the tweak-fn14 ligand receptor axis promotes glioblastoma … · 2020. 4. 2. · 2 the university...

The TWEAK-Fn14 Ligand Receptor Axis PromotesGlioblastoma Cell Invasion and Survival Via Activation

of Multiple GEF-Rho GTPase Signaling Systems

Item Type text; Electronic Dissertation

Authors Fortin Ensign, Shannon Patricia

Publisher The University of Arizona.

Rights Copyright © is held by the author. Digital access to this materialis made possible by the University Libraries, University of Arizona.Further transmission, reproduction or presentation (such aspublic display or performance) of protected items is prohibitedexcept with permission of the author.

Download date 01/09/2021 05:20:25

Link to Item http://hdl.handle.net/10150/293463

http://hdl.handle.net/10150/293463

THE TWEAK-FN14 LIGAND RECEPTOR AXIS PROMOTES GLIOBLASTOMA CELL INVASION AND SURVIVAL VIA ACTIVATION OF

MULTIPLE GEF-RHO GTPASE SIGNALING SYSTEMS

by

Shannon Fortin Ensign

_____________________________ Copyright © Shannon Fortin Ensign 2013

A Dissertation Submitted to the Faculty of the

GRADUATE INTERDISCIPLINARY PROGRAM IN CANCER BIOLOGY

In Partial Fulfillment of the Requirements

For the Degree of

DOCTOR OF PHILOSOPHY

In the Graduate College

THE UNIVERSITY OF ARIZONA

2013

2

THE UNIVERSITY OF ARIZONA GRADUATE COLLEGE

As members of the Dissertation Committee, we certify that we have read the dissertation prepared by Shannon Fortin Ensign, titled The TWEAK-Fn14 Ligand Receptor Axis Promotes Glioblastoma Cell Invasion and Survival Via Activation of Multiple GEF-Rho GTPase Signaling Systems and recommend that it be accepted as fulfilling the dissertation requirement for the Degree of Doctor of Philosophy. _______________________________________________ Date: April 26, 2013 Nhan Tran, PhD _______________________________________________ Date: April 26, 2013 Suwon Kim, PhD _______________________________________________ Date: April 26, 2013 Jesse Martinez, PhD _______________________________________________ Date: April 26, 2013 Anne Cress, PhD _______________________________________________ Date: April 26, 2013 Maria Bishop, MD Final approval and acceptance of this dissertation is contingent upon the candidate’s submission of the final copies of the dissertation to the Graduate College. I hereby certify that I have read this dissertation prepared under my direction and recommend that it be accepted as fulfilling the dissertation requirement. ________________________________________________ Date: April 26, 2013 Dissertation Director: Nhan Tran, PhD ________________________________________________ Date: April 26, 2013 Dissertation Director: Suwon Kim, PhD

3

STATEMENT BY AUTHOR

This dissertation has been submitted in partial fulfillment of the requirements for an advanced degree at the University of Arizona and is deposited in the University Library to be made available to borrowers under rules of the Library.

Brief quotations from this dissertation are allowable without special permission, provided that accurate acknowledgment of source is made. Requests for permission for extended quotation from or reproduction of this manuscript in whole or in part may be granted by the copyright holder. SIGNED: Shannon Fortin Ensign

4

ACKNOWLEDGEMENTS

I would like to express my sincerest gratitude towards everyone who has helped me reach this stage in my career and path in life. I particularly would like to thank my mentor, Dr. Nhan Tran, for his support not only in my graduate studies but as a mentor to me in my undergraduate years as well. Your passion for science and teaching has inspired me to work hard to achieve my goals, and I truly appreciate your guidance, critiques, support and friendship. In addition, I would like to thank Dr. Michael Berens for his time and devotion also as a mentor during both my undergraduate and graduate studies. Your drive for success, caring personality, and remarkable ability for collaboration are inspirational. I hope to take what knowledge I have learned from these mentors and apply it to my own future career. I feel that both of these remarkable individuals keep paramount the understanding that so many patients are suffering from the disease of cancer and that there is an urgency and precision to our work as scientists. I will strive to follow in their lead and never lose sight of this most important aspect of research. I would also like to express my appreciation for the time and devotion of my committee members, Drs. Jesse Martinez, Anne Cress, Suwon Kim, and Maria Bishop. Thank you for sharing your resources, expertise, and critiques; I value your guidance both in my research and towards my personal future career. Thank you to the amazing and devoted undergraduate interns, Ian Mathews, Molly Kupfer, and Danielle Ennesser, who have worked with me during my dissertation. For me it has been so rewarding to mentor these future scientists, and so inspirational to witness their upmost enthusiasm for science and their desire to contribute towards a project in cancer research. I have learned so much in teaching, and these interactions have brought friendship and appreciation in cultivating their passions. I wish them all the best success for their future careers as researchers and clinicians to come. Thank you to the wonderful post-doctoral fellows with whom I have had the chance to work: Dr. Timothy Whitsett and Dr. Harshil Dhruv. Your friendship and guidance have been invaluable to me during my graduate studies and I have much gratitude for your mentorship, and for sharing your critiques and expertise with me. Thank you to everyone in the Berens and Tran labs for their friendship and support during my graduate research. Thank you to the Cancer Biology Interdisciplinary Graduate Program and to Anne Cione for always being so helpful in her assistance and for her genuine caring personality. Finally, I would like to express my deepest appreciation to my friends and family, whose love, support, and encouragement have been unwavering in all my years of education and who have made it possible for me to achieve my goals.

5

DEDICATION

I would like to dedicate this dissertation to those all those individuals who have suffered

from the illness of cancer, and to their family and friends who have endured this

diagnosis with them.

6

TABLE OF CONTENTS

LIST OF FIGURES ........................................................................................................ 11

LIST OF TABLES .......................................................................................................... 14

ABSTRACT ..................................................................................................................... 15

CHAPTER 1: INTRODUCTION .................................................................................. 17

Classification of brain tumors ................................................................................. 17

Clinical description and pathology of brain tumors ...................................... 17

The brain tumor microenvironment ............................................................... 20

Molecular classification and genetics of malignant gliomas ......................... 23

Epidemiology of malignant gliomas ....................................................................... 29

Current treatment strategies for glioblastoma ......................................................... 35

Mechanisms of glioma cell invasion ....................................................................... 39

RhoGTPase signaling .................................................................................... 40

Characteristics and regulation of RhoGTPases .................................... 40

Deregulation of RhoGTPase signaling in brain tumors ....................... 44

TWEAK-Fn14 signaling in glioblastoma ...................................................... 46

Statement of the problem ........................................................................................ 49

Hypotheses and Specific Aims ................................................................................ 50

CHAPTER 2: PRESENT STUDY ................................................................................. 52

REFERENCES ................................................................................................................ 56

7

TABLE OF CONTENTS - Continued

APPENDIX A - CDC42 AND THE GUANINE NUCLEOTIDE EXCHANGE

FACTORS ECT2 AND TRIO MEDIATE FN14-INDUCED MIGRATION AND

INVASION OF GLIOBLASTOMA CELLS ............................................................... 78

Abstract ................................................................................................................... 78

Introduction ............................................................................................................. 79

Materials and Methods ............................................................................................ 81

Results ..................................................................................................................... 88

Ect2 binds to the Fn14 receptor and regulates TWEAK-stimulated Rac1

activation ........................................................................................................ 88

TWEAK regulation of Rac1 activation is dependent upon Cdc42 function . 88

Depletion of Cdc42 or Ect2 by siRNA suppresses TWEAK- or Fn14-induced

cell migration and invasion ............................................................................ 91

Trio activates Rac1 downstream of Fn14 ...................................................... 94

Depletion of Rac1, Cdc42, Ect2, or Trio by siRNA suppresses TWEAK-

induced lamellipodia formation ..................................................................... 97

Fn14 and Ect2 promote proliferation and migration of astrocytes in vivo .. 100

Discussion ............................................................................................................. 105

Acknowledgements ............................................................................................... 110

Grant Support ........................................................................................................ 110

References ............................................................................................................. 111

8


APPENDIX B - SGEF IS OVEREXPRESSED IN HIGH GRADE GLIOMAS

AND PROMOTES TWEAK-FN14-INDUCED CELL MIGRATION AND

INVASION VIA TRAF2 .............................................................................................. 117

Abstract ................................................................................................................. 117

Introduction ........................................................................................................... 118

Materials and Methods .......................................................................................... 120

Results ................................................................................................................... 127

SGEF is overexpressed in high-grade gliomas and expression correlates with

poor patient survival. ................................................................................... 127

SGEF is important for TWEAK-Fn14-induced cell migration and invasion.

..................................................................................................................... 128

SGEF activates RhoG downstream of the TWEAK-Fn14 signaling axis. .. 131

TWEAK-Fn14-stimulated activation of Rac1 is dependent upon SGEF and

RhoG function. ............................................................................................ 136

Depletion of SGEF and RhoG suppresses TWEAK-induced lamellipodia

formation. ..................................................................................................... 136

SGEF binding to the Fn14 cytoplasmic tail requires an intact TRAF domain.

..................................................................................................................... 139

TWEAK-Fn14 induced activation of SGEF and stimulation of migration is

dependent upon TRAF2. .............................................................................. 142

Discussion ............................................................................................................. 147

9



References ............................................................................................................. 155

APPENDIX C - SGEF EXPRESSION IS REGULATED VIA TWEAK-FN14

SIGNALING THROUGH NF-ΚB AND PROMOTES CELL SURVIVAL IN

GLIOBLASTOMA ....................................................................................................... 162

Abstract ................................................................................................................. 162

Introduction ........................................................................................................... 163

Materials and Methods .......................................................................................... 165

Results ................................................................................................................... 172

NF-κB displays increased occupancy of the SGEF promoter region in TMZ

resistant tumorgrafts and SGEF expression trends with TMZ resistance. ... 172

TWEAK-induced SGEF expression is dependent upon NF-kB activity. .... 173

Elevated SGEF expression in TMZ resistant tumorgrafts or following

TWEAK-Fn14 stimulation is dependent upon NF-κB function. ................. 176

Depletion of SGEF impairs colony formation following TMZ insult and

sensitizes cells to TMZ-mediated apoptosis. ............................................... 180

Discussion ............................................................................................................. 187


Grant Support ........................................................................................................ 200

References ............................................................................................................. 201

APPENDIX D - CONCLUDING STATEMENTS .................................................. 207

10


References ............................................................................................................. 223

APPENDIX E - PERMISSION TO USE COPYRIGHTED MATERIAL ........... 237

APPENDIX F - ABSTRACTS AND PUBLICATIONS ......................................... 240

11

LIST OF FIGURES

Figure 1.1. Regulation of Rho GTPases ........................................................................... 41

Figure A.1. Ect2 binds to Fn14 and regulates TWEAK-induced Rac1 activation and

glioma cell migration. ....................................................................................................... 89

Figure A.2. TWEAK stimulation of Rac1 activation is dependent upon Cdc42. ............. 92

Figure A.3. Cdc42 and Ect2 regulate TWEAK-induced glioma cell migration in vitro and

Fn14-induced invasion ex vivo.......................................................................................... 95

Figure A.4. Trio activates Rac1 upon TWEAK stimulation or Fn14 overexpression. ..... 98

Figure A.5. TWEAK-induced lamellipodia formation in glioma cells requires the

function of Rac1, Cdc42, Ect2 and Trio. ........................................................................ 101

Figure A.6. Proliferation and migration of RCAS-Fn14 and RCAS-Ect2-infected

astrocytic cells in vivo. .................................................................................................... 104

Figure A.7. Schematic model of TWEAK-Fn14 signaling via Cdc42 and Rac1 to drive

glioma migration/invasion. ............................................................................................. 108

Figure B.1. Expression profiling of SGEF in non-neoplastic brain and brain tumor

samples. ........................................................................................................................... 129

Figure B.2. SGEF expression is increased in the rim of GB tumor specimens and

knockdown of SGEF expression suppresses glioma cell migration and invasion. ......... 132

Figure B.3. TWEAK-Fn14 signaling activates SGEF and the SGEF dependent activation

of RhoG. .......................................................................................................................... 134

Figure B.4. TWEAK-Fn14 activation of Rac1 is dependent upon SGEF and RhoG. .... 137

12

LIST OF FIGURES - Continued

Figure B.5. TWEAK-induced lamellipodia formation in glioma cells requires the function

of SGEF and RhoG. ........................................................................................................ 140

Figure B.6. SGEF and Fn14 interaction is dependent upon a functional TRAF domain.

......................................................................................................................................... 143

Figure B.7. TWEAK-induced activation of SGEF and stimulation of migration require

TRAF2 function. ............................................................................................................. 145

Figure B.8. Schematic model of TWEAK-Fn14 signaling via SGEF and RhoG to drive

glioma migration/invasion. ............................................................................................. 151

Figure B.9. SGEF induces membrane ruffles and both co-localizes and co-

immunoprecipitates with Fn14. ...................................................................................... 152

Figure C.1. Differential binding of the NF-κB transcription factor in GB-14 and GB-14

TMZ resistant (TMZ-R) tumors and SGEF mRNA and protein levels across a panel of

primary parental versus TMZ-R tumorgrafts. ................................................................. 174

Figure C.2. SGEF mRNA expression is inducible via TWEAK cytokine stimulation and

NF-κB signaling. ............................................................................................................. 177

Figure C.3. NF-κB binds to the SGEF promoter region dependent upon TWEAK

stimulation....................................................................................................................... 179

Figure C.4. SGEF mRNA expression is dependent upon NF-κB signaling and positively

correlates with Fn14 mRNA expression. ........................................................................ 181

Figure C.5. Depletion of SGEF does not affect proliferation, but impairs colony

formation following TMZ insult. .................................................................................... 184

13

LIST OF FIGURES - Continued

Figure C.6. Depletion of SGEF expression sensitizes glioma cells to TMZ-induced

apoptosis. ........................................................................................................................ 186

Figure C.7. Schematic model of TWEAK-Fn14 signaling via NF- κB to regulate SGEF

expression and subsequent pro-survival phenotype. ....................................................... 189

Figure C.8. Increased migration rate of TMZ resistant primary GB cells. ..................... 190

Figure C.9. mRNA expression array analysis in SGEF depleted cells. .......................... 192

Figure C.10. TWEAK-Fn14 pro-survival signaling and the TMZ-induced formation of

DNA damage foci are independent of SGEF function. .................................................. 195

Figure C.11. TMZ induces nuclear SGEF activity and SGEF dependent BRCA1 activity.

......................................................................................................................................... 198

Figure D.1. TWEAK-Fn14 pro-survival and pro-invasive signaling in GB................... 214

14

LIST OF TABLES

Table C.1. Differential mRNA expression of survival and DNA repair associated genes in

SGEF depleted cells. ....................................................................................................... 193

Table D.1. Current signaling pathway points of intervention in GB clinical trials. ....... 219

15

ABSTRACT

Glioblastoma (GB) is the highest grade and most common form of primary adult

brain tumors, characterized by a highly invasive cell population. GB tumors develop

treatment resistance and ultimately recur; the median survival is nearly fifteen months

and importantly, the invading cell population is attributed with having a decreased

sensitivity to therapeutics. Thus, there remains a necessity to identify the genetic and

signaling mechanisms that promote tumor spread and therapeutic resistance in order to

develop new targeted treatment strategies to combat this rapidly progressive disease.

TWEAK-Fn14 ligand-receptor signaling is one mechanism in GB that promotes cell

invasiveness and survival, and is dependent upon the activity of multiple Rho GTPases

including Rac1. Here, we show that Cdc42 is essential in Fn14-mediated Rac1

activation. We identified two guanine nucleotide exchange factors (GEFs), Ect2 and

Trio, involved in the TWEAK-induced activation of Cdc42 and Rac1, respectively, as

well as in the subsequent TWEAK-Fn14 directed glioma cell migration and invasion. In

addition, we characterized the role of SGEF in promoting Fn14-induced Rac1 activation.

SGEF, a RhoG-specific GEF, is overexpressed in GB tumors and promotes TWEAK-

Fn14-mediated glioma invasion. Moreover, we characterized the correlation between

SGEF expression and TMZ resistance, and defined a role for SGEF in promoting the

survival of glioma cells. SGEF mRNA and protein expression are regulated by the

TWEAK-Fn14 signaling axis in an NF-κB dependent manner and inhibition of SGEF

expression sensitizes glioma cells to TMZ treatment. Lastly, gene expression analysis of

SGEF depleted GB cells revealed altered expression of a network of DNA repair and

16

survival genes. Thus TWEAK-Fn14 signaling through the GEF-Rho GTPase systems

which include the Ect2, Trio, and SGEF activation of Cdc42 and/or Rac1 presents a

pathway of attractive drug targets in glioma therapy, and SGEF signaling represents a

novel target in the setting of TMZ refractory, invasive GB cells.

17

CHAPTER 1: INTRODUCTION

Classification of brain tumors

Clinical description and pathology of brain tumors

The World Health Organization (WHO) designates tumors of the central nervous

system (CNS) based primarily on histological characteristics, with genetic profiles

serving as additional aids toward tumor definitions (1). These tumors are divided into

seven overarching categories related to tumor cell of origin, including the following:

tumors of neuroepithelial tissue, tumors of cranial and paraspinal nerves, tumors of the

meninges, tumors of the hematopoietic system, germ cell tumors, tumors of the sellar

region, and metastatic tumors. Within each tumor designation, treatment protocols are

designed based on the WHO grading scheme, where tumors are divided based on their

biologic behavior among one of four grades (grade I to grade IV). Neoplasms of a

different grade are given a distinct name; thus a tumor recurrence of increased

histological malignance receives a different name, but represents progression rather than

new disease. The clinical course of brain tumors is also uniquely influenced by their

location; histologically benign tumors located in a critical region or with an infiltrative

nature may not be entirely surgically resectable for risk of compromising neurologic

function, and can thus result in poor patient prognosis (2).

Brain tumors manifest clinically with either generalized or focal symptoms.

Among the generalized symptoms, headache is a common complaint, present in about

fifty percent of patients, and akin to a typical tension-type headache. However, unlike

18

true tension headaches, brain tumor headaches are worse with bending over or with other

maneuvers that raise intrathoracic pressure in thirty-two percent of patients, and forty

percent of patients also have nausea or vomiting. Furthermore, the physical exam may

include an abnormal neurologic examination or a change in prior headache pattern.

Depending on the location of the tumor, compression of the mass resulting in restriction

of cerebrospinal fluid outflow can lead to headaches caused by increased intracranial

pressure (ICP), and increased ICP can also lead to syncope in patients (3). Seizure is

another common presenting symptom in glioma patients. Primary brain tumors present

more often with seizures that metastatic brain lesions, and interestingly lower grade

gliomas are much more likely to present with seizures than higher grade tumors (4,5).

Lastly among the generalized symptoms, patients often have subtle cognitive

dysfunction, including memory problems or mood and personality changes. Focal

symptoms may include muscle weakness, sensory loss, aphasia, or visual spatial

dysfunction. In diagnosing brain tumors, gadolinium-enhanced magnetic resonance

imaging (MRI) is typically the only test needed for purposes of suggesting a brain tumor,

and can potentially even indicate tumor type (6).

Gliomas comprise the most common group of primary brain tumors and are of the

neuroepithelial designation, named for a glial cell origin (1). These tumors are typically

found in the cerebral hemispheres, but can however occur in the cerebellum, brainstem,

or spinal cord. Gliomas include astrocytomas, oligodendrogliomas, and ependymomas,

with infiltrating astrocytomas accounting for approximately eighty percent of adult

primary brain tumors. The grading spectrum of astrocytomas includes pilocytic

19

astrocytoma (grade I/IV), diffuse astrocytoma (grade II/IV), anaplastic astrocytoma

(grade III/IV), and glioblastoma (GB) (grade IV/IV). Glioblastoma represents clinically

the most malignant primary brain tumors, for which there is no cure. Gliosarcomas are a

subset of GB, comprising about two percent of all GB cases (2). Cytologically, tumors of

astrocytic origin are comprised of elongated or irregular cells that contain hyperchromatic

nuclei and eosinophilic, glial fibrillary acidic protein (GFAP) positive cytoplasm. The

increase in histologic grade relates to additional features to malignancy. Grade III tumors

are characterized by increased mitotic activity. GB retains this increased mitotic activity

and additionally the histopathological hallmarks of GB include pseudopalisading necrosis

and endothelial cell proliferation (1,2,7).

Glioblastoma tumors arise in two scenarios: in patients with new onset disease,

referred to as primary GB, and in patients with a previous history of lower grade

astrocytoma, referred to as secondary GB. The former group tends to be comprised of

older individuals, whereas those with secondary GBs more often present as younger

adults. Interestingly, gliomas rarely metastasize outside the CNS (2). However, within

the brain parenchyma, gliomas can be highly invasive. Furthermore, both lower grade as

well as high grade tumors display marked invasiveness, suggesting this malignant

phenotype may be acquired early in tumorigenesis (7). Gliomas preferentially invade

along white-matter tracts of the cerebrum, at times crossing the corpus callosum and

forming a butterfly lesion. Other patterns of cell spreading include perivascular growth,

subpial spread, or perineuronal satellitosis, which defines a migratory pattern of growth

around gray matter neurons (7).

20

In summary, brain tumors are primarily named according to their apparent

histological cell of origin, with distinctions made to account for increasing grade. Benign

tumors may present in areas of the brain where surgical resection presents a challenge to

maintain normal neurologic function, and can thus become more malignant in clinical

course. Brain tumors in general may present with either generalized or focal symptoms.

Glioblastoma represents the most common malignant primary brain tumor and is

characterized by heightened cell invasion, new vessel formation and remodeling and

pseudopalisading necrosis.

The brain tumor microenvironment

The brain tumor microenvironment is comprised of many cell types that work to

facilitate the characteristic heightened invasion capacity of glioma cells. While

classification of gliomas is based on naming the tumor for the differentiated cell type the

tumor cells most represent, there is no evidence that these neoplasms arise from mature

brain cells. Many studies have defined a cell of origin for malignant gliomas, which are

thought to arise from neural progenitor cells (8-10). Studies in animal models have

assessed the ability of Ras or Akt, two proteins involved in known deregulated signaling

pathways within high-grade gliomas, to form tumors following tissue specific gene

transfer. Genes encoding activated forms of Ras and Akt were expressed postnatally in

either differentiated astrocytes or neural progenitor cells. The study utilized a mouse

model that allowed for replication-competent ALV splice-acceptor (RCAS) viral vector-

mediated somatic transfer of selected oncogenes into a brain cell population genetically

21

engineered to express the tv-a viral receptors in mice. While neither Ras nor Akt alone

was sufficient to induce GB tumors, the combination of the two genes did produce

histologically high grade tumors, but only when the gene transfer occurred in neural

progenitor cells and not in differentiated astrocytes (10). These results corroborated the

current paradigm in the field that GB arises from neuronal progenitor cells. Furthermore,

evidence around the presence of a stem cell niche which is comprised of a perivascular

angiogenic region containing endothelial cells, pericytes, and astrocytes has mounted,

and includes crosstalk among the cell types (11). This niche is associated with elevated

Notch signaling, which has been shown to accelerate tumor progression (12-15).

However, the stage of differentiation (i.e. stem cells versus progenitor cells) is presently

unclear and remains controversial. The existence of these stem or progenitor cells is

clinically relevant, however, as therapies that do not eliminate this population would be

ineffective overall in treating the disease.

Surgically resected glioma tumor specimens contain not only cancer cells but a

large number of tumor-associated macrophages as well (11). While the brain normally

contains resident macrophages, named microglia, several studies have identified via cell

labeling that brain tumor-associated macrophages are not typical resident microglia, but

instead originated from peripheral circulating macrophages (16,17). These glioma-

associated microglia are distinct from pro-inflammatory macrophages and instead are

associated with tumor progression and the promotion of glioma cell migration (11).

Microglia have been shown to promote the migration of GL261 mouse glioma cells and

the depletion of microglia from brain slices reduced glioma cell invasion, providing

22

supportive evidence for the role of microglia in glioma progression (18,19). The

molecular mechanism of microglia in promoting glioma cell motility may involve the

degradation of extracellular matrix (ECM); microglia have been shown to produce

membrane Type 1 metalloprotease (MT1-MMP) in response to soluble factors from

glioma cells. In addition, other cell types in the brain tumor microenvironment including

fibroblasts and reactive astrocytes may contribute to glioma cell movement as they have

been shown to produce and/or activate matrix metalloproteinase MMP2 (20-22). Thus

heightened invasion of glioma cells may not be solely an intrinsic trait of cancer cells

alone, but a culminating phenotype from tumor cells and the surrounding

microenvironment.

Microglia are not the only immune cell type associated with glioma progression.

In glioma, one group has described a positive correlation between a marker for the

immunosuppressive regulatory T-cells (Tregs), FoxP3, and disease progression in

different grades of astrocytomas (23). Moreover, in mice with experimental brain

tumors, use of an antibody targeting lymphocyte marker CD25 both decreased the

number of Tregs, and the mice in the treatment arm lived longer than control animals

(24). Another study provided evidence that there was a large population of infiltrating

Tregs found in postoperative glioma tissue specimens (25). These studies indicated the

possibility of an immunosuppressive environment within glioma tumors that may

facilitate tumor progression.

In addition to immune cells promoting glioma cell invasion and progression, brain

tumors are also characterized by the presence of both angiogenesis and vasculogenesis,

23

the latter of which involves specifically de novo blood vessel formation from bone

marrow-derived endothelial progenitor cells (11). Rat GB cells have been described to

travel along blood vessels, and interact with endothelial cells. Apparently, GB cells

pause temporarily at vessel branch points to proliferate (26). Moreover, it has been

postulated that abnormal astrocyte-endothelial interactions in the brain tumor

microenvironment facilitate glioma disruption and remodeling of the blood brain barrier

leading to increased tumor cell invasion (27). Therefore, the interplay between glioma

cells and blood vessels in the brain are important in tumor spreading into brain

parenchyma. Thus, the brain tumor microenvironment is comprised of several cell types

that work in concert to facilitate tumor cell spread and progression.

Molecular classification and genetics of malignant gliomas

Malignant gliomas are characterized by a high degree of genetic heterogeneity.

Recent studies have highlighted the importance of molecular sub-classification of

gliomas. These efforts can provide a more effective means of patient stratification for

various therapy regimens that target the specific genetic vulnerabilities of each tumor.

One study compared gene expression profiling across twenty-one grade IV tumors

relative to the gene expression profiles of either nineteen grade I, five grade II, or six

non-neoplastic specimens. Notably among the differentially expressed genes that were

up-regulated in grade IV relative to either grade I, grade II or non-neoplastic tissues, were

genes involved in promoting cell motility, the cell cycle, and DNA repair, replication, or

maintenance (28). Lower grade astrocytomas are associated with at least three common

24

genetic alterations, including inactivation of a tumor suppressor gene, TP53, point

mutations of isocitrate dehydrogenase 1 (IDH1), and loss of chromosome 22q. The

specific genes associated with the 22q loss are yet to be determined (29). Grade II

astrocytomas harbored inactivating TP53 mutations in more than fifty percent of cases

(30). In addition, both low grade diffuse astrocytomas, and secondary glioblastomas that

developed through progression from lower grades displayed very high rates (eighty-eight

and eighty-two percent, respectively) of IDH1 gene mutations (31). Overall across

tumor grades, however, IDH1 mutations were much more common in lower grade tumors

and were relatively rare in grade IV GB (32). This suggests that these mutations are

associated more predominantly with tumors that originate as lower grade malignancies

which may progress over time, but are not as likely to occur in primary, or de novo, GB.

Studies from the Cancer Genome Atlas (TCGA) provided a detailed view of the

genomic changes in GB, in which ninety-one matched patient tumor-normal samples

were sequenced and tumor associated mutations were described. TCGA data indicated

that Grade IV glioblastoma shared TP53 pathway deregulation in common with the lower

grade lesions. However, mutations or homozygous deletions of the TP53 gene itself were

found in only thirty-five percent of GB cases, while additional alterations in this signaling

axis also occurred including homozygous deletion or mutation of CDKN2A (ARF) which

occurs in forty-nine percent of cases, and amplification of MDM2 or MDM4 which

occurs in fourteen or seven percent of cases, respectively. Thus the compounding

contribution of deregulated TP53 signaling occurs in fact in the vast majority (eighty-

seven percent) of grade IV tumors (33).

25

TCGA data on glioblastoma also indicates that in addition to altered TP53

signaling, two other key signaling pathways are deregulated in this malignancy:

specifically the RTK/Ras/PI3K and Rb axes. In fact, eighty-eighty percent of GB tumors

display altered signaling in RTK/Ras/PI3K pathways. Tumors contained EGFR

mutation/amplification (forty-five percent of tumors), ERBB2 mutation (eight percent of

tumors), PDGFRA or MET amplification (thirteen and four percent of tumors,

respectively), NF1 or PTEN mutation or homozygous deletion (eighteen and thirty-six

percent of tumors, respectively), RAS, PI3K, and FOXO mutations (two, fifteen, and one

percent of tumors, respectively), and AKT amplification (two percent of tumors).

Moreover, deregulated Rb signaling is documented in seventy-eight percent of GB

tumors. The genes involved include CDKN2A (p16/INK4A), CDKN2B, CDKN2C, or

RB1 homozygous deletion or mutation (fifty-two, forty-seven, two, and eleven percent of

tumors, respectively), and CDK4, CCND2, or CDK6 amplification (eighteen, two, and

one percent of tumors, respectively) (33).

Interestingly, tumors had a tendency to contain at least one aberrant gene from

each of the three pathways, but within each pathway there was a pattern of mutual

exclusivity among the deregulated genes. These reports substantiated former reports

where RB and CDKN2A alterations for example were found to rarely occur within the

same tumor (34). Moreover, animal models of glioma formation have also shown that

heightened malignancy occurs when more than one of these pathways becomes

deregulated. Mice engineered with the RCAS/tv-a system were subjected to postnatal

gene transfer of PDGF-B into either nestin-expressing neural progenitor cells or GFAP-

26

expressing astrocytes, and both populations resulted in the development of

oligodendroglioma or mixed oligoastrocytoma tumors. Interestingly, however, when

mice engineered to contain a null INK4A-ARF background were subjected to the same

viral mediated gene transfer, gliomagenesis occurred with both a shortened latency and

enhanced malignancy as compared to the wild-type background mice (35). Thus loss of

Ink4a-Arf promoted PDGF-induced gliomas toward a more malignant phenotype.

Follow up studies based on TCGA expression data have sub-classified GB

molecularly into four subtypes which include Classical, Mesenchymal, Proneural,and

Neural, among which a degree of prediction exists for response to therapy. In the

Classical subtype chromosome seven amplification along with chromosome ten loss is a

frequently occurring event seen in one-hundred percent of cases. While these events

occur in other subtypes as well, EGFR, which is found on chromosome seven, is found at

a high level of amplification with a corresponding increase in fold expression in ninety-

seven percent of this subtype, and is found infrequently in other subtypes. In addition,

over half of samples in the Classical designation contained a point or vIII EGFR

activating mutation (36). The EGFR vIII mutation is a gain of function in-frame deletion

of exons corresponding to the extracellular portion of the receptor protein (37). Also,

interestingly, EGFR alterations seen in the Classical subtype are typically mutually

exclusive of the TP53 mutations commonly seen in GB. In addition, the Classical

subtype contained frequent homozygous deletion of CDKN2A, as well as elevated

expression of the neural precursor and stem cell marker NES and several members of

each the Notch and Sonic hedgehog signaling pathways (36).

27

The Mesenchymal subtype is characterized largely by NF1 hemizygous deletion

or mutation. Also seen in this subtype are previously described mesenchymal markers

including CHI3L1 and MET, as well as genes in both the tumor necrosis factor

superfamily pathway and NF-κB pathway. The association of these latter genes with

inflammation was consistent with overall increased evidence of necrosis found in tumors

of this subtype (36). Proneural subtype tumors predominantly are classified by

alterations of PDGFRA and point mutations in IDH1, with TP53 mutations and loss of

heterozygosity also occurring as frequent events. Moreover, the Proneural signature

contains high gene expression of both oligodendrocytic development genes including

NKX2-2 and OLIG2 in addition to PDGRFA, and of proneural development genes

including SOX, DCX, DLL3, ASCL1, and TCF4. Interestingly, the few cases analyzed

that were secondary GBs primarily fell into the Proneural category, which was consistent

with the overall younger age found in this subtype. Lastly, the Neural subtype of GB is

characterized by the expression of neuron markers including NEFL, GABRA1, SYT1, and

SLC12A5 (36). A separate study that define GB tumors into Proneural, Proliferative, or

Mesenchymal subclasses also looked at grade III and lower grade gliomas, and found that

most of these tumors would classify as Proneural or Neural. Furthermore, within GB

samples, the Proneural subclass corresponds to tumors with a better prognosis as

compared to the other classes (38). Moreover, this study also interestingly found that

upon recurrence tumors tended to be aligned more with the Mesenchymal designation

(38).

28

GB tumors can also be classified on the basis of O6-methylguanine DNA

methyltransferase (MGMT) expression. MGMT is an enzyme involved in DNA repair

occurring after chemotherapy with alkylating agents. During tumor development and

progression, the promoter region of MGMT may be silenced via methylation, and thus

potentially enhancing the cytotoxic effect of chemotherapy such as temozolomide.

Several studies have correlated improved survival following chemotherapy in tumors

with MGMT promoter methylation, and MGMT promoter methylation has also served a

prognostic role as well (39,40). Furthermore, patients with methylation of the MGMT

promoter were shown to have longer time to initial relapse following radiation and

temozolomide treatment (41).

In summary, the implications of molecular classification within histologic brain

tumor types are far-reaching, and include diagnostic, therapeutic, and prognostic factors

which may impact overall clinical decisions in the management of patients with these

malignancies. It is possible that the subtypes of GB may arise from differing cells of

origin and may require different therapeutic strategies to target each tumor. Furthermore,

the correlation of subtype to prognosis implies that the differentially deregulated

signaling pathways which comprise each class hold both prognostic and directed

therapeutic potential. Moreover, analysis of the MGMT promoter for methylation status

serves as a valuable prognostic tool in assessing GB treatment response. Thus, future

clinical treatment decisions may involve MGMT promoter methylation profiling and the

specific targeting of GB subclasses.

29

Epidemiology of malignant gliomas

In 2010, it was estimated that over 138,054 people in the United States were

living with a malignant brain and CNS tumor. The overall incidence rate of gliomas is

6.03 per 100,000, but this statistic is higher in males than in females (7.16 versus 5.06 per

100,000). While the most commonly diagnosed brain and CNS lesion is a non-malignant

meningioma (greater than one-third of tumors), glioblastoma is both the second most

common brain and CNS tumor diagnosis, and the most commonly diagnosed malignant

tumor of the brain and CNS. In glioblastoma specifically, the overall incidence rate is

3.19 per 100,000, and these are 1.6 times more common in males. The reason for the

increased incidence seen in males is unknown, however some studies have pointed

toward a hormonal influence as a possible explanation. With respect to tumor location, in

decreasing frequency, the majority of gliomas arise in the frontal lobe, temporal lobe, or

parietal lobe of patients (42).

Worldwide, incidence rates for primary malignant brain and CNS tumors were

higher in more developed countries than in less developed countries, with males having

slightly elevated incidence compared to females (43). It is worth noting, however, that

while much of this difference may be accounted for by more complete reporting and

advanced diagnostic technology in the more developed countries, there are still some

notable exceptions. For example, the incidence of malignant brain tumors is twice as

high in Northern Europe as compared with Japan (44). This geographic discrepancy thus

may be dependent on divergent genetic and/or environmental factors between the two

regions.

30

Gliomas are most commonly diagnosed in older adults, with peak age of

diagnosis occurring between 65-84 years. Younger adults and children diagnosed with

GB have a slightly improved prognosis over older adults (44,45). Glioblastomas are two

to three times higher among whites as compared to black, American Indian/Alaskan

Native, and Asian Pacific Islander races. Approximately 24,170 new cases of malignant

brain and CNS tumors were estimated for 2012 (46), with an estimated 13,700 deaths

(47). The five year survival rate for GB is just under ten percent (48). Unfortunately,

prognosis for GB patients has not significantly changed over the past several decades

despite an increased molecular understanding of the tumor.

To date, there are few associated environmental risk factors for glioma. High-

dose radiation treatment has been definitively identified as a risk factor, and prior

chemotherapy treatment for tumors in other locations than the brain has been suggested

to contribute to glioma development (44). Prior radiation exposure is linked with glioma

development in a dose dependent manner, with higher doses associated with both an

increased risk and a shorter latency period (49). Furthermore, the treatment of childhood

leukemia and brain tumors with radiation is known to be linked to subsequent primary

CNS neoplasms, with subsequent gliomas specifically occurring at a median of nine

years from the original diagnosis (50). This study highlights the importance of increased

susceptibility of a developing brain to doses of irradiation. Moreover, recent evidence

suggests that even low doses of irradiation including dental x-rays are linked with the

development of brain tumors later in life. However this exposure is suggested to increase

31

specifically the risk of the typically benign type of brain tumor, the meningioma, and not

the more malignant gliomas and the research to date is merely correlative (51).

Many studies have tried to determine a link between occupation and glioma risk.

Several professions have been suggested to incur an increased risk for tumor

development, and include several white collar professions, electrical workers, oil refinery

workers, and agriculture workers, among others. One study using data from the Cancer-

Environment Registry in Sweden, which links cancer incidence for 1961-1970 with

census information on occupation found significantly elevated rates of intracranial

gliomas among male dentists, agricultural research workers, and public prosecutors, as

well as among female physicians and health care employees. This study also found a

significant link with blue collar workers in industries including metal cutters, glass,

porcelain, or ceramic workers, cellulose plant employees, brick and tile workers, and

those in the wool industry (52). Another study which analyzed data from primary brain

tumors diagnosed in Los Angeles County from 1972 to 1985 found that the numbers of

gliomas were overrepresented in workers from the aircraft industry, as well as in dentists

and electricians (53).

The risk of brain tumors attributed to exposure to electromagnetic fields including

microwave and radiofrequencies has been mixed. Several studies primarily linking death

certificate cause of death analysis to occupation have demonstrated a significant odds

ratio for the elevated risk of exposed individuals to brain tumor development, with some

indication that there was a dose relationship for tumor risk (54-56). Still many other

studies have not confirmed this link by showing no increased risk in electromagnetic field

32

exposure to incidence of brain tumors (57,58). In addition, many studies have tried to

determine whether the radiofrequency radiation exposure from cellular phones is tied to

brain tumor development. Currently, the WHO/International Agency for Research on

Cancer (IARC) lists radiofrequency electromagnetic fields as possibly carcinogenic to

humans (59).

Data on increased risk of brain tumors in oil refinery workers has been mixed;

while many studies have reported an increased risk, two meta-analyses concluded there

was no significant overall increased brain cancer mortality in these workers (60,61).

With respect to agricultural workers, specific studies have linked exposures to fungicides

and copper sulfate in Italian farmers, horticulturist practices in Sweden, and pesticide

exposure in Chinese farm women to a 1.3- to 3.6-fold increased risk of brain tumors (62-

64). To date, there is no clear consensus on which specific chemical(s) is responsible for

these findings.

More studies yet have looked at the relationship between prior head trauma and

brain tumor development. To date there is no evidence that patients with prior brain

trauma incur brain tumors at elevated rates. Of interest, it is important to note that these

studies have been confounded by both an increased exposure to radiation in patients with

head trauma as well as by recall bias, where patients with brain tumors may be more

likely to recall all episodes of head injury than controls (65).

One interesting observed relationship with brain tumors is the inverse correlation

of glioma incidence to allergies. A meta-analysis review taking into account 3,450

patients with gliomas concluded that any form of allergy correlated to a decreased

33

incidence of tumors (66). Furthermore, a prospective study confirmed that there was an

inverse relationship between the levels of serum IgE, a marker for allergic reactions, and

incidence of glioma; elevated total IgE was associated with a twenty-five percent

decreased risk (67). These findings are currently being explored by many laboratories.

