Varmus,
H. Seeding and propagation of untransformed mouse mammary cells in the
lung. Science 2008, 321, 1841-1844.
156
(262) Prendergast, G. C.; Khosravi-Far, R.; Solski, P. A.; Kurzawa, H.; Lebowitz, P. F.; Der, C.
J. Critical role of Rho in cell transformation by oncogenic Ras. Oncogene 1995, 10, 2289-
2296.
(263) Prokopenko, S. N.; Saint, R.; Bellen, H. J. Untying the Gordian knot of cytokinesis. Role
of small G proteins and their regulators. J. Cell Biol. 2000, 148, 843-848.
(264) Qin, J.; Xie, Y.; Wang, B.; Hoshino, M.; Wolff, D. W.; Zhao, J.; Scofield, M. A.; Dowd, F.
J.; Lin, M. F.; Tu, Y. Upregulation of PIP3-dependent Rac exchanger 1 (P-Rex1) promotes
prostate cancer metastasis. Oncogene 2009, 28, 1853-1863.
(265) Qiu, L.; Di, W.; Jiang, Q.; Scheffler, E.; Derby, S.; Yang, J.; Kouttab, N.; Wanebo, H.;
Yan, B.; Wan, Y. Targeted inhibition of transient activation of the EGFR-mediated cell
survival pathway enhances paclitaxel-induced ovarian cancer cell death. Int. J. Oncol. 2005,
27, 1441-1448.
(266) Qiu, R. G.; Abo, A.; McCormick, F.; Symons, M. Cdc42 regulates anchorage-independent
growth and is necessary for Ras transformation. Mol. Cell. Biol. 1997, 17, 3449-3458.
(267) Qiu, R. G.; Chen, J.; Kirn, D.; McCormick, F.; Symons, M. An essential role for Rac in
Ras transformation. Nature 1995, 374, 457-459.
(268) Qiu, R. G.; Chen, J.; McCormick, F.; Symons, M. A role for Rho in Ras
transformation. Proc. Natl. Acad. Sci. U. S. A. 1995, 92, 11781-11785.
(269) Radisky, D. C. Epithelial-mesenchymal transition. J. Cell. Sci. 2005, 118, 4325-4326.
(270) Rajagopalan, H.; Bardelli, A.; Lengauer, C.; Kinzler, K. W.; Vogelstein, B.; Velculescu, V.
E. Tumorigenesis: RAF/RAS oncogenes and mismatch-repair status. Nature 2002, 418, 934.
(271) Razidlo, G. L.; Kortum, R. L.; Haferbier, J. L.; Lewis, R. E. Phosphorylation regulates
KSR1 stability, ERK activation, and cell proliferation. J. Biol. Chem. 2004, 279, 47808-
47814.
(272) Rebecchi, M. J.; Scarlata, S. Pleckstrin homology domains: a common fold with diverse
functions. Annu. Rev. Biophys. Biomol. Struct. 1998, 27, 503-528.
(273) Reddy, E. P.; Reynolds, R. K.; Santos, E.; Barbacid, M. A point mutation is responsible for
the acquisition of transforming properties by the T24 human bladder carcinoma
oncogene. Nature1982, 300, 149-152.
(274) Redston, M. S.; Caldas, C.; Seymour, A. B.; Hruban, R. H.; da Costa, L.; Yeo, C. J.; Kern,
S. E. p53 mutations in pancreatic carcinoma and evidence of common involvement of
homocopolymer tracts in DNA microdeletions. Cancer Res. 1994, 54, 3025-3033.
157
(275) Ren, Y.; Li, R.; Zheng, Y.; Busch, H. Cloning and characterization of GEF-H1, a
microtubule-associated guanine nucleotide exchange factor for Rac and Rho GTPases. J.
Biol. Chem. 1998, 273, 34954-34960.
(276) Repasky, G. A.; Chenette, E. J.; Der, C. J. Renewing the conspiracy theory debate: does
Raf function alone to mediate Ras oncogenesis? Trends Cell Biol. 2004, 14, 639-647.
(277) Ridley, A. J.; Comoglio, P. M.; Hall, A. Regulation of scatter factor/hepatocyte growth
factor responses by Ras, Rac, and Rho in MDCK cells. Mol. Cell. Biol. 1995, 15, 1110-
1122.
(278) Ridley, A. J.; Hall, A. The small GTP-binding protein rho regulates the assembly of focal
adhesions and actin stress fibers in response to growth factors. Cell 1992, 70, 389-399.
(279) Ridley, A. J.; Hall, A. Distinct patterns of actin organization regulated by the small GTP-
binding proteins Rac and Rho. Cold Spring Harb. Symp. Quant. Biol. 1992, 57, 661-671.
(280) Rihet, S.; Vielh, P.; Camonis, J.; Goud, B.; Chevillard, S.; de Gunzburg, J. Mutation status
of genes encoding RhoA, Rac1, and Cdc42 GTPases in a panel of invasive human colorectal
and breast tumors. J. Cancer Res. Clin. Oncol. 2001, 127, 733-738.
(281) Robineau, S.; Chabre, M.; Antonny, B. Binding site of brefeldin A at the interface between
the small G protein ADP-ribosylation factor 1 (ARF1) and the nucleotide-exchange factor
Sec7 domain.Proc. Natl. Acad. Sci. U. S. A. 2000, 97, 9913-9918.
(282) Rodrigues, N. R.; Rowan, A.; Smith, M. E.; Kerr, I. B.; Bodmer, W. F.; Gannon, J. V.;
Lane, D. P. P53 Mutations in Colorectal Cancer. Proc. Natl. Acad. Sci. U. S. A. 1990, 87,
7555-7559.