Immune modulation via viral infection has also been investigated for a possible

connection to brain tumor formation. Studies have looked at the SV40 virus, as well as

herpesviruses including the chickenpox and varicella-zoster viruses, and the Epstein-Barr

virus (EBV), Cytomegalovirus (CMV), and herpes simplex virus (HSV). SV40 viral

particles have been isolated from many types of brain tumor tissue, however it was

unclear whether the infection contributed to transformation or whether development of a

brain tumor facilitated SV40 infection (68), but overall SV40 infection has not been

significantly associated with brain tumor development (69). A case-control study found

that brain tumor patients were less likely than controls to report a history of chickenpox

and have lower levels of IgG to varicella-zoster virus than controls, indicating a possible

protective role for infection with these viruses. However, there was no association found

between history of infection with the other three herpesviruses and adult glioma

formation (70).

Many studies have tried to investigate whether a link exists between diet, alcohol,

or tobacco use and glioma development. Intake of dietary N-nitroso compounds or meat

has largely shown no association with risk (71,72). The intake of antioxidants, fruits and

vegetables has been shown to be associated with a lower brain tumor risk for children

whose mothers had a dietary intake of these foods during pregnancy (73), but adult brain

34

tumor studies are limited. While more studies exist, two large prospective studies

indicated that the intake of fruits and vegetables is unlikely to reduce glioma risk (71,74).

As prospective studies these reports are less likely to contain recall and selection bias and

to date may represent the most accurate consensus on this topic. Studies to determine a

relationship between tobacco or alcohol use and glioma development have also yielded

inconsistent results. Since both tobacco and alcohol such as beer contain nitrosamines

there has been speculation that a link with brain tumor formation may exist, as

nitrosamines have been shown to be neuro-carcinogens in animal models (75). Overall,

an analysis of two prospective studies and one case-control study indicated that tobacco

use does not seem to be strongly linked with increased glioma risk, although there was

some support for a positive association, and alcohol use has no statistical association with

glioma development (76-78).

Lastly, genetic syndromes play a small role in predisposition to glioma formation.

Neurofibromatosis type 1, which is caused by germline mutation on chromosome 17

encoding for the NF1 gene which normally restricts cell proliferation by negatively

regulating Ras proteins as a GTPase activating protein, is associated with a small increase

in astrocytomas. However, these tumors tend to be low grade (79). The NF2 syndrome

predisposed individuals to brain tumors as well, however not specifically gliomas (80).

High grade gliomas have been reported to occur in patients diagnosed with hereditary

nonpolyposis colorectal cancer, which is characterized by germline mutations in DNA

mismatch repair genes, and also in patients with familial adenomatous polyposis,

characterized by mutation to the tumor suppressor APC gene involved in Wnt signaling

35

(81). These two associations of colonic polyposis with brain tumors are specifically

recognized as Turcot’s syndrome.

In summary, while brain tumors are relatively uncommon they are particularly

lethal, especially grade IV glioblastoma tumors. Glioma development is associated with

age, with males having a slightly increased incidence as compared with females.

Radiation exposure or chemotherapy treatment earlier in life can predispose an individual

to glioma formation, however low dose radiation such as dental x-rays predominantly

predisposes individuals to the more common and typically benign meningioma.

Occupational risk analysis presents mixed data on correlative incidence of gliomas to

workplace exposure, but includes a possible increased incidence for those exposed to

potential carcinogens or electromagnetic fields. Interestingly, however, there is a strong

inverse correlation between allergies and serum IgE levels with subsequent development

of gliomas, as well as with infection by certain types of herpesvirus family members that

may correlate with a protective role against brain tumor formation. Studies on diet or

tobacco use remain mixed or show no association with subsequent risk of glioma

development; however individuals with several underlying genetic syndromes are more

predisposed to brain tumor formation in life than non-affected individuals.

Current treatment strategies for glioblastoma

Typical patient presenting signs for astrocytomas include seizure, headaches, and

anatomic specific focal neurologic deficits (2). Upon presentation, a histologic diagnosis

is necessary for the treatment of patients with brain tumors, and this can be accomplished

36

during initial surgical resection or in cases where the lesion is not amenable to surgery,

via stereotactic biopsy. Following surgery, the current standard of care for patients with

GB is radiation therapy with concomitant treatment with the oral alkylating agent

temozolomide (48,82). Formerly, patients with GB were treated with the nitrosourea

carmustine, either alone or in combination regimens. While no randomized trial has

compared temozolomide versus a nitrosourea-based combination regimen given

concurrently with radiotherapy, these treatment modalities have been compared when

given at first tumor recurrence where initial treatment was with radiation alone. In this

setting there was no statistically significant difference in progression-free or overall

survival between the treatment arms (83), however temozolomide has easier patient

administration and better patient tolerance. While use of carmustine for initial therapy

systemically is no longer the standard of care, the use of locally inserted into brain

carmustine polymer wafers (Gliadel) as an adjunct to surgery for patients with malignant

gliomas is still practiced to some extent; patients receiving the wafers had a statistically

significant increase in median survival of approximately two months (84).

Due to the highly angiogenic nature of glioblastoma, the use of an anti-VEGF

antibody (bevacizumab) has been recently explored. Clinical studies have shown that

addition of bevacizumab to a standard of care radiation and temozolomide regimen for

newly diagnosed GB patients revealed impressive responses on imaging modalities and

increases in progression free survival, however treatment does not prevent tumor

recurrence or progression and overall survival remains unchanged (85,86). Moreover,

treatment with bevacizumab has been shown to induce more highly infiltrative and

37

therapy resistant tumors upon recurrence (87), a phenotype that has been linked to VEGF

inhibition leading to enhanced MET activity, and thus mesenchymal transformation, and

increased invasion in GB (88,89). A current phase II study is underway to investigate an

inhibitor of the tyrosine kinases MET, VEGFR2, and RET (Cabozantinib) in order to test

the hypothesis of inhibition of both angiogenesis and invasion in combinatorial fashion

(90).

In addition to the tyrosine kinases inhibited through Cabozantinib, several clinical

trials have examined the role of targeted therapy against other potential drivers of

malignant glioma as well as various biologic approaches. Thus far many other clinical

trials exploring such targeted therapy have had limited or modest success, including small

molecule inhibitors targeting EGFR, PDGFR, or integrins (91-96). However, it is

important to note that in all targeted therapies one main concern is the effect of the blood

brain barrier, defined by tight junctions and a lack of fenestrations, on drug delivery.

While there is increased permeability at the blood tumor barrier which is responsible for

the contrast enhancement seen of brain tumors on CT and MRI scans, this permeability

varies widely within the tumor and among patients (97-99). Furthermore, areas near the

edge of brain tumors appear to have a normal blood brain barrier which may contribute to

the failure of therapeutics to access and fully impact the tumor (97).

Biologic approaches to GB treatment include immune modulators and antitumor

vaccines. Treatment with the immune modulators interferon alpha and interferon beta

has been evaluated in phase I and phase II clinical studies. Interferon beta therapy

showed activity in patients with malignant gliomas, albeit with a narrow therapeutic

38

index (100,101), while treatment with interferon alpha was associated with treatment-

related toxicity and no significant improvement in overall survival (102). Additional

preliminary clinical studies are exploring the possibility of immune system stimulation

via anticancer vaccines using either tumor lysates to stimulate dendritic cells or an

autologous tumor cell virus-modified vaccine. Thus far studies have concluded use of

these techniques is safe and well tolerated, and there may be potential antitumor immune

response (103-105). Larger phase II and III trials will be needed to determine the success

of these strategies. One specific vaccination strategy makes use of targeting specifically

tumors expressing the EGFR variant seen in GB, EGFRvIII, via a peptide vaccine

directed against this EGFR deletion mutant. This vaccine, named rindopepimut, has

shown high efficacy pre-clinically, as well as significant increases in progression free and

overall survival in a phase II clinical trial (106), and thus this vaccine may be a promising

future therapeutic for patients with tumors harboring this mutation in GB.

Despite all these treatment strategies, nearly all patients relapse or progress

following initial therapy. Importantly, in a recurrent setting to date there have been no

randomized trials that directly compare therapeutic intervention versus supportive care,

thus quality of life must be taken into account when considering further treatments. Re-

intervention at the time of relapse may include repeat surgery for further debulking of the

tumor or symptom palliation. While no direct evidence indicates this approach is better

than with chemotherapy alone, a Karnofsky performance status of sixty or greater is

predictive of a longer survival benefit post reoperation (107,108). While re-irradiation is

not commonly feasible in recurrent disease due to toxicity from primary therapy, some

39

patients may benefit from focal radiation therapy (109). Despite the aforementioned

shortcomings, bevacizumab is one agent used in recurrent glioma, as well as repeat

treatment with temozolomide or with nitrosoureas, however often with limited success

(110-115). Lastly, if possible, patients are enrolled in clinical studies where applicable.

Mechanisms of glioma cell invasion

Glioma biology is marked by heightened cell invasion into normal brain

parenchyma. Cell invasion is promoted via deregulated signaling with the ECM,

including for example cell motility mediated via β1 integrin and N-cadherin activity as

well as increased ECM degradation via MMP overexpression. In addition, inhibition of

FAK signaling in gliomas reduced cell invasion (116). Furthermore, overexpression of

receptors such as MET or EGFR, as well as downstream signaling through PI3K and

MAPK pathways, and the Rho family of GTPases, have shown to promote glioma cell

motility among others (117). This increased invasive potential does not only arise in part

from overexpression or mutation of drivers of cell motility, or from interactions of glioma

cells with pro-migratory signals within the brain tumor microenvironment, but also

notably as a response to treatment. Radiation therapy has been shown to enhance the

invasive capacity of primary glioblastoma cells, driven by activation of the Rho signaling

pathway (118). The Rho family of small GTPases, including primarily Rac, RhoA,

Cdc42, and RhoG are key signaling mediators of GB cell invasion. Members of this

signaling family as well as their regulators and effectors represent novel molecular targets

against which therapeutic intervention could be aimed to combat this devastating disease.

40

RhoGTPase signaling

Characteristics and regulation of RhoGTPases

The Rho family of GTPases belongs to the Ras superfamily; they are small

monomeric proteins of low molecular weight. There are twenty known mammalian Rho

protein members, divided into ten subfamilies (119,120). Rho GTPases exist in either an

inactive GDP-bound state, or an active GTP-bound state during which the GTPase can

interact with downstream effectors. Switching between these conformations is mediated

by three classes of proteins. Guanine nucleotide exchange factors (GEFs) are responsible

for GTP loading and thus the switch to an active conformation of Rho GTPases, while

stimulation of Rho GTPase intrinsic GTP to GDP hydrolysis by GTPase activating

proteins (GAPs) facilitates Rho GTPase inactivation (121). Rho GTPases undergo post-

translational prenylation modifications which are attached to the carboxyl-terminal

cysteine residue. These modifications allow for interactions with and attachment at

phospholipid membranes where Rho GTPases can be activated and interact with

signaling complexes (122,123). A third category of Rho GTPase family regulators are

the guanine nucleotide dissociation inhibitors (Rho GDIs) which sequester Rho GTPases

in their inactive conformation in the cytosol, by shielding their hydrophobic tail (124). It

has largely been thought that Rho GTPase activity is regulated by nucleotide binding and

subcellular localization (125). More current studies have added the knowledge of Rho

GTPase regulation via ubiquitin-proteasome degradation (126), as well as the importance

of Rho GDIs in controlling the homeostasis of Rho proteins potentially by preventing

their misfolding and degradation (127) (Figure 1.1).

41

Figure 1.1. Regulation of Rho GTPases

Rho GTPase family members are active in their GTP-bound state, mediated by guanine

nucleotide exchange factor (GEF) loading of GTP. GTPase activating proteins (GAPs)

catalyze intrinsic Rho GTPase GTP to GDP hydrolysis, including the removal of

phosphate and the subsequent inactivation of the Rho GTPase. Guanine nucleotide

dissociation inhibitors (GDIs) sequester Rho GTPases in their inactive GDP-bound

conformation by shielding their hydrophobic tail. Membrane interaction and attachment

is important for Rho GTPase activation and the promotion of subsequent downstream

effector binding.

42

RhoA, Rac, and Cdc42 have been the first and most well described members of

the Rho family of GTPases. These three members have been described as key regulators

of cell migration, important in promoting the formation of stress fibers, induction of

lamellipodia, and filopodia protrusion (121). RhoA was first described to promote the

assembly of contractile actomyosin filaments, and Rac promoted the assembly of a

peripheral actin meshwork (128,129). In addition to inducing peripheral actin rich

microspikes, or filopodia, Cdc42 has been described to activate Rac, demonstrating the

existence of cross-talk within the Rho family of GTPases (121,130). Furthermore, RhoA

and Rac1 have been shown to mutually inhibit each other in some studies, while other

reports postulate a positive feedback between these two GTPases (131). Another Rho

GTPase family member, RhoG, has been shown to confer downstream activity to Rac1 to

enact cell movement, but also signals to promote the robust formation of Rac1

independent lamellipodia (132-135). Moreover, there has been documented cross-talk

between the Rho and Ras families of GTPases; activated Ras can strongly activate Rac

(128).

During the process of cell migration, initial reports led to the hypothesis that

actin-driven protrusions at the leading edge of cell motility were driven by Rac

activation, while actomyosin contractility at the cell body and rear were coordinated by

active Rho (136), with Cdc42 regulating cell polarity through interpreting extracellular

directional cues (137,138). Rac and Cdc42 share an overlapping set of downstream

effectors to enact cytoskeletal changes. Signaling via Pak and MAPK activation, or via

PI5K, Formin, or IQGAP leads to actin reorganization downstream of either Rac or

43

Cdc42. In addition, Cdc42 further signals via WASP and Rac further signals via WAVE

to enact cytoskeletal rearrangement (139). RhoG, which has been described to signal

both in concert with or in parallel to Rac1 and Cdc42 also shares downstream effectors

IQGAP2, MLK3, and PLD1 with Rac1 and Cdc42, but confers independent signaling as

well (135). RhoA signaling leads to phosphorylation of myosin light chain (MLC) and is

conferred by several downstream effectors including the serine/threonine kinase p160

ROCK (140,141). ROCK activity leads to increased MLC phosphorylation via the

inhibition of MLC phosphatase as well as direct MLC phosphorylation (140,142).

ROCK, together with the RhoA effector mDia, coordinates stress fiber formation (143).

While these signaling pathways have become well characterized, the

understanding of Rho GTPase regulation of cell movement has, however, become more

complex. Tumor cell motility has been characterized to occur not only in a mesenchymal

type pattern with a spindle like shape and an obvious leading cell edge, but also in an

amoeboid type fashion with cycles of expansion and contraction of the cell body,

potentially dependent upon the environment through which the cells move (144).

Moreover, biosensors capable of visualizing active Rho family members have implicated

that both Rho and Rac can be active at leading edge protrusions (145). Thus the

environmental regulation and spatiotemporal control of Rho GTPases are additional key

factor in the regulation of cytoskeletal dynamics.

The activity of Rho GTPases is tightly regulated. Activating GEFs contain a Dbl

homology (DH) domain which is the region responsible for catalyzing the exchange of

GDP for GTP (120). During nucleotide exchange, DH domain binding to the Rho

44

GTPase switch region induces conformational remodeling of the nucleotide-binding

pocket (146). Pleckstrin homology (PH) domains are C-terminal adjacent associated

regions to the DH domain that regulate GEF activity. PH domains bind

phosphoinositides which facilitates plasma membrane localization, although it has also

been suggested that other domains are necessary for directing subcellular localization as

well (120). Furthermore, there is some evidence that GEFs themselves may be

negatively regulated by sites in their N-terminus. The constitutive activation of many

Rho GEFs occurs under N-terminal truncations upstream of the DH domain (147); it has

been suggested that the N-terminal region may act to auto-inhibit the DH domain, the

control of which can be relieved by phosphorylation (120). The specific mechanisms of

signal activation of GEFs appear to be complex and still remain not fully characterized.

Deregulation of RhoGTPase signaling in brain tumors

Although altered expression levels and activity of Rho GTPases have been

described in various tumor types and despite widespread reports of activating Ras

mutations across a broad spectrum of cancers, up until recently no reports had ever

classified members of the Rho family as having mutations. Rac1 activating mutations are

newly described, however, and were discovered via exome sequencing in melanoma

tissue (148,149); although to date there have yet to be reports of these mutations in other

tumor types. In brain tumors, the levels of Rac1 protein directly correlate with tumor

grade in astocytomas. In GB in particular, but not in lower grade astrocytomas, Rac1

prominent plasma membrane staining is observed (150), and Rac1 promotes an invasive

45

tumor cell behavior (151). These observations support a role for Rac1 as constitutively

active in GBs, highlighting the importance of Rac1 in GB (150). Moreover, in gliomas,

Rac1 facilitation of glioma cell invasion occurs via signaling through synaptojanin 2

(152), fibroblast growth factor-inducible 14 and NF-κB (153) and Ephrin-B3 (154).

Rac1 has also been shown to regulate the formation of invadopodia, which are defined

formations of the plasma membrane that work in the capacity to promote degradation of

the extracellular matrix, an action which is critical in glioma cell invasion (155,156).

Interestingly, the Rac3 GTPase which has high homology to Rac1 has also been

described to play a role in GB cell invasion; the siRNA-mediated depletion of Rac3 led to

strong inhibition of GB cell invasion through Matrigel in vitro (155).

There have been multiple described mechanisms of Rac1 activation in

gliobalstoma. One such mechanism of Rac1 activation has been shown to be mediated

by the small Rho GTPase RhoG (133,134,157,158). RhoG protein levels are elevated in

GB (158), and RhoG has been reported to stimulate lamellipodia formation and confer

downstream activation of Rac1 with a subsequent increase in cell migration (132-

134,158). Also, the inhibition of Rho kinase led to activation of Rac1 in glioma cells and

the subsequent promotion of invasion (159). In addition, there are five Rac1 activating

GEFs, including Ect2, Vav3, Trio, SWAP-70 and Dock180-ELMO1, that have been

described to promote GB cell migration and invasion (150,157,160).

The role of GEFs in glioma may be in large part due to their expression patterns;

four of the GEFs described to promote GB cell motility, including Ect2, Vav3, Trio, and

SWAP-70, are overexpressed in GB versus non-neoplastic brain, and Dock180

46

expression is higher in the tumor rim than in the tumor core (150,160). These GEFs

have been shown via RNAi knockdown to be important in glioma cell migration and

invasion assessed via radial cell and organotypic brain slice models (150,160,161). The

Dock180 GEF has been shown to signal as a bipartite GEF in connection with ELMO1,

and the expression of ELMO1 has also been characterized to be elevated in a subset of

glioblastomas (38). Furthermore, the exogenous expression of ELMO1 and Dock180 in

glioma cells enhances their migratory and invasive capacities in vitro and in brain tissue

(157). Interestingly, Ect2 has been well described for its role in the nucleus to regulate

cytokinesis (162), however in gliomas, while low-grade astrocytomas show

predominantly nuclear Ect2 staining, GBs display prominent Ect2 staining in both the

cytoplasm and nucleus (150). Thus the role of some GEFs in brain tumors may be

unique as compared to their roles in normal tissue and dependent upon subcellular

localization. Roles for additional GTPases and GEFs have yet to be defined in glioma.

TWEAK-Fn14 signaling in glioblastoma1

Cytokines are membrane bound or soluble proteins released from cells that act

mechanistically via autocrine, paracrine, or endocrine signaling. These signals regulate

important biological activities including reproduction, growth, development,

homeostasis, injury response and repair, and inflammation (163). The tumor necrosis

1 Published in (2012). Rho GTPases and Their Activators, Guanine Nucleotide Exchange Factors (GEFs): Their Roles in Glioma Cell Invasion. In A. Fatatis (Ed.) Signaling Pathways and Molecular Mediators in Metastasis. (pp 143-169). Springer Science+Business Media B.V. Publishing. <http://www.springer.com/biomed/cancer/book/978-94-007-2557-7>. The original publication is available at www.springerlink.com.

47

factor (TNF) superfamily of ligands is a subgroup of cytokines heavily researched for

their role in many disease states, including human cancers and glioblastoma in particular.

The TNF cytokines are type II proteins that can exist in either a membrane

embedded or cleaved soluble form. The ligands can be active in either form, via

assembly as a noncovalent homotrimer (164). TNF receptor superfamily (TNFRSF)

members are known to have a scaffold of disulfide bridges that gives rise to the cysteine

rich domains required to be a family member. TNF receptors signal via protein-protein

interactions to promote either cell death or cell survival (165). Cytoplasmic domains may

contain TNF receptor associated factors (TRAFs) and death domains (DDs); the subset of

TNFRSF members which contain a DD are referred to as death receptors (164), and the

DD signals for cell death via caspase dependent signaling and activation of JUN kinase

pathways (165,166). TRAF mediated survival pathways have been associated with the

activation of NF-κB (166).

Of the TNF receptors characterized for their role in cancer progression,

TNFRSF12a, also known as Fibroblast Growth Factor-Inducible 14 or Fn14, is one

member of the TNF receptor superfamily that has been implicated in tumor progression

(167,168). Fn14 was first identified in murine cells as an immediate-early response gene

which encodes a cell surface localized type Ia transmembrane protein (169). Fn14 is the

smallest known TNF receptor family member and contains only one cysteine rich domain

in the extracellular region. The Fn14 cytoplasmic domain lacks a death domain but

contains TRAF binding sites specific for TRAFs 1, 2, 3, and 5 (167). Fn14 serves as a

cell surface receptor for the multifunctional cytokine tumor necrosis factor-like weak

48

inducer of apoptosis (TWEAK) (170). In humans, Fn14 mRNA are expressed at the

highest relative level in heart, placenta, and kidney, at an intermediate level in lung,

skeletal muscle and pancreas, and are relatively low in brain and liver tissue. Expression

of Fn14 was found to associate with liver regeneration and hepatocarcinogenesis (171),

and endothelial growth and migration (172). Fn14 expression is induced during nerve

regeneration and tissue injury, and in several types of human cancers including brain,

breast, cervical, esophageal, hepatocellular, and testicular carcinoma in situ (168). In

brain tumors, Fn14 expression level is elevated in advanced glial tumors and is also up-

regulated in migrating glioma cells in vitro (173) and in invading glioblastoma cells in

vivo (153).

Activation of Fn14 by TWEAK promotes glioma cell migration, invasion and

survival (153,173,174). Dysregulation of the actin cytoskeleton contributes to the

migratory phenotype of cancer cells, and promotes the invasion so descriptive of GB.

Rho GTPases are a family of molecular switches that regulate the actin cytoskeleton, cell

polarity, and microtubule dynamics (175). The TWEAK-Fn14 signaling axis mediates

glioma migration and invasion via the Rac1 GTPase, and fosters a self-promoting

feedback loop whereby Rac1 mediated TWEAK-Fn14 signaling induces Fn14 gene

expression via the NF-kB pathway (153). siRNA-mediated depletion of Rac1 expression

strongly suppresses TWEAK-induced glioma invasion and Fn14 mRNA transcript levels

(153), suggesting that the TWEAK-Fn14 signaling axis may be one of the key inputs to

Rac hyperactivation in GB and consequently the malignant invasive behavior of gliomas.

49

Statement of the problem

Glioblastoma (GB) is the most common form of primary adult brain tumors characterized

by a poorly defined tumor mass resulting from highly invasive cells. The problem of

resistance to the standard anti-proliferative treatment of concomitant radiotherapy with

chemotherapy using the alkylating agent temozolomide (TMZ) is common, particularly

in the invasive cell population with subsequent tumor recurrence and death. The role of

pro-invasive genes in GB progression remains understudied and the link between cell

invasion and therapeutic insensitivity remains poorly characterized. Importantly and

notably, therapy directed at mediators of invasion has been shown to increase

chemotherapeutic sensitivity (176,177). There is no clear consensus regarding the most

effective target(s) for the development of therapy targeting invading cells. The rationale

is therefore that understanding the signaling mechanisms that promote invasion and

survival pathways with subsequent resistance to therapy in GB can direct development of

adjuvant therapies aimed at increasing cytotoxic susceptibility and prolonging patient

survival.

Cell migration depends on the ability of a cell to continually reorganize its actin

cytoskeleton. Rho GTPases are a family of molecular switches that regulate the actin

cytoskeleton by cycling through an active GTP-bound state and an inactive GDP-bound

state (121,175,178). They are regulated by three classes of molecules including the

guanine nucleotide exchange factors, which are responsible for Rho GTPase activation.

The Rho GTPase family is comprised of twenty-two members who are ubiquitously

expressed among tissue types, however many members have been shown to be frequently

50

overexpressed at the protein level in many tumor types and in correlation with tumor

grade (179,180). There has been an increasing documented role for the Rac1 GTPase in

promoting glioma cell migration, invasion, and survival (150,151,155), and thus the study

of GEFs responsible for activating GTPases has become a prominent field of interest in

understanding the key players involved in the pathogenesis and progression of

infiltrative therapeutically insensitive GB cells.

Hypotheses and Specific Aims

The central hypothesis of this dissertation is that deregulated Rho GTPase

signaling enhances TWEAK-Fn14 mediated GB progression by promoting cell

invasion and resistance to therapy. This hypothesis was investigated through the three

following specific aims:

Aim 1: Determine the role of TWEAK-Fn14 signaling to activate Rac1 in glioma

migration and invasion. Hypothesis: TWEAK-Fn14 signaling regulates multiple GEF-

Rho GTPase complexes including Ect2, Cdc42, Trio and Rac1 to enable glioma cell

motility. Activation kinetics of the Cdc42 and Rac1 Rho GTPases were determined

following TWEAK-Fn14 stimulation. Analysis of GEF mediated GTP exchange was

characterized for each Rho GTPase to determine the roles of the Ect2 and Trio GEFs in

GB.

Aim 2: Determine the signaling mechanism(s) by which SGEF promotes TWEAK-

Fn14 induced GB invasion. Hypothesis: SGEF mediates TWEAK-Fn14 signaling via

RhoG activation to promote GB cell migration and invasion via TRAF2 recruitment and

51

Rac1 activation. SGEF protein regulation of RhoG activation downstream of TWEAK-

Fn14 signaling to promote GB invasion was characterized. Specifically, SGEF activity in

vitro and SGEF controlled kinetics of RhoG activation were determined, as well as Fn14

recruitment of TRAF2 for signaling through SGEF. Lastly, SGEF regulation of Rac1

activity was determined, as well as the subsequent effect of this signaling cascade on cell

motility.

Aim 3: Characterize the up-regulation of SGEF expression by TWEAK-Fn14

signaling and the role of SGEF to promote TMZ insensitivity in GB. Hypothesis:

TWEAK-Fn14 up-regulation of SGEF expression leads to SGEF promoted decreased

sensitivity to TMZ cytotoxic therapy. An analysis of the kinetics of SGEF mRNA and

protein expression following TWEAK stimulation was performed. The increased

susceptibility to TMZ treatment under depletion of SGEF was noted as well as

mechanistically characterized by assessing the role of DNA damage repair proteins in the

TMZ insensitivity phenotype.

52

CHAPTER 2: PRESENT STUDY

The details of this research are presented in the appended papers, which have been

published, submitted, or are in preparation for journal submission. This chapter details

the research summary.


brain tumors, characterized by a poorly defined and highly invasive cell population.

Treatment with surgical resection followed by concomitant radiation and chemotherapy

with the alkylating agent temozolomide (TMZ) is not curative and patients are faced with

a poor prognosis defined by a median survival of a mere fifteen months. GB tumors

become therapy resistant and ultimately recur, and importantly, the invading cell

population is attributed to having an intrinsic decreased sensitivity to radiation and

chemotherapy. Thus, it remains a necessity to identify the genetic and signaling

mechanisms that promote tumor invasion and therapy resistance, in order to develop new

targeted treatment strategies to combat this aggressive disease with little to no effective

treatment options once it recurs.

TWEAK-Fn14 ligand-receptor signaling is one of the mechanisms in GB that

promotes cell invasion and survival, and has been shown to be dependent upon the

activity of multiple Rho GTPases including Rac1. The molecular components of the

TWEAK-Fn14 signaling pathway have not been well understood. Here, we show that the

Rho GTPase Cdc42 is an essential signaling component in the TWEAK-Fn14 signaling

pathway that results in Rac1 activation. We first demonstrated that the TWEAK

treatment of glioma cells induced Cdc42 activity. Secondly, depletion of Cdc42

53

abolished TWEAK-induced Rac1 activation. Lastly, depletion of Cdc42 abrogated

TWEAK-induced glioma cell migration and invasion.

Furthermore, we identified two guanine nucleotide exchange factors (GEFs), Ect2

and Trio, that mediated the TWEAK-induced activation of Cdc42 and Rac1, respectively,

as well as promoted TWEAK-Fn14 directed glioma cell migration and invasion. The

depletion of Ect2 abrogated both TWEAK-induced Cdc42 and Rac1 activation, whereas

the depletion of Trio inhibited TWEAK-induced Rac1 activation but not TWEAK-

induced Cdc42 activation. We additionally demonstrated that ectopic expression of Fn14

or Ect2 in mouse astrocytes in vivo using an RCAS vector system for glial-specific gene

transfer in G-tva transgenic mice induced astrocyte migration within the brain,

corroborating the in vitro data of both Fn14 and Ect2 in GB invasion.

In addition, we characterized the role of another GEF, SGEF, in promoting Fn14-

induced Rac1 activation. We found that SGEF, a RhoG-specific GEF, was

overexpressed in GB tumors and promoted TWEAK-Fn14-mediated glioma invasion.

SGEF levels correlate with the invasive rim population of GB tumors analyzed via laser

capture micro-dissection, and upon TWEAK stimulation, both SGEF activity and the

SGEF-dependent activity of RhoG are increased. Moreover, we showed that TWEAK

binding to Fn14 led to the recruitment of SGEF to the Fn14 cytoplasmic tail via an

adaptor molecule TRAF2; either mutation in the Fn14-TRAF binding domain or

depletion of TRAF2 expression blocked SGEF recruitment to Fn14 and inhibited SGEF

activity. The knockdown of either SGEF or RhoG diminished TWEAK-induced

activation of Rac1 and lamellipodia formation, a ruffling extension of cell membranes

54

indicative of cell motility. Moreover, we found that SGEF mRNA and protein expression

are up-regulated by the TWEAK-Fn14 signaling axis in an NF-κB dependent manner.

Thus, we demonstrated the role of SGEF/RhoG in the TWEAK/Fn14 signal pathway that

leads to GB cell motility.

Consistent with SGEF playing a role in GB cell invasion, we found that the levels

of SGEF expression in GB tumors inversely correlated with patient survival.

Additionally, we correlated high SGEF expression with TMZ resistance in some primary

glioma cell lines and defined a role for SGEF in promoting the survival of glioma cells

treated with TMZ. Inhibition of SGEF expression via shRNA shutdown sensitized

glioma cells to apoptosis and impaired colony formation under TMZ treatment. Thus, it

appears that SGEF has a dual function in aggressive GB, one that promotes cell motility

and the other one that confers TMZ resistance. It is presently unclear whether the two

functions are mechanistically related. Lastly, gene expression analysis of SGEF depleted

GB cells revealed altered expression of a network of DNA repair and survival genes,

including the down-regulation of DCLRE1C, BRCA2, XIAP, ATM, ATR, and GEN1,

among others. These results additionally supported that SGEF promotes cell survival.

In summary, we present the novel findings that the TWEAK-Fn14 ligand-receptor

pair signals through the GEF-Rho GTPase system which includes the Ect2, Trio, and

SGEF GEFs that leads to the activation of Cdc42 and Rac1, thereby increasing cell

motility and invasion. Our study results present new components in the TWEAK-Fn14

pathway that play a role in aggressive GB, and thus may represent attractive drug targets

55

in glioma therapy. Additionally, SGEF signaling within the TWEAK-Fn14 pathway may

represent a novel target in TMZ refractory, invasive GB cells.

56

REFERENCES

1. Louis, D. N., Ohgaki, H., Wiestler, O. D., Cavenee, W. K., Burger, P. C., Jouvet, A., Scheithauer, B. W., and Kleihues, P. (2007) The 2007 WHO classification of tumours of the central nervous system. Acta Neuropathol 114, 97-109

2. Kumar, V., Abbas, A. K., Fausto, N., Robbins, S. L., Cotran, R. S., and MD Consult LLC. (2010) Robbins and Cotran pathologic basis of disease. in MD Consult e-books, 8th Ed., Elsevier Saunders, Philadelphia

3. Forsyth, P. A., and Posner, J. B. (1993) Headaches in patients with brain tumors: a study of 111 patients. Neurology 43, 1678-1683

4. Lote, K., Stenwig, A. E., Skullerud, K., and Hirschberg, H. (1998) Prevalence and prognostic significance of epilepsy in patients with gliomas. Eur J Cancer 34, 98-102

5. Pace, A., Bove, L., Innocenti, P., Pietrangeli, A., Carapella, C. M., Oppido, P., Raus, L., Occhipinti, E., and Jandolo, B. (1998) Epilepsy and gliomas: incidence and treatment in 119 patients. J Exp Clin Cancer Res 17, 479-482

6. Sathornsumetee, S., Rich, J. N., and Reardon, D. A. (2007) Diagnosis and treatment of high-grade astrocytoma. Neurol Clin 25, 1111-1139, x

7. Louis, D. N. (2006) Molecular pathology of malignant gliomas. Annu Rev Pathol 1, 97-117

8. Galli, R., Binda, E., Orfanelli, U., Cipelletti, B., Gritti, A., De Vitis, S., Fiocco, R., Foroni, C., Dimeco, F., and Vescovi, A. (2004) Isolation and characterization of tumorigenic, stem-like neural precursors from human glioblastoma. Cancer research 64, 7011-7021

9. Singh, S. K., Hawkins, C., Clarke, I. D., Squire, J. A., Bayani, J., Hide, T., Henkelman, R. M., Cusimano, M. D., and Dirks, P. B. (2004) Identification of human brain tumour initiating cells. Nature 432, 396-401

57

10. Holland, E. C., Celestino, J., Dai, C., Schaefer, L., Sawaya, R. E., and Fuller, G. N. (2000) Combined activation of Ras and Akt in neural progenitors induces glioblastoma formation in mice. Nat Genet 25, 55-57

11. Charles, N. A., Holland, E. C., Gilbertson, R., Glass, R., and Kettenmann, H. (2012) The brain tumor microenvironment. Glia 60, 502-514

12. Charles, N., Ozawa, T., Squatrito, M., Bleau, A. M., Brennan, C. W., Hambardzumyan, D., and Holland, E. C. (2010) Perivascular nitric oxide activates notch signaling and promotes stem-like character in PDGF-induced glioma cells. Cell Stem Cell 6, 141-152

13. Jeon, H. M., Jin, X., Lee, J. S., Oh, S. Y., Sohn, Y. W., Park, H. J., Joo, K. M., Park, W. Y., Nam, D. H., DePinho, R. A., Chin, L., and Kim, H. (2008) Inhibitor of differentiation 4 drives brain tumor-initiating cell genesis through cyclin E and notch signaling. Genes & development 22, 2028-2033

14. Shih, A. H., and Holland, E. C. (2006) Notch signaling enhances nestin expression in gliomas. Neoplasia 8, 1072-1082

15. Zhang, X. P., Zheng, G., Zou, L., Liu, H. L., Hou, L. H., Zhou, P., Yin, D. D., Zheng, Q. J., Liang, L., Zhang, S. Z., Feng, L., Yao, L. B., Yang, A. G., Han, H., and Chen, J. Y. (2008) Notch activation promotes cell proliferation and the formation of neural stem cell-like colonies in human glioma cells. Mol Cell Biochem 307, 101-108

16. Badie, B., and Schartner, J. M. (2000) Flow cytometric characterization of tumor-associated macrophages in experimental gliomas. Neurosurgery 46, 957-961; discussion 961-952

17. Parney, I. F., Waldron, J. S., and Parsa, A. T. (2009) Flow cytometry and in vitro analysis of human glioma-associated macrophages. Laboratory investigation. Journal of neurosurgery 110, 572-582

18. Bettinger, I., Thanos, S., and Paulus, W. (2002) Microglia promote glioma migration. Acta Neuropathol 103, 351-355

58

19. Markovic, D. S., Glass, R., Synowitz, M., Rooijen, N., and Kettenmann, H. (2005) Microglia stimulate the invasiveness of glioma cells by increasing the activity of metalloprotease-2. J Neuropathol Exp Neurol 64, 754-762

20. Le, D. M., Besson, A., Fogg, D. K., Choi, K. S., Waisman, D. M., Goodyer, C. G., Rewcastle, B., and Yong, V. W. (2003) Exploitation of astrocytes by glioma cells to facilitate invasiveness: a mechanism involving matrix metalloproteinase-2 and the urokinase-type plasminogen activator-plasmin cascade. The Journal of neuroscience : the official journal of the Society for Neuroscience 23, 4034-4043

21. Sameshima, T., Nabeshima, K., Toole, B. P., Yokogami, K., Okada, Y., Goya, T., Koono, M., and Wakisaka, S. (2000) Glioma cell extracellular matrix metalloproteinase inducer (EMMPRIN) (CD147) stimulates production of membrane-type matrix metalloproteinases and activated gelatinase A in co-cultures with brain-derived fibroblasts. Cancer letters 157, 177-184

22. Markovic, D. S., Vinnakota, K., Chirasani, S., Synowitz, M., Raguet, H., Stock, K., Sliwa, M., Lehmann, S., Kalin, R., van Rooijen, N., Holmbeck, K., Heppner, F. L., Kiwit, J., Matyash, V., Lehnardt, S., Kaminska, B., Glass, R., and Kettenmann, H. (2009) Gliomas induce and exploit microglial MT1-MMP expression for tumor expansion. Proceedings of the National Academy of Sciences of the United States of America 106, 12530-12535

23. El Andaloussi, A., and Lesniak, M. S. (2007) CD4+ CD25+ FoxP3+ T-cell infiltration and heme oxygenase-1 expression correlate with tumor grade in human gliomas. Journal of neuro-oncology 83, 145-152

24. El Andaloussi, A., Han, Y., and Lesniak, M. S. (2006) Prolongation of survival following depletion of CD4+CD25+ regulatory T cells in mice with experimental brain tumors. Journal of neurosurgery 105, 430-437

25. Hussain, S. F., Yang, D., Suki, D., Aldape, K., Grimm, E., and Heimberger, A. B. (2006) The role of human glioma-infiltrating microglia/macrophages in mediating antitumor immune responses. Neuro-oncology 8, 261-279

26. Farin, A., Suzuki, S. O., Weiker, M., Goldman, J. E., Bruce, J. N., and Canoll, P. (2006) Transplanted glioma cells migrate and proliferate on host brain vasculature: a dynamic analysis. Glia 53, 799-808

59

27. Lee, J., Lund-Smith, C., Borboa, A., Gonzalez, A. M., Baird, A., and Eliceiri, B. P. (2009) Glioma-induced remodeling of the neurovascular unit. Brain Res 1288, 125-134

28. Rickman, D. S., Bobek, M. P., Misek, D. E., Kuick, R., Blaivas, M., Kurnit, D. M., Taylor, J., and Hanash, S. M. (2001) Distinctive molecular profiles of high-grade and low-grade gliomas based on oligonucleotide microarray analysis. Cancer research 61, 6885-6891

29. Hartmann, C., Numann, A., Mueller, W., Holtkamp, N., Simon, M., and von Deimling, A. (2004) Fine mapping of chromosome 22q tumor suppressor gene candidate regions in astrocytoma. International journal of cancer. Journal international du cancer 108, 839-844

30. Okamoto, Y., Di Patre, P. L., Burkhard, C., Horstmann, S., Jourde, B., Fahey, M., Schuler, D., Probst-Hensch, N. M., Yasargil, M. G., Yonekawa, Y., Lutolf, U. M., Kleihues, P., and Ohgaki, H. (2004) Population-based study on incidence, survival rates, and genetic alterations of low-grade diffuse astrocytomas and oligodendrogliomas. Acta Neuropathol 108, 49-56

31. Watanabe, T., Nobusawa, S., Kleihues, P., and Ohgaki, H. (2009) IDH1 mutations are early events in the development of astrocytomas and oligodendrogliomas. The American journal of pathology 174, 1149-1153

32. Sanson, M., Marie, Y., Paris, S., Idbaih, A., Laffaire, J., Ducray, F., El Hallani, S., Boisselier, B., Mokhtari, K., Hoang-Xuan, K., and Delattre, J. Y. (2009) Isocitrate dehydrogenase 1 codon 132 mutation is an important prognostic biomarker in gliomas. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 27, 4150-4154

33. (2008) Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature 455, 1061-1068

34. Ueki, K., Ono, Y., Henson, J. W., Efird, J. T., von Deimling, A., and Louis, D. N. (1996) CDKN2/p16 or RB alterations occur in the majority of glioblastomas and are inversely correlated. Cancer research 56, 150-153

60

35. Dai, C., Celestino, J. C., Okada, Y., Louis, D. N., Fuller, G. N., and Holland, E. C. (2001) PDGF autocrine stimulation dedifferentiates cultured astrocytes and induces oligodendrogliomas and oligoastrocytomas from neural progenitors and astrocytes in vivo. Genes & development 15, 1913-1925

36. Verhaak, R. G., Hoadley, K. A., Purdom, E., Wang, V., Qi, Y., Wilkerson, M. D., Miller, C. R., Ding, L., Golub, T., Mesirov, J. P., Alexe, G., Lawrence, M., O'Kelly, M., Tamayo, P., Weir, B. A., Gabriel, S., Winckler, W., Gupta, S., Jakkula, L., Feiler, H. S., Hodgson, J. G., James, C. D., Sarkaria, J. N., Brennan, C., Kahn, A., Spellman, P. T., Wilson, R. K., Speed, T. P., Gray, J. W., Meyerson, M., Getz, G., Perou, C. M., and Hayes, D. N. (2010) Integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1. Cancer Cell 17, 98-110

37. Nishikawa, R., Ji, X. D., Harmon, R. C., Lazar, C. S., Gill, G. N., Cavenee, W. K., and Huang, H. J. (1994) A mutant epidermal growth factor receptor common in human glioma confers enhanced tumorigenicity. Proceedings of the National Academy of Sciences of the United States of America 91, 7727-7731

38. Phillips, H. S., Kharbanda, S., Chen, R., Forrest, W. F., Soriano, R. H., Wu, T. D., Misra, A., Nigro, J. M., Colman, H., Soroceanu, L., Williams, P. M., Modrusan, Z., Feuerstein, B. G., and Aldape, K. (2006) Molecular subclasses of high-grade glioma predict prognosis, delineate a pattern of disease progression, and resemble stages in neurogenesis. Cancer Cell 9, 157-173

39. Hegi, M. E., Diserens, A. C., Gorlia, T., Hamou, M. F., de Tribolet, N., Weller, M., Kros, J. M., Hainfellner, J. A., Mason, W., Mariani, L., Bromberg, J. E., Hau, P., Mirimanoff, R. O., Cairncross, J. G., Janzer, R. C., and Stupp, R. (2005) MGMT gene silencing and benefit from temozolomide in glioblastoma. N Engl J Med 352, 997-1003

40. Hermisson, M., Klumpp, A., Wick, W., Wischhusen, J., Nagel, G., Roos, W., Kaina, B., and Weller, M. (2006) O6-methylguanine DNA methyltransferase and p53 status predict temozolomide sensitivity in human malignant glioma cells. J Neurochem 96, 766-776

41. Brandes, A. A., Tosoni, A., Franceschi, E., Sotti, G., Frezza, G., Amista, P., Morandi, L., Spagnolli, F., and Ermani, M. (2009) Recurrence pattern after temozolomide concomitant with and adjuvant to radiotherapy in newly diagnosed

61

patients with glioblastoma: correlation With MGMT promoter methylation status. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 27, 1275-1279

42. McKinley, B. P., Michalek, A. M., Fenstermaker, R. A., and Plunkett, R. J. (2000) The impact of age and sex on the incidence of glial tumors in New York state from 1976 to 1995. Journal of neurosurgery 93, 932-939

43. Ferlay J, S. H., Bray F, Forman D, Mathers C and Parkin DM. GLOBOCAN 2008 v1.2, Cancer Incidence and Mortality Worldwide: IARC CancerBase No. 10 [Internet]. Lyon, France: International Agency for Research on Cancer; 2010. Available from: http://globocan.iarc.fr.

44. Schwartzbaum, J. A., Fisher, J. L., Aldape, K. D., and Wrensch, M. (2006) Epidemiology and molecular pathology of glioma. Nat Clin Pract Neurol 2, 494-503; quiz 491 p following 516

45. Porter, K. R., McCarthy, B. J., Freels, S., Kim, Y., and Davis, F. G. (2010) Prevalence estimates for primary brain tumors in the United States by age, gender, behavior, and histology. Neuro-oncology 12, 520-527

46. Dolecek, T. A., Propp, J. M., Stroup, N. E., and Kruchko, C. (2012) CBTRUS statistical report: primary brain and central nervous system tumors diagnosed in the United States in 2005-2009. Neuro-oncology 14 Suppl 5, v1-49

47. Siegel, R., Naishadham, D., and Jemal, A. (2012) Cancer statistics, 2012. CA Cancer J Clin 62, 10-29

48. Stupp, R., Hegi, M. E., Mason, W. P., van den Bent, M. J., Taphoorn, M. J., Janzer, R. C., Ludwin, S. K., Allgeier, A., Fisher, B., Belanger, K., Hau, P., Brandes, A. A., Gijtenbeek, J., Marosi, C., Vecht, C. J., Mokhtari, K., Wesseling, P., Villa, S., Eisenhauer, E., Gorlia, T., Weller, M., Lacombe, D., Cairncross, J. G., and Mirimanoff, R. O. (2009) Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol 10, 459-466

62

49. Braganza, M. Z., Kitahara, C. M., Berrington de Gonzalez, A., Inskip, P. D., Johnson, K. J., and Rajaraman, P. (2012) Ionizing radiation and the risk of brain and central nervous system tumors: a systematic review. Neuro-oncology 14, 1316-1324

50. Neglia, J. P., Robison, L. L., Stovall, M., Liu, Y., Packer, R. J., Hammond, S., Yasui, Y., Kasper, C. E., Mertens, A. C., Donaldson, S. S., Meadows, A. T., and Inskip, P. D. (2006) New primary neoplasms of the central nervous system in survivors of childhood cancer: a report from the Childhood Cancer Survivor Study. J Natl Cancer Inst 98, 1528-1537

51. Claus, E. B., Calvocoressi, L., Bondy, M. L., Schildkraut, J. M., Wiemels, J. L., and Wrensch, M. (2012) Dental x-rays and risk of meningioma. Cancer 118, 4530-4537

52. McLaughlin, J. K., Malker, H. S., Blot, W. J., Malker, B. K., Stone, B. J., Weiner, J. A., Ericsson, J. L., and Fraumeni, J. F., Jr. (1987) Occupational risks for intracranial gliomas in Sweden. J Natl Cancer Inst 78, 253-257

53. Preston-Martin, S. (1989) Descriptive epidemiology of primary tumors of the brain, cranial nerves and cranial meninges in Los Angeles County. Neuroepidemiology 8, 283-295

54. Lin, R. S., Dischinger, P. C., Conde, J., and Farrell, K. P. (1985) Occupational exposure to electromagnetic fields and the occurrence of brain tumors. An analysis of possible associations. J Occup Med 27, 413-419

55. Loomis, D. P., and Savitz, D. A. (1990) Mortality from brain cancer and leukaemia among electrical workers. Br J Ind Med 47, 633-638

56. Savitz, D. A., and Loomis, D. P. (1995) Magnetic field exposure in relation to leukemia and brain cancer mortality among electric utility workers. Am J Epidemiol 141, 123-134

57. Sahl, J. D., Kelsh, M. A., and Greenland, S. (1993) Cohort and nested case-control studies of hematopoietic cancers and brain cancer among electric utility workers. Epidemiology 4, 104-114

63

58. Guenel, P., Raskmark, P., Andersen, J. B., and Lynge, E. (1993) Incidence of cancer in persons with occupational exposure to electromagnetic fields in Denmark. Br J Ind Med 50, 758-764

59. IARC monographs on the evaluation of carcinogenic risks to humans, I., Lyon Vol 102. http://www.iarc.fr/en/media-centre/pr/2011/pdfs/pr208_E.pdf.

60. Wong, O., and Raabe, G. K. (1989) Critical review of cancer epidemiology in petroleum industry employees, with a quantitative meta-analysis by cancer site. Am J Ind Med 15, 283-310

61. Wong, O., and Raabe, G. K. (2000) A critical review of cancer epidemiology in the petroleum industry, with a meta-analysis of a combined database of more than 350,000 workers. Regulatory toxicology and pharmacology : RTP 32, 78-98

62. Musicco, M., Sant, M., Molinari, S., Filippini, G., Gatta, G., and Berrino, F. (1988) A case-control study of brain gliomas and occupational exposure to chemical carcinogens: the risk to farmers. Am J Epidemiol 128, 778-785

63. Littorin, M., Attewell, R., Skerfving, S., Horstmann, V., and Moller, T. (1993) Mortality and tumour morbidity among Swedish market gardeners and orchardists. Int Arch Occup Environ Health 65, 163-169

64. Heineman, E. F., Gao, Y. T., Dosemeci, M., and McLaughlin, J. K. (1995) Occupational risk factors for brain tumors among women in Shanghai, China. J Occup Environ Med 37, 288-293

65. Wrensch, M., Miike, R., Lee, M., and Neuhaus, J. (2000) Are prior head injuries or diagnostic X-rays associated with glioma in adults? The effects of control selection bias. Neuroepidemiology 19, 234-244

66. Linos, E., Raine, T., Alonso, A., and Michaud, D. (2007) Atopy and risk of brain tumors: a meta-analysis. J Natl Cancer Inst 99, 1544-1550

67. Schwartzbaum, J., Ding, B., Johannesen, T. B., Osnes, L. T., Karavodin, L., Ahlbom, A., Feychting, M., and Grimsrud, T. K. (2012) Association between prediagnostic IgE levels and risk of glioma. J Natl Cancer Inst 104, 1251-1259

64

68. Huang, H., Reis, R., Yonekawa, Y., Lopes, J. M., Kleihues, P., and Ohgaki, H. (1999) Identification in human brain tumors of DNA sequences specific for SV40 large T antigen. Brain Pathol 9, 33-42

69. Strickler, H. D., Rosenberg, P. S., Devesa, S. S., Hertel, J., Fraumeni, J. F., Jr., and Goedert, J. J. (1998) Contamination of poliovirus vaccines with simian virus 40 (1955-1963) and subsequent cancer rates. Jama 279, 292-295

70. Wrensch, M., Weinberg, A., Wiencke, J., Miike, R., Sison, J., Wiemels, J., Barger, G., DeLorenze, G., Aldape, K., and Kelsey, K. (2005) History of chickenpox and shingles and prevalence of antibodies to varicella-zoster virus and three other herpesviruses among adults with glioma and controls. Am J Epidemiol 161, 929-938

71. Dubrow, R., Darefsky, A. S., Park, Y., Mayne, S. T., Moore, S. C., Kilfoy, B., Cross, A. J., Sinha, R., Hollenbeck, A. R., Schatzkin, A., and Ward, M. H. (2010) Dietary components related to N-nitroso compound formation: a prospective study of adult glioma. Cancer Epidemiol Biomarkers Prev 19, 1709-1722

72. Michaud, D. S., Holick, C. N., Batchelor, T. T., Giovannucci, E., and Hunter, D. J. (2009) Prospective study of meat intake and dietary nitrates, nitrites, and nitrosamines and risk of adult glioma. Am J Clin Nutr 90, 570-577

73. Pogoda, J. M., Preston-Martin, S., Howe, G., Lubin, F., Mueller, B. A., Holly, E. A., Filippini, G., Peris-Bonet, R., McCredie, M. R., Cordier, S., and Choi, W. (2009) An international case-control study of maternal diet during pregnancy and childhood brain tumor risk: a histology-specific analysis by food group. Ann Epidemiol 19, 148-160

74. Holick, C. N., Giovannucci, E. L., Rosner, B., Stampfer, M. J., and Michaud, D. S. (2007) Prospective study of intake of fruit, vegetables, and carotenoids and the risk of adult glioma. Am J Clin Nutr 85, 877-886

75. Hecht, S. S., Chen, C. B., Ohmori, T., and Hoffmann, D. (1980) Comparative carcinogenicity in F344 rats of the tobacco-specific nitrosamines, N'-nitrosonornicotine and 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone. Cancer research 40, 298-302

65

76. Silvera, S. A., Miller, A. B., and Rohan, T. E. (2006) Cigarette smoking and risk of glioma: a prospective cohort study. International journal of cancer. Journal international du cancer 118, 1848-1851

77. Holick, C. N., Giovannucci, E. L., Rosner, B., Stampfer, M. J., and Michaud, D. S. (2007) Prospective study of cigarette smoking and adult glioma: dosage, duration, and latency. Neuro-oncology 9, 326-334

78. Hurley, S. F., McNeil, J. J., Donnan, G. A., Forbes, A., Salzberg, M., and Giles, G. G. (1996) Tobacco smoking and alcohol consumption as risk factors for glioma: a case-control study in Melbourne, Australia. J Epidemiol Community Health 50, 442-446

79. Gutmann, D. H., James, C. D., Poyhonen, M., Louis, D. N., Ferner, R., Guha, A., Hariharan, S., Viskochil, D., and Perry, A. (2003) Molecular analysis of astrocytomas presenting after age 10 in individuals with NF1. Neurology 61, 1397-1400

80. Goutagny, S., and Kalamarides, M. (2010) Meningiomas and neurofibromatosis. Journal of neuro-oncology 99, 341-347

81. Hamilton, S. R., Liu, B., Parsons, R. E., Papadopoulos, N., Jen, J., Powell, S. M., Krush, A. J., Berk, T., Cohen, Z., Tetu, B., and et al. (1995) The molecular basis of Turcot's syndrome. The New England journal of medicine 332, 839-847

82. Stupp, R., Mason, W. P., van den Bent, M. J., Weller, M., Fisher, B., Taphoorn, M. J., Belanger, K., Brandes, A. A., Marosi, C., Bogdahn, U., Curschmann, J., Janzer, R. C., Ludwin, S. K., Gorlia, T., Allgeier, A., Lacombe, D., Cairncross, J. G., Eisenhauer, E., and Mirimanoff, R. O. (2005) Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma. N Engl J Med 352, 987-996

83. Brada, M., Stenning, S., Gabe, R., Thompson, L. C., Levy, D., Rampling, R., Erridge, S., Saran, F., Gattamaneni, R., Hopkins, K., Beall, S., Collins, V. P., and Lee, S. M. (2010) Temozolomide versus procarbazine, lomustine, and vincristine in recurrent high-grade glioma. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 28, 4601-4608

66

84. Westphal, M., Hilt, D. C., Bortey, E., Delavault, P., Olivares, R., Warnke, P. C., Whittle, I. R., Jaaskelainen, J., and Ram, Z. (2003) A phase 3 trial of local chemotherapy with biodegradable carmustine (BCNU) wafers (Gliadel wafers) in patients with primary malignant glioma. Neuro-oncology 5, 79-88

85. Lai, A., Tran, A., Nghiemphu, P. L., Pope, W. B., Solis, O. E., Selch, M., Filka, E., Yong, W. H., Mischel, P. S., Liau, L. M., Phuphanich, S., Black, K., Peak, S., Green, R. M., Spier, C. E., Kolevska, T., Polikoff, J., Fehrenbacher, L., Elashoff, R., and Cloughesy, T. (2011) Phase II study of bevacizumab plus temozolomide during and after radiation therapy for patients with newly diagnosed glioblastoma multiforme. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 29, 142-148

86. Moustakas, A., and Kreisl, T. N. (2010) New treatment options in the management of glioblastoma multiforme: a focus on bevacizumab. Onco Targets Ther 3, 27-38

87. de Groot, J. F., Fuller, G., Kumar, A. J., Piao, Y., Eterovic, K., Ji, Y., and Conrad, C. A. (2010) Tumor invasion after treatment of glioblastoma with bevacizumab: radiographic and pathologic correlation in humans and mice. Neuro-oncology 12, 233-242

88. Jahangiri, A., De Lay, M., Miller, L. M., Carbonell, W. S., Hu, Y. L., Lu, K., Tom, M. W., Paquette, J., Tokuyasu, T. A., Tsao, S., Marshall, R., Perry, A., Bjorgan, K. M., Chaumeil, M. M., Ronen, S. M., Bergers, G., and Aghi, M. K. (2013) Gene expression profile identifies tyrosine kinase c-Met as a targetable mediator of anti-angiogenic therapy resistance. Clin Cancer Res

89. Lu, K. V., Chang, J. P., Parachoniak, C. A., Pandika, M. M., Aghi, M. K., Meyronet, D., Isachenko, N., Fouse, S. D., Phillips, J. J., Cheresh, D. A., Park, M., and Bergers, G. (2012) VEGF inhibits tumor cell invasion and mesenchymal transition through a MET/VEGFR2 complex. Cancer Cell 22, 21-35

90. Clinical Trial (http://clinicaltrials.gov) Identifier: NCT00960492.

91. Brown, P. D., Krishnan, S., Sarkaria, J. N., Wu, W., Jaeckle, K. A., Uhm, J. H., Geoffroy, F. J., Arusell, R., Kitange, G., Jenkins, R. B., Kugler, J. W., Morton, R. F., Rowland, K. M., Jr., Mischel, P., Yong, W. H., Scheithauer, B. W., Schiff, D., Giannini, C., and Buckner, J. C. (2008) Phase I/II trial of erlotinib and

67

temozolomide with radiation therapy in the treatment of newly diagnosed glioblastoma multiforme: North Central Cancer Treatment Group Study N0177. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 26, 5603-5609

92. van den Bent, M. J., Brandes, A. A., Rampling, R., Kouwenhoven, M. C., Kros, J. M., Carpentier, A. F., Clement, P. M., Frenay, M., Campone, M., Baurain, J. F., Armand, J. P., Taphoorn, M. J., Tosoni, A., Kletzl, H., Klughammer, B., Lacombe, D., and Gorlia, T. (2009) Randomized phase II trial of erlotinib versus temozolomide or carmustine in recurrent glioblastoma: EORTC brain tumor group study 26034. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 27, 1268-1274

93. Wen, P. Y., Yung, W. K., Lamborn, K. R., Dahia, P. L., Wang, Y., Peng, B., Abrey, L. E., Raizer, J., Cloughesy, T. F., Fink, K., Gilbert, M., Chang, S., Junck, L., Schiff, D., Lieberman, F., Fine, H. A., Mehta, M., Robins, H. I., DeAngelis, L. M., Groves, M. D., Puduvalli, V. K., Levin, V., Conrad, C., Maher, E. A., Aldape, K., Hayes, M., Letvak, L., Egorin, M. J., Capdeville, R., Kaplan, R., Murgo, A. J., Stiles, C., and Prados, M. D. (2006) Phase I/II study of imatinib mesylate for recurrent malignant gliomas: North American Brain Tumor Consortium Study 99-08. Clin Cancer Res 12, 4899-4907

94. Raymond, E., Brandes, A. A., Dittrich, C., Fumoleau, P., Coudert, B., Clement, P. M., Frenay, M., Rampling, R., Stupp, R., Kros, J. M., Heinrich, M. C., Gorlia, T., Lacombe, D., and van den Bent, M. J. (2008) Phase II study of imatinib in patients with recurrent gliomas of various histologies: a European Organisation for Research and Treatment of Cancer Brain Tumor Group Study. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 26, 4659-4665

95. Reardon, D. A., Fink, K. L., Mikkelsen, T., Cloughesy, T. F., O'Neill, A., Plotkin, S., Glantz, M., Ravin, P., Raizer, J. J., Rich, K. M., Schiff, D., Shapiro, W. R., Burdette-Radoux, S., Dropcho, E. J., Wittemer, S. M., Nippgen, J., Picard, M., and Nabors, L. B. (2008) Randomized phase II study of cilengitide, an integrin-targeting arginine-glycine-aspartic acid peptide, in recurrent glioblastoma multiforme. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 26, 5610-5617

96. Stupp, R., Hegi, M. E., Neyns, B., Goldbrunner, R., Schlegel, U., Clement, P. M., Grabenbauer, G. G., Ochsenbein, A. F., Simon, M., Dietrich, P. Y., Pietsch, T.,

68

Hicking, C., Tonn, J. C., Diserens, A. C., Pica, A., Hermisson, M., Krueger, S., Picard, M., and Weller, M. (2010) Phase I/IIa study of cilengitide and temozolomide with concomitant radiotherapy followed by cilengitide and temozolomide maintenance therapy in patients with newly diagnosed glioblastoma. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 28, 2712-2718

97. Hochberg, F. H., and Pruitt, A. (1980) Assumptions in the radiotherapy of glioblastoma. Neurology 30, 907-911

98. Blasberg, R. G., and Groothuis, D. R. (1986) Chemotherapy of brain tumors: physiological and pharmacokinetic considerations. Semin Oncol 13, 70-82

99. Chamberlain, M. C., Murovic, J. A., and Levin, V. A. (1988) Absence of contrast enhancement on CT brain scans of patients with supratentorial malignant gliomas. Neurology 38, 1371-1374

100. Fine, H. A., Wen, P. Y., Robertson, M., O'Neill, A., Kowal, J., Loeffler, J. S., and Black, P. M. (1997) A phase I trial of a new recombinant human beta-interferon (BG9015) for the treatment of patients with recurrent gliomas. Clin Cancer Res 3, 381-387

101. Colman, H., Berkey, B. A., Maor, M. H., Groves, M. D., Schultz, C. J., Vermeulen, S., Nelson, D. F., Mehta, M. P., and Yung, W. K. (2006) Phase II Radiation Therapy Oncology Group trial of conventional radiation therapy followed by treatment with recombinant interferon-beta for supratentorial glioblastoma: results of RTOG 9710. Int J Radiat Oncol Biol Phys 66, 818-824

102. Buckner, J. C., Schomberg, P. J., McGinnis, W. L., Cascino, T. L., Scheithauer, B. W., O'Fallon, J. R., Morton, R. F., Kuross, S. A., Mailliard, J. A., Hatfield, A. K., Cole, J. T., Steen, P. D., and Bernath, A. M. (2001) A phase III study of radiation therapy plus carmustine with or without recombinant interferon-alpha in the treatment of patients with newly diagnosed high-grade glioma. Cancer 92, 420-433

103. De Vleeschouwer, S., Fieuws, S., Rutkowski, S., Van Calenbergh, F., Van Loon, J., Goffin, J., Sciot, R., Wilms, G., Demaerel, P., Warmuth-Metz, M., Soerensen, N., Wolff, J. E., Wagner, S., Kaempgen, E., and Van Gool, S. W. (2008)

69

Postoperative adjuvant dendritic cell-based immunotherapy in patients with relapsed glioblastoma multiforme. Clin Cancer Res 14, 3098-3104

104. Schneider, T., Gerhards, R., Kirches, E., and Firsching, R. (2001) Preliminary results of active specific immunization with modified tumor cell vaccine in glioblastoma multiforme. Journal of neuro-oncology 53, 39-46

105. Steiner, H. H., Bonsanto, M. M., Beckhove, P., Brysch, M., Geletneky, K., Ahmadi, R., Schuele-Freyer, R., Kremer, P., Ranaie, G., Matejic, D., Bauer, H., Kiessling, M., Kunze, S., Schirrmacher, V., and Herold-Mende, C. (2004) Antitumor vaccination of patients with glioblastoma multiforme: a pilot study to assess feasibility, safety, and clinical benefit. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 22, 4272-4281

106. Del Vecchio, C. A., Li, G., and Wong, A. J. (2012) Targeting EGF receptor variant III: tumor-specific peptide vaccination for malignant gliomas. Expert Rev Vaccines 11, 133-144

107. Landy, H. J., Feun, L., Schwade, J. G., Snodgrass, S., Lu, Y., and Gutman, F. (1994) Retreatment of intracranial gliomas. South Med J 87, 211-214

108. Young, B., Oldfield, E. H., Markesbery, W. R., Haack, D., Tibbs, P. A., McCombs, P., Chin, H. W., Maruyama, Y., and Meacham, W. F. (1981) Reoperation for glioblastoma. Journal of neurosurgery 55, 917-921

109. Nieder, C., Astner, S. T., Mehta, M. P., Grosu, A. L., and Molls, M. (2008) Improvement, clinical course, and quality of life after palliative radiotherapy for recurrent glioblastoma. Am J Clin Oncol 31, 300-305

110. Brandes, A. A., Tosoni, A., Amista, P., Nicolardi, L., Grosso, D., Berti, F., and Ermani, M. (2004) How effective is BCNU in recurrent glioblastoma in the modern era? A phase II trial. Neurology 63, 1281-1284

111. Schmidt, F., Fischer, J., Herrlinger, U., Dietz, K., Dichgans, J., and Weller, M. (2006) PCV chemotherapy for recurrent glioblastoma. Neurology 66, 587-589

70

112. Omuro, A., Chan, T. A., Abrey, L. E., Khasraw, M., Reiner, A. S., Kaley, T. J., Deangelis, L. M., Lassman, A. B., Nolan, C. P., Gavrilovic, I. T., Hormigo, A., Salvant, C., Heguy, A., Kaufman, A., Huse, J. T., Panageas, K. S., Hottinger, A. F., and Mellinghoff, I. (2013) Phase II trial of continuous low-dose temozolomide for patients with recurrent malignant glioma. Neuro-oncology 15, 242-250

113. Perry, J. R., Belanger, K., Mason, W. P., Fulton, D., Kavan, P., Easaw, J., Shields, C., Kirby, S., Macdonald, D. R., Eisenstat, D. D., Thiessen, B., Forsyth, P., and Pouliot, J. F. (2010) Phase II trial of continuous dose-intense temozolomide in recurrent malignant glioma: RESCUE study. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 28, 2051-2057

114. Kreisl, T. N., Kim, L., Moore, K., Duic, P., Royce, C., Stroud, I., Garren, N., Mackey, M., Butman, J. A., Camphausen, K., Park, J., Albert, P. S., and Fine, H. A. (2009) Phase II trial of single-agent bevacizumab followed by bevacizumab plus irinotecan at tumor progression in recurrent glioblastoma. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 27, 740-745

115. Friedman, H. S., Prados, M. D., Wen, P. Y., Mikkelsen, T., Schiff, D., Abrey, L. E., Yung, W. K., Paleologos, N., Nicholas, M. K., Jensen, R., Vredenburgh, J., Huang, J., Zheng, M., and Cloughesy, T. (2009) Bevacizumab alone and in combination with irinotecan in recurrent glioblastoma. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 27, 4733-4740

116. Demuth, T., and Berens, M. E. (2004) Molecular mechanisms of glioma cell migration and invasion. Journal of neuro-oncology 70, 217-228

117. Nakada, M., Nakada, S., Demuth, T., Tran, N. L., Hoelzinger, D. B., and Berens, M. E. (2007) Molecular targets of glioma invasion. Cell Mol Life Sci 64, 458-478

118. Zhai, G. G., Malhotra, R., Delaney, M., Latham, D., Nestler, U., Zhang, M., Mukherjee, N., Song, Q., Robe, P., and Chakravarti, A. (2006) Radiation enhances the invasive potential of primary glioblastoma cells via activation of the Rho signaling pathway. Journal of neuro-oncology 76, 227-237

119. Boureux, A., Vignal, E., Faure, S., and Fort, P. (2007) Evolution of the Rho family of ras-like GTPases in eukaryotes. Mol Biol Evol 24, 203-216

71

120. Rossman, K. L., Der, C. J., and Sondek, J. (2005) GEF means go: turning on RHO GTPases with guanine nucleotide-exchange factors. Nat Rev Mol Cell Biol 6, 167-180

121. Nobes, C. D., and Hall, A. (1995) Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 81, 53-62

122. Ando, S., Kaibuchi, K., Sasaki, T., Hiraoka, K., Nishiyama, T., Mizuno, T., Asada, M., Nunoi, H., Matsuda, I., Matsuura, Y., and et al. (1992) Post-translational processing of rac p21s is important both for their interaction with the GDP/GTP exchange proteins and for their activation of NADPH oxidase. The Journal of biological chemistry 267, 25709-25713

123. Seabra, M. C. (1998) Membrane association and targeting of prenylated Ras-like GTPases. Cellular signalling 10, 167-172

124. Olofsson, B. (1999) Rho guanine dissociation inhibitors: pivotal molecules in cellular signalling. Cellular signalling 11, 545-554

125. Wennerberg, K., and Der, C. J. (2004) Rho-family GTPases: it's not only Rac and Rho (and I like it). Journal of cell science 117, 1301-1312

126. Ding, F., Yin, Z., and Wang, H. R. (2011) Ubiquitination in Rho signaling. Curr Top Med Chem 11, 2879-2887

127. Boulter, E., Garcia-Mata, R., Guilluy, C., Dubash, A., Rossi, G., Brennwald, P. J., and Burridge, K. (2010) Regulation of Rho GTPase crosstalk, degradation and activity by RhoGDI1. Nature cell biology 12, 477-483

128. Ridley, A. J., Paterson, H. F., Johnston, C. L., Diekmann, D., and Hall, A. (1992) The small GTP-binding protein rac regulates growth factor-induced membrane ruffling. Cell 70, 401-410

129. Ridley, A. J., and Hall, A. (1992) The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 70, 389-399

72

130. Kozma, R., Ahmed, S., Best, A., and Lim, L. (1995) The Ras-related protein Cdc42Hs and bradykinin promote formation of peripheral actin microspikes and filopodia in Swiss 3T3 fibroblasts. Molecular and cellular biology 15, 1942-1952

131. Guilluy, C., Garcia-Mata, R., and Burridge, K. (2011) Rho protein crosstalk: another social network? Trends Cell Biol 21, 718-726

132. Katoh, H., and Negishi, M. (2003) RhoG activates Rac1 by direct interaction with the Dock180-binding protein Elmo. Nature 424, 461-464

133. Katoh, H., Hiramoto, K., and Negishi, M. (2006) Activation of Rac1 by RhoG regulates cell migration. J Cell Sci 119, 56-65

134. Hiramoto, K., Negishi, M., and Katoh, H. (2006) Dock4 is regulated by RhoG and promotes Rac-dependent cell migration. Experimental cell research 312, 4205-4216

135. Wennerberg, K., Ellerbroek, S. M., Liu, R. Y., Karnoub, A. E., Burridge, K., and Der, C. J. (2002) RhoG signals in parallel with Rac1 and Cdc42. J Biol Chem 277, 47810-47817

136. Raftopoulou, M., and Hall, A. (2004) Cell migration: Rho GTPases lead the way. Dev Biol 265, 23-32

137. Etienne-Manneville, S., and Hall, A. (2001) Integrin-mediated activation of Cdc42 controls cell polarity in migrating astrocytes through PKCzeta. Cell 106, 489-498

138. Srinivasan, S., Wang, F., Glavas, S., Ott, A., Hofmann, F., Aktories, K., Kalman, D., and Bourne, H. R. (2003) Rac and Cdc42 play distinct roles in regulating PI(3,4,5)P3 and polarity during neutrophil chemotaxis. The Journal of cell biology 160, 375-385

139. Cotteret, S., and Chernoff, J. (2002) The evolutionary history of effectors downstream of Cdc42 and Rac. Genome Biol 3, REVIEWS0002

73

140. Kimura, K., Ito, M., Amano, M., Chihara, K., Fukata, Y., Nakafuku, M., Yamamori, B., Feng, J., Nakano, T., Okawa, K., Iwamatsu, A., and Kaibuchi, K. (1996) Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science 273, 245-248

141. Chrzanowska-Wodnicka, M., and Burridge, K. (1996) Rho-stimulated contractility drives the formation of stress fibers and focal adhesions. The Journal of cell biology 133, 1403-1415

142. Amano, M., Chihara, K., Kimura, K., Fukata, Y., Nakamura, N., Matsuura, Y., and Kaibuchi, K. (1997) Formation of actin stress fibers and focal adhesions enhanced by Rho-kinase. Science 275, 1308-1311

143. Watanabe, N., Kato, T., Fujita, A., Ishizaki, T., and Narumiya, S. (1999) Cooperation between mDia1 and ROCK in Rho-induced actin reorganization. Nature cell biology 1, 136-143

144. Pankova, K., Rosel, D., Novotny, M., and Brabek, J. (2010) The molecular mechanisms of transition between mesenchymal and amoeboid invasiveness in tumor cells. Cellular and molecular life sciences : CMLS 67, 63-71

145. Machacek, M., Hodgson, L., Welch, C., Elliott, H., Pertz, O., Nalbant, P., Abell, A., Johnson, G. L., Hahn, K. M., and Danuser, G. (2009) Coordination of Rho GTPase activities during cell protrusion. Nature 461, 99-103

146. Shimizu, T., Ihara, K., Maesaki, R., Kuroda, S., Kaibuchi, K., and Hakoshima, T. (2000) An open conformation of switch I revealed by the crystal structure of a Mg2+-free form of RHOA complexed with GDP. Implications for the GDP/GTP exchange mechanism. The Journal of biological chemistry 275, 18311-18317

147. Schmidt, A., and Hall, A. (2002) Guanine nucleotide exchange factors for Rho GTPases: turning on the switch. Genes & development 16, 1587-1609

148. Krauthammer, M., Kong, Y., Ha, B. H., Evans, P., Bacchiocchi, A., McCusker, J. P., Cheng, E., Davis, M. J., Goh, G., Choi, M., Ariyan, S., Narayan, D., Dutton-Regester, K., Capatana, A., Holman, E. C., Bosenberg, M., Sznol, M., Kluger, H. M., Brash, D. E., Stern, D. F., Materin, M. A., Lo, R. S., Mane, S., Ma, S., Kidd, K. K., Hayward, N. K., Lifton, R. P., Schlessinger, J., Boggon, T. J., and Halaban,

74

R. (2012) Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma. Nat Genet 44, 1006-1014

149. Davis, M. J., Ha, B. H., Holman, E. C., Halaban, R., Schlessinger, J., and Boggon, T. J. (2013) RAC1P29S is a spontaneously activating cancer-associated GTPase. Proceedings of the National Academy of Sciences of the United States of America 110, 912-917

150. Salhia, B., Tran, N. L., Chan, A., Wolf, A., Nakada, M., Rutka, F., Ennis, M., McDonough, W. S., Berens, M. E., Symons, M., and Rutka, J. T. (2008) The guanine nucleotide exchange factors trio, Ect2, and Vav3 mediate the invasive behavior of glioblastoma. Am J Pathol 173, 1828-1838

151. Tran, N. L., McDonough, W. S., Savitch, B. A., Fortin, S. P., Winkles, J. A., Symons, M., Nakada, M., Cunliffe, H. E., Hostetter, G., Hoelzinger, D. B., Rennert, J. L., Michaelson, J. S., Burkly, L. C., Lipinski, C. A., Loftus, J. C., Mariani, L., and Berens, M. E. (2006) Increased fibroblast growth factor-inducible 14 expression levels promote glioma cell invasion via Rac1 and nuclear factor-kappaB and correlate with poor patient outcome. Cancer Res 66, 9535-9542

152. Chuang, Y. Y., Tran, N. L., Rusk, N., Nakada, M., Berens, M. E., and Symons, M. (2004) Role of synaptojanin 2 in glioma cell migration and invasion. Cancer Res 64, 8271-8275

153. Tran, N. L., McDonough, W. S., Savitch, B. A., Fortin, S. P., Winkles, J. A., Symons, M., Nakada, M., Cunliffe, H. E., Hostetter, G., Hoelzinger, D. B., Rennert, J. L., Michaelson, J. S., Burkly, L. C., Lipinski, C. A., Loftus, J. C., Mariani, L., and Berens, M. E. (2006) Increased Fibroblast Growth Factor-Inducible 14 Expression Levels Promote Glioma Cell Invasion via Rac1 and Nuclear Factor-{kappa}B and Correlate with Poor Patient Outcome. Cancer Res 66, 9535-9542

154. Nakada, M., Drake, K. L., Nakada, S., Niska, J. A., and Berens, M. E. (2006) Ephrin-B3 Ligand Promotes Glioma Invasion through Activation of Rac1. Cancer Res 66, 8492-8500

75

155. Chan, A. Y., Coniglio, S. J., Chuang, Y. Y., Michaelson, D., Knaus, U. G., Philips, M. R., and Symons, M. (2005) Roles of the Rac1 and Rac3 GTPases in human tumor cell invasion. Oncogene 24, 7821-7829

156. Gimona, M., Buccione, R., Courtneidge, S. A., and Linder, S. (2008) Assembly and biological role of podosomes and invadopodia. Curr Opin Cell Biol 20, 235-241

157. Jarzynka, M. J., Hu, B., Hui, K. M., Bar-Joseph, I., Gu, W., Hirose, T., Haney, L. B., Ravichandran, K. S., Nishikawa, R., and Cheng, S. Y. (2007) ELMO1 and Dock180, a bipartite Rac1 guanine nucleotide exchange factor, promote human glioma cell invasion. Cancer Res 67, 7203-7211

158. Kwiatkowska, A., Didier, S., Fortin, S., Chuang, Y., White, T., Berens, M. E., Rushing, E., Eschbacher, J., Tran, N. L., Chan, A., and Symons, M. (2012) The small GTPase RhoG mediates glioblastoma cell invasion. Mol Cancer 11, 65

159. Salhia, B., Rutten, F., Nakada, M., Beaudry, C., Berens, M., Kwan, A., and Rutka, J. T. (2005) Inhibition of Rho-kinase affects astrocytoma morphology, motility, and invasion through activation of Rac1. Cancer Res 65, 8792-8800

160. Seol, H. J., Smith, C. A., Salhia, B., and Rutka, J. T. (2009) The Guanine Nucleotide Exchange Factor SWAP-70 Modulates the Migration and Invasiveness of Human Malignant Glioma Cells. Transl Oncol 2, 300-309

161. Sano, M., Genkai, N., Yajima, N., Tsuchiya, N., Homma, J., Tanaka, R., Miki, T., and Yamanaka, R. (2006) Expression level of ECT2 proto-oncogene correlates with prognosis in glioma patients. Oncol Rep 16, 1093-1098

162. Tatsumoto, T., Xie, X., Blumenthal, R., Okamoto, I., and Miki, T. (1999) Human ECT2 is an exchange factor for Rho GTPases, phosphorylated in G2/M phases, and involved in cytokinesis. J Cell Biol 147, 921-928

163. Foster, D., Parrish-Novak, J., Fox, B., and Xu, W. (2004) Cytokine-receptor pairing: accelerating discovery of cytokine function. Nat Rev Drug Discov 3, 160-170

76

164. Locksley, R. M., Killeen, N., and Lenardo, M. J. (2001) The TNF and TNF receptor superfamilies: integrating mammalian biology. Cell 104, 487-501

165. Baker, S. J., and Reddy, E. P. (1998) Modulation of life and death by the TNF receptor superfamily. Oncogene 17, 3261-3270

166. Fesik, S. W. (2000) Insights into programmed cell death through structural biology. Cell 103, 273-282

167. Brown, S. A., Richards, C. M., Hanscom, H. N., Feng, S. L., and Winkles, J. A. (2003) The Fn14 cytoplasmic tail binds tumour-necrosis-factor-receptor-associated factors 1, 2, 3 and 5 and mediates nuclear factor-kappaB activation. Biochem J 371, 395-403

168. Willis, A. L., Tran, N. L., Chatigny, J. M., Charlton, N., Vu, H., Brown, S. A., Black, M. A., McDonough, W. S., Fortin, S. P., Niska, J. R., Winkles, J. A., and Cunliffe, H. E. (2008) The fibroblast growth factor-inducible 14 receptor is highly expressed in HER2-positive breast tumors and regulates breast cancer cell invasive capacity. Mol Cancer Res 6, 725-734

169. Meighan-Mantha, R. L., Hsu, D. K., Guo, Y., Brown, S. A., Feng, S. L., Peifley, K. A., Alberts, G. F., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Richards, C. M., and Winkles, J. A. (1999) The mitogen-inducible Fn14 gene encodes a type I transmembrane protein that modulates fibroblast adhesion and migration. J Biol Chem 274, 33166-33176

170. Wiley, S. R., and Winkles, J. A. (2003) TWEAK, a member of the TNF superfamily, is a multifunctional cytokine that binds the TweakR/Fn14 receptor. Cytokine Growth Factor Rev 14, 241-249

171. Feng, S. L., Guo, Y., Factor, V. M., Thorgeirsson, S. S., Bell, D. W., Testa, J. R., Peifley, K. A., and Winkles, J. A. (2000) The Fn14 immediate-early response gene is induced during liver regeneration and highly expressed in both human and murine hepatocellular carcinomas. Am J Pathol 156, 1253-1261

172. Wiley, S. R., Cassiano, L., Lofton, T., Davis-Smith, T., Winkles, J. A., Lindner, V., Liu, H., Daniel, T. O., Smith, C. A., and Fanslow, W. C. (2001) A novel TNF

77

receptor family member binds TWEAK and is implicated in angiogenesis. Immunity 15, 837-846

173. Tran, N. L., McDonough, W. S., Donohue, P. J., Winkles, J. A., Berens, T. J., Ross, K. R., Hoelzinger, D. B., Beaudry, C., Coons, S. W., and Berens, M. E. (2003) The human Fn14 receptor gene is up-regulated in migrating glioma cells in vitro and overexpressed in advanced glial tumors. Am J Pathol 162, 1313-1321

174. Tran, N. L., McDonough, W. S., Savitch, B. A., Sawyer, T. F., Winkles, J. A., and Berens, M. E. (2005) The tumor necrosis factor-like weak inducer of apoptosis (TWEAK)-fibroblast growth factor-inducible 14 (Fn14) signaling system regulates glioma cell survival via NFkappaB pathway activation and BCL-XL/BCL-W expression. J Biol Chem 280, 3483-3492

175. Etienne-Manneville, S., and Hall, A. (2002) Rho GTPases in cell biology. Nature 420, 629-635

176. Munson, J. M., Fried, L., Rowson, S. A., Bonner, M. Y., Karumbaiah, L., Diaz, B., Courtneidge, S. A., Knaus, U. G., Brat, D. J., Arbiser, J. L., and Bellamkonda, R. V. (2012) Anti-invasive adjuvant therapy with imipramine blue enhances chemotherapeutic efficacy against glioma. Sci Transl Med 4, 127ra136

177. Acharyya, S., Oskarsson, T., Vanharanta, S., Malladi, S., Kim, J., Morris, P. G., Manova-Todorova, K., Leversha, M., Hogg, N., Seshan, V. E., Norton, L., Brogi, E., and Massague, J. (2012) A CXCL1 Paracrine Network Links Cancer Chemoresistance and Metastasis. Cell 150, 165-178

178. Schmitz, A. A., Govek, E. E., Bottner, B., and Van Aelst, L. (2000) Rho GTPases: signaling, migration, and invasion. Exp Cell Res 261, 1-12

179. Gomez del Pulgar, T., Benitah, S. A., Valeron, P. F., Espina, C., and Lacal, J. C. (2005) Rho GTPase expression in tumourigenesis: evidence for a significant link. BioEssays : news and reviews in molecular, cellular and developmental biology 27, 602-613

180. Ridley, A. J. (2004) Rho proteins and cancer. Breast Cancer Res Treat 84, 13-19

78

APPENDIX A - CDC42 AND THE GUANINE NUCLEOTIDE EXCHANGE FACTORS ECT2 AND TRIO MEDIATE FN14-INDUCED MIGRATION

AND INVASION OF GLIOBLASTOMA CELLS2

Paper is published in Molecular Cancer Research

Abstract

Malignant glioblastomas (GB) are characterized by their ability to infiltrate into

normal brain. We previously reported that binding of the multifunctional cytokine tumor

necrosis factor-like weak inducer of apoptosis (TWEAK) to its receptor fibroblast growth

factor-inducible 14 (Fn14) induces GB cell invasion via Rac1 activation. Here, we show

that Cdc42 plays an essential role in Fn14-mediated activation of Rac1. TWEAK-treated

glioma cells display an increased activation of Cdc42 and depletion of Cdc42 using

siRNA abolishes TWEAK-induced Rac1 activation and abrogates glioma cell migration

and invasion. In contrast, Rac1 depletion does not affect Cdc42 activation by Fn14,

showing that Cdc42 mediates TWEAK-stimulated Rac1 activation. Furthermore, we

identified two guanine nucleotide exchange factors (GEF), Ect2 and Trio, involved in

TWEAK-induced activation of Cdc42 and Rac1, respectively. Depletion of Ect2

abrogates both TWEAK-induced Cdc42 and Rac1 activation as well as subsequent

TWEAK-Fn14 directed glioma cell migration and invasion. In contrast, Trio depletion

inhibits TWEAK-induced Rac1 activation but not TWEAK-induced Cdc42 activation.