(283) Rodriguez-Viciana, P.; Warne, P. H.; Dhand, R.; Vanhaesebroeck, B.; Gout, I.; Fry, M. J.;
Waterfield, M. D.; Downward, J. Phosphatidylinositol-3-OH kinase as a direct target of
Ras. Nature1994, 370, 527-532.
(284) Rodriguez-Viciana, P.; Warne, P. H.; Khwaja, A.; Marte, B. M.; Pappin, D.; Das, P.;
Waterfield, M. D.; Ridley, A.; Downward, J. Role of phosphoinositide 3-OH kinase in cell
transformation and control of the actin cytoskeleton by Ras. Cell 1997, 89, 457-467.
(285) Ron, D.; Graziani, G.; Aaronson, S. A.; Eva, A. The N-terminal region of proto-dbl down
regulates its transforming activity. Oncogene 1989, 4, 1067-1072.
(286) Ron, D.; Zannini, M.; Lewis, M.; Wickner, R. B.; Hunt, L. T.; Graziani, G.; Tronick, S. R.;
Aaronson, S. A.; Eva, A. A region of proto-dbl essential for its transforming activity shows
sequence similarity to a yeast cell cycle gene, CDC24, and the human breakpoint cluster
gene, bcr. New Biol. 1991, 3, 372-379.
158
(287) Rozenblum, E.; Schutte, M.; Goggins, M.; Hahn, S. A.; Panzer, S.; Zahurak, M.;
Goodman, S. N.; Sohn, T. A.; Hruban, R. H.; Yeo, C. J.; Kern, S. E. Tumor-suppressive
pathways in pancreatic carcinoma. Cancer Res. 1997, 57, 1731-1734.
(288) Ruley, H. E. Adenovirus early region 1A enables viral and cellular transforming genes to
transform primary cells in culture. Nature 1983, 304, 602-606.
(289) Sahai, E.; Olson, M. F.; Marshall, C. J. Cross-talk between Ras and Rho signalling
pathways in transformation favours proliferation and increased motility. EMBO J. 2001, 20,
755-766.
(290) Saito, S.; Tatsumoto, T.; Lorenzi, M. V.; Chedid, M.; Kapoor, V.; Sakata, H.; Rubin, J.;
Miki, T. Rho exchange factor ECT2 is induced by growth factors and regulates cytokinesis
through the N-terminal cell cycle regulator-related domains. J. Cell. Biochem. 2003, 90,
819-836.
(291) Samarin, S. N.; Ivanov, A. I.; Flatau, G.; Parkos, C. A.; Nusrat, A. Rho/Rho-associated
kinase-II signaling mediates disassembly of epithelial apical junctions. Mol. Biol. Cell 2007,
18, 3429-3439.
(292) Samouelian, V.; Maugard, C. M.; Jolicoeur, M.; Bertrand, R.; Arcand, S. L.; Tonin, P. N.;
Provencher, D. M.; Mes-Masson, A. M. Chemosensitivity and radiosensitivity profiles of
four new human epithelial ovarian cancer cell lines exhibiting genetic alterations in BRCA2,
TGFbeta-RII, KRAS2, TP53 and/or CDNK2A. Cancer Chemother. Pharmacol. 2004, 54,
497-504.
(293) Sanchez-Tillo, E.; de Barrios, O.; Siles, L.; Cuatrecasas, M.; Castells, A.; Postigo, A. beta-
catenin/TCF4 complex induces the epithelial-to-mesenchymal transition (EMT)-activator
ZEB1 to regulate tumor invasiveness. Proc. Natl. Acad. Sci. U. S. A. 2011, 108, 19204-
19209.
(294) Sander, E. E.; Collard, J. G. Rho-like GTPases: their role in epithelial cell-cell adhesion
and invasion. Eur. J. Cancer 1999, 35, 1302-1308.
(295) Schaber, M. D.; O'Hara, M. B.; Garsky, V. M.; Mosser, S. C.; Bergstrom, J. D.; Moores, S.
L.; Marshall, M. S.; Friedman, P. A.; Dixon, R. A.; Gibbs, J. B. Polyisoprenylation of Ras in
vitro by a farnesyl-protein transferase. J. Biol. Chem. 1990, 265, 14701-14704.
(296) Schiff, P. B.; Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast cells. Proc.
Natl. Acad. Sci. U. S. A. 1980, 77, 1561-1565.
(297) Schmid-Alliana, A.; Menou, L.; Manie, S.; Schmid-Antomarchi, H.; Millet, M. A.;
Giuriato, S.; Ferrua, B.; Rossi, B. Microtubule integrity regulates src-like and extracellular
signal-regulated kinase activities in human pro-monocytic cells. Importance for interleukin-
1 production. J. Biol. Chem. 1998, 273, 3394-3400.
159
(298) Schmidt, A.; Hall, A. Guanine nucleotide exchange factors for Rho GTPases: turning on
the switch. Genes Dev. 2002, 16, 1587-1609.
(299) Schmidt, S.; Diriong, S.; Mery, J.; Fabbrizio, E.; Debant, A. Identification of the first Rho-
GEF inhibitor, TRIPalpha, which targets the RhoA-specific GEF domain of Trio. FEBS
Lett. 2002, 523, 35-42.
(300) Schneider, G.; Schmid, R. M. Genetic alterations in pancreatic carcinoma. Mol.
Cancer. 2003, 2, 15.
(301) Schulze-Osthoff, K.; Ferrari, D.; Riehemann, K.; Wesselborg, S. Regulation of NF-kappa
B activation by MAP kinase cascades. Immunobiology 1997, 198, 35-49.
(302) Schumacher, G.; Kataoka, M.; Roth, J. A.; Mukhopadhyay, T. Potent antitumor activity of
2-methoxyestradiol in human pancreatic cancer cell lines. Clin. Cancer Res. 1999, 5, 493-
499.
(303) Seidman, R.; Gitelman, I.; Sagi, O.; Horwitz, S. B.; Wolfson, M. The role of ERK 1/2 and
p38 MAP-kinase pathways in taxol-induced apoptosis in human ovarian carcinoma
cells. Exp. Cell Res.2001, 268, 84-92.
(304) Settleman, J. Rho GTPases in development. Prog. Mol. Subcell. Biol. 1999, 22, 201-229.
(305) Settleman, J.; Albright, C. F.; Foster, L. C.; Weinberg, R. A. Association between GTPase
activators for Rho and Ras families. Nature 1992, 359, 153-154.
(306) Shen, Y.; Zhu, Y. M.; Fan, X.; Shi, J. Y.; Wang, Q. R.; Yan, X. J.; Gu, Z. H.; Wang, Y. Y.;
Chen, B.; Jiang, C. L.; Yan, H.; Chen, F. F.; Chen, H. M.; Chen, Z.; Jin, J.; Chen, S. J. Gene
mutation patterns and their prognostic impact in a cohort of 1185 patients with acute
myeloid leukemia. Blood 2011, 118, 5593-5603.
(307) Shen, Y. M.; Yang, X. C.; Yang, C.; Shen, J. K. Enhanced therapeutic effects for human
pancreatic cancer by application K-ras and IGF-IR antisense oligodeoxynucleotides. World
J. Gastroenterol.2008, 14, 5176-5185.
(308) Shi, Y.; Massague, J. Mechanisms of TGF-beta signaling from cell membrane to the
nucleus. Cell 2003, 113, 685-700.
(309) Shirasawa, S.; Furuse, M.; Yokoyama, N.; Sasazuki, T. Altered growth of human colon
cancer cell lines disrupted at activated Ki-ras. Science 1993, 260, 85-88.
(310) Sieburth, D. S.; Sundaram, M.; Howard, R. M.; Han, M. A PP2A regulatory subunit
positively regulates Ras-mediated signaling during Caenorhabditis elegans vulval
induction. Genes Dev. 1999, 13, 2562-2569.
160
(311) Silverstein, A. M.; Barrow, C. A.; Davis, A. J.; Mumby, M. C. Actions of PP2A on the
MAP kinase pathway and apoptosis are mediated by distinct regulatory subunits. Proc. Natl.
Acad. Sci. U. S. A.2002, 99, 4221-4226.
(312) Singh, A.; Greninger, P.; Rhodes, D.; Koopman, L.; Violette, S.; Bardeesy, N.; Settleman,
J. A gene expression signature associated with "K-Ras addiction" reveals regulators of EMT
and tumor cell survival. Cancer. Cell. 2009, 15, 489-500.
(313) Smit, V. T.; Boot, A. J.; Smits, A. M.; Fleuren, G. J.; Cornelisse, C. J.; Bos, J. L. KRAS
codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids
Res. 1988, 16, 7773-7782.
(314) Smith, F. D.; Langeberg, L. K.; Cellurale, C.; Pawson, T.; Morrison, D. K.; Davis, R. J.;
Scott, J. D. AKAP-Lbc enhances cyclic AMP control of the ERK1/2 cascade. Nat. Cell
Biol. 2010, 12, 1242-1249.
(315) Solit, D. B.; Garraway, L. A.; Pratilas, C. A.; Sawai, A.; Getz, G.; Basso, A.; Ye, Q.; Lobo,
J. M.; She, Y.; Osman, I.; Golub, T. R.; Sebolt-Leopold, J.; Sellers, W. R.; Rosen, N. BRAF
mutation predicts sensitivity to MEK inhibition. Nature 2006, 439, 358-362.
(316) Solit, D. B.; Garraway, L. A.; Pratilas, C. A.; Sawai, A.; Getz, G.; Basso, A.; Ye, Q.; Lobo,
J. M.; She, Y.; Osman, I.; Golub, T. R.; Sebolt-Leopold, J.; Sellers, W. R.; Rosen, N. BRAF
mutation predicts sensitivity to MEK inhibition. Nature 2006, 439, 358-362.
(317) Sontag, E.; Fedorov, S.; Kamibayashi, C.; Robbins, D.; Cobb, M.; Mumby, M. The
interaction of SV40 small tumor antigen with protein phosphatase 2A stimulates the map
kinase pathway and induces cell proliferation. Cell 1993, 75, 887-897.
(318) Stebel, A.; Brachetti, C.; Kunkel, M.; Schmidt, M.; Fritz, G. Progression of breast tumors
is accompanied by a decrease in expression of the Rho guanine exchange factor
Tiam1. Oncol. Rep.2009, 21, 217-222.
(319) Stevens, E. V.; Banet, N.; Onesto, C.; Plachco, A.; Alan, J. K.; Nikolaishvili-Feinberg, N.;
Midkiff, B. R.; Kuan, P. F.; Liu, J.; Miller, C. R.; Vigil, D.; Graves, L. M.; Der, C. J.
RhoGDI2 antagonizes ovarian carcinoma growth, invasion and metastasis. Small
GTPases 2011, 2, 202-210.
(320) Strumane, K.; Rygiel, T.; van der Valk, M.; Collard, J. G. Tiam1-deficiency impairs
mammary tumor formation in MMTV-c-neu but not in MMTV-c-myc mice. J. Cancer Res.
Clin. Oncol. 2009, 135, 69-80.