Finally, inappropriate expression of Fn14 or Ect2 in mouse astrocytes in vivo using an

RCAS vector system for glial-specific gene transfer in G-tva transgenic mice induces

astrocyte migration within the brain, corroborating the in vitro importance of the

2 Published in Molecular Cancer Research. 2012 Jul; 10(7):958-68.

79

TWEAK-Fn14 signaling cascade in GB invasion. Our results suggest that the TWEAK-

Fn14 signaling axis stimulates glioma cell migration and invasion through two GEF-

GTPase signaling units, Ect2-Cdc42 and Trio-Rac1. Components of the Fn14-Rho GEF-

Rho GTPase signaling pathway present innovative drug targets for glioma therapy.

Introduction

Glioblastomas are the most malignant and common primary brain tumor in adults.

Glioblastomas are highly infiltrative, leading to a poorly defined tumor mass. As a result,

complete resection of the tumor is not feasible without compromising neurologic

function, and despite adjuvant chemo- and radiation therapy, the five year survival rate is

just under ten percent (1). The invasive nature of glioblastoma correlates to an increased

resistance to current therapeutic strategies, the mechanisms of which are complex and

remain to be fully characterized (2).

Glioma cell invasion requires adhesion to extracellular matrix, subsequent

degradation and remodeling of this matrix, as well as signaling initiated by pro-migratory

growth factors, and Rho GTPase-mediated organization and remodeling of the actin

cytoskeleton (3). Specifically, the Rho GTPase family members RhoA, Rac1, and Cdc42

are key regulators of cell migration, and have been implicated in the formation of stress

fibers, induction of lamellipodia, and filopodia protrusion (4). The regulation of Rho

GTPase activation is mediated by three classes of proteins: guanine nucleotide exchange

factors (GEFs), which are responsible for activating Rho GTPases to their GTP bound

state, GTPase activating proteins (GAPs), which enact phosphate bond hydrolysis thus

80

inactivating Rho GTPases to a GDP bound state, and GDP dissociation inhibitors (GDIs)

which bind to and stabilize Rho GTPases in their inactive GDP bound form (5). To date,

22 Rho GTPases and 80 Rho GEFs belonging to either the Dbl or DOCK families have

been identified (6).

Previous studies have shown that the fibroblast growth factor inducible -14

(Fn14) receptor can signal to induce Rac1 activation (7). Fn14 is a transmembrane

receptor belonging to the tumor necrosis factor receptor superfamily (TNFRSF), and

serves as the receptor for the multifunctional cytokine TWEAK (8). The Fn14

cytoplasmic tail lacks a death domain but contains TNFR associated factor (TRAF)

binding sites specific for TRAFs 1, 2, 3, and 5 (9). Fn14 expression is minimal to absent

in normal brain tissue but correlates with tumor grade in glioblastoma (10). Activation of

Fn14 by TWEAK promotes glioma cell migration, invasion and survival (7,10,11). The

TWEAK-Fn14 signaling axis mediates glioma migration and invasion via the Rac1

GTPase, and fosters a self-promoting feedback loop whereby Rac1 mediated TWEAK-

Fn14 signaling induces Fn14 gene expression via the NF-κB pathway (7). While Rac1 is

ubiquitously expressed among tissue types (12,13), the levels of Rac1 protein expression

in astrocytomas directly correlate with tumor grade in TMA analysis. Furthermore, in

GB, but not in lower grade astrocytomas, prominent plasma membrane staining of Rac1

is observed. These observations indicate that Rac1 is constitutively active in GBs,

underlining the importance of Rac1 in these tumors (14). To date, five GEFs that can

activate Rac1 (Ect2, Vav3, Trio, SWAP-70 and Dock180-ELMO1), have been shown to

contribute to the invasive behavior of glioblastoma (14-16). Four of these GEFs have

81

been shown to be overexpressed in GB versus non-neoplastic brain (Ect2, Vav3, Trio,

and SWAP-70) (14,16) and expression of Dock180 is higher in the tumor rim than in the

tumor core.

In this study, we describe a role for TWEAK-Fn14 signaling through a multi-

GEF, multi-Rho GTPase signaling pathway that includes Ect2, Trio, Cdc42, and Rac1.

We show that Rac1 activation via TWEAK-Fn14 signaling is dependent upon Cdc42

function. We also report that Ect2 mediates Cdc42 activation, whereas Trio mediates

Rac1 activation following TWEAK stimulation. Depletion of Ect2, Trio, or Cdc42 by

siRNA oligonucleotides suppresses TWEAK-Fn14-induced Rac1 activation and

subsequently glioma cell migration and invasion. Finally, we show that the inappropriate

expression of either Fn14 or Ect2 in the astrocyte population of glial fibrillary acidic

protein (GFAP)-tv-a transgenic mice induces astrocyte cell motility and proliferation,

suggesting that the aberrant expression of Fn14 observed in GB may play an important

role in GB progression, especially cell invasion.

Materials and Methods

Cell culture conditions. Human astrocytoma cell lines T98G and U118 (American Type

Culture Collection) were maintained in DMEM (Gibco, USA) supplemented with 10%

heat-inactivated fetal bovine serum (FBS; Gibco, USA) at 37˚C with 5% CO2. For all

assays with TWEAK treatment, cells were cultured in reduced serum (0.5% fetal bovine

serum) for 16 h before stimulation with recombinant TWEAK at 100 ng/mL in DMEM +

0.1% bovine serum albumin for the indicated time.

82

Antibodies, reagents, and Western blot analysis. A monoclonal Cdc42 antibody was

purchased from Santa Cruz (Santa Cruz, CA). Anti-myc was purchased from Cell

Signaling Technologies (Beverly, MA). A polyclonal Ect2 antibody and a monoclonal

antibody to tubulin were purchased from Millipore (Billerica, MA). Human recombinant

TWEAK was purchased from PeproTech (Rock Hill, NJ), and laminin from human

placenta was obtained from Sigma (St. Louis, MO). Lipofectamine 2000 was purchased

from Invitrogen (Carlsbad, CA).

For immunoblotting, cells were lysed in 2x SDS sample buffer (0.25 M Tris-HCl,

pH 6.8, 10% SDS, 25% glycerol) containing 10 µg/mL aprotinin, 10 µg/mL leupeptin, 20

mM NaF, 2 mM sodium orthovanadate, and 1 mM phenylmethylsulfonyl fluoride.

Protein concentrations were determined using the BCA assay (Pierce) with bovine serum

albumin (BSA) as a standard. Thirty micrograms of total cellular protein were loaded per

lane and separated by SDS PAGE. After transfer at 4°C, the nitrocellulose (Invitrogen)

was blocked with either 5% nonfat milk or 5% BSA in Tris-buffered saline, pH 8.0,

containing 0.1% Tween 20 (TBST) prior to addition of primary antibodies and followed

with peroxidase-conjugated anti-mouse IgG or anti-rabbit IgG. Protein bands were

detected using SuperSignal West Dura Chemiluminescent Substrate (Thermo Scientific)

with a UVP BioSpectrum 500 Imaging System (Upland, CA).

Preparation of recombinant adenoviruses and infection. Adenoviruses expressing

myc-tagged Fn14 wild-type protein and the cytoplasmic domain truncation mutant myc-

Fn14tCT protein were previously described (7). Cells were infected at matched

83

multiplicity of infections ranging from 5 to 20. For adenoviral infection, 1.5 x 105 cells

were plated into a six-well plate and cultured for 24 h before infection.

Immunoprecipitation, Rac and Cdc42 activity assays, and nucleotide-free GEF

pulldowns. For immunoprecipitation, cells were lysed on ice for 10 min in a buffer

containing 10 mM Tris-HCl (pH 7.4), 0.5% Nonidet P-40, 150 mM NaCl, 1 mM

phenylmethylsulfonyl fluoride, 1 mM EDTA, 2 mM sodium orthovanadate, 10 µg/mL

aprotinin, and 10 µg/mL leupeptin (Sigma). Equivalent amounts of protein (500 µg) were

precleared and immunoprecipitated from the lysates, and then washed with lysis buffer

followed by S1 buffer [10 mM HEPES (pH 7.4), 0.15 M NaCl, 2 mM EDTA, 1.5%

Triton X-100, 0.5% deoxycholate, and 0.2% SDS]. Samples were then resuspended in 2×

SDS sample buffer and boiled in the presence of 2-mercaptoethanol (Sigma), separated

by SDS-PAGE, transferred to nitrocellulose for 1 h at 4°C, and proteins were detected

using SuperSignal West Dura Chemiluminescent Substrate (Thermo Scientific).

Activity assays for Rac1 and Cdc42 were done according to the protocol of the

manufacturer (Pierce, Rockford, IL). Lysates were harvested and equal concentrations of

lysates were assessed for Rac or Cdc42 activity. Affinity pulldowns of active GEFs

bound to Rho GTPases were performed using a nucleotide free Rac1 mutant (G15A)

expressed and purified as described (17). Recombinant Rac1 G15A-GST protein was

produced in BL21 cells. Cells were lysed in B-PER lysis buffer (Pierce) containing

protease inhibitors, and purified with GSH beads. Equal amounts of total GST fusion

protein were then incubated with total cellular protein lysate (1 mg), and precipitated

lysates were resolved with SDS-PAGE.

84

Small-interfering RNA transfection. Small interfering RNA (siRNA) oligonucleotides

specific for Rac1, GL2 luciferase (24), Ect2, and Trio were previously described (14).

siRNA sequences for Cdc42 are as follows: Cdc42-1 (5’ AAAGACTCCTTTCTTGCTT-

GT) and Cdc42-2 (5’ AATAACTCACCACTGTCCAAA). Transient transfection of

siRNA was performed using Lipofectamine 2000. Cells were plated at 70% confluency

in DMEM + 10% FBS without antibiotics and were transfected within 8 h of plating.

The siRNA and Lipofectamine were diluted in serum-free DMEM. After 5 min the

mixtures were combined and incubated 20 min at RT to enable complex formation.

siRNA oligonucleotides were transfected at 50 nM, and no cell toxicity was observed.

Maximum inhibition of mRNA and protein levels was achieved 48 to 72 h post-

transfection.

Radial cell migration assay. Cell migration was quantified as previously described (18).

Glioma cells were transfected with siRNA targeting luciferase, Ect2, or Cdc42. After 24

h, cells were plated onto 10-well glass slides precoated with 10 µg/mL laminin. Cells

were cultured in reduced serum (0.5% FBS) for an additional 16 h prior to TWEAK

addition, and migration rate was assessed over 24 h.

Lentiviral production. The cDNA encoding murine myc-tagged Fn14 wild-type protein

(pSec/Tag2/Fn14wt) or signal deficient myc-Fn14tCT (7) was excised and ligated into

the lentiviral transfer vector pCDH (System Biosciences, Mountain View, CA) that

contains a second transcriptional cassette for the expression of green fluorescent protein

(GFP). An empty pCDH vector expressing only GFP was used as a control. VSV-G

pseudo-typed recombinant lentiviruses were produced by co-transfection of 293

85

packaging cells with the pCDH construct and the pPACK packaging mix (System

Biosystems) according to the manufacturer's directions. For lentiviral transduction,

medium containing recombinant lentiviruses was harvested from the packaging cells after

48 hours, concentrated by PEG precipitation and centrifugation, and added to

subconfluent cultures of T98G and U118 cells together with 8 µg/ml polybrene for 4 to 6

hours. Positively transduced cells were enriched by mass sorting the GFP positive cells

on a Vantage flow cytometer (BD Biosciences, San Jose, CA).

Organotypic brain slice invasion assay. Preparation and culture of brain slices was

carried out as described previously (19) with minor modification. Glioma cells (T98G

and U118) stably expressing GFP were placed bilaterally onto the putamen of 400 µm

thick slices of freshly isolated 4-6 week-old murine brains. Glioma cell invasion into the

brain slices was quantified using the LSM 5 confocal microscope and depth of invasion

(z-axis stacks) was calculated as previously described (19).

Matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry

(MALDI-TOF MS). For MALDI-TOF MS, protein bands were stained with SYPRO

ruby protein staining kit (Bio-Rad) according to the manufacturer’s protocol. Prominent

protein bands present in the nucleotide free Rac1-G15A mutant lysates were visualized

under UV light and isolated. The samples of generated peptides were dissolved in 5 mL

of 0.5% trifluoroacetic acid and measured by MALDI-TOF MS analysis on a Voyager

reflector instrument (Applied Biosystems) and a Q-STAR mass spectrometer (Perceptive

Biosystems) in positive ion mode at the University of Arizona Proteomic Facility. Data

searches were done using the NCBI protein data bank with a minimum matching peptide

86

setting of four, a mass tolerance setting of 50-200 ppm, and a single trypsin miss cut

setting.

Quantification of lamellipodia formation. Glioma cells were transfected with siRNA

targeting luciferase, Rac1, Cdc42, Ect2, or Trio. After 24 h, cells were plated onto 10-

well glass slides pre-coated with 10 µg/mL laminin. Twenty-four hours later, cells were

cultured in reduced serum (0.5% FBS) for an additional 16 h prior to TWEAK

stimulation for 5 minutes. Subsequently, cells were fixed in 4% formaldehyde/PBS,

permeabilized with 0.1% Triton-X100 dissolved in PBS and incubated with AlexaFluor

phalloidin (Molecular Probes) to stain for F-actin. Slides were mounted with ProLong

Gold Antifade Reagent with DAPI (Molecular Probes). Images were collected using a

Zeiss LSM 510 microscope, equipped with a 63x objective, ZEN 2009 image analysis

software and Adobe Photoshop CS3. For each experimental condition, ten images were

taken randomly. Lamellipodia were traced using Image J software. For each cell, the

fraction of the cell perimeter that displayed lamellipodia was calculated.

RCAS astrocyte-specific infection in transgenic mouse models. Immortalized DF-1

chicken fibroblasts (obtained from ATCC) were transfected by calcium phosphate

precipitation with plasmids in which the cDNAs for alkaline phosphatase (AP), Fn14,

Ect2, and HGF were cloned into the ALV-A expression vector, RCAS-Y (a derivative of

RCASBP(A) (20). Transfected cells were cultured in DMEM with 10% FBS and 1X

Penicillin-Streptomycin, and passaged 1:3 every other day to maintain maximal

logarithmic growth and viral production. Viral expression was detected by Western

blotting using whole cell lysates.

87

Mice (G-tva) expressing the TVA receptor protein under control of the glial

fibrillary acidic protein (GFAP) promoter were used (21). Viral-producing DF-1 cells

from a confluent T-75 flask were trypsinized, centrifuged, resuspended in 100 µL of

medium, and placed on ice. DF-1 cells infected with RCASBP(A)-AP and RCASBP(A)-

Fn14, -Ect2, or -HGF were combined in equal proportions and co-injected into the

newborn mouse brain. A single intracranial injection of 5 µL was made at the intersection

of the coronal and sagittal sutures using a Hamilton Gastight Syringe. The number of wt

mice per cohort injected with virally producing DF-1 cells was as follows: AP (2), Fn14

(15), Ect2 (19), HGF (4). The number of transgenic (TG/+) mice per cohort injected with

virally producing DF-1 cells was as follows: AP (4), Fn14 (14), Ect2 (18), HGF (10).

Mice injected with RCAS viruses were euthanized 10 weeks post-injection, and

whole brains were removed and fixed in 10% Neutral Buffered Formalin overnight.

After fixing, brains were dehydrated in 20% sucrose, 2% glycerol in PBS. Dehydrated

tissues used for AP staining were cut into 60-µm sections on a vibratome. Fixed brain

tissue was incubated at 65 °C in PBS (pH 9.5) for 1 h to remove endogenous AP activity.

Sections were then subject to 1-StepTM NBT/BCIP (Thermo Scientific) until violet

staining was visualized.

Statistical analysis. Statistical analyses were done using the two-sample t test. P < 0.05

was considered significant.

88

Results

Ect2 binds to the Fn14 receptor and regulates TWEAK-stimulated Rac1 activation.

We have previously shown that TWEAK-Fn14 signaling stimulates Rac1 activity (7).

Consistent with our previous data, TWEAK stimulation of glioma cells results in a rapid

increase of Rac1 activity (Figure A.1A). We also reported that specific Rac1 GEFs (Ect2,

Trio, and Vav3) are upregulated in GBs and regulate glioma migration and invasion (14).

Here, we examined which GEFs are important in regulating TWEAK-induced Rac1

activation. Co-immunoprecipitation studies indicated that the Fn14 wild-type receptor,

but not an Fn14 mutant with a truncated cytoplasmic tail (tCT), interacted with Ect2

(Figure A.1B) but not Trio or Vav3 (data not shown). To determine whether Ect2 is

important for TWEAK-induced Rac1 activation we obtained two siRNAs targeting Ect2

and analyzed whether Ect2 depletion affected TWEAK-stimulated Rac1 activation.

siRNA-mediated knockdown of Ect2 expression in the glioma cell lines with two

independent siRNA oligos was ~90% effective (Figure A.1C). Ect2 depletion suppressed

TWEAK-induced Rac1 activation to levels below the untreated baseline of GTP bound

Rac1 (Figure A.1D) and also suppressed TWEAK-induced glioma cell migration to

levels below baseline (Figure A.1E). These data implicate Ect2 as a nucleotide exchange

factor for TWEAK-Fn14-mediated Rac1 activation and cell migration.

TWEAK regulation of Rac1 activation is dependent upon Cdc42 function. Rac1 has

been shown to function downstream of Cdc42 in a number of different settings (22,23).

We therefore examined whether TWEAK also stimulates Cdc42 and whether Cdc42, in

turn, mediates TWEAK-induced Rac1 activation. We found that Cdc42 is

89

Figure A.1. Ect2 binds to Fn14 and regulates TWEAK-induced Rac1 activation and

glioma cell migration.

(A) T98G cells were cultured in reduced serum followed by treatment with 100 ng/mL

TWEAK for the indicated times. Whole cell lysates were assessed for active Rac1 via

affinity pulldown with the Pak1 binding domain (PBD). (B) T98G cells were infected

with adenoviruses expressing either myc-tagged- Fn14 wild-type, Fn14 C-terminal

truncated (Fn14tCT), or control LacZ. Whole cell lysates were immunoprecipitated for

myc with subsequent western blot for Ect2 and myc. (C) T98G cells were transfected

with two siRNA oligonucleotides targeting Ect2 and assessed for the level of shutdown

efficiency relative to non-transfected (NT) or ctrl siRNA transfection targeting non-

mammalian luciferase (ctrl) by western blot analysis. (D) T98G cells were cultured in

reduced serum followed by treatment with TWEAK (100 ng/mL) for 10 min in the

presence of either control (ctrl) luciferase targeted siRNA or siRNA targeting Ect2 and

were assessed by Western blot. (E) Glioma cells were transfected with siRNA targeting

either control (ctrl) luciferase or two independent siRNA oligonucleotides to Ect2 (Ect2-1

and Ect2-2). After 24 h, cells were cultured in reduced serum medium (0.5% FBS) for 16

h and were seeded onto 10-well glass slides precoated with 10 µg/ml human laminin.

Cells were either left untreated or treated with TWEAK and glioma cell migration was

assessed over 24 h. Data represents the average of three independent experiments (* = p

< 0.01).

91

activated by TWEAK with maximal activation achieved at 5 min (Figure A.2A). Since

Ect2 can catalyze nucleotide exchange on Cdc42 (24,25), we also examined whether

Cdc42 activation by TWEAK was dependent upon Ect2. Depletion of Ect2 by siRNA

oligonucleotides prevents TWEAK-induced Cdc42 activation (Figure A.2B), indicating

that Ect2 indeed mediates TWEAK-induced Cdc42 activation. To determine the epistatic

relationship between Cdc42 and Rac1 in TWEAK signaling, we examined whether

Cdc42 activity was necessary for Rac1 activation, and vice versa. Using siRNA directed

against Cdc42 (Figure A.2C) we assessed Rac1 activity under depletion of Cdc42.

Depletion of Cdc42 expression resulted in the suppression of TWEAK-induced Rac1

activation (Figure A.2D), whereas Rac1 depletion had no effect on TWEAK-induced

Cdc42 activation (Figure A.2E). Collectively, these data indicate that Ect2 mediates the

Cdc42 activation downstream of TWEAK-Fn14 and that in turn, Cdc42 activates Rac1.

Depletion of Cdc42 or Ect2 by siRNA suppresses TWEAK- or Fn14-induced cell

migration and invasion. Cdc42 is known to control directional responses to

extracellular cues at the front of the cell (4) and has been reported to play an important

role in chemotaxis and cell invasion (26-28). Therefore, we investigated the role of

Cdc42 function in TWEAK-induced glioma cell migration. TWEAK stimulation of

migration was ablated in glioma cell lines under Cdc42 knockdown conditions (Figure

A.3A). This level of inhibition of cell migration is similar to that caused by Ect2

depletion (Figure A.1E). We next assessed whether Cdc42 or Ect2 knockdown affects

Fn14-stimulated invasion using an ex vivo rat brain slice model as detailed previously

(19).

92

Figure A.2. TWEAK stimulation of Rac1 activation is dependent upon Cdc42.

(A) T98G cells were treated with TWEAK for the indicated times and assayed for Cdc42

activity using the PBD assay. (B) T98G cells were transfected with Ect2 siRNA

oligonucleotides or luciferase control siRNA (ctrl). Cells were then cultured under

reduced serum (0.5% FBS) for 24 h, followed by treatment with TWEAK for 5 min and

then assessed for Cdc42 activity. (C) T98G cells were either left non-transfected (NT),

transfected with two independent siRNAs designed against Cdc42 (Cdc42-1 and Cdc42-

2) or transfected with control siRNA. Cells were then lysed and western blot analysis for

Cdc42 was performed to confirm protein depletion. (D) Cells transfected with either

control or Cdc42 targeting siRNA were cultured under reduced serum for 16 h. Cells

were then either left untreated or treated with TWEAK for 10 min and assayed for Rac1

activity. (E) Cells transfected with either control or Rac1 targeting siRNA were cultured

under reduced serum for 16 h. Cells were then either left untreated or treated with

TWEAK for 5 min and assessed for Cdc42 activity.

94

Glioma cells infected with recombinant lentiviruses encoding GFP alone (V), wild type

Fn14 (WT), or Fn14 containing a truncation of the cytoplasmic domain (tCT) were

transfected with siRNA oligonucleotides targeting either Cdc42 or Ect2, and

subsequently assessed for depth of invasion into the brain slices over 48 hours. As

reported previously (7) glioma cells over-expressing the Fn14wt receptor have increased

invasive activity, whereas, cells expressing the Fn14tCT receptor do not (Figure A.3B).

siRNA-mediated knockdown of Cdc42 and Ect2 in glioma cells expressing Fn14wt

abrogated Fn14-induced cell invasion relative to control non-mammalian-targeted siRNA

in Fn14wt cells (Figure A.3B). These data corroborate the cell migration data and further

show that Ect2-Cdc42 mediate Fn14-induced glioma cell migration and invasion.

Trio activates Rac1 downstream of Fn14. Our data show that Ect2 depletion

suppresses TWEAK-induced Cdc42 and Rac1 activation. Furthermore, depletion of

Cdc42 expression by siRNA oligonucleotides suppresses TWEAK-induced Rac1

activation, which suggests that Ect2 is an indirect exchange factor for Rac1 and argues

that an additional GEF(s) may activate Rac1 downstream of TWEAK-Fn14 signaling. To

identify such GEFs, we performed a Rho GEF pull-down assay using a nucleotide-free

Rac1 GTPase mutant (G15A-Rac1) GST-fusion protein that can precipitate activated

Rac1 GEFs out of cell lysates. T98G glioma cells were treated with TWEAK, subjected

to the nucleotide-free Rac1 GEF pull-down assay, and proteins were resolved by SDS-

PAGE analysis. Prominent protein bands present in the G15A-Rac1 complex under

TWEAK stimulation but absent in the untreated G15A-Rac1 complex were recovered

95

Figure A.3. Cdc42 and Ect2 regulate TWEAK-induced glioma cell migration in vitro

and Fn14-induced invasion ex vivo.

(A) T98G and U118 glioma cells were transfected with siRNA targeting either control

non-mammalian luciferase (ctrl) or two independent siRNA oligonucleotides targeting

Cdc42 (Cdc42-1 and Cdc42-2). After 24 h, cells were cultured in reduced serum medium

(0.5% FBS) for 16 h and were seeded onto 10-well glass slides precoated with 10 µg/ml

human laminin. Cells were either left untreated or treated with TWEAK and glioma cell

migration was assessed over 24 h. Data represents the average of three independent

experiments ( * = p < 0.01). (B) T98G and U118 glioma cells were stably transduced

with lentiviruses expressing GFP alone (V), the Fn14-wild-type (WT), or the cytoplasmic

domain truncated Fn14 receptor (tCT). In certain experiments, cells were either

transfected with siRNA oligonucleotides against Cdc42, Ect2 or control luciferase (ctrl).

Cells were implanted bilaterally onto the putamen of murine organotypic brain slices and

observed at 48 h. Depth of invasion was then calculated from Z-axis images collected by

confocal laser scanning microscopy. The mean value of the depth of invasion was

obtained from six independent experiments (* = p < 0.01).

97

from the gel. Proteins were eluted, trypsin digested, and MALDI-TOF and MS-MS

analysis of the trypsin digests were performed. A known Rac1-GEF, Trio, was a

candidate protein identified by MS in the TWEAK-treated G15A-Rac1 complex. We

therefore pursued Trio as a potential Rac1 activator, using two siRNAs that significantly

reduce Trio expression (Figure A.4A). The increased activity of Rac1 seen upon TWEAK

stimulation is eliminated under Trio knockdown conditions (Figure A.4B), indicating that

Trio mediates TWEAK-induced Rac1 activation. Interestingly, depletion of Trio

expression by siRNA oligonucleotides had no effect on TWEAK-induced Cdc42

activation (Figure A.4C), suggesting that Trio functions downstream of Cdc42 to induce

Rac1 activation. In addition, depletion of Trio inhibited TWEAK-induced glioma cell

migration in vitro (Figure A.4D). Likewise, Trio depletion also abrogated Fn14-induced

cell invasion in the ex vivo rat brain slice model (Figure A.4E), further supporting the

function of Trio in mediating Fn14-induced cell invasion. Therefore, these data suggest

that Trio functions downstream of Ect2 and Cdc42 to mediate TWEAK-Fn14-stimulated

Rac1 activation.

Depletion of Rac1, Cdc42, Ect2, or Trio by siRNA suppresses TWEAK-induced

lamellipodia formation. Activated Cdc42 and Rac1 are known to control actin

cytoskeleton-based dynamics and promote lamellipodia formation. To determine whether

TWEAK activation of Cdc42 and Rac1 signaling confers changes in the actin

cytoskeleton, we treated cells with TWEAK and examined filamentous actin using

phalloidin staining. We found that TWEAK stimulation of glioma cells strongly

stimulates lamellipodia formation (Figure A.5A, panel b arrows) as compared to control

98

Figure A.4. Trio activates Rac1 upon TWEAK stimulation or Fn14 overexpression.

(A) T98G cells were transfected with two siRNA oligonucleotides targeting Trio and

assessed for the level of shutdown efficiency relative to non- transfected (NT) or ctrl

siRNA transfection targeting non-mammalian luciferase (ctrl) by western blot analysis.

Glioma cells transfected with Trio siRNA were cultured under reduced serum for 16 h

followed by treatment with TWEAK for 10 min and assessment for Rac1 activity (B) or

Cdc42 activity (C). (D) T98G and U118 glioma cells were transfected with siRNA

targeting either control non-mammalian luciferase (ctrl) or two independent siRNA

oligonucleotides targeting Trio (Trio-1 and Trio-2). After 24 h, cells were cultured in

reduced serum medium (0.5% FBS) for 16 h and were seeded onto 10-well glass slides

precoated with 10 µg/ml human laminin. Cells were either left untreated or treated with

TWEAK and glioma cell migration was assessed over 24 h. Data represents the average

of three independent experiments ( * = p < 0.01). (E) T98G and U118 glioma cells were

stably infected with lentiviruses expressing GFP and either the control vector (V), the

Fn14-wild-type (WT), or the cytoplasmic domain truncated Fn14 receptor (tCT). In

certain experiments, cells were either transfected with siRNA oligonucleotides against

Trio or control luciferase gene (ctrl). Cells were implanted bilaterally onto the putamen of

murine organotypic brain slices and observed at 48 h. Depth of invasion was then

calculated from Z-axis images collected by confocal laser scanning microscopy. The

mean value of the depth of invasion was obtained from six independent experiments (* =

p < 0.01).

100

untreated cells (Figure A.5A, panel a). Furthermore, treatment with siRNA

oligonucleotides targeting either Rac1, Cdc42, Ect2 or Trio significantly inhibited

TWEAK-stimulated lamellipodia formation (Figure A.5A, B). These data are in line

with the migration and invasion data, and are consistent with the existence of a signaling

cascade comprising Ect2, Cdc42, Trio and Rac1, that functions downstream of Fn14 to

control the invasive behavior of glioblastoma cells.

We also examined focal adhesions in TWEAK-stimulated glioma cells using

immunofluorescence staining for vinculin and paxillin. However, we did not observe any

significant changes in the number or distribution of focal adhesions upon TWEAK

treatment of control cells or TWEAK stimulation of cells depleted of Rac1, Cdc42, Ect2

or Trio (data not shown).

Fn14 and Ect2 promote proliferation and migration of astrocytes in vivo. We

previously showed that activation of the Fn14 receptor results in glioma cell migration

and invasion in vitro (7); furthermore, Ect2 has also been implicated as a regulator of

glioma cell migration and invasion (14), a key feature of glioblastoma tumors. To assess

the role of Fn14 and Ect2 in vivo, we used transgenic mice engineered to express TVA,

the avian cell surface receptor for subgroup A avian leukosis viruses (ALV-A), under

control of the astrocyte-specific glial fibrillary acidic protein (GFAP) promoter. This

allows for the selective infection of astrocytes with ALV-A from virus-infected and -

producing DF-1 chicken fibroblasts to deliver both the Fn14 or Ect2 and alkaline

phosphatase (AP) genes (21,29,30). It is important to note that the same cells producing

AP-expressing virus are used to infect TVA+ mice with AP alone or in the combination

101

Figure A.5. TWEAK-induced lamellipodia formation in glioma cells requires the

function of Rac1, Cdc42, Ect2 and Trio.

T98G glioma cells were transfected with siRNA targeting either control non-mammalian

luciferase (ctrl), Rac1, Cdc42, Ect2, or Trio. After 24 h, cells were seeded onto 10-well

glass slides precoated with 10 µg/ml human laminin. Cells were further grown for 24

additional hours and then cultured in reduced serum medium (0.5% FBS) for 16 h. Cells

were either left untreated or treated with TWEAK (5 min) and stained for filamentous

actin using AlexaFluor-phallodin. (A) Representative images of control transfected non-

treated (panel a), or TWEAK-treated (panel b) cells as well as TWEAK-treated cells after

depletion of Rac1 (panel c), Cdc42 (panel d), Ect2 (panel e), or Trio (panel f) are shown.

Arrows indicate lamellipodia. Bar = 10 µm. (B) Quantification of lamellipodia formation.

Data represents the average of ten cells per condition ( * = p < 0.001).

103

of AP and either Fn14, Ect2, or HGF expressing viruses. Co-injection of DF-1 cells with

Fn14 or Ect2 expressing and AP-expressing viral vectors into the brains of the transgenic

mice induced astrocytic cell migration along tracts at the intersection of the coronal and

sagittal sutures (Figure A.6B-C & F-G). This effect was similar to that caused by co-

injection of DF-1 cells infected with avian leucosis viruses expressing AP and a known

robust inducer of cell motility, hepatocyte growth factor (HGF) (31) (Figure A.6D & H).

The injection of DF-1 cells producing AP-expressing viruses alone did not stimulate cell

migration (Figure A.6A & E). Given the limited number of cells injected and the lack of

selective proliferation or survival advantage under AP expression alone it is technically

difficult to find these cells after necropsy and staining and thus the injection sites are

labeled with a box (Figure A.6). Furthermore, the number of AP positive cells in the

Fn14 or Ect2 and AP co-injection conditions was clearly increased relative to conditions

in which AP was injected alone, indicating a role for Fn14 and Ect2 in astrocyte

proliferation in addition to migration. Co-injection of HGF- and AP-producing DF-1

cells also resulted in increased numbers of AP-staining cells. Moreover, analysis of

virally-infected cells in culture suggests no evidence of toxicity associated with AP

expression. This is consistent with previous studies using AP expression as a glial cell

marker with no evidence of deleterious effects on glial cell proliferation or survival in

vitro (32) or in vivo (33) This data suggests that the abnormal expression of Fn14 or Ect2

can be an inducer of migration in situ. Thus, increased expression of Fn14 or Ect2

observed in GB may play a critical role in the malignant behavior of GB.

104

Figure A.6. Proliferation and migration of RCAS-Fn14 and RCAS-Ect2-infected

astrocytic cells in vivo.

DF-1 chicken fibroblasts producing subgroup A avian leukosis viruses (ALV-A) carrying

the RCAS-AP plasmid along with either the RCAS-Fn14 (B & F) , RCAS-Ect2 (C& G)

or RCAS-HGF (D & H) plasmids were injected at the intersection of the coronal and

sagittal sutures of transgenic mice expressing the TVA receptor for ALV-A under control

of the GFAP promoter. In certain animals, chicken DF-1 cells producing RCAS-AP

ALV-A viruses were injected alone as a negative control (A & E). Rectangles indicate

area of injection. Arrows indicate AP staining 10 weeks post infection. Images A-D and

E-H represent magnification at 2x and 4x, respectively.

105

Discussion

In this paper, we describe a signaling cascade comprising Ect2, Cdc42, Trio and

Rac1, that mediates TWEAK-stimulated glioblastoma cell invasion via the TNFRSF

member Fn14. In addition, we report that ectopic expression of either Fn14 or Ect2 in the

astrocytic lineage induces aberrant proliferation and migration of glial cells, underlining

the importance of Fn14 and Ect2 in the malignant behavior of glioblastoma.

Over the past several years, a number of Rho GEFs that contribute to the invasive

behavior of glioblastoma cells have been identified: Ect2, Vav3, Trio, SWAP-70 and

Dock180 (14-16). All these GEFs can act on the Rac1 GTPase in vitro (6,25,34,35). In

addition, siRNA-mediated depletion of these GEFs has been shown to diminish Rac1

activation in glioblastoma cells (14-16). Several of these GEFs can also act on Cdc42 and

RhoA, but thus far, the roles of these GTPases in glioblastoma cell invasion have not

been investigated. Here, we show that Cdc42 plays a critical role in glioblastoma cell

migration and invasion stimulated by TNF family member TWEAK. Cdc42 is best

known for its key role in the control of cell polarity (36), but it also has been implicated

in the regulation of cell migration and invasion in a variety of different cell types (26,28).