(321) Sukumar, S.; Notario, V.; Martin-Zanca, D.; Barbacid, M. Induction of mammary
carcinomas in rats by nitroso-methylurea involves malignant activation of H-ras-1 locus by
single point mutations.Nature 1983, 306, 658-661.
161
(322) Sundaram, M.; Han, M. The C. elegans ksr-1 gene encodes a novel Raf-related kinase
involved in Ras-mediated signal transduction. Cell 1995, 83, 889-901.
(323) Suwa, H.; Ohshio, G.; Imamura, T.; Watanabe, G.; Arii, S.; Imamura, M.; Narumiya, S.;
Hiai, H.; Fukumoto, M. Overexpression of the rhoC gene correlates with progression of
ductal adenocarcinoma of the pancreas. Br. J. Cancer 1998, 77, 147-152.
(324) Sweet, R. W.; Yokoyama, S.; Kamata, T.; Feramisco, J. R.; Rosenberg, M.; Gross, M. The
product of ras is a GTPase and the T24 oncogenic mutant is deficient in this
activity. Nature 1984, 311, 273-275.
(325) Tabin, C. J.; Bradley, S. M.; Bargmann, C. I.; Weinberg, R. A.; Papageorge, A. G.;
Scolnick, E. M.; Dhar, R.; Lowy, D. R.; Chang, E. H. Mechanism of activation of a human
oncogene. Nature 1982, 300, 143-149.
(326) Tada, M.; Ohashi, M.; Shiratori, Y.; Okudaira, T.; Komatsu, Y.; Kawabe, T.; Yoshida, H.;
Machinami, R.; Kishi, K.; Omata, M. Analysis of K-ras gene mutation in hyperplastic duct
cells of the pancreas without pancreatic disease. Gastroenterology 1996, 110, 227-231.
(327) Takahashi, H.; Guroff, G. Evidence for an indirect effect of nerve growth factor (NGF) on
the ADP-ribosylation of a 22 kDa rho-like protein in PC12 cells. Biochem. Biophys. Res.
Commun. 1993, 190, 1156-1162.
(328) Takahashi, M.; Ota, S.; Shimada, T.; Hamada, E.; Kawabe, T.; Okudaira, T.; Matsumura,
M.; Kaneko, N.; Terano, A.; Nakamura, T. Hepatocyte growth factor is the most potent
endogenous stimulant of rabbit gastric epithelial cell proliferation and migration in primary
culture. J. Clin. Invest. 1995, 95, 1994-2003.
(329) Taparowsky, E.; Suard, Y.; Fasano, O.; Shimizu, K.; Goldfarb, M.; Wigler, M. Activation
of the T24 bladder carcinoma transforming gene is linked to a single amino acid
change. Nature 1982, 300, 762-765.
(330) Taube, J. H.; Herschkowitz, J. I.; Komurov, K.; Zhou, A. Y.; Gupta, S.; Yang, J.; Hartwell,
K.; Onder, T. T.; Gupta, P. B.; Evans, K. W.; Hollier, B. G.; Ram, P. T.; Lander, E. S.;
Rosen, J. M.; Weinberg, R. A.; Mani, S. A. Core epithelial-to-mesenchymal transition
interactome gene-expression signature is associated with claudin-low and metaplastic breast
cancer subtypes. Proc. Natl. Acad. Sci. U. S. A. 2010, 107, 15449-15454.
(331) Therrien, M.; Chang, H. C.; Solomon, N. M.; Karim, F. D.; Wassarman, D. A.; Rubin, G.
M. KSR, a novel protein kinase required for RAS signal transduction. Cell 1995, 83, 879-
888.
(332) Therrien, M.; Michaud, N. R.; Rubin, G. M.; Morrison, D. K. KSR modulates signal
propagation within the MAPK cascade. Genes Dev. 1996, 10, 2684-2695.
162
(333) Thompson, E. W.; Torri, J.; Sabol, M.; Sommers, C. L.; Byers, S.; Valverius, E. M.;
Martin, G. R.; Lippman, M. E.; Stampfer, M. R.; Dickson, R. B. Oncogene-induced
basement membrane invasiveness in human mammary epithelial cells. Clin. Exp.
Metastasis 1994, 12, 181-194.
(334) Toksoz, D.; Williams, D. A. Novel human oncogene lbc detected by transfection with
distinct homology regions to signal transduction products. Oncogene 1994, 9, 621-628.
(335) Trahey, M.; Milley, R. J.; Cole, G. E.; Innis, M.; Paterson, H.; Marshall, C. J.; Hall, A.;
McCormick, F. Biochemical and biological properties of the human N-ras p21 protein. Mol.
Cell. Biol. 1987, 7, 541-544.
(336) Traut, T. W. Physiological concentrations of purines and pyrimidines. Mol. Cell.
Biochem. 1994, 140, 1-22.
(337) Tsapara, A.; Luthert, P.; Greenwood, J.; Hill, C. S.; Matter, K.; Balda, M. S. The RhoA
activator GEF-H1/Lfc is a transforming growth factor-beta target gene and effector that
regulates alpha-smooth muscle actin expression and cell migration. Mol. Biol. Cell 2010, 21,
860-870.
(338) Urano, T.; Emkey, R.; Feig, L. A. Ral-GTPases mediate a distinct downstream signaling
pathway from Ras that facilitates cellular transformation. EMBO J. 1996, 15, 810-816.
(339) Van Cutsem, E.; Aerts, R.; Haustermans, K.; Topal, B.; Van Steenbergen, W.; Verslype, C.
Systemic treatment of pancreatic cancer. Eur. J. Gastroenterol. Hepatol. 2004, 16, 265-274.
(340) van Horck, F. P.; Ahmadian, M. R.; Haeusler, L. C.; Moolenaar, W. H.; Kranenburg, O.
Characterization of p190RhoGEF, a RhoA-specific guanine nucleotide exchange factor that
interacts with microtubules. J. Biol. Chem. 2001, 276, 4948-4956.
(341) Varker, K. A.; Phelps, S. H.; King, M. M.; Williams, C. L. The small GTPase RhoA has
greater expression in small cell lung carcinoma than in non-small cell lung carcinoma and
contributes to their unique morphologies. Int. J. Oncol. 2003, 22, 671-681.
(342) Varma, H.; Yamamoto, A.; Sarantos, M. R.; Hughes, R. E.; Stockwell, B. R. Mutant
huntingtin alters cell fate in response to microtubule depolymerization via the GEF-H1-
RhoA-ERK pathway. J. Biol. Chem. 2010, 285, 37445-37457.
(343) Venter, J. C.; Adams, M. D.; Myers, E. W.; Li, P. W.; Mural, R. J.; Sutton, G. G.; Smith,
H. O.; Yandell, M.; Evans, C. A.; Holt, R. A.; Gocayne, J. D.; Amanatides, P.; Ballew, R.
M.; Huson, D. H.; Wortman, J. R.; Zhang, Q.; Kodira, C. D.; Zheng, X. H.; Chen, L.;
Skupski, M.; Subramanian, G.; Thomas, P. D.; Zhang, J.; Gabor Miklos, G. L.; Nelson, C.;
Broder, S.; Clark, A. G.; Nadeau, J.; McKusick, V. A.; Zinder, N.; Levine, A. J.; Roberts, R.
J.; Simon, M.; Slayman, C.; Hunkapiller, M.; Bolanos, R.; Delcher, A.; Dew, I.; Fasulo, D.;
Flanigan, M.; Florea, L.; Halpern, A.; Hannenhalli, S.; Kravitz, S.; Levy, S.; Mobarry, C.;
Reinert, K.; Remington, K.; Abu-Threideh, J.; Beasley, E.; Biddick, K.; Bonazzi, V.;
163
Brandon, R.; Cargill, M.; Chandramouliswaran, I.; Charlab, R.; Chaturvedi, K.; Deng, Z.; Di
Francesco, V.; Dunn, P.; Eilbeck, K.; Evangelista, C.; Gabrielian, A. E.; Gan, W.; Ge, W.;
Gong, F.; Gu, Z.; Guan, P.; Heiman, T. J.; Higgins, M. E.; Ji, R. R.; Ke, Z.; Ketchum, K. A.;
Lai, Z.; Lei, Y.; Li, Z.; Li, J.; Liang, Y.; Lin, X.; Lu, F.; Merkulov, G. V.; Milshina, N.;
Moore, H. M.; Naik, A. K.; Narayan, V. A.; Neelam, B.; Nusskern, D.; Rusch, D. B.;
Salzberg, S.; Shao, W.; Shue, B.; Sun, J.; Wang, Z.; Wang, A.; Wang, X.; Wang, J.; Wei,
M.; Wides, R.; Xiao, C.; Yan, C.; Yao, A.; Ye, J.; Zhan, M.; Zhang, W.; Zhang, H.; Zhao,
Q.; Zheng, L.; Zhong, F.; Zhong, W.; Zhu, S.; Zhao, S.; Gilbert, D.; Baumhueter, S.; Spier,
G.; Carter, C.; Cravchik, A.; Woodage, T.; Ali, F.; An, H.; Awe, A.; Baldwin, D.; Baden,
H.; Barnstead, M.; Barrow, I.; Beeson, K.; Busam, D.; Carver, A.; Center, A.; Cheng, M. L.;
Curry, L.; Danaher, S.; Davenport, L.; Desilets, R.; Dietz, S.; Dodson, K.; Doup, L.;
Ferriera, S.; Garg, N.; Gluecksmann, A.; Hart, B.; Haynes, J.; Haynes, C.; Heiner, C.;
Hladun, S.; Hostin, D.; Houck, J.; Howland, T.; Ibegwam, C.; Johnson, J.; Kalush, F.; Kline,
L.; Koduru, S.; Love, A.; Mann, F.; May, D.; McCawley, S.; McIntosh, T.; McMullen, I.;
Moy, M.; Moy, L.; Murphy, B.; Nelson, K.; Pfannkoch, C.; Pratts, E.; Puri, V.; Qureshi, H.;
Reardon, M.; Rodriguez, R.; Rogers, Y. H.; Romblad, D.; Ruhfel, B.; Scott, R.; Sitter, C.;
Smallwood, M.; Stewart, E.; Strong, R.; Suh, E.; Thomas, R.; Tint, N. N.; Tse, S.; Vech, C.;
Wang, G.; Wetter, J.; Williams, S.; Williams, M.; Windsor, S.; Winn-Deen, E.; Wolfe, K.;
Zaveri, J.; Zaveri, K.; Abril, J. F.; Guigo, R.; Campbell, M. J.; Sjolander, K. V.; Karlak, B.;
Kejariwal, A.; Mi, H.; Lazareva, B.; Hatton, T.; Narechania, A.; Diemer, K.; Muruganujan,
A.; Guo, N.; Sato, S.; Bafna, V.; Istrail, S.; Lippert, R.; Schwartz, R.; Walenz, B.; Yooseph,
S.; Allen, D.; Basu, A.; Baxendale, J.; Blick, L.; Caminha, M.; Carnes-Stine, J.; Caulk, P.;
Chiang, Y. H.; Coyne, M.; Dahlke, C.; Mays, A.; Dombroski, M.; Donnelly, M.; Ely, D.;
Esparham, S.; Fosler, C.; Gire, H.; Glanowski, S.; Glasser, K.; Glodek, A.; Gorokhov, M.;
Graham, K.; Gropman, B.; Harris, M.; Heil, J.; Henderson, S.; Hoover, J.; Jennings, D.;
Jordan, C.; Jordan, J.; Kasha, J.; Kagan, L.; Kraft, C.; Levitsky, A.; Lewis, M.; Liu, X.;
Lopez, J.; Ma, D.; Majoros, W.; McDaniel, J.; Murphy, S.; Newman, M.; Nguyen, T.;
Nguyen, N.; Nodell, M.; Pan, S.; Peck, J.; Peterson, M.; Rowe, W.; Sanders, R.; Scott, J.;
Simpson, M.; Smith, T.; Sprague, A.; Stockwell, T.; Turner, R.; Venter, E.; Wang, M.; Wen,
M.; Wu, D.; Wu, M.; Xia, A.; Zandieh, A.; Zhu, X. The sequence of the human
genome. Science 2001, 291, 1304-1351.