Our data also place Cdc42 upstream of Rac1 in TWEAK-stimulated cell

migration and invasion. Importantly, depletion of Cdc42 completely inhibits TWEAK-

stimulated Rac1 activation, indicating that the Ect2-Cdc42 module mediates the main, if

not the only signaling pathway that controls Rac1 activation downstream of TWEAK.

We note that Cdc42 has been shown to function upstream of Rac1 in the regulation of a

variety of different biological functions, including cell polarity, cell migration and

106

glucose-stimulated insulin secretion (37,38), although several Rac1-independent

functions of Cdc42 also have been delineated (22,23).

We also showed that depletion of the GEF Trio strongly inhibits TWEAK-

stimulated activation of Rac1, but not of Cdc42, suggesting that Trio relays Cdc42

activation to that of Rac1. We note however that we cannot exclude the possibility that

additional GEFs contribute to the activation of Rac1 by Cdc42. Indeed, in other systems,

other GEFs have been shown to mediate Cdc42-induced Rac1 activation, including Cool-

2/alpha-Pix and Tiam1 (37,39), suggesting that Cdc42 may couple to Rac1 via different

GEFs, depending on the biological setting. Trio contains two GEF domains, which act on

Rac1 and RhoA respectively, but not Cdc42 (40). The role of RhoA in glioblastoma cell

invasion remains to be elucidated however. Notably, we previously showed that

stimulation of glioblastoma cells with TWEAK leads to a decrease in RhoA activation

(7), making it unlikely that RhoA activity contributes to TWEAK-stimulated

glioblastoma invasion.

Our data showing that depletion of Ect2 completely inhibits TWEAK-stimulated

Cdc42 activation also indicates that Ect2 is the sole GEF that is responsible for Cdc42

activation in this setting. It is interesting to note that Ect2 can also act as an exchange

factor for Rac1, both in vitro (25) and in cells (41). However, even though we observed

that depletion of Ect2 strongly inhibits TWEAK-induced Rac1 activation, it is unlikely

that Ect2 directly acts on Rac1 in TWEAK-stimulated glioblastoma cells, as depletion of

Cdc42 completely inhibits TWEAK-stimulated Rac1 activation. Thus, our data support a

model in which TWEAK/Fn14 in glioblastoma cells signals via Ect2, leading to Cdc42

107

and subsequently to Rac1 activation (Figure A.7). In addition, although our results

suggest that Trio is a critical mediator of Rac1 activation downstream of TWEAK and

Cdc42, in the absence of biochemical data showing that Trio activity is regulated by

Cdc42, we cannot exclude the possibility that Trio may be activated via crosstalk with

other TWEAK-stimulated signaling events. Interestingly, in lung cancer cells, Ect2 has

been shown to mediate the activation of Rac1, but not Cdc42 (41). Moreover, during

mitosis, Ect2 activates Cdc42 during metaphase, but regulates RhoA during telophase

(42,43). Thus, these findings suggest that Ect2 acts on different GTPases depending on

the cellular context. The molecular mechanisms that underlie the substrate specificity

dynamics of Ect2 largely remain to be elucidated and may involve the interaction of Ect2

with different binding partners, such as MgcRacGAP and the PKC/Par6 complex (41-44).

The Fn14-Rac1 axis is highly deregulated in GB tumors. Expression levels of Fn14, Ect2

and Trio increase with astrocytoma grade and correlate with poor patient outcome

(7,14,45). We also have noted an increase in the degree of cytoplasmic localization of

Ect2 in glioblastoma versus low grade astrocytoma (14). Ect2 localizes to the nucleus in

non-transformed cells and aberrant localization of Ect2 to the cytoplasm correlates with

its oncogenic activity (46,47). Rac1 expression levels also increase with astrocytoma

grade (14). In addition, prominent Rac1 plasma membrane localization in a significant

subset of glioblastoma tumors indicates that this GTPase is hyperactive in these tumors

(14). We also note that the Fn14-Rac1-NF-κB axis contributes to the malignant behavior

of glioblastoma cells by promoting cell survival (7,11).

108

Figure A.7. Schematic model of TWEAK-Fn14 signaling via Cdc42 and Rac1 to

drive glioma migration/invasion.

We propose that TWEAK engagement of the Fn14 receptor results in the activation of

Cdc42 by the Ect2 guanine nucleotide exchange factor. Ect2-Cdc42 signaling results in

the activation of Rac1 by the Trio guanine nucleotide exchange factor to drive glioma cell

migration and invasion.

109

Based on their role in glioma cell migration, we assessed the ability of Fn14 and

Ect2 to promote astrocyte migration and proliferation when inappropriately expressed in

glial cells of transgenic mice. Previous work from Holland et. al. showed that basic

fibroblast growth factor production in astrocytes induces the proliferation and migration

of glial cells whereas injection of cells producing AP expressing virus alone results in

only a small number of infected cells near the site of injection that do not migrate (21).

Here we report the ability of both Fn14 and Ect2 to induce cell proliferation and motility

with no evidence of toxicity to cells when introduced into the murine astrocyte

population.

Thus, the functional observations described in this paper and our previous work

(7,11), together with the observations that Fn14 and Ect2 are overexpressed in patient GB

tumors in comparison to non-neoplastic tissue (10,14), strongly suggest that blocking

Fn14 signaling may slow the invasion and progression of the pro-migratory population of

GB tumors. Furthermore, our findings that Ect2, Cdc42 and Trio are essential signaling

components that mediate TWEAK-stimulated activation of Rac1 suggest novel avenues

for therapeutic intervention in TWEAK/Fn14-dependent glioblastoma tumors. The recent

development of an immunoconjugate containing a highly specific anti-Fn14 monoclonal

antibody conjugated to recombinant gelonin (rGel), a cytotoxic ribosome-inactivating N-

glycosidase, that can kill Fn14 expressing cells in vitro and induce long term tumor

growth suppression in nude mice bearing T-24 human bladder cancer cell xenografts,

supports the proposal that Fn14-targeted agents may have anti-tumor effects (48).

Additional therapeutic strategies targeting the TWEAK/Fn14 axis, including small

110

molecule antagonists of TWEAK trimerization or TWEAK-Fn14 binding and Fn14-Fc

fusion proteins, have been recently reviewed (8). There is also an increasing body of

literature that supports the feasibility of targeting GTPases and their cognate GEFs as

promising anti-cancer therapies (49,50). Thus targeting the TWEAK-Fn14 signaling axis

presents a unique therapeutic strategy for invasive GB cells.

Acknowledgements

The authors would like to thank Dr. Keith Burridge (University of North Carolina,

Chapel Hill) for a gift of G15A-Rac1-GST plasmid and Dr. Eric Holland (Memorial

Sloan-Kettering Cancer Center) for a gift of the transgenic mice.

Grant Support

Supported by NIH grants R01 CA130940 (N.L. Tran), R21 NS060023 (M.H. Symons),

R01 NS055126 (J.A. Winkles), R01 CA103956 (J.C. Loftus), a VARI-TGen Integration

Grant (N.L. Tran and B.O Williams), the ARCS Foundation Eller Scholarship and

Science Foundation Arizona Fellowship (S.P. Fortin).

111

References

1. Stupp, R., Hegi, M. E., Mason, W. P., van den Bent, M. J., Taphoorn, M. J.,

Janzer, R. C., Ludwin, S. K., Allgeier, A., Fisher, B., Belanger, K., Hau, P., Brandes, A. A., Gijtenbeek, J., Marosi, C., Vecht, C. J., Mokhtari, K., Wesseling, P., Villa, S., Eisenhauer, E., Gorlia, T., Weller, M., Lacombe, D., Cairncross, J. G., and Mirimanoff, R. O. (2009) Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol 10, 459-466

2. Lefranc, F., Brotchi, J., and Kiss, R. (2005) Possible future issues in the treatment of glioblastomas: special emphasis on cell migration and the resistance of migrating glioblastoma cells to apoptosis. J Clin Oncol 23, 2411-2422

3. Nakada, M., Nakada, S., Demuth, T., Tran, N. L., Hoelzinger, D. B., and Berens, M. E. (2007) Molecular targets of glioma invasion. Cell Mol Life Sci 64, 458-478


5. Bustelo, X. R., Sauzeau, V., and Berenjeno, I. M. (2007) GTP-binding proteins of the Rho/Rac family: regulation, effectors and functions in vivo. Bioessays 29, 356-370



112

8. Winkles, J. A. (2008) The TWEAK-Fn14 cytokine-receptor axis: discovery, biology and therapeutic targeting. Nat Rev Drug Discov 7, 411-425




12. Didsbury, J., Weber, R. F., Bokoch, G. M., Evans, T., and Snyderman, R. (1989) rac, a novel ras-related family of proteins that are botulinum toxin substrates. J Biol Chem 264, 16378-16382

13. Bosco, E. E., Mulloy, J. C., and Zheng, Y. (2009) Rac1 GTPase: a "Rac" of all trades. Cell Mol Life Sci 66, 370-374



113

16. Seol, H. J., Smith, C. A., Salhia, B., and Rutka, J. T. (2009) The Guanine Nucleotide Exchange Factor SWAP-70 Modulates the Migration and Invasiveness of Human Malignant Glioma Cells. Transl Oncol 2, 300-309

17. Garcia-Mata, R., Wennerberg, K., Arthur, W. T., Noren, N. K., Ellerbroek, S. M., and Burridge, K. (2006) Analysis of activated GAPs and GEFs in cell lysates. Methods in Enzymology 406, 425-437

18. Berens, M. E., Rief, M. D., Loo, M. A., and Giese, A. (1994) The role of extracellular matrix in human astrocytoma migration and proliferation studied in a microliter scale assay. Clin Exp Metastasis 12, 405-415

19. Nakada, M., Niska, J. A., Miyamori, H., McDonough, W. S., Wu, J., Sato, H., and Berens, M. E. (2004) The phosphorylation of EphB2 receptor regulates migration and invasion of human glioma cells. Cancer Res 64, 3179-3185

20. Petropoulos, C. J., Payne, W., Salter, D. W., and Hughes, S. H. (1992) Appropriate in vivo expression of a muscle-specific promoter by using avian retroviral vectors for gene transfer [corrected]. J Virol 66, 3391-3397

21. Holland, E. C., and Varmus, H. E. (1998) Basic fibroblast growth factor induces cell migration and proliferation after glia-specific gene transfer in mice. Proc Natl Acad Sci U S A 95, 1218-1223

22. Iden, S., and Collard, J. G. (2008) Crosstalk between small GTPases and polarity proteins in cell polarization. Nat Rev Mol Cell Biol 9, 846-859

23. Berzat, A., and Hall, A. (2010) Cellular responses to extracellular guidance cues. EMBO J 29, 2734-2745

24. Solski, P. A., Wilder, R. S., Rossman, K. L., Sondek, J., Cox, A. D., Campbell, S. L., and Der, C. J. (2004) Requirement for C-terminal sequences in regulation of Ect2 guanine nucleotide exchange specificity and transformation. J Biol Chem 279, 25226-25233

114


26. Keely, P. J., Westwick, J. K., Whitehead, I. P., Der, C. J., and Parise, L. V. (1997) Cdc42 and Rac1 induce integrin-mediated cell motility and invasiveness through PI(3)K. Nature 390, 632-636

27. Allen, W. E., Zicha, D., Ridley, A. J., and Jones, G. E. (1998) A role for Cdc42 in macrophage chemotaxis. J Cell Biol 141, 1147-1157

28. Schmitz, A. A., Govek, E. E., Bottner, B., and Van Aelst, L. (2000) Rho GTPases: signaling, migration, and invasion. Exp Cell Res 261, 1-12

29. Federspiel, M. J., Bates, P., Young, J. A., Varmus, H. E., and Hughes, S. H. (1994) A system for tissue-specific gene targeting: transgenic mice susceptible to subgroup A avian leukosis virus-based retroviral vectors. Proc Natl Acad Sci U S A 91, 11241-11245

30. Brenner, M., Kisseberth, W. C., Su, Y., Besnard, F., and Messing, A. (1994) GFAP promoter directs astrocyte-specific expression in transgenic mice. J Neurosci 14, 1030-1037

31. Trusolino, L., Bertotti, A., and Comoglio, P. M. (2010) MET signalling: principles and functions in development, organ regeneration and cancer. Nat Rev Mol Cell Biol 11, 834-848

32. Holland, E. C., Hively, W. P., Gallo, V., and Varmus, H. E. (1998) Modeling mutations in the G1 arrest pathway in human gliomas: overexpression of CDK4 but not loss of INK4a-ARF induces hyperploidy in cultured mouse astrocytes. Genes Dev 12, 3644-3649

33. Casper, K. B., and McCarthy, K. D. (2006) GFAP-positive progenitor cells produce neurons and oligodendrocytes throughout the CNS. Mol Cell Neurosci 31, 676-684

115

34. Shinohara, M., Terada, Y., Iwamatsu, A., Shinohara, A., Mochizuki, N., Higuchi, M., Gotoh, Y., Ihara, S., Nagata, S., Itoh, H., Fukui, Y., and Jessberger, R. (2002) SWAP-70 is a guanine-nucleotide-exchange factor that mediates signalling of membrane ruffling. Nature 416, 759-763

35. Kiyokawa, E., Hashimoto, Y., Kobayashi, S., Sugimura, H., Kurata, T., and Matsuda, M. (1998) Activation of Rac1 by a Crk SH3-binding protein, DOCK180. Genes Dev 12, 3331-3336

36. Etienne-Manneville, S. (2004) Cdc42--the centre of polarity. J Cell Sci 117, 1291-1300

37. Nishimura, T., Yamaguchi, T., Kato, K., Yoshizawa, M., Nabeshima, Y., Ohno, S., Hoshino, M., and Kaibuchi, K. (2005) PAR-6-PAR-3 mediates Cdc42-induced Rac activation through the Rac GEFs STEF/Tiam1. Nat Cell Biol 7, 270-277

38. Wang, Z., Oh, E., and Thurmond, D. C. (2007) Glucose-stimulated Cdc42 signaling is essential for the second phase of insulin secretion. J Biol Chem 282, 9536-9546

39. Baird, D., Feng, Q., and Cerione, R. A. (2005) The Cool-2/alpha-Pix protein mediates a Cdc42-Rac signaling cascade. Curr Biol 15, 1-10

40. Bellanger, J. M., Lazaro, J. B., Diriong, S., Fernandez, A., Lamb, N., and Debant, A. (1998) The two guanine nucleotide exchange factor domains of Trio link the Rac1 and the RhoA pathways in vivo. Oncogene 16, 147-152

41. Justilien, V., and Fields, A. P. (2009) Ect2 links the PKCiota-Par6alpha complex to Rac1 activation and cellular transformation. Oncogene 28, 3597-3607

42. Oceguera-Yanez, F., Kimura, K., Yasuda, S., Higashida, C., Kitamura, T., Hiraoka, Y., Haraguchi, T., and Narumiya, S. (2005) Ect2 and MgcRacGAP regulate the activation and function of Cdc42 in mitosis. J Cell Biol 168, 221-232

43. Yuce, O., Piekny, A., and Glotzer, M. (2005) An ECT2-centralspindlin complex regulates the localization and function of RhoA. J Cell Biol 170, 571-582

116

44. Liu, X. F., Ishida, H., Raziuddin, R., and Miki, T. (2004) Nucleotide exchange factor ECT2 interacts with the polarity protein complex Par6/Par3/protein kinase Czeta (PKCzeta) and regulates PKCzeta activity. Mol Cell Biol 24, 6665-6675

45. Sano, M., Genkai, N., Yajima, N., Tsuchiya, N., Homma, J., Tanaka, R., Miki, T., and Yamanaka, R. (2006) Expression level of ECT2 proto-oncogene correlates with prognosis in glioma patients. Oncol Rep 16, 1093-1098

46. Saito, S., Liu, X. F., Kamijo, K., Raziuddin, R., Tatsumoto, T., Okamoto, I., Chen, X., Lee, C. C., Lorenzi, M. V., Ohara, N., and Miki, T. (2004) Deregulation and mislocalization of the cytokinesis regulator ECT2 activate the Rho signaling pathways leading to malignant transformation. J Biol Chem 279, 7169-7179

47. Fields, A. P., and Justilien, V. (2010) The guanine nucleotide exchange factor (GEF) Ect2 is an oncogene in human cancer. Adv Enzyme Regul 50, 190-200

48. Zhou, H., Marks, J. W., Hittelman, W. N., Yagita, H., Cheung, L. H., Rosenblum, M. G., and Winkles, J. A. (2011) Development and Characterization of a Potent Immunoconjugate Targeting the Fn14 Receptor on Solid Tumor Cells. Mol Cancer Ther

49. Vigil, D., Cherfils, J., Rossman, K. L., and Der, C. J. (2010) Ras superfamily GEFs and GAPs: validated and tractable targets for cancer therapy? Nat Rev Cancer 10, 842-857

50. Lazer, G., and Katzav, S. (2011) Guanine nucleotide exchange factors for RhoGTPases: good therapeutic targets for cancer therapy? Cell Signal 23, 969-979

117

APPENDIX B - SGEF IS OVEREXPRESSED IN HIGH GRADE GLIOMAS AND PROMOTES TWEAK-FN14-INDUCED CELL MIGRATION AND

INVASION VIA TRAF2

Paper is pending publication in the Journal of Biological Chemistry

Abstract

Glioblastoma (GB) is the highest grade of primary adult brain tumors,

characterized by a poorly defined and highly invasive cell population. Importantly, these

invading cells are attributed with having a decreased sensitivity to radiation and

chemotherapy. TWEAK-Fn14 ligand-receptor signaling is one mechanism in GB that

promotes cell invasiveness and survival, and is dependent upon the activity of multiple

Rho GTPases including Rac1. Here we report that SGEF, a RhoG-specific guanine

nucleotide exchange factor (GEF), is overexpressed in GB tumors and promotes

TWEAK-Fn14-mediated glioma invasion. Importantly, levels of SGEF expression in GB

tumors inversely correlate with patient survival. SGEF mRNA expression is increased in

GB cells at the invasive rim relative to those in the tumor core, and knockdown of SGEF

expression by shRNA decreases glioma cell migration in vitro and invasion ex vivo.

Furthermore, we showed that upon TWEAK stimulation, SGEF is recruited to the Fn14

cytoplasmic tail via TRAF2. Mutation of the Fn14-TRAF domain site or depletion of

TRAF2 expression by siRNA oligonucleotides blocked SGEF recruitment to Fn14, and

inhibited SGEF activity and subsequent GB cell migration. We also showed that

knockdown of either SGEF or RhoG diminished TWEAK activation of Rac1 and

subsequent lamellipodia formation. Together, these results indicate that SGEF-RhoG is

an important downstream regulator of Fn14-driven GB cell migration and invasion.

118

Introduction

One of the key hallmarks of glioblastoma is the heightened proclivity to invade

normal brain tissue. Despite attempts at treatment with surgical resection, radiation, and

chemotherapy with the alkylating agent temozolomide, patient survival rates are less than

ten percent at five years (1). Resistance to these current treatments is inevitable with

subsequent tumor recurrence and death. Recurrent tumors develop most commonly

within two centimeters from the primary excised tumor, although single or grouped

tumor cells have frequently been observed outside this distance, as well as in the

contralateral hemisphere (2), and the possibility exists that cell invasion is an early

acquired phenotype in GB tumor formation (3). Importantly, therapy directed at

mediators of invasion has been shown to increase chemotherapeutic sensitivity (4,5) and

thus efforts are being made to identify and characterize potential drivers of cell migration.

The Rho GTPase family is comprised of critical mediators of cell migration and

invasion via cytoskeletal reorganization, most notably including Rac1, Cdc42, and RhoA

(6-8). Rho family GTPases enable downstream signaling when in their activated GTP-

bound state catalyzed by guanine nucleotide exchange factor (GEF)-mediated GTP

loading. Conversely, stimulation of Rho GTPase intrinsic GTP to GDP hydrolysis by

GTPase activating proteins (GAPs) facilitates Rho GTPase inactivation (6). To allow

activation of Rho GTPases, post-translational prenylation modifications are attached to

the carboxyl-terminal cysteine residue, the impact of which is to allow interactions with

phospholipid membranes and signaling complexes (9,10). A third category of Rho

GTPase family regulators are the guanine nucleotide dissociation inhibitors (Rho GDIs)

119

which sequester Rho GTPases in their inactive conformation in the cytosol, sequestering

their hydrophobic tail (11).

Rac1 can be activated by multiple growth factors and cytokines. One mechanism

of Rac1 activation in GB is via the tumor necrosis factor receptor superfamily 12A

(TNFRSF12A) member, known as Fn14, which has been highly characterized in GB for

its role in promoting cell migration, invasion, and survival (12-14). Ligand mediated

activation of the receptor by TWEAK, the TNF-like weak inducer of apoptosis,

specifically promotes Cdc42-dependent activation of Rac1 with subsequent robust

lamellipodia formation (15). Interestingly, while Rac1 mRNA levels are ubiquitous in

expression among many tissue types (16,17), Rac1 protein localizes in situ to the plasma

membrane in a subset of GB tumors, suggesting that heightened or constitutive Rac1

activity in this cancer promotes a malignant phenotype (18).

In several cancers, including glioblastoma, Rac1 activation has been shown to be

mediated by small Rho GTPase RhoG (19-22). Notably, a role for RhoG in promoting

GB migration and invasion has been recently described (22). RhoG protein levels are

elevated in GB (22), and RhoG has been reported to stimulate lamellipodia formation and

confer downstream activation of Rac1 with a subsequent increase in cell migration

(19,20,22,23). Mechanisms of RhoG activation and signaling in GB, however, have yet

to be characterized.

Here we show that the src-homology 3 domain containing GEF (SGEF), an

exchange factor for RhoG, is overexpressed in high-grade brain tumors and correlates

with poor patient survival. We report that SGEF activity is activated upon TWEAK

120

stimulation, and SGEF promotes TWEAK-induced RhoG-dependent Rac1 activation, as

well as TWEAK-stimulated lamellipodia formation and migration and invasion of GB

cells. The Fn14 cytoplasmic tail contains a single TNFR associated factor (TRAF)

consensus motif that has been shown to bind TRAFs 1, 2, 3, and 5, the recruitment of

which is critical to Fn14 downstream signaling (24). Analysis of the SGEF protein

sequence indicates five potential TRAF2 binding sites. We demonstrate that SGEF co-

immunoprecipitates with Fn14, and that this interaction and the promotion of downstream

signaling are dependent upon the presence of an intact TRAF binding domain on Fn14

and the recruitment of TRAF2.


Cell culture conditions. Human astrocytoma cell lines U87, U118, and T98G, as well as

HEK293 cells (American Type Culture Collection) were maintained in DMEM (Gibco,

USA) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Gibco, USA) at

37˚C with 5% CO2. For all assays with TWEAK treatment, cells were cultured in reduced

serum (0.5% fetal bovine serum) for 16 h before stimulation with recombinant TWEAK

at 100 ng/mL in DMEM + 0.1% bovine serum albumin for the indicated time.

Antibodies, plasmids, reagents, and Western blot analysis. A polyclonal SGEF

antibody was purchased from Sigma (St. Louis, MO). A monoclonal RhoG antibody and

a monoclonal tubulin antibody were purchased from Millipore (Billerica, MA).

Monoclonal anti-myc and a polyclonal antibody to TRAF2 were purchased from Cell

Signaling Technologies (Beverly, MA). Anti-HA polyclonal antibody was purchased

121

from Santa Cruz Biotechnology (Dallas, TX). Human recombinant TWEAK was

purchased from PeproTech (Rock Hill, NJ). Human placental laminin was obtained from

Sigma. Lipofectamine RNAiMax was purchased from Invitrogen (Carlsbad, CA).

Plasmids: pCMV-GST-ELMO-NT was obtained from Dr. Hironori Katoh (Kyoto

University), pGEX4T-1-RhoG(15A) was obtained from Dr. Keith Burridge (U. North

Carolina-Chapel Hill), and pCMV-SGEF-myc was obtained from Dr. Thomas Samson

(U. North Carolina-Chapel Hill). The HA epitope-tagged wild type Fn14 (Fn14wt) was

constructed by amplifying the Fn14 coding sequence by polymerase chain reaction and

ligating the product in-frame upsteam of a 3X HA epitope in pcDNA3. The Fn14 variant

designated Fn14TRAFaa containing a mutation of the TRAF binding domain

(PIEE→PIAA) was generated using the Quickchange site-directed mutagenesis kit

(Stratagene, La Jolla, CA) and the Fn14wt-HA plasmid as a template.





albumin (BSA) as a standard. Thirty micrograms of total cellular protein were loaded per

lane and separated by SDS PAGE. After transfer at 4°C, the nitrocellulose (Invitrogen)

was blocked with either 5% nonfat milk or 5% BSA in Tris-buffered saline, pH 8.0,

containing 0.1% Tween 20 (TBST) prior to addition of primary antibodies and followed

with peroxidase-conjugated anti-mouse IgG or anti-rabbit IgG. Protein bands were

122

detected using SuperSignal West Dura Chemiluminescent Substrate (Thermo Scientific)

with a UVP BioSpectrum 500 Imaging System (Upland, CA).

Expression profile dataset of SGEF in nonneoplastic brain and human gliomas.

SGEF gene expression was mined in the publicly available NCBI Gene Expression

Omnibus dataset GSE4290 containing 195 clinically annotated brain tumor specimens.

Expression values were filtered and principal component (PC) analysis to investigate the

relationship between samples was performed as previously described (14). Box plots for

SGEF expression in each survival cluster derived from PC analysis were graphed and the

significance between the two populations was tested with a two-sample t test assuming

unequal variances as previous described (14).

Immunohistochemical analysis of SGEF protein. A glioma invasion tissue microarray

and immunohistochemistry protocol used to examine SGEF expression in glioblastoma

tumor samples has been described previously (25). A scoring system of 0, negative; 1-2,

moderate; 3, strong was used to grade the staining.

Laser capture microdissection (LCM), RNA isolation, and quantitative reverse

transcriptase-polymerase chain reaction (qRT-PCR). LCM of tumor core and

invasive cells was done and total RNA was isolated as previously described (26). cDNA

was synthesized from 500 ng of total RNA in a 20 µL reaction volume using the

SuperScript III First-Strand Synthesis SuperMix Kit (Invitrogen) for 50 minutes at 50°C,

followed by 85°C for 5 minutes. qPCR analysis of SGEF (sense: 5’-TGC TGA AAG

GAC AAG GAA CA-3’; anti-sense: 5’-GTA GTT TTG ATA CAG GAC AGC ATT-3’)

and histone H3.3 (sense: 5’- CCA CTG AAC TTC TGA TTC GC-3’; anti-sense: 5’-GCG

123

TGC TAG CTG GAT GTC TT-3’) mRNA levels was conducted using SYBR green

(Roche) fluorescence for detection of amplification after each cycle with LightCycler

analysis software and quantified as previously described (12).

Lentiviral production.

Lentiviral vectors containing SGEF shRNA were obtained from Open Biosystems (Fisher

Scientific, Pittsburgh, PA). The SGEF shRNA constructs were packaged into VSV-G

pseudotyped lentiviral particles following transfection of 293T cells using the pPACKH1

packaging plasmid mix (Open Biosystems) according to the manufacturer's instructions.

For lentiviral transduction of target cells, lentiviral-containing supernatants were

collected from packaging cells at 48 and 72 hours after transfection, concentrated by PEG

precipitation, and added to subconfluent cultures of cells with 8 µg/ml polybrene for 4–6

hours. Forty-eight hours after infection, infected cells were enriched by selection with 2

µg/mL puromycin for two weeks. Confirmation of knockdown was performed by western

blot analysis.


Glioma cells stably expressing shRNA targeting SGEF or a control empty vector, or cells

that were transfected with siRNA targeting luciferase or TRAF2 at 24 h post-transfection

were plated onto 10-well glass slides precoated with 10 µg/mL laminin. Cells were

cultured in reduced serum (0.5% FBS) for an additional 16 h prior to TWEAK addition,

and migration rate was assessed over 24 h.

Organotypic brain slice invasion assay. Preparation and culture of brain slices was

carried out as described previously (28) with minor modification. Glioma cells (U87 and

124

U118) stably expressing GFP were placed bilaterally onto the putamen of 400 µm thick

slices of freshly isolated 4-6 week-old murine brains. Glioma cell invasion into the brain

slices was quantified using the LSM 5 confocal microscope and depth of invasion (z-axis

stacks) was calculated as previously described (28).

RhoG and Rac activity assay, and nucleotide-free GEF pulldowns. Activity assays for

Rac1 were done according to the protocol of the manufacturer (Pierce, Rockford, IL).

Lysates were harvested and equal concentrations of lysates were assessed for Rac

activity. RhoG activity was measured as described previously using a GST-ELMO-NT

fusion protein (22). Affinity pulldowns of active SGEF bound to RhoG were performed

using a nucleotide free RhoG mutant (G15A) expressed and purified as described (29).

Recombinant RhoG G15A-GST protein and GST-ELMO-NT (GST fusion protein

containing the N-terminal RhoG-binding domain of ELMO2, amino acids 1– 362) were

produced in Escherichia coli (BL21) cells. Cells were lysed in B-PER lysis buffer

(Pierce) containing protease inhibitors, and purified with glutathione sepharose beads

(GE Healthcare). U87 and U118 cells were grown in 10 cm dishes in reduced serum for

16 h before treatment with TWEAK for the indicated times. Subsequently equal amounts

of total GST fusion protein were then incubated with total cellular protein lysate (1 mg),

and precipitated lysates were resolved with SDS-PAGE.

Immunofluorescence. For immunofluorescence, glioma cells were transfected with

plasmids encoding Fn14wt-HA and SGEF-myc using effectene according to the protocol

of the manufacturer (Qiagen). After 24 h, cells were plated onto 10-well glass slides pre-

coated with 10 µg/mL laminin. Twenty-four hours later, cells were fixed in 4%

125

formaldehyde/PBS, permeabilized with 0.1% Triton-X100 dissolved in PBS and

incubated with anti-HA and/or anti-myc antibodies, and AlexaFluor phalloidin

(Molecular Probes) to stain for F-actin. Slides were mounted with ProLong Gold

Antifade Reagent with DAPI (Molecular Probes). Images were collected using a Zeiss

LSM 510 microscope, equipped with a 63x objective, ZEN 2009 image analysis software

and Adobe Photoshop CS3.

Quantification of lamellipodia formation. T98G glioma cells were stably transduced

with an empty lentivirus vector expressing GFP alone or with a recombinant lentivirus

expressing a shRNA targeting SGEF. For transient knockdown experiments, T98G

glioma cells were transfected with siRNA targeting luciferase, or RhoG. 24 hours after

siRNA transfection, all cells were plated onto 10-well glass slides pre-coated with 10

µg/mL laminin. Twenty-four hours later, cells were cultured in reduced serum (0.5%

FBS) for an additional 16 h prior to TWEAK stimulation for 5 minutes. Subsequently,

cells were fixed in 4% formaldehyde/PBS, permeabilized with 0.1% Triton-X100

dissolved in PBS and incubated with AlexaFluor phalloidin (Molecular Probes) to stain

for F-actin. Slides were mounted with ProLong Gold Antifade Reagent with DAPI

(Molecular Probes). Images were collected using a Zeiss LSM 510 microscope, equipped

with a 63x objective, ZEN 2009 image analysis software and Adobe Photoshop CS3. For

each experimental condition, at least twelve images were taken randomly. Lamellipodia

were traced using Image J software. For each cell, the fraction of the cell perimeter that

displayed lamellipodia was calculated.

126

Immunoprecipitation. For immunoprecipitation, cells were transfected as indicated with

1 µg of Fn14 WT-HA, Fn14 TRAFaa-HA, or SGEF-myc plasmid DNA. After 48 hours

cells were lysed on ice for 10 min in a buffer containing 10 mM Tris-HCl (pH 7.4), 0.5%

Nonidet P-40, 150 mM NaCl, 1 mM phenylmethylsulfonyl fluoride, 1 mM EDTA, 2 mM

sodium orthovanadate, 20 mM sodium fluoride, 10 µg/mL aprotinin, and 10 µg/mL

leupeptin. Equivalent amounts of protein (500 µg) were pre-cleared and

immunoprecipitated from the lysates using either TRAF2, Myc or HA antibodies as

indicated, or a control isotype-matched antibody, and then washed with lysis buffer

followed by TX-100 buffer [10 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM EDTA, 2

mM EGTA, 20 mM sodium fluoride, and 0.5% Triton X-100]. Samples were then re-

suspended in 2× SDS sample buffer and boiled in the presence of 2-mercaptoethanol

(Sigma), separated by SDS-PAGE, transferred to nitrocellulose for 1 h at 4°C, and

proteins were detected using SuperSignal West Dura Chemiluminescent Substrate

(Thermo Scientific).

Small-interfering RNA transfection. Small interfering RNA (siRNA) oligonucleotides

specific for GL2 luciferase was previously described (18). siRNA target sequences for

TRAF2 are as follows: TRAF2-1 (5’ CTG GAC CAA GAC AAG ATT GAA) and

TRAF2-2 (5’ CTG CTG CGG AGC AGA CGT GAA). Transient transfection of siRNA

was performed using Lipofectamine RNAiMax. Cells were plated at 70% confluence in

DMEM + 10% FBS without antibiotics and were transfected within 8 h of plating. The

siRNA and Lipofectamine were diluted in Opti-MEM (Gibco). After 5 min the mixtures

were combined and incubated 20 min at RT to enable complex formation. siRNA

127

oligonucleotides were transfected at 50 nM, and no cell toxicity was observed.

Maximum inhibition of protein levels was achieved 48 to 72 h post-transfection.



Results

SGEF is overexpressed in high-grade gliomas and expression correlates with poor

patient survival. To examine the expression pattern of SGEF in high grade astrocytoma,

we used a panel of publicly available grade three anaplastic astrocytoma and grade four

glioblastoma patient tissue samples versus non-neoplastic brain [National Center for

Biotechnology Information (NCBI) Gene Expression Omnibus data set GSE4290]. We

found that SGEF mRNA is significantly elevated in high-grade brain tumors relative to

non-neoplastic control tissue (Figure B.1A). Next, we assessed the levels of SGEF

mRNA on this GB database, where principle component (PC) analysis has been used to

discern possible relationships between subgroups of samples, and in which Kaplan-Meier

survival curves were developed for each PC cluster (14). One cluster had a median

survival time of 401 days (short-term survival), and the other cluster had a median

survival time of 952 days (long-term survival). Analysis of SGEF mRNA expression

showed that GB patients in the short-term survival cluster had significantly higher

expression of SGEF than GB patients in the long-term survival cluster (Figure B.1B, p <

0.001). These data suggest that increased SGEF expression correlates with poor patient

outcome.

128

To determine the levels of SGEF protein expression in GB tissue, we analyzed 43

tumors via immunohistochemistry for SGEF. Overall, the majority of GB tumor tissue

displayed elevated staining intensity (76.7%, moderate and 4.7%, strong, Figure B.1C,

panel b), whereas minimum to no SGEF staining was detected in non-neoplastic cells

including endothelial, neuronal and glial cells (Figure B.1C, panel a). To assess protein

levels of SGEF in the tumor rim versus the tumor core, four patient GB tissues were

demarcated by a board-certified pathologist as tumor core versus rim and respective cells

from each population were obtained via LCM. In three of the four cases, the levels of

SGEF mRNA were elevated 2-to-10-fold in cells from the tumor rim versus cells from

the tumor core (Figure B.2A). Collectively, these data show that elevated SGEF message

and protein expression is found in high-grade gliomas, is enriched in the invasive cell

population, and that elevated SGEF expression correlates with poor clinical outcome.

SGEF is important for TWEAK-Fn14-induced cell migration and invasion. We

have previously shown that the TWEAK-Fn14 ligand-receptor signaling axis promotes

the activation of Rac1 in GB cells, leading to increased cell migration and invasion

(14,15). To determine the role that SGEF may play in GB cell migration, we stably

transduced U87 and U118 glioma cells with lentiviruses expressing either control empty

vector or SGEF-targeting shRNA. Two independent shRNA constructs targeting SGEF

were used and the level of SGEF knockdown in both cell lines was greater than 90%

(Figure B.2B). Knockdown of SGEF expression in both U87 and U118 cells abrogated

TWEAK-induced cell migration (Figure B.2C, p < 0.01). We next investigated whether

knockdown of SGEF affects glioma invasion in an ex vivo mouse brain model. In both

129

Figure B.1. Expression profiling of SGEF in non-neoplastic brain and brain tumor

samples.

(A) Box and whisker plots of SGEF mRNA expression levels from NCBI Gene

Expression Omnibus GSE4290 (NB = non-neoplastic brain; AA = anaplastic

astrocytoma; GBM = glioblastoma multiforme). Significance between groups was tested

with a two-sample t test assuming unequal variances. (B) Principal component analysis

of brain tumors from NCBI Gene Expression Omnibus GSE4290 correlating SGEF

expression level in long term (median = 952 days) and short term (median = 401 days)

survival groups. Significance between groups was tested with a two-sample t test

assuming unequal variances. (C) Paraffin sections of an invasive glioma tissue

microarray were immunostained with a polyclonal antibody against SGEF. a,

representative SGEF immunohistochemistry micrograph of reactive tissue adjacent to

tumor. “V” indicates vessel, arrows indicate normal glial cells, and arrowheads indicate

reactive astrocytes in the tumor rim. b, representative SGEF immunohistochemistry

micrograph of tumor core.

131

U87 and U118 cells, knockdown of SGEF diminished the depth of invasion into the brain

slices (Figure B.2D, p < 0.01). These data suggest that SGEF functions within the

TWEAK-Fn14 signaling pathway to enhance glioma cell migration in vitro and promote

invasion ex vivo.

SGEF activates RhoG downstream of the TWEAK-Fn14 signaling axis. Our data

show that SGEF is overexpressed in glioblastoma and is important in TWEAK-induced

glioma cell migration. We therefore assessed whether SGEF is activated by TWEAK.

U87 glioma cells were treated with TWEAK and lysates were analyzed for levels of

active SGEF bound to RhoG G15A, a nucleotide-free mutant of RhoG with high affinity

for active GEFs (29). Upon TWEAK stimulation, a rapid increase in the level of active

SGEF was detected within two minutes and diminished after ten minutes (Figure B.3A).

SGEF is known to catalyze guanine nucleotide exchange on RhoG (30), and RhoG has

been shown to be overexpressed and activated by both EGF and HGF in glioblastoma

cells (22). We therefore assessed whether SGEF plays a role in activating RhoG

downstream of the Fn14 receptor. Similar to SGEF activation levels, RhoG activity was

sharply increased within two minutes of TWEAK activation in U118 cells, an effect that

diminished after ten minutes (Figure B.3B). To confirm whether the increase in active

RhoG upon TWEAK stimulation was dependent upon SGEF activity, we assessed RhoG

activation in U118 glioma cells with stable knockdown of SGEF protein. Knockdown of

SGEF abrogated TWEAK-stimulated RhoG activity (Figure B.3C). Together, these data

demonstrate that SGEF activates RhoG downstream of TWEAK and Fn14.

132

Figure B.2. SGEF expression is increased in the rim of GB tumor specimens and

knockdown of SGEF expression suppresses glioma cell migration and invasion.

(A) qRT-PCR analysis of SGEF mRNA expression from patient tumor samples laser

capture micro-dissected for either the core (C) or rim (R) tumor population. (B) U87 or

U118 cells were stably transduced with two independent lentivirus encoding shRNA

targeting SGEF (SGEF-12 & SGEF-13) or an empty vector (Ctrl) and cell lysates

immunoblotted for SGEF. (C) U87 and U118 glioma cells stably transduced with shRNA

targeting either SGEF (SGEF-12 & SGEF-13) or an empty vector (Ctrl) were seeded onto

10-well glass slides pre-coated with 10 µg/ml human laminin. Cells were either left

untreated or TWEAK stimulated and cell migration was assessed over 24h. Data

represents the average of 10 replicates (*, ** = p < 0.01). (D) U87 and U118 glioma cells

stably transduced with shRNA targeting either SGEF (SGEF-12 & SGEF-13) or empty

vector (Ctrl) were implanted into the bilateral putamen of murine organotypic brain slices

and observed at 48 hours. The depth of invasion was calculated from Z-axis images

collected by confocal laser scanning microscopy. Data represents the average of 9

replicates (* = p < 0.01).