(344) Verschueren, H.; De Baetselier, P.; De Braekeleer, J.; Dewit, J.; Aktories, K.; Just, I. ADP-
ribosylation of Rho-proteins with botulinum C3 exoenzyme inhibits invasion and shape
changes of T-lymphoma cells. Eur. J. Cell Biol. 1997, 73, 182-187.
(345) Vetter, I. R.; Wittinghofer, A. The guanine nucleotide-binding switch in three
dimensions. Science 2001, 294, 1299-1304.
(346) Vigil, D.; Cherfils, J.; Rossman, K. L.; Der, C. J. Ras superfamily GEFs and GAPs:
validated and tractable targets for cancer therapy? Nat. Rev. Cancer. 2010, 10, 842-857.
(347) Vlotides, G.; Cruz-Soto, M.; Rubinek, T.; Eigler, T.; Auernhammer, C. J.; Melmed, S.
Mechanisms for growth factor-induced pituitary tumor transforming gene-1 expression in
pituitary folliculostellate TtT/GF cells. Mol. Endocrinol. 2006, 20, 3321-3335.
164
(348) Vogelstein, B.; Fearon, E. R.; Hamilton, S. R.; Kern, S. E.; Preisinger, A. C.; Leppert, M.;
Nakamura, Y.; White, R.; Smits, A. M.; Bos, J. L. Genetic alterations during colorectal-
tumor development.N. Engl. J. Med. 1988, 319, 525-532.
(349) Vojtek, A. B.; Hollenberg, S. M.; Cooper, J. A. Mammalian Ras interacts directly with the
serine/threonine kinase Raf. Cell 1993, 74, 205-214.
(350) Wagner, P.; Wang, B.; Clark, E.; Lee, H.; Rouzier, R.; Pusztai, L. Microtubule Associated
Protein (MAP)-Tau: a novel mediator of paclitaxel sensitivity in vitro and in vivo. Cell.
Cycle 2005, 4, 1149-1152.
(351) Walker, L. C.; Waddell, N.; Ten Haaf, A.; kConFab Investigators; Grimmond, S.; Spurdle,
A. B. Use of expression data and the CGEMS genome-wide breast cancer association study
to identify genes that may modify risk in BRCA1/2 mutation carriers. Breast Cancer Res.
Treat. 2008, 112, 229-236.
(352) Wang, H.; Linghu, H.; Wang, J.; Che, Y. L.; Xiang, T. X.; Tang, W. X.; Yao, Z. W. The
role of Crk/Dock180/Rac1 pathway in the malignant behavior of human ovarian cancer cell
SKOV3. Tumour Biol. 2010, 31, 59-67.
(353) Wang, Y.; Prywes, R. Activation of the c-fos enhancer by the erk MAP kinase pathway
through two sequence elements: the c-fos AP-1 and p62TCF sites. Oncogene 2000, 19,
1379-1385.
(354) Wang, Y.; Zhang, Z.; Lubet, R. A.; You, M. A mouse model for tumor progression of lung
cancer in ras and p53 transgenic mice. Oncogene 2006, 25, 1277-1280.
(355) Warne, P. H.; Viciana, P. R.; Downward, J. Direct interaction of Ras and the amino-
terminal region of Raf-1 in vitro. Nature 1993, 364, 352-355.
(356) Warshaw, A. L.; Fernandez-del Castillo, C. Pancreatic carcinoma. N. Engl. J. Med. 1992,
326, 455-465.
(357) Wasielewski, M.; Elstrodt, F.; Klijn, J. G.; Berns, E. M.; Schutte, M. Thirteen new p53
gene mutants identified among 41 human breast cancer cell lines. Breast Cancer Res.
Treat. 2006, 99, 97-101.
(358) Wassarman, D. A.; Solomon, N. M.; Chang, H. C.; Karim, F. D.; Therrien, M.; Rubin, G.
M. Protein phosphatase 2A positively and negatively regulates Ras1-mediated photoreceptor
development in Drosophila. Genes Dev. 1996, 10, 272-278.
(359) Weinberg, R. A. Oncogenes, antioncogenes, and the molecular bases of multistep
carcinogenesis. Cancer Res. 1989, 49, 3713-3721.
(360) Wells, J. A.; McClendon, C. L. Reaching for high-hanging fruit in drug discovery at
protein-protein interfaces. Nature 2007, 450, 1001-1009.
165
(361) Wennerberg, K.; Rossman, K. L.; Der, C. J. The Ras superfamily at a glance. J. Cell.
Sci. 2005, 118, 843-846.
(362) West, M.; Kung, H. F.; Kamata, T. A novel membrane factor stimulates guanine
nucleotide exchange reaction of ras proteins. FEBS Lett. 1990, 259, 245-248.