134

Figure B.3. TWEAK-Fn14 signaling activates SGEF and the SGEF dependent

activation of RhoG.

(A) U87 glioma cells were cultured in reduced serum (0.5% FBS) overnight then treated

with TWEAK for the indicated times. SGEF activation in control and treated cell lysates

was assessed using RhoG G15A-GST constructs. (B) U118 glioma cells were cultured

in reduced serum (0.5% FBS) overnight then treated with TWEAK for the indicated

times. RhoG activation in control and treated cell lysates was assessed using GST-

ELMO-NT constructs. (C) U118 glioma cells stably transduced with an empty lentivirus

vector (Ctrl) or shRNA targeting SGEF (SGEF-12) were cultured overnight in reduced

serum (0.5% FBS) and either left untreated or TWEAK treated for 2 minutes. Levels of

active RhoG in control and treated cell lysates were assessed using GST-ELMO-NT.

Data are representative of two independent experiments.

136

TWEAK-Fn14-stimulated activation of Rac1 is dependent upon SGEF and RhoG

function. SGEF has been shown to exchange for RhoG (30). Since RhoG is known to

directly bind ELMO as a downstream effector in its activated state, and the ELMO-

Dock180 GEF complex has been shown to confer guanine nucleotide exchange directly

for Rac1 downstream of RhoG activation (20,21,23), we therefore sought to determine

whether TWEAK-induced activation of SGEF and RhoG modulated downstream Rac1

activation. TWEAK induction of Rac1 activity was diminished in U118 and U87 cells

with stable knockdown of SGEF expression compared to control cells (Figure B.4A).

Furthermore, transfection of U87 glioma cells with a siRNA targeting RhoG (Figure

B.4B) abrogated TWEAK-induced Rac1 activity in a similar fashion to SGEF depletion.

Thus, increased Rac1 activity induced by TWEAK-Fn14 signaling is dependent upon

SGEF and RhoG activity.

Depletion of SGEF and RhoG suppresses TWEAK-induced lamellipodia formation.

Activated RhoG and Rac1 are known to promote actin cytoskeletal rearrangement

resulting in lamellipodia formation (31). To determine the role of SGEF and RhoG in the

regulation of lamellipodia, we treated T98G glioma cells, which display robust

lamellipodia formation, with TWEAK and stained cells for filamentous actin using

phalloidin. The addition of TWEAK to T98G cells transduced with a control shRNA or

transfected with a control siRNA robustly induced lamellipodia formation (Figure B.5A,

panels b & e arrows, respectively, p<0.01) relative to untreated cells (Figure B.5A, panels

a & d, respectively). In contrast, stable knockdown of SGEF or knockdown of RhoG by

transient transfection with siRNA (Figure B.5D) abrogated lamellipodia formation

137

Figure B.4. TWEAK-Fn14 activation of Rac1 is dependent upon SGEF and RhoG.

(A) U87 & U118 glioma cells stably expressing either control empty vector (Ctrl) or

shRNA targeting SGEF (SGEF-12) were cultured overnight in reduced serum medium

(0.5% FBS). Cells were left untreated or treated with TWEAK for 5 minutes. Cells were

lysed and assessed for levels of active Rac1. (B) U87 glioma cells were transfected with

one of two independent siRNA oligonucleotides targeting RhoG (RhoG-1 & RhoG-2), or

with siRNA targeting non-mammalian luciferase (Ctrl), or left untreated (NT). After 72

hours, cell lysates were immunoblotted with the indicated antibodies. (C) U87 glioma

cells were transfected with siRNA targeting non-mammalian luciferase (Ctrl), or with a

siRNA oligonucleotide targeting RhoG (RhoG-2). 48 hours after transfection, cells were

cultured an additional 16 hours overnight in reduced serum medium (0.5% FBS) prior to

addition of TWEAK treatment for 5 minutes in the indicated samples. Cells were lysed

and assessed for levels of Rac1 activity. Data are representative of two independent

experiments.

139

following TWEAK stimulation (Figure B.5A, panels c & f, and Figure B.5B & C, both

respectively, p < 0.01). Both SGEF and RhoG, therefore play an important role in the

promotion of TWEAK-Fn14-induced actin cytoskeleton rearrangement, lamellipodia

formation, and invasive behavior.

SGEF binding to the Fn14 cytoplasmic tail requires an intact TRAF domain. To

determine whether SGEF binds to the Fn14 cytoplasmic tail, we transfected HEK293

cells with both Fn14 wild-type (Fn14WT-HA) and SGEF-myc (Figure B.9C) and

performed co-immunoprecipitation. Cellular lysates immunoprecipitated with anti-myc

antibody showed the presence of Fn14 as assessed by HA immunoblot analysis (Figure

B.9D), indicating that SGEF binds in complex with Fn14.

Fn14 downstream signaling, including the activation of NF-κB, has been shown

to depend on an intact TRAF binding site (13,24). Using a functional site prediction

analysis algorithm, we observed that SGEF contains five TRAF2 binding consensus

motifs of the pattern (P/S/A/T/)X(Q/E)E. The five TRAF2 consensus sites in SGEF

include TPEE (aa 157-160), PSQE (aa 221-224), AGEE (aa 292-295), SDEE (aa 392-

395), and SQEE (aa 434-437), all of which are located N-terminal to the GEF canonical

DH-PH domains (Figure B.6A). To determine whether the TRAF binding site on Fn14 is

required for SGEF recruitment to its cytoplasmic tail, we mutated the TRAF binding

domain of Fn14 (Fn14TRAFaa-HA) and assessed SGEF binding by co-

immunoprecipitation. As expected, Fn14 wild-type was present in the anti-TRAF2

immunoprecipitate, however, mutation of the TRAF2 binding site in the Fn14TRAFaa

construct prevented its co-immunoprecipitation with TRAF2 (Figure B.6C). Furthermore,

140

Figure B.5. TWEAK-induced lamellipodia formation in glioma cells requires the

function of SGEF and RhoG.

T98G glioma cells were stably transduced with lentivirus encoding shRNA targeting

SGEF (SGEF-12) or an empty vector (Ctrl). Additionally, T98G glioma cells were

transfected with siRNA targeting either control non-mammalian luciferase (ctrl), or

RhoG (RhoG-2). After 24 h of siRNA transfection, all cells were seeded onto 10-well

glass slides pre-coated with 10 µg/ml human laminin. Cells were further grown for 24

additional hours and then cultured in reduced serum medium (0.5% FBS) for 16 h. Cells

were either left untreated or treated with TWEAK (5 min) and stained for filamentous

actin using AlexaFluor-phallodin. (A) Representative images of empty vector ctrl non-

treated cells (panel a), TWEAK-treated cells (panel b), or TWEAK-treated cells with

knockdown of SGEF (panel c). Additionally, representative images of control luciferase

transfected non-treated (panel d), or TWEAK-treated (panel e) cells as well as TWEAK-

treated cells after siRNA depletion of RhoG (panel f) are shown. Arrows indicate

lamellipodia. (B) Quantification of lamellipodia formation in T98G with and without

SGEF knockdown. (C) Quantification of lamellipodia formation in control and RhoG

knockdown T98G cells. Data represents the average of at least twelve cells per condition

(*, ** = p < 0.01). (D) Immunblot analysis (upper panel) of T98G cells stably transduced

with lentivirus empty vector (Ctrl) or lentivirus encoding shRNA targeting SGEF (SGEF-

12) or (lower panel) T98G cells transfected with siRNA targeting either luciferase (Ctrl)

or RhoG (RhoG-2).

142

immunoprecipitation with TRAF2 in cells co-transfected with both Fn14 wild-type and

SGEF indicated that both Fn14 and SGEF co-immunoprecipitate in complex with TRAF2

(Figure B.6D). Interestingly, SGEF did not co-immunoprecipitate with the Fn14TRAFaa

mutant, suggesting that the TRAF binding domain of Fn14 is required for SGEF binding

(Figure B.6E). The reverse immunoprecipitation for HA also demonstrated that SGEF

robustly co-immunoprecipitated with Fn14WTbut did not readily co-immunoprecipitate

with the Fn14TRAFaa mutant (Figure B.6F). Therefore, recruitment of SGEF to Fn14

requires an intact TRAF binding domain.

TWEAK-Fn14 induced activation of SGEF and stimulation of migration is

dependent upon TRAF2. We next sought to determine the requirement of TRAF2 in

SGEF activation downstream of TWEAK-Fn14 signaling based upon the predicted

TRAF2 binding sites in the SGEF protein (Figure B.6A). Using two independent siRNA

oligonucleotides targeting TRAF2, (Figure B.7A), we assessed TWEAK stimulation of

SGEF activity in U87 glioma cells following knockdown of TRAF2. In control cells,

TWEAK stimulation increased the amount of SGEF bound to the RhoG G15A

nucleotide-free construct relative to un-stimulated cells. Conversely, knockdown of

TRAF2 decreased the amount of SGEF bound to RhoG G15A under TWEAK treatment

to baseline levels (Figure B.7B). Therefore, TRAF2 is necessary for the TWEAK-

induced increase in SGEF activity. Furthermore, targeted depletion of TRAF2 protein

significantly abrogated TWEAK-induced glioma cell migration in both U87 and U118

cells (Figure B.7C), supporting the role of TRAF2 recruitment in the TWEAK-Fn14-

stimulated migratory phenotype of GB.

143

Figure B.6. SGEF and Fn14 interaction is dependent upon a functional TRAF

domain.

(A) The SGEF protein contains fiveTRAF2 binding consensus motifs of the pattern

(P/S/A/T/)X(Q/E)E, including TPEE (aa 157-160), PSQE (aa 221-224), AGEE (aa 292-

295), SDEE (aa 392-395), and SQEE (aa 434-437). (B) Whole cell lysates of HEK293

cells transiently transfected with plasmids encoding Fn14wt-HA, Fn14TRAFaa-HA, or

SGEF-myc were immunoblotted as indicated. (C) Whole cell lysates of HEK293 cells

transiently transfected with plasmids encoding Fn14wt-HA or Fn14TRAFaa were

collected and pre-cleared, followed by immunoprecipitation using antibodies as indicated

for anti-TRAF2 or control IP (Ctrl), and resolution via SDS-PAGE analysis using an anti-

HA antibody. (D) Whole cell lysates of HEK293 cells transiently transfected with

plasmids encoding Fn14wt-HA or SGEF-myc were collected and pre-cleared, followed

by immunoprecipitation using antibodies as indicated for anti-TRAF2 or control IP (Ctrl),

and resolution via SDS-PAGE analysis using anti-myc and anti-HA antibodies. (E & F)

HEK293 cells transiently transfected with plasmids encoding Fn14wt-HA, Fn14TRAFaa,

or SGEF-myc were collected and pre-cleared, followed by immunoprecipitation using

antibodies as indicated for anti-myc(E), anti-HA (F), or control IP (Ctrl), and resolution

via SDS-PAGE analysis using an anti-HA (E) or anti-myc (F) antibody.

145

Figure B.7. TWEAK-induced activation of SGEF and stimulation of migration

require TRAF2 function.

(A) U87 and U118 glioma cells were transfected with one of two independent siRNA

oligonucleotides targeting TRAF2 (TRAF2-1 & TRAF2-2), or with siRNA targeting non-

mammalian luciferase (Ctrl). After 72 hours, cells were lysed and lysates were

immunoblotted as indicated. (B) U87 glioma cells were transiently transfected with

siRNA targeting non-mammalian luciferase (Ctrl) or TRAF2 (TRAF2-1) for 48 hours.

Cells were then serum reduced (0.5% FBS) for an additional 16 hours and treated with

TWEAK for 2 minutes. SGEF activation in cell lysates was assessed using RhoG G15A-

GST constructs. (C) U87 and U118 cells were transiently transfected with siRNA

targeting non-mammalian luciferase (Ctrl) or two independent siRNA oligonucleotides

targeting TRAF2 (TRAF2-1 & TRAF2-2). After 24 hours cells were plated on glass

slides pre-coated with 10 µg/mL laminin, and cultured an additional 16 hours in reduced

serum (0.5% FBS) medium. Cells were either left untreated or treated with TWEAK and

glioma cell migration was assessed over 24 hours. Data represents the average of 10

replicates (* = p < 0.01).

147

Discussion

In this study, we report the importance of SGEF and RhoG signaling downstream

of TWEAK-Fn14 in promoting glioblastoma cell invasion. Levels of SGEF mRNA and

protein expression are significantly elevated in high-grade brain tumors relative to non-

neoplastic brain tissue, and elevated expression in GB samples correlates with a poorer

patient prognosis. Our data are consistent with data in the Human Protein Atlas

(www.proteinatlas.org), a publicly available portal with protein expression profiles across

human tumors, where SGEF protein staining is stronger in both glioma and liver cancer

tissues relative to normal organ tissue staining. Furthermore, SGEF expression is

elevated in cells found at the invasive edge, or rim of GB tumor specimens relative to

tumor core cells. SGEF has been shown to have the ability to confer cell invasiveness

during HPV-mediated transformation and to direct actin cytoskeleton remodeling

following infection with salmonella and in leukocyte trans-endothelial migration (30,32-

34). We have previously reported that glioma cells with the increased capacity for

migration have a decreased expression of pro-apoptotic genes and are coincidently less

sensitive to cytotoxic therapy induced apoptosis (13,14,26,35,36), arguing for a more

detailed characterization and new therapeutic strategies for the invasive cell population.

Moreover, we demonstrated that knockdown of SGEF protein inhibits TWEAK-Fn14

stimulated cell migration and invasion. Therefore, elevated SGEF signaling may

contribute to the invasive behavior of GB cells and this data highlights the potential for

targeted therapy development.

148

In glioblastoma, the Fn14 receptor is significantly overexpressed, and glioma cells

with an increased migratory capacity display elevated levels of Fn14 (12). Our data

demonstrate that TWEAK activates SGEF, followed by RhoG and subsequent Rac1

activation in glioblastoma cells. Moreover, loss of SGEF or RhoG protein inhibits

TWEAK-Fn14-induced lamellipodia formation, which is consistent with the ability of

SGEF to promote TWEAK stimulation of glioma cell migration and downstream Rac1

activation. This data corroborates our previous finding that TWEAK-Fn14 increased cell

migration is dependent on Rac1 activation (14). RhoG signaling has been described to

occur in both Rac1-dependent and -independent manners with these two GTPases sharing

overlapping signal transduction pathways (23,31,37,38). Our data support a role for

RhoG upstream of Rac1 that is dependent upon TWEAK-Fn14 stimulation of SGEF

activity.

Several studies have linked the ability of RhoG to confer downstream activation

of Rac1 with a subsequent increase in cell migration via nucleotide exchange by the

bipartite GEF Engulfment and Motility-Dedicator of Cytokinesis 180 (ELMO-Dock180)

(19,20,23). The Dock180 superfamily of proteins is an unconventional family of Rho

GTPase-specific GEFs, containing a conserved “Dock Homology Region-2” (DHR-2) or

“Docker” domain as opposed to the characteristic GEF Dbl homology (DH) domain for

catalytic nucleotide exchange (39,40), and requires the interaction with the pleckstrin

homology (PH) domain of ELMO. ELMO is a direct effector of RhoG (23). It is

possible that the dependence of TWEAK-Fn14 induced Rac1 activity on the presence of

149

SGEF and RhoG may utilize the ELMO-Dock180 GEF to facilitate guanine nucleotide

exchange for Rac1. This possibility is the focus of future studies.

We have previously shown that immunoprecipitates of Fn14 contain Rac1, and

that this interaction is dependent upon the presence of a functional Fn14 cytoplasmic tail.

The deletion of the TRAF binding site from the cytoplasmic domain results in the loss of

Fn14-Rac1 co-immunoprecipitation (14). Here we have assessed the mechanism by

which SGEF is recruited to the Fn14 cytoplasmic domain. Using predicted site analysis,

we observed that SGEF contains five TRAF2 consensus binding sites and demonstrated

that SGEF activity downstream of TWEAK-Fn14 requires the presence of a functional

TRAF binding site in the Fn14 cytoplasmic domain. Specifically, loss of TRAF2

decreases the induced levels of SGEF activity following TWEAK stimulation indicating

a requirement for TRAF2 in this signaling axis. Signaling through TRAF2, but not

TRAF1 or TRAF3, is known to promote NF-κB activity, and TRAF2 is also responsible

for promoting JNK/SAPK activity, inflammation, cell migration and chemo- and radio-

resistance of cancer cells (41-47). The specific depletion of TRAF2 in GB has been

shown to inhibit growth and confer radio-sensitization to tumor cells (48). Similarly,

signaling through Fn14 by TWEAK in glioma results in increased resistance to cytotoxic

therapy-induced apoptosis and enhanced survival via TRAF recruitment and Rac1

dependent NF-κB activation (13,14,24,36), and furthermore RhoG has been shown to

promote the activation of NF-κB (49). Thus, TRAF2 and SGEF interaction may be

necessary in the TWEAK-Fn14-TRAF signaling axis resulting in increased levels of NF-

κB activity.

150

Activated Rho GTPases are localized at the plasma membrane in close proximity

with signaling complexes (50,51). We found that the SGEF and Fn14 proteins co-

localize to areas of induced membrane ruffling (Figure B.9B). Notably, transfection of

the SGEF-myc plasmid alone into HEK293 cells resulted in robust membrane ruffling

(Figure B.9A). Furthermore, immunoprecipitation analysis demonstrated that SGEF co-

immunoprecipitated with Fn14 from cells co-expressing SGEF and Fn14 (Figure B.9D).

Thus, SGEF binds to the Fn14 receptor complex and co-localizes with Fn14 at the

leading edge of cells. Interestingly, even though levels of active SGEF are dependent

upon the presence of TRAF2, we found that the forced expression of SGEF alongside

expression of Fn14TRAFaa is still predominantly found at the cell edge (data not shown).

Other studies have also provided evidence that the overexpression of SGEF alone can

induce membrane ruffling in fibroblasts and co-localization with filamentous actin (30),

thus further supporting the role of SGEF in modulating cytoskeletal dynamics.

New treatment strategies are needed to cure glioblastoma. Patient prognosis

remains poor and actively invading cells survive current therapeutic regimens.

Importantly, therapy directed at mediators of invasion has been shown to increase

chemotherapeutic sensitivity (4,5). Our data support a role for SGEF and RhoG

activation and signaling downstream of the TWEAK-Fn14 axis to confer increased Rac1

activity and promote GB cell migration and invasion dependent upon TRAF2 recruitment

(Figure B.8). Together, these data provide a rationale for the targeting of this signaling

axis as an adjuvant therapy in glioblastoma to limit dispersion of malignant cells and

increase susceptibility to traditional radiation and chemotherapies. The role of SGEF in

151

Figure B.8. Schematic model of TWEAK-Fn14 signaling via SGEF and RhoG to

drive glioma migration/invasion.

TWEAK ligand binding to the Fn14 receptor results in the activation of RhoG by the

SGEF guanine nucleotide exchange factor. SGEF-RhoG signaling results in the

activation of Rac1 via additional guanine nucleotide exchange promoting cytoskeletal

reorganization and glioma cell migration and invasion.

152

Figure B.9. SGEF induces membrane ruffles and both co-localizes and co-

immunoprecipitates with Fn14.

(A) Non-transfected HEK293 (top panel) or HEK293 cells transiently transfected with

SGEF-myc plasmid DNA for 48 hours (bottom panel) were plated onto glass coverslips

coated with 10 µg/mL laminin and stained for actin (phalloidin) and myc. Arrows

represent membrane ruffling and areas of actin-SGEF co-localization. (B) HEK293 cells

were co-transfected with plasmids encoding Fn14wt-HA and SGEF-Myc. After 24 hours

cells, were plated on glass slides pre-coated with 10 µg/mL laminin and allowed to grow

for an additional 24 hours. Cells were stained with antibodies against HA and Myc. (C)

Immunoblot of whole cell lysates of HEK293 cells co-transfected with plasmids

encoding Fn14wt-HA and SGEF-myc. (D) HEK293 cells co-transfected with Fn14-HA

and SGEF-myc were lysed, lysates pre-cleared, and immunoprecipitated with antibodies

as indicated for anti-myc or control IP (Ctrl). Precipitates were immunoblotted as

indicated.

154

other disease processes is also emerging. SGEF has recently been shown to contribute to

the formation of atherosclerosis by promoting endothelial docking structures for

leukocytes at areas of inflammation (52). Thus SGEF presents a therapeutic target for

atherosclerosis and in the present study we validated SGEF as a target for glioblastoma.

Acknowledgements

This work is supported by NIH grants R01 CA130940 (N.L. Tran), the ARCS Foundation

Eller Scholarship and Science Foundation Arizona Fellowship (S.P. Fortin Ensign). The

authors would like to thank Dr. Hironori Katoh (Kyoto University) for the gift of the

pCMV-GST-ELMO-NT plasmid, and Drs. Keith Burridge and Thomas Samson

(University of North Carolina, Chapel Hill) for the gift of the pGEX4T-1-RhoG(15A)

and pCMV-SGEF-myc plasmids, respectively. The authors would also like to thank

Molly Kupfer for technical support.

155

References

1. Stupp, R., Hegi, M. E., Mason, W. P., van den Bent, M. J., Taphoorn, M. J., Janzer, R. C., Ludwin, S. K., Allgeier, A., Fisher, B., Belanger, K., Hau, P., Brandes, A. A., Gijtenbeek, J., Marosi, C., Vecht, C. J., Mokhtari, K., Wesseling, P., Villa, S., Eisenhauer, E., Gorlia, T., Weller, M., Lacombe, D., Cairncross, J. G., and Mirimanoff, R. O. (2009) Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial. Lancet Oncol 10, 459-466

2. Burger, P. C., Heinz, E. R., Shibata, T., and Kleihues, P. (1988) Topographic anatomy and CT correlations in the untreated glioblastoma multiforme. J Neurosurg 68, 698-704

3. Sampetrean, O., Saga, I., Nakanishi, M., Sugihara, E., Fukaya, R., Onishi, N., Osuka, S., Akahata, M., Kai, K., Sugimoto, H., Hirao, A., and Saya, H. (2011) Invasion precedes tumor mass formation in a malignant brain tumor model of genetically modified neural stem cells. Neoplasia 13, 784-791





156

8. Ridley, A. J., and Hall, A. (1992) The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 70, 389-399

9. Ando, S., Kaibuchi, K., Sasaki, T., Hiraoka, K., Nishiyama, T., Mizuno, T., Asada, M., Nunoi, H., Matsuda, I., Matsuura, Y., and et al. (1992) Post-translational processing of rac p21s is important both for their interaction with the GDP/GTP exchange proteins and for their activation of NADPH oxidase. The Journal of biological chemistry 267, 25709-25713

10. Seabra, M. C. (1998) Membrane association and targeting of prenylated Ras-like GTPases. Cellular signalling 10, 167-172

11. Olofsson, B. (1999) Rho guanine dissociation inhibitors: pivotal molecules in cellular signalling. Cellular signalling 11, 545-554




15. Fortin, S. P., Ennis, M. J., Schumacher, C. A., Zylstra-Diegel, C. R., Williams, B. O., Ross, J. T., Winkles, J. A., Loftus, J. C., Symons, M. H., and Tran, N. L. (2012) Cdc42 and the Guanine Nucleotide Exchange Factors Ect2 and Trio

157

Mediate Fn14-Induced Migration and Invasion of Glioblastoma Cells. Molecular cancer research : MCR

16. Didsbury, J., Weber, R. F., Bokoch, G. M., Evans, T., and Snyderman, R. (1989) rac, a novel ras-related family of proteins that are botulinum toxin substrates. J Biol Chem 264, 16378-16382

17. Bosco, E. E., Mulloy, J. C., and Zheng, Y. (2009) Rac1 GTPase: a "Rac" of all trades. Cell Mol Life Sci 66, 370-374


19. Hiramoto, K., Negishi, M., and Katoh, H. (2006) Dock4 is regulated by RhoG and promotes Rac-dependent cell migration. Experimental cell research 312, 4205-4216

20. Katoh, H., Hiramoto, K., and Negishi, M. (2006) Activation of Rac1 by RhoG regulates cell migration. J Cell Sci 119, 56-65



23. Katoh, H., and Negishi, M. (2003) RhoG activates Rac1 by direct interaction with the Dock180-binding protein Elmo. Nature 424, 461-464

24. Brown, S. A., Richards, C. M., Hanscom, H. N., Feng, S. L., and Winkles, J. A. (2003) The Fn14 cytoplasmic tail binds tumour-necrosis-factor-receptor-

158

associated factors 1, 2, 3 and 5 and mediates nuclear factor-kappaB activation. Biochem J 371, 395-403

25. Fortin, S. P., Ennis, M. J., Savitch, B. A., Carpentieri, D., McDonough, W. S., Winkles, J. A., Loftus, J. C., Kingsley, C., Hostetter, G., and Tran, N. L. (2009) Tumor necrosis factor-like weak inducer of apoptosis stimulation of glioma cell survival is dependent on Akt2 function. Mol Cancer Res 7, 1871-1881

26. Hoelzinger, D. B., Mariani, L., Weis, J., Woyke, T., Berens, T. J., McDonough, W. S., Sloan, A., Coons, S. W., and Berens, M. E. (2005) Gene expression profile of glioblastoma multiforme invasive phenotype points to new therapeutic targets. Neoplasia 7, 7-16


28. Nakada, M., Niska, J. A., Miyamori, H., McDonough, W. S., Wu, J., Sato, H., and Berens, M. E. (2004) The phosphorylation of EphB2 receptor regulates migration and invasion of human glioma cells. Cancer Res 64, 3179-3185


30. Ellerbroek, S. M., Wennerberg, K., Arthur, W. T., Dunty, J. M., Bowman, D. R., DeMali, K. A., Der, C., and Burridge, K. (2004) SGEF, a RhoG guanine nucleotide exchange factor that stimulates macropinocytosis. Mol Biol Cell 15, 3309-3319

31. Prieto-Sanchez, R. M., and Bustelo, X. R. (2003) Structural basis for the signaling specificity of RhoG and Rac1 GTPases. The Journal of biological chemistry 278, 37916-37925

32. Krishna Subbaiah, V., Massimi, P., Boon, S. S., Myers, M. P., Sharek, L., Garcia-Mata, R., and Banks, L. (2012) The invasive capacity of HPV transformed cells requires the hDlg-dependent enhancement of SGEF/RhoG activity. PLoS Pathog 8, e1002543

159

33. Patel, J. C., and Galan, J. E. (2006) Differential activation and function of Rho GTPases during Salmonella-host cell interactions. J Cell Biol 175, 453-463

34. van Buul, J. D., Allingham, M. J., Samson, T., Meller, J., Boulter, E., Garcia-Mata, R., and Burridge, K. (2007) RhoG regulates endothelial apical cup assembly downstream from ICAM1 engagement and is involved in leukocyte trans-endothelial migration. J Cell Biol 178, 1279-1293

35. Mariani, L., Beaudry, C., McDonough, W. S., Hoelzinger, D. B., Demuth, T., Ross, K. R., Berens, T., Coons, S. W., Watts, G., Trent, J. M., Wei, J. S., Giese, A., and Berens, M. E. (2001) Glioma cell motility is associated with reduced transcription of proapoptotic and proliferation genes: a cDNA microarray analysis. J Neurooncol 53, 161-176

36. Kislin, K. L., McDonough, W. S., Eschbacher, J. M., Armstrong, B. A., and Berens, M. E. (2009) NHERF-1: modulator of glioblastoma cell migration and invasion. Neoplasia 11, 377-387

37. Wennerberg, K., Ellerbroek, S. M., Liu, R. Y., Karnoub, A. E., Burridge, K., and Der, C. J. (2002) RhoG signals in parallel with Rac1 and Cdc42. J Biol Chem 277, 47810-47817

38. Gauthier-Rouviere, C., Vignal, E., Meriane, M., Roux, P., Montcourier, P., and Fort, P. (1998) RhoG GTPase controls a pathway that independently activates Rac1 and Cdc42Hs. Molecular biology of the cell 9, 1379-1394

39. Cote, J. F., and Vuori, K. (2002) Identification of an evolutionarily conserved superfamily of DOCK180-related proteins with guanine nucleotide exchange activity. J Cell Sci 115, 4901-4913

40. Brugnera, E., Haney, L., Grimsley, C., Lu, M., Walk, S. F., Tosello-Trampont, A. C., Macara, I. G., Madhani, H., Fink, G. R., and Ravichandran, K. S. (2002) Unconventional Rac-GEF activity is mediated through the Dock180-ELMO complex. Nat Cell Biol 4, 574-582

41. Yang, H. J., Youn, H., Seong, K. M., Jin, Y. W., Kim, J., and Youn, B. (2012) Phosphorylation of ribosomal protein S3 and anti-apoptotic TRAF2 mediates

160

radioresistance in non-small cell lung cancer cells. The Journal of biological chemistry

42. Lin, W. J., Su, Y. W., Lu, Y. C., Hao, Z., Chio, II, Chen, N. J., Brustle, A., Li, W. Y., and Mak, T. W. (2011) Crucial role for TNF receptor-associated factor 2 (TRAF2) in regulating NFkappaB2 signaling that contributes to autoimmunity. Proceedings of the National Academy of Sciences of the United States of America 108, 18354-18359

43. Jang, K. W., Lee, K. H., Kim, S. H., Jin, T., Choi, E. Y., Jeon, H. J., Kim, E., Han, Y. S., and Chung, J. H. (2011) Ubiquitin ligase CHIP induces TRAF2 proteasomal degradation and NF-kappaB inactivation to regulate breast cancer cell invasion. J Cell Biochem 112, 3612-3620

44. Natoli, G., Costanzo, A., Guido, F., Moretti, F., Bernardo, A., Burgio, V. L., Agresti, C., and Levrero, M. (1998) Nuclear factor kB-independent cytoprotective pathways originating at tumor necrosis factor receptor-associated factor 2. The Journal of biological chemistry 273, 31262-31272

45. Rothe, M., Sarma, V., Dixit, V. M., and Goeddel, D. V. (1995) TRAF2-mediated activation of NF-kappa B by TNF receptor 2 and CD40. Science 269, 1424-1427

46. Liu, Z. G., Hsu, H., Goeddel, D. V., and Karin, M. (1996) Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-kappaB activation prevents cell death. Cell 87, 565-576

47. Natoli, G., Costanzo, A., Ianni, A., Templeton, D. J., Woodgett, J. R., Balsano, C., and Levrero, M. (1997) Activation of SAPK/JNK by TNF receptor 1 through a noncytotoxic TRAF2-dependent pathway. Science 275, 200-203

48. Zheng, M., Morgan-Lappe, S. E., Yang, J., Bockbrader, K. M., Pamarthy, D., Thomas, D., Fesik, S. W., and Sun, Y. (2008) Growth inhibition and radiosensitization of glioblastoma and lung cancer cells by small interfering RNA silencing of tumor necrosis factor receptor-associated factor 2. Cancer research 68, 7570-7578

161

49. Murga, C., Zohar, M., Teramoto, H., and Gutkind, J. S. (2002) Rac1 and RhoG promote cell survival by the activation of PI3K and Akt, independently of their ability to stimulate JNK and NF-kappaB. Oncogene 21, 207-216

50. Ridley, A. J. (2006) Rho GTPases and actin dynamics in membrane protrusions and vesicle trafficking. Trends Cell Biol 16, 522-529

51. DerMardirossian, C., and Bokoch, G. M. (2005) GDIs: central regulatory molecules in Rho GTPase activation. Trends Cell Biol 15, 356-363

52. Samson, T., van Buul, J. D., Kroon, J., Welch, C., Bakker, E. N., Matlung, H. L., van den Berg, T. K., Sharek, L., Doerschuk, C., Hahn, K., and Burridge, K. (2013) The Guanine-Nucleotide Exchange Factor SGEF Plays a Crucial Role in the Formation of Atherosclerosis. PLoS One 8, e55202

162

APPENDIX C - SGEF EXPRESSION IS REGULATED VIA TWEAK-FN14 SIGNALING THROUGH NF-ΚB AND PROMOTES CELL SURVIVAL IN

GLIOBLASTOMA

Paper was prepared to submit to a biological sciences journal not yet determined

Abstract


brain tumors. Despite surgical removal followed by concomitant radiation and

chemotherapy with the alkylating agent temozolomide (TMZ), GB tumors develop

treatment resistance and ultimately recur. Impaired response to treatment occurs rapidly

conferring a median survival of just fifteen months. Thus, it is necessary to identify the

genetic and signaling mechanisms that promote tumor resistance in order to develop

targeted therapies to combat this refractory setting. We have previously reported the

SGEF guanine nucleotide exchange factor (GEF) to be overexpressed in GB tumors and

play an important role in promoting TWEAK-Fn14 mediated glioma invasion. Here we

report a role for SGEF, a RhoG specific GEF, in glioma survival. A genome-wide

determination of NF-κB controlled genes in TMZ-resistant primary GB tumor grafts

(GB14-TMZ-R) revealed an increased occupancy of NF-κB on the SGEF gene promoter

region via ChIP-on-chip analysis. Importantly, SGEF mRNA expression is elevated in

TMZ-resistant primary GB tumor grafts compared to those with known TMZ sensitivity.

SGEF mRNA and protein expression are regulated by the TWEAK-Fn14 signaling axis

in an NF-κB dependent manner and inhibition of SGEF expression via shRNA shutdown

sensitizes glioma cells to TMZ-induced apoptosis and suppresses colony formation

following TMZ insult. Furthermore, gene expression analysis of SGEF depleted GB cells

163

revealed altered expression of a network of DNA repair and survival genes, including

DCLRE1C, BRCA2, XIAP, ATM, ATR, and GEN1, among others. Understanding the

role of SGEF in promoting chemotherapeutic resistance may direct the development of

novel targeted therapeutics for TMZ refractory, invasive GB cells.

Introduction

Glioblastoma (GB) is the most common form of primary adult brain tumors

characterized by a poorly defined tumor mass resulting from highly invasive cells. The

problem of resistance to the standard anti-proliferative treatment of concomitant

radiotherapy with chemotherapy using the alkylating agent temozolomide (TMZ) is

common, and actively invading cells survive the current therapeutic regimens. Glioma

cells with the increased capacity for migration have a decreased expression of pro-

apoptotic genes and are less sensitive to cytotoxic therapy induced apoptosis (1-5); the

knockdown of several pro-invasive gene candidates in GB decreases glioma cell

migration rate and subsequently sensitizes the cells to cytotoxic therapy and importantly,

therapy directed at mediators of invasion has been shown to increase chemotherapeutic

sensitivity (6,7).

An increased capacity for cell survival results from the multi-faceted regulation of

pathways involved in promoting cell growth, replication and spread, and in importantly

preventing apoptosis in response to cytotoxic insult (8). Treatment strategies of tumor

irradiation and temozolomide administration in glioblastoma both lead to the formation

of DNA double strand breaks (DSBs), either directly, or via mismatch repair conversion

164

of O(6)-methylguanine adducts into DSBs, respectively (9). DSBs are primarily repaired

through two mechanisms, homologous recombination (HR) and non-homologous end-

joining (NHEJ). HR repair makes use of a non-damaged homologous DNA template,

and thus is characterized as an error free mechanism, while NHEJ has no homologous

strand for template use leading to error development resulting in sequence modification

near the break point (10).

DNA repair is initiated via sensing of DSBs by the kinases ataxia telangiectasia

mutated (ATM), ataxia telangiectasia and Rad3 related (ATR), and Chk2. Subsequently,

the early phosphorylation of histone H2AX (γH2AX) by ATM occurs at DNA damage

foci and leads to the phosphorylation of mediator of DNA damage checkpoint protein 1

(MDC1), with subsequent chromatin remodeling and recruitment of DNA repair proteins

(11). BRCA1 is one such key mediator of HR and NHEJ repair; after exposure to DNA

damaging agents BRCA1 is rapidly phosphorylated by ATM, ATR, and Chk2, and

relocated to sites of replication forks with γH2AX foci , where it recruits further proteins

including BRCA2 and Rad51to mediate strand exchange toward DNA repair and cell

survival (10).

One key driver in GB that has been characterized to promote both cell invasion

and cell survival is the transmembrane receptor fibroblast growth factor inducible-14

(Fn14). Fn14 is a member of the tumor necrosis factor receptor superfamily with one

known ligand, the tumor necrosis factor-like weak inducer of apoptosis (TWEAK).

Signaling through Fn14 by its cytokine ligand TWEAK activates the Rac1, Akt and NF-

165

κB-pathways, and has been shown to promote increased cell invasion and resistance to

cytotoxic therapy-induced apoptosis (3,4,12).

Here we show that the src-homology 3 domain containing GEF (SGEF) promotes

cell survival in response to TMZ insult. In GB tumors, SGEF has been shown to be

significantly overexpressed, to be correlated with poor patient outcome, and to promote

glioma cell motility (Appendix B). We report that SGEF expression is increased in TMZ

resistant derived primary GB tumorgrafts and is up-regulated by TWEAK-Fn14 signaling

via NF-κB activity. SGEF and Fn14 mRNA are positively correlated in GB tumor

specimens. Depletion of SGEF impairs colony formation following TMZ insult and

increases cell susceptibility to TMZ-induced apoptosis. Moreover, the depletion of

SGEF is associated with genome wide changes in expression of DNA repair and pro-

survival pathways, and TMZ treatment of glioma cells both leads to increased nuclear

activation of SGEF and the SGEF dependent phosphorylation of the DNA damage repair

protein BRCA1. SGEF may thus be an important mediator of pro-survival signaling in

response to TMZ therapy.


Cell culture conditions. Human astrocytoma cell lines U87, U118, and T98G (American

Type Culture Collection), as well as primary tumorgraft cells (GB14 & GB14 TMZ-R)

were maintained in DMEM (Gibco, USA) supplemented with 10% heat-inactivated fetal

bovine serum (FBS; Gibco, USA) at 37˚C with 5% CO2. For all assays with TWEAK

treatment, cells were cultured in reduced serum (0.5% fetal bovine serum) for 16 h before

166

stimulation with recombinant TWEAK at 100 ng/mL in DMEM + 0.1% bovine serum

albumin for the indicated time.

ChIP on Chip Array. Analysis of the NF-κB promoter element of a primary GB

xenograft line (GB14) and its derivative line selected in vivo for temozolomide resistance

(GB14-TMZ-R) was performed using Agilent G4489a human promoter 244K array

Chips; TMZ resistance was derived as described (13). The human promoter array chip

contains ~17,000 well-defined human transcripts which encompassed -5.5 KB upstream

to +2.5 downstream from the transcriptional start site. Fresh frozen GB tumor containing

mouse brains were sliced to 20 micron thickness, formaldehyde fixed for 10min, and

collected and sheared by sonication. Samples were immunoprecipitated with the p65

antibody (IP), eluted and labeled with cy5 dye and hybridized with whole cell extracts

(WCE) labeled with cy3 dye on the chip array. GB14-TMZ-R and GB14 were processed

and hybridized independently. A “call” for a transcription factor binding event was

determined to be a region with a p-value < .05 (normalized intensity ratio) and p-Xbar <

.05 (an average of neighboring events).

RNA isolation and quantitative reverse transcriptase-polymerase chain reaction

(qRT-PCR). Total RNA was isolated as previously described (1). cDNA was

synthesized from 500 ng of total RNA in a 20 µL reaction volume using the SuperScript

III First-Strand Synthesis SuperMix Kit (Invitrogen) for 50 minutes at 50°C, followed by

85°C for 5 minutes. qPCR analysis of SGEF (sense: 5’-TGC TGA AAG GAC AAG

GAA CA-3’; anti-sense: 5’-GTA GTT TTG ATA CAG GAC AGC ATT-3’) and histone

H3.3 (sense: 5’- CCA CTG AAC TTC TGA TTC GC-3’; anti-sense: 5’-GCG TGC TAG

167

CTG GAT GTC TT-3’) mRNA levels was conducted using SYBR green (Roche)

fluorescence for detection of amplification after each cycle with LightCycler analysis

software and quantified as previously described (14).