(363) Westra, W. H.; Baas, I. O.; Hruban, R. H.; Askin, F. B.; Wilson, K.; Offerhaus, G. J.;
Slebos, R. J. K-ras oncogene activation in atypical alveolar hyperplasias of the human
lung. Cancer Res. 1996, 56, 2224-2228.
(364) Westwick, J. K.; Lambert, Q. T.; Clark, G. J.; Symons, M.; Van Aelst, L.; Pestell, R. G.;
Der, C. J. Rac regulation of transformation, gene expression, and actin organization by
multiple, PAK-independent pathways. Mol. Cell. Biol. 1997, 17, 1324-1335.
(365) Westwick, J. K.; Lee, R. J.; Lambert, Q. T.; Symons, M.; Pestell, R. G.; Der, C. J.;
Whitehead, I. P. Transforming potential of Dbl family proteins correlates with transcription
from the cyclin D1 promoter but not with activation of Jun NH2-terminal kinase, p38/Mpk2,
serum response factor, or c-Jun. J. Biol. Chem. 1998, 273, 16739-16747.
(366) White, M. A.; Nicolette, C.; Minden, A.; Polverino, A.; Van Aelst, L.; Karin, M.; Wigler,
M. H. Multiple Ras functions can contribute to mammalian cell transformation. Cell 1995,
80, 533-541.
(367) White, M. A.; Vale, T.; Camonis, J. H.; Schaefer, E.; Wigler, M. H. A role for the Ral
guanine nucleotide dissociation stimulator in mediating Ras-induced transformation. J. Biol.
Chem. 1996, 271, 16439-16442.
(368) Whitehead, I.; Kirk, H.; Tognon, C.; Trigo-Gonzalez, G.; Kay, R. Expression cloning of
lfc, a novel oncogene with structural similarities to guanine nucleotide exchange factors and
to the regulatory region of protein kinase C. J. Biol. Chem. 1995, 270, 18388-18395.
(369) Whitehead, I. P.; Abe, K.; Gorski, J. L.; Der, C. J. CDC42 and FGD1 cause distinct
signaling and transforming activities. Mol. Cell. Biol. 1998, 18, 4689-4697.
(370) Whitehead, I. P.; Campbell, S.; Rossman, K. L.; Der, C. J. Dbl family proteins. Biochim.
Biophys. Acta 1997, 1332, F1-23.
(371) Whyte, D. B.; Kirschmeier, P.; Hockenberry, T. N.; Nunez-Oliva, I.; James, L.; Catino, J.
J.; Bishop, W. R.; Pai, J. K. K- and N-Ras are geranylgeranylated in cells treated with
farnesyl protein transferase inhibitors. J. Biol. Chem. 1997, 272, 14459-14464.
(372) Wilentz, R. E.; Geradts, J.; Maynard, R.; Offerhaus, G. J.; Kang, M.; Goggins, M.; Yeo, C.
J.; Kern, S. E.; Hruban, R. H. Inactivation of the p16 (INK4A) tumor-suppressor gene in
pancreatic duct lesions: loss of intranuclear expression. Cancer Res. 1998, 58, 4740-4744.
166
(373) Wilentz, R. E.; Iacobuzio-Donahue, C. A.; Argani, P.; McCarthy, D. M.; Parsons, J. L.;
Yeo, C. J.; Kern, S. E.; Hruban, R. H. Loss of expression of Dpc4 in pancreatic
intraepithelial neoplasia: evidence that DPC4 inactivation occurs late in neoplastic
progression. Cancer Res. 2000, 60, 2002-2006.
(374) Wilson, L.; Jordan, M. A. New microtubule/tubulin-targeted anticancer drugs and novel
chemotherapeutic strategies. J. Chemother. 2004, 16 Suppl 4, 83-85.
(375) Wilson, L.; Panda, D.; Jordan, M. A. Modulation of microtubule dynamics by drugs: a
paradigm for the actions of cellular regulators. Cell Struct. Funct. 1999, 24, 329-335.
(376) Witkowski, C. M.; Rabinovitz, I.; Nagle, R. B.; Affinito, K. S.; Cress, A. E.
Characterization of integrin subunits, cellular adhesion and tumorgenicity of four human
prostate cell lines. J. Cancer Res. Clin. Oncol. 1993, 119, 637-644.
(377) Wright, L. P.; Philips, M. R. Thematic review series: lipid posttranslational modifications.
CAAX modification and membrane targeting of Ras. J. Lipid Res. 2006, 47, 883-891.
(378) Xiao, H.; Zhang, Q.; Shen, J.; Bindokas, V.; Xing, H. R. Pharmacologic inactivation of
kinase suppressor of Ras1 sensitizes epidermal growth factor receptor and oncogenic Ras-
dependent tumors to ionizing radiation treatment. Mol. Cancer. Ther. 2010, 9, 2724-2736.
(379) Xie, L.; Law, B. K.; Chytil, A. M.; Brown, K. A.; Aakre, M. E.; Moses, H. L. Activation of
the Erk pathway is required for TGF-beta1-induced EMT in vitro. Neoplasia 2004, 6, 603-
610.
(380) Xing, H. R.; Cordon-Cardo, C.; Deng, X.; Tong, W.; Campodonico, L.; Fuks, Z.;
Kolesnick, R. Pharmacologic inactivation of kinase suppressor of ras-1 abrogates Ras-
mediated pancreatic cancer.Nat. Med. 2003, 9, 1266-1268.
(381) Xu, G. F.; Lin, B.; Tanaka, K.; Dunn, D.; Wood, D.; Gesteland, R.; White, R.; Weiss, R.;
Tamanoi, F. The catalytic domain of the neurofibromatosis type 1 gene product stimulates
ras GTPase and complements ira mutants of S. cerevisiae. Cell 1990, 63, 835-841.
(382) Yamamoto, M.; Marui, N.; Sakai, T.; Morii, N.; Kozaki, S.; Ikai, K.; Imamura, S.;
Narumiya, S. ADP-ribosylation of the rhoA gene product by botulinum C3 exoenzyme
causes Swiss 3T3 cells to accumulate in the G1 phase of the cell cycle. Oncogene 1993, 8,
1449-1455.
(383) Yan, F.; John, S. K.; Polk, D. B. Kinase suppressor of Ras determines survival of intestinal
epithelial cells exposed to tumor necrosis factor. Cancer Res. 2001, 61, 8668-8675.
(384) Yan, F.; John, S. K.; Wilson, G.; Jones, D. S.; Washington, M. K.; Polk, D. B. Kinase
suppressor of Ras-1 protects intestinal epithelium from cytokine-mediated apoptosis during
inflammation. J. Clin. Invest. 2004, 114, 1272-1280.
167
(385) Yanez-Mo, M.; Mittelbrunn, M.; Sanchez-Madrid, F. Tetraspanins and intercellular
interactions. Microcirculation 2001, 8, 153-168.
(386) Yoshioka, K.; Imamura, F.; Shinkai, K.; Miyoshi, J.; Ogawa, H.; Mukai, M.; Komagome,
R.; Akedo, H. Participation of rhop21 in serum-dependent invasion by rat ascites hepatoma
cells. FEBS Lett. 1995, 372, 25-28.
(387) Yoshioka, K.; Matsumura, F.; Akedo, H.; Itoh, K. Small GTP-binding protein Rho
stimulates the actomyosin system, leading to invasion of tumor cells. J. Biol. Chem. 1998,
273, 5146-5154.
(388) Yoshioka, K.; Nakamori, S.; Itoh, K. Overexpression of small GTP-binding protein RhoA
promotes invasion of tumor cells. Cancer Res. 1999, 59, 2004-2010.
(389) Yu, K.; Toral-Barza, L.; Shi, C.; Zhang, W. G.; Zask, A. Response and determinants of
cancer cell susceptibility to PI3K inhibitors: combined targeting of PI3K and Mek1 as an
effective anticancer strategy. Cancer. Biol. Ther. 2008, 7, 307-315.
(390) Yuan, Z.; Su, J.; You, J. F.; Wang, J. L.; Cui, X. L.; Zheng, J. Correlation of expression of
RhoC with invasiveness of breast cancer cells in vitro. Zhonghua Zhong Liu Za Zhi 2007,
29, 898-903.
(391) Zelivianski, S.; Spellman, M.; Kellerman, M.; Kakitelashvilli, V.; Zhou, X. W.; Lugo, E.;
Lee, M. S.; Taylor, R.; Davis, T. L.; Hauke, R.; Lin, M. F. ERK inhibitor PD98059
enhances docetaxel-induced apoptosis of androgen-independent human prostate cancer
cells. Int. J. Cancer 2003, 107, 478-485.
(392) Zerial, M.; McBride, H. Rab proteins as membrane organizers. Nat. Rev. Mol. Cell
Biol. 2001, 2, 107-117.
(393) Zhang, C. C.; Yang, J. M.; White, E.; Murphy, M.; Levine, A.; Hait, W. N. The role of
MAP4 expression in the sensitivity to paclitaxel and resistance to vinca alkaloids in p53
mutant cells.Oncogene 1998, 16, 1617-1624.
(394) Zhang, J.; Zhao, J.; Zhang, W.; Liu, G.; Yin, D.; Li, J.; Zhang, S.; Li, H. Establishment of
Paclitaxel-Resistant Cell Line and the Underlying Mechanism on Drug Resistance. Int. J.
Gynecol. Cancer2012.
(395) Zhang, X. F.; Settleman, J.; Kyriakis, J. M.; Takeuchi-Suzuki, E.; Elledge, S. J.; Marshall,
M. S.; Bruder, J. T.; Rapp, U. R.; Avruch, J. Normal and oncogenic p21ras proteins bind to
the amino-terminal regulatory domain of c-Raf-1. Nature 1993, 364, 308-313.
(396) Zhao, F.; Siu, M. K.; Jiang, L.; Tam, K. F.; Ngan, H. Y.; Le, X. F.; Wong, O. G.; Wong, E.
S.; Chan, H. Y.; Cheung, A. N. Overexpression of dedicator of cytokinesis I (Dock180) in
ovarian cancer correlated with aggressive phenotype and poor patient
survival. Histopathology 2011, 59, 1163-1172.
168
(397) Zhou, B.; Wang, Z. X.; Zhao, Y.; Brautigan, D. L.; Zhang, Z. Y. The specificity of
extracellular signal-regulated kinase 2 dephosphorylation by protein phosphatases. J. Biol.
Chem. 2002, 277, 31818-31825.
(398) Zhu, H.; Liang, Z. Y.; Ren, X. Y.; Liu, T. H. Small interfering RNAs targeting mutant K-
ras inhibit human pancreatic carcinoma cells growth in vitro and in vivo. Cancer. Biol.
Ther. 2006, 5, 1693-1698.
(399) Zuber, J.; Tchernitsa, O. I.; Hinzmann, B.; Schmitz, A. C.; Grips, M.; Hellriegel, M.; Sers,
C.; Rosenthal, A.; Schafer, R. A genome-wide survey of RAS transformation targets. Nat.
Genet. 2000, 24, 144-152.