Antibodies, plasmids, reagents, and Western blot analysis. A polyclonal SGEF

antibody was purchased from Sigma (St. Louis, MO). A monoclonal tubulin antibody

was purchased from Millipore (Billerica, MA). Polyclonal antibodies for phospho-p65

(Ser536), phospho-Akt (Ser473), MCL-1, phospho-BRCA1 (Ser1524), and BRCA1, and

monoclonal antibodies for cleaved PARP, phospho-Histone H2AX (Ser139), and Histone

H3 were purchased from Cell Signaling Technologies (Beverly, MA). Anti-NF-κB p65

polyclonal antibody was purchased from Santa Cruz Biotechnology (Dallas, TX).

Human recombinant TWEAK was purchased from PeproTech (Rock Hill, NJ). Human

placental laminin and temozolomide were obtained from Sigma. In certain experiments

cells were pre-incubated for 1 hour with either 50µM SN50 or SN50M (Calbiochem)

prior to TWEAK addition. Or, in certain experiments glioma cells were infected with

either control or IκBαM expressing adenovirus (Imgenex, San Diego, CA) for 24 hours

prior to culture in reduced serum medium (0.5% FBS DMEM) for 16 hours with

subsequent addition of TWEAK for 4 hours. Plasmids: pGEX4T-1-RhoG(15A) was

obtained from Dr. Keith Burridge (U. North Carolina-Chapel Hill).





168

albumin as a standard. Thirty micrograms of total protein were loaded per lane and

separated by SDS PAGE. After 4°C transfer, the nitrocellulose (Invitrogen) was blocked

with either 5% nonfat milk or 5% BSA in Tris-buffered saline, pH 8.0, containing 0.1%

Tween 20 (TBST) prior to addition of primary antibodies and followed with peroxidase-

conjugated anti-mouse IgG or anti-rabbit IgG. Protein was detected using SuperSignal

West Dura Chemiluminescent Substrate (Thermo Scientific) with a UVP BioSpectrum

500 Imaging System (Upland, CA). Densitometry was calculated via Image J software.

Biotinylated electrophoretic mobility shift assay. T98G glioma cells were plated at a

density of 3x106 in 100 mm2 tissue culture dishes in normal growth medium. After 12

hours, cells were cultured under reduced serum (0.5% FBS) for an additional 16 hours

before TWEAK (100 ng/mL) addition for two hours. Isolation of cell nuclear protein

was carried out using the NE-PER kit (Pierce) according to the protocol of the

manufacturer. Protein-DNA complexes were detected using biotin end-labeled double-

stranded DNA 23-mer probes containing the NF-κB binding sites within the SGEF

promoter (NF-κB-SGEF wt target sequence: 5’- GTC TAG GAG GCA AAT CCC AGA

AA -3’; NF-κB-SGEF mt target sequence: 5’- GTC TAG GAG CCA GAT CGC AGA

AA -3’). The binding reactions were done using the LightShift kit (Pierce) according to

the protocol of the manufacturer. Where indicated, 200-fold molar excess of unlabeled

NF-κB-SGEF wt oligonucleotides or anti-p65 antibody (Santa Cruz Biotechnology,

SantaCruz, CA; 1 mg/mL) was included. The reaction products were resolved by gel

electrophoresis and detected by chemiluminescence according to the protocol of the

manufacturer (Pierce).

169

Gene expression analysis of SGEF and Fn14 correlation. Expression data generated

using the Affymetrix U133 Plus 2.0 Array for 82 GB samples was downloaded from the

REpository for Molecular BRAin Neoplasia DaTa (REMBRANDT) for correlatation

ARHGEF26(SGEF) and TNFRSF12A (FN14) (15). The expression level of

ARHGEF26 (SGEF) was calculated as the median of the three relative expression

intensity values for the three probe sets annotated for ARHGEF26 (SGEF). There was a

high correlation of all three ARHGEF26 (SGEF) probes sets to each other (Pearson

correlation of .90 to .97). The relative expression intensity of the probe set 218368_s_at

was used for TNFRSF12A (FN14) as it is the only probe set annotated for TNFRSF12A

(FN14). The Pearson Product Moment Correlation was calculated using the R software

code as supplied by (16).

Lentiviral production. Lentiviral vectors containing SGEF shRNA were obtained from

Open Biosystems (Fisher Scientific, Pittsburgh, PA). The SGEF shRNA constructs were

packaged into VSV-G pseudotyped lentiviral particles following transfection of 293T

cells using the pPACKH1 packaging plasmid mix (Open Biosystems) according to the

manufacturer's instructions. For lentiviral transduction of target cells, lentiviral-

containing supernatants were collected from packaging cells at 48 and 72 hours after

transfection, concentrated by PEG precipitation, and added to subconfluent cultures of

cells with 8 µg/ml polybrene for 4–6 hours. Forty-eight hours after infection, infected

cells were enriched by selection with 2 µg/mL puromycin for two weeks. Confirmation

of knockdown was performed by western blot analysis.

170

Proliferation, clonogenic, and apoptosis studies. Cell viability was determined via

Alamar Blue. Briefly, glioma cells were plated in 96-well plates in quadruplicate for use

as a standard curve of known cell counts, or plated in replicates of 8 at 3,000 cells per

well to monitor proliferation over 72 hours. After cell attachment of the standard curve,

or 24 hours post-attachment of experimental wells, cells were treated with 10% Alamar

Blue (Trek Diagnostic Systems) for 5 hours at 37ºC. The absorbance was read at 560 nm

and 595 nm and the cell viability was expressed as number of cells per well calculated

relative to the standard curve for each line. Cell viability was repeatedly assessed daily

over 72 hours.

Observations of colony forming capacity following cytotoxic insult were

performed as described (17). Briefly, U87 and U118 cells stably expressing either control

empty vector (Ctrl) or shRNA targeting SGEF (SGEF-12 & SGEF-13) were treated with

500µM TMZ. Cells were trypsinized 24 hours post-TMZ treatment and plated in

triplicate in 6-well cell culture dishes at 250 cells per well. Colonies were allowed to

grow until controls reached a 50 cell density (approximately 6-7 days) before being fixed

briefly in a 10% (v/v) methanol 10% (v/v) glacial acetic acid solution, stained with a

0.5% (w/v) crystal violet solution and washed with deionized water. Apparent colonies

were recorded, and surviving fractions were determined relative to the non-treated control

for each cell line.

For apoptotic studies, apoptotic cells were evaluated by nuclear morphology of

4′,6-diamidino-2-phenylindole–stained cells. Cells with condensed, fragmented

171

chromatin were manually scored as apoptotic cells. At least three fields were evaluated

per condition, and data reported as apoptotic cells/total cells × 100.


Primary GB14 tumorgraft cells or TMZ resistant derived GB14TMZ-R were plated onto

10-well glass slides pre-coated with 10 µg/mL laminin. Cell migration rate was assessed

over 24 h.

mRNA expression array. RNA from U87 control empty vector or shRNA targeting

SGEF (SGEF-12) glioma cells was profiled using Agilent whole human genome 8x60k

SurePrint G3 Human Gene Expression Arrays. A quick-amplification kit (Agilent, Santa

Clara, CA) was used to amplify and label 500 ng target mRNA species into

complementary RNA (cRNA) for oligo microarrays according to the manufacturer's

protocol. For each array, experimental samples were run in duplicate along with a

commercial universal reference RNA (Stratagene, La Jolla, CA) that was labeled with

cyanine 5-CTP and cyanine-3-CTP (Perkin Elmer, Boston, MA), respectively. cRNA

concentration and labeling efficiency were measured spectrophotometrically.

Approximately 800 ng of both Cy5-labeled experimental cRNA and Cy3-labeled

universal reference RNA were hybridized to each microarray (adjusting for labeling

efficiency). Images were captured using an Agilent DNA microarray scanner set at

default settings for gene expression. Scanned images were processed using Feature

Extractor v. 10.5.1.1. By applying a LOWESS (locally weighted linear regression)

correction for dye bias, background noise was subtracted from spot intensities. To filter

the preprocessed data, genes with a background signal higher than feature signal were

172

removed. Gene pathway analysis was examined using GeneGo and Gene Spring GX11

software.

Nucleotide-free GEF pulldowns. Affinity pulldowns of active SGEF bound to RhoG

were performed using a nucleotide free RhoG mutant (G15A) expressed and purified as

described (19). Recombinant RhoG G15A-GST protein was produced in Escherichia coli

(BL21) cells. Cells were lysed in B-PER lysis buffer (Pierce) containing protease

inhibitors, and purified with glutathione sepharose beads (GE Healthcare). U87 cells

were grown in 10 cm dishes before treatment with TMZ (500µM) for 24 hours. Isolation

of cell nuclear protein was carried out using the NE-PER kit (Pierce) according to the

protocol of the manufacturer. Subsequently, equal amounts of total GST fusion protein

were then incubated with nuclear protein lysate (1 mg), and precipitated lysates were

resolved with SDS-PAGE.



Results

NF-κB displays increased occupancy of the SGEF promoter region in TMZ resistant

tumorgrafts and SGEF expression trends with TMZ resistance. NF-κB has been

described to promote glioblastoma cell survival (4,20,21). To examine the role of NF-κB

in TMZ resistance we utilized a panel of primary GB tumorgrafts treated in vivo with

TMZ to derive resistance (TMZ-R) (13) and performed chromatin immunoprecipitation

of one parental versus TMZ-R line using an antibody against the NF-κB p65 subunit,

173

followed by promoter microarray analysis using Agilent G4489a human promoter 244K

array chips to determine differential p65 promoter occupancy across the genome (ChIP-

on-chip technology). The human promoter array chip contains approximately 17,000

well-defined human transcripts which encompasses 5.5 KB upstream to 2.5 downstream

from the transcriptional start site. Among the differential occupancy of p65, the SGEF

promoter region demonstrated just over a five-fold increase in p65 binding in the TMZ-R

tumorgraft line as compared to the parental line (Figure C.1A). This data suggests that

SGEF expression may be differentially regulated within a tumor after TMZ exposure.

To determine the levels of SGEF expression under TMZ derived resistance in GB

tumors, we assessed both protein and mRNA expression of SGEF in a panel of

tumorgrafts with matched parental and TMZ-R derived pairs. mRNA and protein

expression of SGEF trended higher in the resistant lines versus the parental (Figure C.1B

& C.1C, respectively), suggesting increased SGEF expression may result following

exposure to TMZ in some GB tumors.

TWEAK-induced SGEF expression is dependent upon NF-kB activity. Increased

promoter occupancy by NF-κB of SGEF in TMZ-R tumorgrafts suggests NF-κB may

modulate SGEF expression levels. Fn14 activation by its ligand TWEAK has been shown

to result in increased NF-κB activity, and the NF-κB dependent up-regulation of survival

pathways including increased Rac1 activity and expression of BCL-xL and BCL-w (3,4).

To determine whether NF-κB activity via TWEAK-Fn14 signaling plays a role in the

regulation of SGEF expression we stimulated T98G and U118 glioma cells with the

TWEAK ligand; SGEF mRNA and protein levels both increased in a time course fashion

174

Figure C.1. Differential binding of the NF-κB transcription factor in GB-14 and GB-

14 TMZ resistant (TMZ-R) tumors and SGEF mRNA and protein levels across a

panel of primary parental versus TMZ-R tumorgrafts.

(A) Analysis of the NF-κB promoter element of a primary GB xenograft line (GB14) and

its derivative line selected in vivo for TMZ resistance (GB14-TMZ-R) using Agilent

G4489a human promoter 244K array Chips. Fresh frozen GB tumor containing mouse

brains were sliced to 20 micron thickness, formaldehyde fixed for 10min, and collected

and sheared by sonication. Samples were immunoprecipitated with the p65 antibody (IP),

eluted and labeled with cy5 dye and hybridized with whole cell extracts (WCE) labeled

with cy3 dye on the chip array. Fold signal enrichment of IP vs. total cell lysates for

NFkB binding to promoters of selected genes are represented in log scale and raw values

are displayed in a tabular format below each column. (B) qRT-PCR analysis of SGEF

mRNA expression from 42 primary tumorgraft samples (representing 16 unique tumors)

comparing parental tumor versus each corresponding tumor derivative selected in vivo for

TMZ resistance (TMZR). (C) SGEF protein levels from 17 pooled tumorgraft samples

comparing parental tumor versus each corresponding tumor derivative selected in vivo for

TMZ resistance (TMZR), and plotted after densitometry normalized to tubulin control.

Inset contains three tumorgraft representative western blot images.

176

over twenty-four hours with increased levels apparent within two hours of treatment

(Figure C.2). Next, to further characterize the regulation of SGEF expression by NF-κB,

we performed a promoter analysis of SGEF for NF-κB p65 consensus sequence binding

sites. Using an electrophoretic mobility shift assay with wild-type and mutant p65

consensus sequence oligonucleotides from the SGEF promoter region we assessed

whether NFkB binds to the SGEF promoter following treatment with TWEAK. SGEF

wild-type but not mutant sequences shifted under nuclear lysate binding; the addition of

an anti-p65 antibody confirmed the shift as p65 binding specific (Figure C.3).

Elevated SGEF expression in TMZ resistant tumorgrafts or following TWEAK-

Fn14 stimulation is dependent upon NF-κB function. To determine whether increased

NF-κB occupancy on the SGEF promoter region of TMZ-R GB14 tumorgrafts resulted in

NF-κB regulated SGEF gene expression, we assessed levels of SGEF mRNA in GB14

and GB14 TMZ-R tumorgrafts alone and in the presence of the cell permeable NF-κB

peptide inhibitor SN50. GB14 TMZ-R tumorgrafts displayed approximately five-fold

increased levels of SGEF mRNA expression than parental GB14 tumorgrafts, and

treatment with the SN50 inhibitor for twenty-four hours abrogated the increased SGEF

levels, while SGEF expression remained elevated under treatment with the mutated

peptide inhibitor SN50M (Figure C.4A). Thus this data suggests that elevated SGEF in

response to TMZ treatment is dependent upon the presence of a functional NF-κB

transcription factor. To determine whether the observed TWEAK-Fn14 driven increase

in SGEF expression is dependent upon NF-κB, we infected T98G and U118 glioma cells

with adenoviruses expressing either control vector or IκBαM, an upstream super

177

Figure C.2. SGEF mRNA expression is inducible via TWEAK cytokine stimulation

and NF-κB signaling.

(A & B) T98G glioma cells were cultured in reduced serum (0.5% FBS DMEM) for 16

hours prior to stimulation with TWEAK (100ng/mL) for the indicated times. SGEF

mRNA (A) and protein (B) expression were analyzed via qPCR with fold change relative

to histone and via western blotting with the indicated antibodies, respectively. (C & D)

U118 glioma cells were cultured in reduced serum (0.5% FBS DMEM) for 16 hours prior

to stimulation with TWEAK (100ng/mL) for the indicated times. SGEF mRNA (C) and

protein (D) expression were analyzed via qPCR with fold change relative to histone and

via western blotting with the indicated antibodies, respectively.

179

Figure C.3. NF-κB binds to the SGEF promoter region dependent upon TWEAK

stimulation.

T98G cells were treated with TWEAK (100ng/mL). Nuclear proteins were isolated 2

hours post-treatment and incubated with biotin end-labeled, wild-type SGEF (SGEF wt)

oligonucleotides containing the NF-κB consensus binding region. Proteins were also

incubated with biotin end-labeled SGEF oligonucleotides containing mutated NF-κB

consensus binding region (SGEF mt). In certain experiments, either 200-fold molar

excess of unlabeled NF-κB-SGEF wt oligonucleotides or anti-p65 antibody was

incubated with the nuclear lysates from TWEAK-treated cells.

180

repressor of NF-κB, and analyzed SGEF mRNA levels following treatment with TWEAK

(Figure C.4B & C.4C). Moreover, we treated T98G glioma cells with SN50 or SN50M

inhibitor under TWEAK stimulation and analyzed SGEF protein levels (Figure C.4D).

NF-κB inhibition either by IκBaM or SN50M resulted in diminished SGEF mRNA and

protein expression, indicating that NF-κB is required for the TWEAK-Fn14 induction of

SGEF.

TWEAK-Fn14 signaling can self-promote Fn14 expression, which is dependent

upon NF-κB function (4). Since SGEF expression is inducible under Fn14-NF-κB

signaling we sought to assess whether there was a relationship between Fn14 and SGEF

expression in primary patient GB tumors. An analysis of 82 Patient GB tumor specimens

in the publicly available REMBRANDT dataset revealed a positive association between

Fn14 and SGEF expression across the tissues (p < 0.001) (Figure C.4E), thus indicating

these two proteins are strongly correlated in GB tumors.

Depletion of SGEF impairs colony formation following TMZ insult and sensitizes

cells to TMZ-mediated apoptosis. To determine the importance of the SGEF protein in

the response to TMZ, we first developed stable SGEF depleted glioma cell lines via

lentiviral-mediated transduction of either control (Ctrl) empty vector expressing or

shRNA targeting SGEF (SGEF-12 & SGEF-13) expressing vectors (Figure B.2B).

Stable depletion of SGEF in U87 or U118 glioma cells does not alter proliferation (Figure

C.5A & C.5B), however, in glioma cells treated for twenty-four hours with TMZ

followed by subsequent time allowance for colony growth formation, cells depleted of

SGEF displayed significantly impaired colony formation after TMZ insult as compared to

181

Figure C.4. SGEF mRNA expression is dependent upon NF-κB signaling and

positively correlates with Fn14 mRNA expression.

(A) GB14 and GB-TMZ-R cell lines were cultured in the presence or absence of SN50

NF-κB inhibitor or control SN50M. Total RNA was isolated 24 hour post-treatment and

SGEF mRNA expression was assessed via qRT-PCR normalized to histone H3.3 and

further corrected to GB14 mRNA expression values. (B & C) U118 (B) and T98G (C)

glioma cells were infected with either control- or mutant IκBα-expressing adenoviruses

for 24 hours, followed by serum starvation for an additional 16 hours (0.5% FBS

DMEM), with subsequent TWEAK treatment in certain cases for 4 hours. Total RNA

was isolated and SGEF mRNA expression was analyzed via qPCR with fold change

relative to histone H3.3. (D) T98G glioma cells were cultured for 16 hours in reduced

serum medium (0.5% FBS DMEM) followed by pre-treatment with SN50 NF-κB

inhibitor or control SN50M as indicated for 1 hour with the subsequent addition of

TWEAK to all dishes for 4 hours. Protein lysates were resolved via SDS-PAGE and

probed with the indicated antibodies. (E) SGEF and Fn14 mRNA expression from the

publicly available REMBRANDT dataset of 82 GB tumors was accessed and assessed

using the Pearson product moment correlation statistic (p < 0.001).

183

control TMZ treated cells (Figure C.5C). The depletion of SGEF in un-treated glioma

cells did not affect colony formation (Figure C.5C). Therefore, these data indicate that

SGEF protein function is important in the recovery response following TMZ treatment.

To further characterize the susceptibility of glioma cells with stable SGEF

knockdown to TMZ, we treated U87 and U118 glioma cells for forty-eight hours with

TMZ and assessed cellular apoptosis. SGEF depleted glioma cells showed increased

chromatin condensation indicative of apoptosis following TMZ treatment (Figure C.6A)

as well as elevated cleaved PARP on immunoblot analysis (Figure C.6B) in comparison

to control TMZ treated cells. Therefore, the loss of SGEF protein sensitizes glioma cells

to TMZ-induced cytotoxicity.

184

Figure C.5. Depletion of SGEF does not affect proliferation, but impairs colony

formation following TMZ insult.

U87 (A) and U118 (B) glioma cells stably expressing either control empty vector (Ctrl)

shRNA targeting SGEF were assessed for proliferation over 72 hours via Alamar Blue

analysis. Data represent an average and SD of 8 replicates. (C) U87 and U118 glioma

cells stably expressing either control empty vector (Ctrl) shRNA targeting SGEF were

treated with either TMZ (500µM) or control DMSO for 48 hours followed by plating for

clonogenic studies. Data represent an average and SD of 3 replicates. (* p < 0.01).

186

Figure C.6. Depletion of SGEF expression sensitizes glioma cells to TMZ-induced

apoptosis.

U87 glioma cells stably expressing either control empty vector (Ctrl) or shRNA targeting

SGEF (SGEF-12 & SGEF-13) were treated for 48H with TMZ (500µM), and were either

stained for DAPI and counted for percent chromatin condensation (A), or lysates were

collected for immunoblotting with cleaved PARP (B). Data represent an average and SD

of 3 replicates. (* p < 0.05).

187

Discussion

In this study we report on the relationship between SGEF and both therapeutic

resistance and cell survival. The NF-κB transcription factor differentially binds at higher

levels to the promoter region of SGEF in TMZ-resistant primary GB tumorgrafts relative

to parent GB tumorgraft specimens. Our ChIP-Chip data is also consistent with increased

promoter occupancy of several well characterized pro-survival proteins including BCL2

and Akt3 (Figure C.1A). Moreover, SGEF mRNA expression in TMZ-R GB tumorgraft

lines is elevated and dependent on NF-κB. NF-κB signaling has been well characterized

to promote both GB cell invasion and survival (3,4,20-22), and elevated or constitutive

NF-κB activity has been demonstrated in gliomas and correlates with increasing brain

tumor grade (22,23). NF-κB signaling has specifically been highlighted to protect cells

against the standard of care treatments in GB; the inhibition of IκBα phosphorylation

prevents NF-κB activity and sensitizes glioma cells to radiation treatment (24,25) and

NF-κB is an important player in promoting resistance to O6-alkylation (26), a TMZ

induced DNA damage modification.

TWEAK-Fn14 signaling is one notable pathway in glioma that utilizes Rac1

dependent NF-κB activation to promote cell invasion and cytotoxic therapy resistance

with enhanced cell survival (3,4,27). To date, SGEF has been largely associated with a

role in promoting cell motility; SGEF has been shown to promote the invasive capacity of

HPV transformed tumor cells and actin cytoskeleton remodeling after salmonella

infection (28,29). In GB tumors, in addition to a role in the promotion of cell invasion,

we have described SGEF to be significantly overexpressed and to be correlated with poor

188

patient outcome (Appendix B). Here, we report the role of SGEF in promoting cell

survival. We show that TWEAK binding to Fn14 promotes NF-κB promoter occupancy

of SGEF in glioblastoma, and that the TWEAK-Fn14 up-regulation of SGEF mRNA and

protein expression is dependent upon NF-κB function. The link between Fn14 and SGEF

in GB is further supported on the basis of mRNA expression analysis indicating a strong

positive correlation in expression of the two genes among a panel of primary tumor

specimens. Of note, this correlation was not significant when brain tumors of all grades

were considered (data not shown) but was highly statistically significant within GB

tumors alone, indicating the relationship between SGEF and Fn14 may be specific to

heightened malignancy. Furthermore, the siRNA-mediated depletion of SGEF does not

affect cell proliferation, but does impair the ability of glioma cells to form colonies

following insult with TMZ and leads to glioma cell sensitization to TMZ-induced cell

death via apoptosis. We thus propose a scheme of TWEAK-Fn14 inducible SGEF

mRNA and protein expression dependent upon NF-κB nuclear translocation and activity,

whereby increased SGEF levels promote a pro-survival phenotype in the face of TMZ

insult (Figure C.7).

Interestingly, radial migration analysis of GB14 and GB14 TMZ-R primary

tumorgrafts revealed an elevated rate of cell migration corresponding to the TMZ-R

setting (Figure C.8). We have previously shown a role for SGEF in glioblastoma in

promoting cell migration and invasion via activation of the Rho GTPase RhoG with

subsequent RhoG-dependent activation of Rac1 and the formation of lamellipodia

(Appendix B). Thus, NF-κB mediated increased SGEF expression may be one

189

Figure C.7. Schematic model of TWEAK-Fn14 signaling via NF- κB to regulate

SGEF expression and subsequent pro-survival phenotype.

TWEAK interaction with the Fn14 receptor leads to the NF-κB mediated up-regulation of

SGEF mRNA and protein expression. SGEF protein promotes glioma cell survival and is

associated with TMZ resistance.

190

Figure C.8. Increased migration rate of TMZ resistant primary GB cells.

GB14 and GB14-TMZ-Resistant (TMZ-R) primary glioma cells were plated on glass

slides pre-coated with 10 µg/mL laminin. Cell migration was assessed over 48 hours

using a radial migration assay. Data represents the average of 10 replicates (* = p <

0.01).

191

mechanism that facilitates the increased cell motility of TMZ-R glioma cells. Moreover,

it has been shown that treatment with radiation in glioblastoma leads to the enhanced cell

invasive potential via activation of the Rho-PI-3K signaling pathway (30). In addition,

the pro-invasive characterized integrins, αvβ3 and αvβ5, have been demonstrated to

mediate a pro-survival response in glioma to radiation through integrin-linked kinase and

the RhoB GTPase (31), thus implying overlapping roles for mediators of cell motility

with the promotion of cell survival. Of note, there have been multiple reports of

increased cell invasiveness resulting from treatment with chemotherapeutic agents (32-

35). The roles of invasion and survival are thus interconnected processes in the

promotion of disease progression, and the overlap between these two pathways is

emerging (36). SGEF thus presents a novel hub in the interconnected processes of cell

invasion and survival.

Our data suggest an important role for SGEF in the glioma cellular response to

TMZ insult. To begin to determine the role of SGEF in this cell survival phenotype we

performed gene expression analysis on U87 cells with stable depletion of SGEF.

Pathway maps confirmed DNA damage response and apoptosis and survival as top hits

differentially associated with SGEF knockdown as compared to control cells (Figure

C.9). Subsequent pathway analysis via sorting of statistically significant maps revealed

the decreased expression of several DNA repair genes specific to the SGEF depleted

condition (Table C.1). TWEAK-Fn14 signaling has been shown to confer pro-survival

signaling via activation of Akt, and NF- κB signaling, and the up-regulation of anti-

192

Figure C.9. mRNA expression array analysis in SGEF depleted cells.

RNA from U87 control empty vector or shRNA targeting SGEF (SGEF-12) glioma cells

was profiled using Agilent whole human genome 8x60k SurePrint G3 Human Gene

Expression Arrays. To filter the preprocessed data, genes with a background signal higher

than feature signal were removed, and pathway analysis was performed using GeneGo

and Gene Spring GX11 software.

193

Table C.1. Differential mRNA expression of survival and DNA repair associated

genes in SGEF depleted cells.

Differential fold change of mRNA expression was compiled for genes involved in

survival and DNA repair pathways as indicated from the gene pathway analysis in U87

control empty vector or shRNA targeting SGEF (SGEF-12) glioma cells profiled using

Agilent whole human genome 8x60k SurePrint G3 Human Gene Expression Arrays and

examined using GeneGo and Gene Spring GX11 software.

194

apoptotic BCL2 family members (3,4,12). To determine whether SGEF is important in

the regulation of these survival pathways we analyzed both the TWEAK-induced

phosphorylation of Akt, and NF- κB p65, and TWEAK induction of MCL1 in control

empty vector expressing (Ctrl) versus shRNA targeting SGEF (SGEF-12) expressing

T98G glioma cells (Figure C.10A). Depletion of SGEF did not impact TWEAK-Fn14

activation of these pathways, thus indicating that the role of SGEF in cell survival is

independent of TWEAK-Fn14 pro-survival signaling.

Since the pathway map analysis suggested a role for SGEF in the DNA damage

response in addition to pro-survival pathway signaling, we investigated whether depletion

of SGEF affects the phosphorylation of histone H2AX following treatment with TMZ.

The phosphorylation of histone (γH2AX) is one of the earliest responses to double strand

DNA breaks (DSB). γH2AX is involved in the recruitment of and localization of DNA

repair proteins and thus this phosphorylation is indicative of DNA damage DSB foci (37).

We analyzed U87 glioma cells over sixteen hours of treatment with TMZ and assessed

levels of H2AX phosphorylation in control empty vector or SGEF depleted lines (Figure

C.10B). The phosphorylation of H2AX occurred rapidly within four hours of TMZ

treatment in either control or SGEF depleted conditions, thus indicating that SGEF does

not play a role in preventing the formation of DNA damage foci subsequent to TMZ

insult.

While SGEF does not prevent DNA damage following TMZ, we sought to assess

whether SGEF plays a role in the coordinated response to DNA damage. We first

assessed whether the activity of SGEF is influenced under TMZ treatment. U87 glioma

195

Figure C.10. TWEAK-Fn14 pro-survival signaling and the TMZ-induced formation

of DNA damage foci are independent of SGEF function.

(A) T98G glioma cells stably expressing either control empty vector (Ctrl) or shRNA

targeting SGEF (SGEF-12) were cultured in reduced serum medium (0.5% FBS DMEM)

for 16 hours prior to the addition of TWEAK (100ng/mL) for the indicated times.

Lysates were resolved via SDS-PAGE followed by immunoblotting with the indicated

anitbodies. (B) U87 glioma cells stably expressing either control empty vector (Ctrl) or

shRNA targeting SGEF (SGEF-12) were treated with TMZ (500µM) for the indicated

times. Lysates were resolved via SDS-PAGE followed by immunoblotting with the

indicated anitbodies.

197

cells treated for twenty-four hours with TMZ were fractionated specifically for nuclear

lysates, in which SGEF activity was determined using RhoG G15A nucleotide free

mutant constructs (19). Interestingly, treatment with TMZ did result in increased SGEF

activity in the nucleus (Figure C.11A), further supporting a role for SGEF in the response

to TMZ treatment. Use of functional site prediction analysis suggests that SGEF contains

two domains of phosphopeptide motifs at amino acids 493-497 (ASKKF) and 741-745

(ASHLF) which directly interact with the BRCT (carboxy-terminal) domain of BRCA1.

BRCT domains are present in DNA damage response proteins (38), and the

phosphorylation of BRCA1 occurs rapidly in response to DNA damaging agents (10).

We therefore sought to determine if SGEF is important in BRCA1 activation following

TMZ insult. U87 glioma cells were treated for twenty-four hours with TMZ and the

phosphorylation of BRCA1 was assessed between control empty vector and SGEF

depleted lines (Figure C.11B). The depletion of SGEF prevented TMZ-induced BRCA1

phosphorylation. Thus SGEF may function in part to promote the BRCA1 response to

DNA damage.

Interestingly, mRNA expression analysis of SGEF depleted cells indicated that

diminished BRCA2 levels, not BRCA1, were correlated with a decrease in SGEF

expression (Figure C.9B). BRCA1 and BRCA2 have been shown to transiently interact

at sites of damage or stalled replication forks with the one shared role of homologous

recombination. While this appears to be the primary role for BRCA2, BRCA1 also

functions in NHEJ, and S- and G2-M-phase checkpoints (10). Some reports suggest that

BRCA1 preferentially promotes the error free HR pathway for DNA repair over NHEJ to

198

Figure C.11. TMZ induces nuclear SGEF activity and SGEF dependent BRCA1

activity.

(A) U87 glioma cells were treated with TMZ (500µM) for 24 hours followed by isolation

of nuclear proteins. SGEF activation in control and treated lysates was assessed using

RhoG G15A-GST constructs with immunoblotting for antibodies as indicated. (B) U87

glioma cells stably expressing either control empty vector (Ctrl) or shRNA targeting

SGEF (SGEF-12) were treated with TMZ (500µM) for 24 hours. Lysates were resolved

via SDS-PAGE followed by immunoblotting with the indicated anitbodies.

199

preserve chromosome stability (10). This coupled with the primary role for BRCA2 to

promote HR suggests a conserved redundancy and thus heightened importance of this

repair mechanism. Thus, the combined effect of decreased BRCA2 expression and the

decreased capacity of TMZ-induced BRCA1 phosphorylation in SGEF depleted glioma

cells may help explain the observed significantly impaired capacity of glioma cells to

recover for colony formation and the increased occurrence of apoptosis in TMZ-treated

SGEF depleted glioma cells.

Despite advances in medical technology and treatment, GB prognosis has

remained largely unchanged over the last several decades (39,40). The ability of glioma

cells to survive undeterred from current treatment strategies implies that new therapeutic

avenues are necessary for treatment of this disease. There is accumulating evidence that

combinatorial therapy that includes use of treatment modalities designed to hamper the

DNA repair mechanisms of the cell may provide a significant added survival benefit over

the standard of care alone or when used in combination with inhibitors of other GB

deregulated pathways (41-45). Moreover therapy aimed at mediators of invasion can also

lead to increased chemotherapeutic sensitivity (6,7). Thus, pathways deregulated in GB

that promote both TMZ resistance and cell motility represent novel therapeutic targets in

future drug design. Our data support a role for SGEF in both the promotion of cell

invasion and cell survival signaling within GB tumors and provide a rationale for

targeting this signaling axis. Interestingly, there has been a recent report of the RhoJ

GTPase in promoting melanoma chemoresistance by suppressing DNA damage sensing

pathways including the uncoupling of ATR from its downstream effectors with resulting

200

decreased DNA damage-induced apoptosis (46). Thus the role of GEFs and GTPases in

chemoresistance via modulation of DNA repair mechanisms is an emerging field in

which we have validated a role for SGEF in GB.

Acknowledgements

The authors would like to thank Dr. Keith Burridge (University of North Carolina,

Chapel Hill) for the gift of the pGEX4T-1-RhoG(15A) plasmid.

Grant Support

This work is supported by NIH grants R01 CA130940 (N.L. Tran), the ARCS Foundation

Eller Scholarship and Science Foundation Arizona Fellowship (S.P. Fortin Ensign).

201

References







202


8. Hanahan, D., and Weinberg, R. A. (2011) Hallmarks of cancer: the next generation. Cell 144, 646-674

9. Roos, W. P., and Kaina, B. (2012) DNA damage-induced apoptosis: From specific DNA lesions to the DNA damage response and apoptosis. Cancer letters

10. Zhang, J., and Powell, S. N. (2005) The role of the BRCA1 tumor suppressor in DNA double-strand break repair. Molecular cancer research : MCR 3, 531-539

11. Lukas, J., Lukas, C., and Bartek, J. (2011) More than just a focus: The chromatin response to DNA damage and its role in genome integrity maintenance. Nature cell biology 13, 1161-1169


13. Kitange, G. J., Mladek, A. C., Carlson, B. L., Schroeder, M. A., Pokorny, J. L., Cen, L., Decker, P. A., Wu, W., Lomberk, G. A., Gupta, S. K., Urrutia, R. A., and Sarkaria, J. N. (2012) Inhibition of histone deacetylation potentiates the evolution of acquired temozolomide resistance linked to MGMT upregulation in glioblastoma xenografts. Clin Cancer Res 18, 4070-4079


15. REpository for Molecular BRAin Neoplasia DaTa (REMBRANDT) database (National Cancer Institute. 2005. REMBRANDT home page. http://rembrandt.nci.nih.gov. Accessed 2012 November 26).

203

16. Wessa, P. , (2012) Pearson Correlation (v1.0.6) in Free Statistics Software (v1.1.23-r7), Office for Research Development and Education, URL http://www.wessa.net/rwasp_correlation.wasp/.

17. Franken, N. A., Rodermond, H. M., Stap, J., Haveman, J., and van Bree, C. (2006) Clonogenic assay of cells in vitro. Nat Protoc 1, 2315-2319



20. Robe, P. A., Bentires-Alj, M., Bonif, M., Rogister, B., Deprez, M., Haddada, H., Khac, M. T., Jolois, O., Erkmen, K., Merville, M. P., Black, P. M., and Bours, V. (2004) In vitro and in vivo activity of the nuclear factor-kappaB inhibitor sulfasalazine in human glioblastomas. Clin Cancer Res 10, 5595-5603

21. Kasuga, C., Ebata, T., Kayagaki, N., Yagita, H., Hishii, M., Arai, H., Sato, K., and Okumura, K. (2004) Sensitization of human glioblastomas to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) by NF-kappaB inhibitors. Cancer Sci 95, 840-844

22. Raychaudhuri, B., Han, Y., Lu, T., and Vogelbaum, M. A. (2007) Aberrant constitutive activation of nuclear factor kappaB in glioblastoma multiforme drives invasive phenotype. Journal of neuro-oncology 85, 39-47

23. Conti, A., Ageunnouz, M., La Torre, D., Cardali, S., Angileri, F. F., Buemi, C., Tomasello, C., Iacopino, D. G., D'Avella, D., Vita, G., and Tomasello, F. (2005) Expression of the tumor necrosis factor receptor-associated factors 1 and 2 and regulation of the nuclear factor-kappaB antiapoptotic activity in human gliomas. Journal of neurosurgery 103, 873-881

24. Ding, G. R., Honda, N., Nakahara, T., Tian, F., Yoshida, M., Hirose, H., and Miyakoshi, J. (2003) Radiosensitization by inhibition of IkappaB-alpha phosphorylation in human glioma cells. Radiat Res 160, 232-237

204

25. Russell, J. S., Raju, U., Gumin, G. J., Lang, F. F., Wilson, D. R., Huet, T., and Tofilon, P. J. (2002) Inhibition of radiation-induced nuclear factor-kappaB activation by an anti-Ras single-chain antibody fragment: lack of involvement in radiosensitization. Cancer research 62, 2318-2326

26. Bredel, M., Bredel, C., Juric, D., Duran, G. E., Yu, R. X., Harsh, G. R., Vogel, H., Recht, L. D., Scheck, A. C., and Sikic, B. I. (2006) Tumor necrosis factor-alpha-induced protein 3 as a putative regulator of nuclear factor-kappaB-mediated resistance to O6-alkylating agents in human glioblastomas. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 24, 274-287




30. Zhai, G. G., Malhotra, R., Delaney, M., Latham, D., Nestler, U., Zhang, M., Mukherjee, N., Song, Q., Robe, P., and Chakravarti, A. (2006) Radiation enhances the invasive potential of primary glioblastoma cells via activation of the Rho signaling pathway. Journal of neuro-oncology 76, 227-237

31. Monferran, S., Skuli, N., Delmas, C., Favre, G., Bonnet, J., Cohen-Jonathan-Moyal, E., and Toulas, C. (2008) Alphavbeta3 and alphavbeta5 integrins control glioma cell response to ionising radiation through ILK and RhoB. International journal of cancer. Journal international du cancer 123, 357-364

32. Giavazzi, R., Miller, L., and Hart, I. R. (1983) Metastatic behavior of an adriamycin-resistant murine tumor. Cancer research 43, 5081-5086

205

33. Liang, Y., Meleady, P., Cleary, I., McDonnell, S., Connolly, L., and Clynes, M. (2001) Selection with melphalan or paclitaxel (Taxol) yields variants with different patterns of multidrug resistance, integrin expression and in vitro invasiveness. Eur J Cancer 37, 1041-1052

34. Lucke-Huhle, C. (1994) Permissivity for methotrexate-induced DHFR gene amplification correlates with the metastatic potential of rat adenocarcinoma cells. Carcinogenesis 15, 695-700

35. Glynn, S. A., Gammell, P., Heenan, M., O'Connor, R., Liang, Y., Keenan, J., and Clynes, M. (2004) A new superinvasive in vitro phenotype induced by selection of human breast carcinoma cells with the chemotherapeutic drugs paclitaxel and doxorubicin. British journal of cancer 91, 1800-1807

36. Alexander, S., and Friedl, P. (2012) Cancer invasion and resistance: interconnected processes of disease progression and therapy failure. Trends Mol Med 18, 13-26

37. Kuo, L. J., and Yang, L. X. (2008) Gamma-H2AX - a novel biomarker for DNA double-strand breaks. In Vivo 22, 305-309

38. Gerloff, D. L., Woods, N. T., Farago, A. A., and Monteiro, A. N. (2012) BRCT domains: A little more than kin, and less than kind. FEBS Lett 586, 2711-2716

39. Tait, M. J., Petrik, V., Loosemore, A., Bell, B. A., and Papadopoulos, M. C. (2007) Survival of patients with glioblastoma multiforme has not improved between 1993 and 2004: analysis of 625 cases. Br J Neurosurg 21, 496-500

40. Barnholtz-Sloan, J. S., Sloan, A. E., and Schwartz, A. G. (2003) Relative survival rates and patterns of diagnosis analyzed by time period for individuals with primary malignant brain tumor, 1973-1997. Journal of neurosurgery 99, 458-466

41. Barazzuol, L., Jena, R., Burnet, N. G., Meira, L. B., Jeynes, J. C., Kirkby, K. J., and Kirkby, N. F. (2013) Evaluation of poly (ADP-ribose) polymerase inhibitor ABT-888 combined with radiotherapy and temozolomide in glioblastoma. Radiat Oncol 8, 65

206

42. Tang, Y., Dai, Y., Grant, S., and Dent, P. (2012) Enhancing CHK1 inhibitor lethality in glioblastoma. Cancer Biol Ther 13, 379-388

43. McEllin, B., Camacho, C. V., Mukherjee, B., Hahm, B., Tomimatsu, N., Bachoo, R. M., and Burma, S. (2010) PTEN loss compromises homologous recombination repair in astrocytes: implications for glioblastoma therapy with temozolomide or poly(ADP-ribose) polymerase inhibitors. Cancer research 70, 5457-5464

44. Russo, A. L., Kwon, H. C., Burgan, W. E., Carter, D., Beam, K., Weizheng, X., Zhang, J., Slusher, B. S., Chakravarti, A., Tofilon, P. J., and Camphausen, K. (2009) In vitro and in vivo radiosensitization of glioblastoma cells by the poly (ADP-ribose) polymerase inhibitor E7016. Clin Cancer Res 15, 607-612

45. Nadkarni, A., Shrivastav, M., Mladek, A. C., Schwingler, P. M., Grogan, P. T., Chen, J., and Sarkaria, J. N. (2012) ATM inhibitor KU-55933 increases the TMZ responsiveness of only inherently TMZ sensitive GBM cells. Journal of neuro-oncology 110, 349-357

46. Ho, H., Aruri, J., Kapadia, R., Mehr, H., White, M. A., and Ganesan, A. K. (2012) RhoJ regulates melanoma chemoresistance by suppressing pathways that sense DNA damage. Cancer research 72, 5516-5528

207

APPENDIX D - CONCLUDING STATEMENTS

Deregulated pathway signaling in GB tumors occurs within multiple processes

including proliferation, metabolism, stem cells and gliomagenesis, angiogenesis, survival

and invasion. Patients ultimately die due to tumor spread and growth burden, thus the

identification of key drivers of cell invasion can inform future targeted therapy

development for use in clinical trials, with the intent to sensitize cells to combinatorial

therapy with chemotherapeutic and radiologic intervention. The overall objective of this

dissertation has been to investigate the role of the Rho family of GTPases in glioblastoma

invasion, and define which family members and regulators are key mediators of this

deadly cell process.

The acquisition of cell motility is complex and influenced by various intracellular

and extracellular signaling events. The Rho family of GTPases are well defined

regulators of actin cytoskeletal dynamics (1-3), and have been characterized to contribute

to most steps of cancer initiation and progression (4). Many Rho GTPases have been

shown to be up-regulated in several human cancers, including RhoA, RhoC, Rac1, Rac2,

Rac3, Cdc42, RhoG, Wrch2/RhoV and RhoF (4,5). Rac1 activating mutations found via

exome sequencing are newly described in melanoma tissue as a UV-signature, whereby

9.2% of sun-exposed melanomas were found to contain a proline to serine mutation at

position 29 in the highly conserved switch I domain of Rac1, which is a necessary

domain for nucleotide binding and interactions with effector molecules (6,7). However,

outside of this recent finding most reports of deregulated Rho GTPase signaling in cancer

208

involve overexpression of the GTPase itself or of upstream activators or downstream

effectors, and to date no Rac1 mutations have been described in GB. Rac1 can be

activated by multiple growth factors and cytokines. One of the mechanisms of Rac1

activation in GB is via Fn14, a transmembrane receptor of the tumor necrosis factor

receptor superfamily which has been characterized in GB for its role in promoting cell

migration, invasion, and survival (8-10). The central hypothesis of this dissertation is

that deregulated Rho GTPase signaling enhances TWEAK-Fn14 mediated GB

progression by promoting cell invasion and resistance to therapy.

In appendix A, we investigated the role of TWEAK-Fn14 signaling to activate

Rac1 in glioma migration and invasion. In our studies, we determined the kinetics of

Rac1 activation, whereby Rac1 activity increases rapidly following TWEAK treatment in

glioma cells. This activation and subsequent glioma cell migration is dependent upon the

function of Ect2. Activated GEF and Rho GTPase signaling complexes are found in

proximity to the plasma membrane and this localization is important for their function

(11,12); here we described that Fn14 wild-type, but not Fn14 cytoplasmic deleted

constructs immunoprecipitated with the Ect2 protein. In addition, we have previously

shown that Fn14 complexes with Rac1(10), and thus this data supports that within the

TWEAK-Fn14 signaling axis both the spatial and temporal intracellular regulation of the

Rac1 GTPase and its activating GEF Ect2 are important aspects of pathway control.

In GB tumors, Ect2 has been shown to localize to the cytoplasm in comparison to

a largely nuclear localization pattern in non-transformed cells (13). Moreover Rac1 has

been shown to be prominently at the plasma membrane in a significant subset of GB

209

tumors (14), thus highlighting the correlation of subcellular localization with activity and

malignancy. We showed that Ect2 is necessary for TWEAK-induced Cdc42 activation,

and that Cdc42 is necessary for Rac1 activity, but Cdc42 activity does not depend on

Rac1. We discovered Trio as an additional GEF acting downstream of TWEAK-induced

Cdc42 activation that exchanges for Rac1, and thus proposed a scheme whereby

TWEAK-Fn14 stimulation confers Ect2-mediated nucleotide exchange for Cdc42 with

subsequent Rac1 activation conferred by Trio. In addition, the ectopic expression of

Fn14 or Ect2 induced astrocyte motility, and further supports a role for this axis in

promoting cell motility. Thus Ect2-Cdc42 and Trio-Rac1 activation contribute to the

TWEAK-Fn14 induced migratory capacity of GB tumor cells (Figure D.1).

Cdc42 and Rac1 share an overlapping set of activators and effectors (15). Despite

the redundancy of multiple GEFs capable of activating each GTPase, it is not clear how

each GEF is regulated to catalyze GTP loading. The Rac GEFs are differentially

expressed across tissues and at different stages of development, and thus they may be

involved in specific embryological events (16), and their regulation of GTPases may be

related to tissue specificity. Alternatively, differential GEF activation may be receptor

signaling specific; Vav2 activates Rac downstream of PDGF in fibroblasts, however

integrin mediated Rac activation in fibroblasts utilizes an unknown GEF that is not Vav2

(17). However, the Vav family is activated downstream of many receptors (18), implying

that receptor specificity may not entirely account for GEF activation. In addition, it is

also not presently clear how Rho GTPases achieve target specificity. There is some

evidence that suggests the specificity of GEF activation may determine the signal output.

210

For example, PI3K constitutive activation induces some Rac and Rho downstream

activities, but not others; Rac-mediated lamellipodia and focal complex formation, and

Rho-mediated stress fibers and focal adhesions were formed, however, Rac and Rho

regulated gene transcription was unchanged (19). Moreover, the Rac and Cdc42 GEF β-

PIX binds PAK, a Rac and Cdc42 downstream effector, recruiting it to focal complexes

with the induction of membrane ruffles and Rac1 activation (20). Thus the GEF physical

association with one or more specific GTPase target effectors may help explain the

diversity of GEFs relative to Rho GTPases and support a role for GEFs to act as unique

scaffolds conferring specificity to GTPase downstream activity. Thus the underlying

importance of the central hypothesis in this dissertation is to determine which GEFs are

critical specifically for glioblastoma progression and malignancy.

In addition to Rac1 and Cdc42 activity in GB progression, the small GTPase

RhoG has been shown to play a role in promoting tumor cell invasion (5). In appendix B

we analyzed the RhoG specific GEF SGEF, to determine whether this GEF was

important in GB biology, and we reported the importance of SGEF and RhoG signaling

downstream of TWEAK-Fn14 in promoting glioblastoma cell invasion. We determined

that SGEF mRNA expression was significantly elevated among grade three anaplastic

astrocytoma and grade four glioblastoma patient tissue samples versus non-neoplastic

brain samples, and that elevated SGEF mRNA levels correlated to poor patient survival.

Furthermore, SGEF expression was elevated in cells at the invasive edge of GB tumor

specimens relative to tumor core cells. SGEF has been previously correlated to an

invasive phenotype; SGEF is necessary for the acquisition of cell invasiveness during

211

HPV-mediated transformation and in actin cytoskeleton remodeling following infection

with salmonella and in leukocyte trans-endothelial migration (21-24). In this study, we

demonstrated that knockdown of SGEF abrogated TWEAK-induced cell migration and

decreased the depth of cell invasion, thus supporting a role for SGEF in GB cell motility.

The Fn14 receptor is significantly overexpressed in GB, and elevated Fn14 levels

correlate to cells with an increased migratory capacity (8). We determined components

of the signaling mechanism by which SGEF promotes TWEAK-Fn14 induced GB

migration. Our data demonstrated that TWEAK stimulation of Fn14 led to increased

SGEF activity and the SGEF dependent activation of RhoG with subsequent increased

Rac1 activity. Moreover, loss of SGEF or RhoG protein inhibits TWEAK-Fn14-induced

lamellipodia formation, which is consistent with the ability of SGEF to promote TWEAK

stimulation of glioma cell migration and downstream Rac1 activation. This data

corroborates our previous finding that TWEAK-Fn14 increased cell migration is

dependent on Rac1 activation (10). The interaction of Fn14 and Rac1 requires a

functional Fn14 cytoplasmic tail; the deletion of the TRAF binding site from the

cytoplasmic domain results in the loss of Fn14-Rac1 co-immunoprecipitation (10). In

appendix B we assessed the mechanism of SGEF recruitment to the Fn14 cytoplasmic

tail. A predicted site analysis indicated the SGEF protein contains five TRAF2 consensus

binding sites and we observed that SGEF activity downstream of TWEAK-Fn14 requires

the presence of a functional TRAF binding site in the Fn14 cytoplasmic domain. The

specific depletion of TRAF2 decreased both TWEAK-induced SGEF activity and the

TWEAK-induced migration of glioma cells. Thus our data supports that TRAF2, SGEF,

212

RhoG, and subsequent Rac1 activation contribute to the TWEAK-Fn14 induced

migratory capacity of GB tumor cells (Figure D.1). It is presently unclear whether SGEF

impacts TWEAK-Fn14-induced activation of Cdc42 (Figure D.1, dotted line).

Glioma cells with a heightened migratory ability have a decreased expression of

pro-apoptotic genes and are less sensitive to cytotoxic therapy induced apoptosis

(9,10,25-27). We have shown that TWEAK-Fn14-induced Rac1 activation can be

mediated through several GEF and GTPase signaling complexes. Studies have shown

that the suppression of Rac activity selectively induces apoptosis in glioma cells but not

in normal human astrocytes (28), thus proffering a rationale for the therapeutic inhibition

of pro-migratory signaling pathways including those promoting Rac activation as an

effective clinical option for GB. Moreover, the Rac1 protein is important in promoting

TWEAK-Fn14 activation of the Akt and NF-κB-pathways, and Fn14 signaling has been

shown to promote increased cell invasion and resistance to cytotoxic therapy-induced

apoptosis (9,10,29). In appendix C we characterized the role of TWEAK-Fn14 signaling

in promoting cell survival. A CHip-Chip assay to identify differential NF-κB promoter

binding under temozolomide naïve versus resistant primary GB tumorgraft specimens

interestingly revealed increased occupancy of NF-κB on the promoter region of SGEF

under TMZ resistance. We thus formed the hypothesis that TWEAK-Fn14 signaling

regulates SGEF expression and that SGEF promotes TMZ insensitivity in GB.

We determined that TWEAK binding to Fn14 induces SGEF mRNA and protein

levels. NF-κB is capable of binding the SGEF promoter region in a TWEAK-dependent

fashion, and TWEAK-induced SGEF mRNA and protein levels are dependent upon NF-

213

κB activity. Furthermore, we showed that in a panel of 82 publicly available GB tumor

specimens there was a strong positive association between Fn14 and SGEF expression,

whereas there was no strong association noted in lower grade brain tumors, suggesting

that the co-expression of these genes is relevant specifically to GB malignancy.

Moreover, we determined that the depletion of SGEF sensitized cells to TMZ-induced

apoptosis and impaired colony formation following TMZ insult. Thus our data supports a

role for SGEF in promoting both the increased invasive capacity of glioma cells

downstream of TWEAK-Fn14 signaling and in promoting chemotherapeutic resistance

(Figure D.1).

Cancer invasion and resistance are increasingly being recognized as

interconnected processes sharing overlapping pathways that together promote disease

progression and therapy failure (30). In GB, the tumor response to external stresses

including from the tumor microenvironment or from chemotherapeutic or radiation

treatment involves the coordination of both pro-survival and pro-invasion signaling

working in concert to promote overall GB progression. The GB tumor microenvironment

is comprised of areas of hypoxia. Hypoxia, including notably areas induced by anti-

VEGF therapy, promotes increased tumor cell glycolysis and invasion into normal brain

(31). Moreover, areas of pseudopalisading necrosis, one of the histological hallmarks of

GB, have been defined to consist of tumor cells actively invading away from a hypoxic

core of tissue formed from a vaso-occlusive event. These pro-migratory cells actively

secrete proangiogenic factors, linking the formation of pseudopalisades with

microvascular hyperplasia in GB (32,33). Additionally, glioma cells promote the

214

Figure D.1. TWEAK-Fn14 pro-survival and pro-invasive signaling in GB.

215

survival of endothelial cells in order to facilitate the angiogenesis necessary for tumor

survival. Hypoxia has been shown to activate NF- κB signaling in endothelial cells with

the resultant increased gene expression of antiapoptotic factors BCL2, BCL-xL, survivin,

and XIAP; the crosstalk from this endothelial cell signaling with glioma cell signaling to

release factors VEGF and TNF-alpha together promoted endothelial cell survival (34),

and increased microvessel density in astroglial brain tumors is a prognostic indicator of

poor patient survival (35). Thus, tumor hypoxia which is a common occurrence in GB

promotes both cell invasion into normal brain tissue and supports angiogenesis for tumor

survival and growth.

In addition to hypoxia, chemotherapeutic or radiation therapy promote a

coordinated pro-survival and pro-invasive tumor response. For example,

chemotherapeutic resistance in glioma cells has been shown to be promoted through Rac1

dependent Akt2 activity working upstream of the BCL2 family to promote cell survival

(29), and activation of Akt2 leads to increased MMP-9 expression and increased glioma

cell migration and invasion (36). The inhibition of NF-κB has been shown to promote

increased glioma cell death, which was synergistic under the combined treatment with

TMZ, and led to decreased migration and invasion with specifically a decreased

expression of invasion-related genes (37). Moreover, the specific depletion of TRAF2 in

GB has been shown to inhibit growth and confer radio-sensitization to tumor cells (38),

and signaling through TRAF2 promotes not only NF-κB activity, but also JNK/SAPK

activity, inflammation, and cell migration and chemo- and radio-resistance of cancer

cells (39-45). In addition, the pharmacologic auto-phosphorylation inhibition of focal

216

adhesion kinase in GB was shown to inhibit cell invasion and increase cell apoptosis, an

effect which was synergistic when treated with TMZ in vivo (46), and drug resistant

glioma cells displayed elevated expression of integrins (47), with the beta-1 integrin

shown to promote cell survival following radiation treatment via Akt signaling (48). The

combination of an mTOR inhibitor, which was shown to decrease cell invasion, with

radiotherapy prolonged survival in a syngeneic mouse glioma model through additive

cytostatic effects (49). Moreover, our data supported a relationship between invasion and

chemotherapeutic resistance; primary GB tumorgraft cells treated to develop resistance to

TMZ therapy acquired an increased migratory capacity relative to their TMZ naïve

counterparts.

Our data demonstrates a role for SGEF in the TMZ treatment resistance response.

The level of SGEF activity increased upon treatment with TMZ, and SGEF depleted

glioma cells displayed impaired expression of a network of pro-survival and DNA repair

genes. We showed that glioma cells depleted of SGEF display an impaired ability to

phosphorylate BRCA1 following treatment with TMZ, an effect that may contribute to

impaired DNA repair and explain the increased susceptibility to undergo apoptosis in

these glioma cells. Interestingly, the increase in SGEF activity following TMZ treatment

was observed to occur in the nuclear fraction of glioma cell lysates. The SGEF protein

contains two nuclear localization signal (NLS) sequences (50), as well as a site analysis

predicted nuclear export signal. Other studies have confirmed that cytoplasmic SGEF

acts in a pro-invasive fashion, while also documenting an undefined SGEF nuclear

population as well (21). We believe nuclear SGEF may act in a pro-survival fashion in

217

the coordinated response to DNA damage. Of note, several GEFs and Rho GTPases have

been identified to contain NLS sequences. The GEFs Ect2 and Net1 both contain NLS

sequences, however only Net1 contains a nuclear export signal (51,52). Moreover the

Rac1 and RhoA GTPases have been shown to contain a functional NLS, and several

additional Rho GTPases have predicted NLS sequences, including RhoC, RhoG, and

Cdc42 (53,54). Lastly, several Rho GTPase associated proteins have been shown to be

present in nuclear pools, including the GAPs p190 RhoGAP and DCL-1, and downstream

effector proteins ROCKII and LIMK (54), however a nuclear role for these proteins has

yet to be determined.

Interestingly, several recent publications have linked the role of GEFs and Rho

GTPases to the pro-survival and DNA damage responses following radiation or

chemotherapy treatment. Inhibition of Rho in vivo in glioblastoma xenografts induces

the radio-sensitivity of tumor cells, and corresponds to both improved tumor oxygenation

as a result of decreased microvessel density and to decreased MMP2 expression. Thus

Rho pathways are involved in radioresistance, via modulation of hypoxia and

angiogenesis in GB (55). The GTPase RhoA and the RhoA GEF Net1have been shown

to be activated in the nucleus following irradiation, and NET1 has been shown to regulate

RhoA-dependent actin stress fiber formation upon induction of DNA damage via p38

MAPK signaling, implicating this pathway in the DNA damage response to promote cell

survival (54,56). Moreover, the depletion of NET1 increased cell susceptibility to

apoptosis following radiation therapy (56). In addition, in melanoma cells the GTPase

RhoJ and its effector PAK1 have been shown to promote chemoresistance via modulation

218

of the ATM/ATR DNA damage response to decrease specifically DNA damage-induced

apoptosis with a corresponding increase in expression of several pro-survival genes (57).

Thus GEF and Rho GTPase signaling may promote pro-invasive signaling in concert

with pro-survival signaling by mediating the response to DNA damage.

GB tumors are characterized by deregulated pathway signaling including

proliferation, metabolism, stem cells and gliomagenesis, angiogenesis, survival and

invasion. Much effort is being placed on assessing inhibitors of these processes in

various current clinical trials, often through combinatorial treatment strategies (Table

D.1), however to date the life expectancy of a patient diagnosed with GB has not

increased significantly. Importantly, future effective treatment strategies for

glioblastoma need to address multiple hallmarks of tumor progression. The pro-invasive

and pro-survival TWEAK-Fn14 signaling pathway thus represents a novel target for

therapy; indeed drugs are currently in clinical trials which inhibit the TWEAK-Fn14

interaction, however these trials do not to date include GB (Table D.1). Moreover, the

downstream mediators of TWEAK-Fn14 signaling present new therapeutic targets for

additional future GB treatments.

Therapy directed at mediators of pro-invasive and pro-survival pathways, as well

as importantly therapy against molecules critical to tumor initiation will help prevent

tumor resistance, angiogenesis, spread and progression. NF- κB signaling, which has

been shown to be important in GB cell invasion and survival, has recently been described

to be activated during differentiation of glioblastoma-initiating cells derived from

surgical tumor specimens, whereby blockade of this signaling led to replication arrest and

219

Target Process Drugs in GB Clinical Trials ** References

TWEAK/FN14* Invasion Survival

PDL192 (Enavatuzumab), R05458640 (RG7212)

(8-10,29,58-61)

NOTCH Gliomagenesis,Angiogenesis

RO4929097 (62-68)

Integrins (αVβ3 & αVβ5)

Vascular Permeability

Cilengitide, ATN-161 (69,70)

VEGF/VEGFR Angiogenesis Metabolism

Aflibercept, Bevacizumab, Cediranib, Lenvatinib mesylate, Nintedanib, Pazopanib, Sorafenib, Sunitinib,

Vandetanib, Cabozantinib, Ramucirumab, Vatalanib

(71-74)

PDGFR, KIT Angiogenesis Proliferation

Imatinib, Nintedanib, Pazopanib, Sorafenib, Sunitinib, Tandutinib,

Olavatumab, Vatalanib

(74-77)

MET Proliferation Invasion

Rilotumumab, Cabozantinib (72,78-82)

EGFR Proliferation Invasion

Cetuximab, Erlotinib, Gefitinib, Lapatinib, Vandetanib, Rindopepimut,

I-125 MAB-425, Nimotuzumab, Dacomitinib

(75,81,83,84)

PI3K Proliferation Survival

Enzastaurin, BKM120, PX-866, XL147

(82,85,86)

AKT Proliferation Survival

Enzastaurin, Nelfinavir, Perifosine (29,82,85,87)

mTOR Proliferation Metabolism

Temsirolimus, XL765, AZD8055, Everolimus, Sirolimus

(85,88)

RAS/RAF/MAPK Proliferation Invasion

Sorafenib, Tipifarnib, Lonafarnib (89-92)

PARP DNA damage response

Veliparib, Iniparib (93)

*Current Clinical Trials are not specific to GB ** Data accessed from [www.clinicaltrials.gov]

Table D.1. Current signaling pathway points of intervention in GB clinical trials.

Drugs currently in use in clinical trials for GB treatment are listed above. The target

pathway for the drug and its role in tumor malignancy, as well as the list of citations

supporting a rationale for this target in GB therapy are detailed. TWEAK/Fn14 directed

therapeutics are currently in clinical trials, but are not GB specific to date.

220

senescence with results confirmed in a xenograft model (94). These findings suggest that

inhibition of NF- κB signaling may prevent these initiating cells from driving

tumorigenesis. Thus key players in NF- κB signaling should be included as future

therapeutic targets. Although to date the role of GEFs and Rho GTPases has not been

explored in cancer initiating cells in GB, there is evidence of a link between Rho GTPase

expression and tumorigenesis (95). Rac1 has been shown to play a key role downstream

of Kras in initiating early metaplastic changes in pancreatic ductal adenocarcinoma (96),

and Rac1 depletion in non-small cell lung adenocarcinoma inhibited cancer stem cell

activity, including effects on invasion, proliferation, anchorage-independent growth,

sphere formation, and lung colonization (97). Furthermore, it has been suggested that

Rac is required for the maintenance and expansion of leukemic stem/progenitor cells by

mediating stromal cell interaction (98). Lastly, during HPV-mediated cell

transformation, SGEF and RhoG are critical for the acquisition of an invasive

phenotype(21). Thus the role of GEFs and Rho GTPases in the promotion of

tumorigenesis further supports the rationale for targeting GEF-Rho GTPase signaling to

inhibit cancer progression.

Increased support for the utility of Rho GTPase pathway inhibitors in treating

cancer has led to the recent development of several strategies to identify specific drugs

that will act against Rho GTPases, or their regulation by GEFs. For example, recently a

new high-throughput flow cytometric-based assay for the identification of selective Rho

GTPase inhibitors was described which uses a fluorescent-GTP binding readout to

determine inhibition of activity (99). The development of peptide and peptidomimetic

221

inhibitors to Rho GTPase family members is also underway (100). Additionally, a new

compound targeting specifically the Rac1-Tiam GEF interaction has been described to

inhibit GTP-loading specifically of Rac1 without affecting Cdc42 or RhoA activity and

inhibited PC-3 prostate cancer cell proliferation in preliminary models (101). A

subsequently developed Rac1 inhibitor has been shown to block the association of Vav2

with Rac1 (102). Moreover, the targeting of Rho GTPases at potential allosteric non-

nucleotide binding sites has recently been described, and novel binding sites important

for these proteins have been identified (103). There is also study of Rho GTPase effector

inhibition; recently a new PAK small molecule inhibitor was described that inhibits

anchorage-independent growth of a panel of tumor cell lines (104).

Furthermore, various studies highlight the potential use of GEF inhibition and the

recent development of several therapeutics targeting GEFs supports both the rationale for

and the feasibility of future GEF inhibitors for clinical use. Recently a new method has

been described that is an adaptation of the yeast two-hybrid system, in which rapid

medium-throughput screening can be performed to identify chemical GEF inhibitors

(105). This model converts the activation of a mammalian Rho GTPase by its cognate

Rho GEF into a readout system that affects the growth of yeast. In addition, there are

reports of the identification of Trio GEF specific inhibitors that are specific either to Trio

exchange on RhoA (106) or Rac1 and RhoG (107). These preliminary studies indicate

targeting Rho GTPase signaling is a new but active field of study. Moreover,

combinatorial therapy that includes use of treatment modalities designed to hamper the

survival and DNA repair mechanisms of the cell may provide a significant added survival

222

benefit over the standard of care alone or when used in combination with inhibitors of

other GB deregulated pathways (93,108-111). Thus therapy targeting the deregulated

GEF-Rho GTPase pathways in TWEAK-Fn14 signaling in GB may act to inhibit both

cellular mechanisms of invasion and survival and in combination with chemotherapy and

radiation may improve the prognosis of patients suffering from this devastating disease.

223

References



3. Chrzanowska-Wodnicka, M., and Burridge, K. (1996) Rho-stimulated contractility drives the formation of stress fibers and focal adhesions. The Journal of cell biology 133, 1403-1415

4. Vega, F. M., and Ridley, A. J. (2008) Rho GTPases in cancer cell biology. FEBS Lett 582, 2093-2101


6. Krauthammer, M., Kong, Y., Ha, B. H., Evans, P., Bacchiocchi, A., McCusker, J. P., Cheng, E., Davis, M. J., Goh, G., Choi, M., Ariyan, S., Narayan, D., Dutton-Regester, K., Capatana, A., Holman, E. C., Bosenberg, M., Sznol, M., Kluger, H. M., Brash, D. E., Stern, D. F., Materin, M. A., Lo, R. S., Mane, S., Ma, S., Kidd, K. K., Hayward, N. K., Lifton, R. P., Schlessinger, J., Boggon, T. J., and Halaban, R. (2012) Exome sequencing identifies recurrent somatic RAC1 mutations in melanoma. Nat Genet 44, 1006-1014

7. Davis, M. J., Ha, B. H., Holman, E. C., Halaban, R., Schlessinger, J., and Boggon, T. J. (2013) RAC1P29S is a spontaneously activating cancer-associated GTPase. Proceedings of the National Academy of Sciences of the United States of America 110, 912-917

8. Tran, N. L., McDonough, W. S., Donohue, P. J., Winkles, J. A., Berens, T. J., Ross, K. R., Hoelzinger, D. B., Beaudry, C., Coons, S. W., and Berens, M. E.

224

(2003) The human Fn14 receptor gene is up-regulated in migrating glioma cells in vitro and overexpressed in advanced glial tumors. Am J Pathol 162, 1313-1321



11. Ridley, A. J. (2006) Rho GTPases and actin dynamics in membrane protrusions and vesicle trafficking. Trends Cell Biol 16, 522-529

12. DerMardirossian, C., and Bokoch, G. M. (2005) GDIs: central regulatory molecules in Rho GTPase activation. Trends Cell Biol 15, 356-363

13. Saito, S., Liu, X. F., Kamijo, K., Raziuddin, R., Tatsumoto, T., Okamoto, I., Chen, X., Lee, C. C., Lorenzi, M. V., Ohara, N., and Miki, T. (2004) Deregulation and mislocalization of the cytokinesis regulator ECT2 activate the Rho signaling pathways leading to malignant transformation. J Biol Chem 279, 7169-7179


15. Cotteret, S., and Chernoff, J. (2002) The evolutionary history of effectors downstream of Cdc42 and Rac. Genome Biol 3, REVIEWS0002

225


17. Liu, B. P., and Burridge, K. (2000) Vav2 activates Rac1, Cdc42, and RhoA downstream from growth factor receptors but not beta1 integrins. Molecular and cellular biology 20, 7160-7169

18. Bustelo, X. R. (2000) Regulatory and signaling properties of the Vav family. Molecular and cellular biology 20, 1461-1477

19. Reif, K., Nobes, C. D., Thomas, G., Hall, A., and Cantrell, D. A. (1996) Phosphatidylinositol 3-kinase signals activate a selective subset of Rac/Rho-dependent effector pathways. Current biology : CB 6, 1445-1455

20. Manser, E., Loo, T. H., Koh, C. G., Zhao, Z. S., Chen, X. Q., Tan, L., Tan, I., Leung, T., and Lim, L. (1998) PAK kinases are directly coupled to the PIX family of nucleotide exchange factors. Mol Cell 1, 183-192



23. Ellerbroek, S. M., Wennerberg, K., Arthur, W. T., Dunty, J. M., Bowman, D. R., DeMali, K. A., Der, C., and Burridge, K. (2004) SGEF, a RhoG guanine nucleotide exchange factor that stimulates macropinocytosis. Mol Biol Cell 15, 3309-3319

24. van Buul, J. D., Allingham, M. J., Samson, T., Meller, J., Boulter, E., Garcia-Mata, R., and Burridge, K. (2007) RhoG regulates endothelial apical cup assembly downstream from ICAM1 engagement and is involved in leukocyte trans-endothelial migration. J Cell Biol 178, 1279-1293

226




28. Senger, D. L., Tudan, C., Guiot, M. C., Mazzoni, I. E., Molenkamp, G., LeBlanc, R., Antel, J., Olivier, A., Snipes, G. J., and Kaplan, D. R. (2002) Suppression of Rac activity induces apoptosis of human glioma cells but not normal human astrocytes. Cancer research 62, 2131-2140


30. Alexander, S., and Friedl, P. (2012) Cancer invasion and resistance: interconnected processes of disease progression and therapy failure. Trends Mol Med 18, 13-26

31. Keunen, O., Johansson, M., Oudin, A., Sanzey, M., Rahim, S. A., Fack, F., Thorsen, F., Taxt, T., Bartos, M., Jirik, R., Miletic, H., Wang, J., Stieber, D., Stuhr, L., Moen, I., Rygh, C. B., Bjerkvig, R., and Niclou, S. P. (2011) Anti-VEGF treatment reduces blood supply and increases tumor cell invasion in glioblastoma. Proceedings of the National Academy of Sciences of the United States of America 108, 3749-3754

32. Brat, D. J., Castellano-Sanchez, A. A., Hunter, S. B., Pecot, M., Cohen, C., Hammond, E. H., Devi, S. N., Kaur, B., and Van Meir, E. G. (2004) Pseudopalisades in glioblastoma are hypoxic, express extracellular matrix

227

proteases, and are formed by an actively migrating cell population. Cancer research 64, 920-927

33. Rong, Y., Durden, D. L., Van Meir, E. G., and Brat, D. J. (2006) 'Pseudopalisading' necrosis in glioblastoma: a familiar morphologic feature that links vascular pathology, hypoxia, and angiogenesis. J Neuropathol Exp Neurol 65, 529-539

34. Ueda, Y., Nakagawa, T., Kubota, T., Ido, K., and Sato, K. (2005) Glioma cells under hypoxic conditions block the brain microvascular endothelial cell death induced by serum starvation. J Neurochem 95, 99-110

35. Leon, S. P., Folkerth, R. D., and Black, P. M. (1996) Microvessel density is a prognostic indicator for patients with astroglial brain tumors. Cancer 77, 362-372

36. Zhang, B., Gu, F., She, C., Guo, H., Li, W., Niu, R., Fu, L., Zhang, N., and Ma, Y. (2009) Reduction of Akt2 inhibits migration and invasion of glioma cells. International journal of cancer. Journal international du cancer 125, 585-595

37. Brassesco, M. S., Roberto, G. M., Morales, A. G., Oliveira, J. C., Delsin, L. E., Pezuk, J. A., Valera, E. T., Carlotti, C. G., Jr., Rego, E. M., de Oliveira, H. F., Scrideli, C. A., Umezawa, K., and Tone, L. G. (2013) Inhibition of NF- kappa B by Dehydroxymethylepoxyquinomicin Suppresses Invasion and Synergistically Potentiates Temozolomide and gamma -Radiation Cytotoxicity in Glioblastoma Cells. Chemother Res Pract 2013, 593020

38. Zheng, M., Morgan-Lappe, S. E., Yang, J., Bockbrader, K. M., Pamarthy, D., Thomas, D., Fesik, S. W., and Sun, Y. (2008) Growth inhibition and radiosensitization of glioblastoma and lung cancer cells by small interfering RNA silencing of tumor necrosis factor receptor-associated factor 2. Cancer research 68, 7570-7578

39. Yang, H. J., Youn, H., Seong, K. M., Jin, Y. W., Kim, J., and Youn, B. (2013) Phosphorylation of Ribosomal Protein S3 and Antiapoptotic TRAF2 Protein Mediates Radioresistance in Non-small Cell Lung Cancer Cells. The Journal of biological chemistry 288, 2965-2975

228

40. Lin, W. J., Su, Y. W., Lu, Y. C., Hao, Z., Chio, II, Chen, N. J., Brustle, A., Li, W. Y., and Mak, T. W. (2011) Crucial role for TNF receptor-associated factor 2 (TRAF2) in regulating NFkappaB2 signaling that contributes to autoimmunity. Proceedings of the National Academy of Sciences of the United States of America 108, 18354-18359

41. Jang, K. W., Lee, K. H., Kim, S. H., Jin, T., Choi, E. Y., Jeon, H. J., Kim, E., Han, Y. S., and Chung, J. H. (2011) Ubiquitin ligase CHIP induces TRAF2 proteasomal degradation and NF-kappaB inactivation to regulate breast cancer cell invasion. J Cell Biochem 112, 3612-3620

42. Natoli, G., Costanzo, A., Guido, F., Moretti, F., Bernardo, A., Burgio, V. L., Agresti, C., and Levrero, M. (1998) Nuclear factor kB-independent cytoprotective pathways originating at tumor necrosis factor receptor-associated factor 2. The Journal of biological chemistry 273, 31262-31272

43. Rothe, M., Sarma, V., Dixit, V. M., and Goeddel, D. V. (1995) TRAF2-mediated activation of NF-kappa B by TNF receptor 2 and CD40. Science 269, 1424-1427

44. Liu, Z. G., Hsu, H., Goeddel, D. V., and Karin, M. (1996) Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-kappaB activation prevents cell death. Cell 87, 565-576

45. Natoli, G., Costanzo, A., Ianni, A., Templeton, D. J., Woodgett, J. R., Balsano, C., and Levrero, M. (1997) Activation of SAPK/JNK by TNF receptor 1 through a noncytotoxic TRAF2-dependent pathway. Science 275, 200-203

46. Golubovskaya, V. M., Huang, G., Ho, B., Yemma, M., Morrison, C. D., Lee, J., Eliceiri, B. P., and Cance, W. G. (2013) Pharmacologic blockade of FAK autophosphorylation decreases human glioblastoma tumor growth and synergizes with temozolomide. Molecular cancer therapeutics 12, 162-172

47. Hikawa, T., Mori, T., Abe, T., and Hori, S. (2000) The ability in adhesion and invasion of drug-resistant human glioma cells. J Exp Clin Cancer Res 19, 357-362

48. Cordes, N., Seidler, J., Durzok, R., Geinitz, H., and Brakebusch, C. (2006) beta1-integrin-mediated signaling essentially contributes to cell survival after radiation-induced genotoxic injury. Oncogene 25, 1378-1390

229

49. Weiler, M., Pfenning, P. N., Thiepold, A. L., Blaes, J., Jestaedt, L., Gronych, J., Dittmann, L. M., Berger, B., Jugold, M., Kosch, M., Combs, S. E., von Deimling, A., Weller, M., Bendszus, M., Platten, M., and Wick, W. (2013) Suppression of proinvasive RGS4 by mTOR inhibition optimizes glioma treatment. Oncogene 32, 1099-1109

50. Qi, H., Fournier, A., Grenier, J., Fillion, C., Labrie, Y., and Labrie, C. (2003) Isolation of the novel human guanine nucleotide exchange factor Src homology 3 domain-containing guanine nucleotide exchange factor (SGEF) and of C-terminal SGEF, an N-terminally truncated form of SGEF, the expression of which is regulated by androgen in prostate cancer cells. Endocrinology 144, 1742-1752

51. Schmidt, A., and Hall, A. (2002) The Rho exchange factor Net1 is regulated by nuclear sequestration. The Journal of biological chemistry 277, 14581-14588


53. Williams, C. L. (2003) The polybasic region of Ras and Rho family small GTPases: a regulator of protein interactions and membrane association and a site of nuclear localization signal sequences. Cellular signalling 15, 1071-1080

54. Dubash, A. D., Guilluy, C., Srougi, M. C., Boulter, E., Burridge, K., and Garcia-Mata, R. (2011) The small GTPase RhoA localizes to the nucleus and is activated by Net1 and DNA damage signals. PLoS One 6, e17380

55. Ader, I., Delmas, C., Bonnet, J., Rochaix, P., Favre, G., Toulas, C., and Cohen-Jonathan-Moyal, E. (2003) Inhibition of Rho pathways induces radiosensitization and oxygenation in human glioblastoma xenografts. Oncogene 22, 8861-8869

56. Guerra, L., Carr, H. S., Richter-Dahlfors, A., Masucci, M. G., Thelestam, M., Frost, J. A., and Frisan, T. (2008) A bacterial cytotoxin identifies the RhoA exchange factor Net1 as a key effector in the response to DNA damage. PLoS One 3, e2254

230

57. Ho, H., Aruri, J., Kapadia, R., Mehr, H., White, M. A., and Ganesan, A. K. (2012) RhoJ regulates melanoma chemoresistance by suppressing pathways that sense DNA damage. Cancer research 72, 5516-5528

58. Winkles, J. A., Tran, N. L., and Berens, M. E. (2006) TWEAK and Fn14: new molecular targets for cancer therapy? Cancer Lett 235, 11-17

59. Winkles, J. A., Tran, N. L., Brown, S. A., Stains, N., Cunliffe, H. E., and Berens, M. E. (2007) Role of TWEAK and Fn14 in tumor biology. Front Biosci 12, 2761-2771

60. Winkles, J. A. (2008) The TWEAK-Fn14 cytokine-receptor axis: discovery, biology and therapeutic targeting. Nat Rev Drug Discov 7, 411-425

61. Fortin, S. P., Ennis, M. J., Schumacher, C. A., Zylstra-Diegel, C. R., Williams, B. O., Ross, J. T., Winkles, J. A., Loftus, J. C., Symons, M. H., and Tran, N. L. (2012) Cdc42 and the Guanine Nucleotide Exchange Factors Ect2 and Trio Mediate Fn14-Induced Migration and Invasion of Glioblastoma Cells. Molecular cancer research : MCR

62. Wang, J., Wakeman, T. P., Lathia, J. D., Hjelmeland, A. B., Wang, X. F., White, R. R., Rich, J. N., and Sullenger, B. A. (2010) Notch promotes radioresistance of glioma stem cells. Stem Cells 28, 17-28

63. Hovinga, K. E., Shimizu, F., Wang, R., Panagiotakos, G., Van Der Heijden, M., Moayedpardazi, H., Correia, A. S., Soulet, D., Major, T., Menon, J., and Tabar, V. (2010) Inhibition of notch signaling in glioblastoma targets cancer stem cells via an endothelial cell intermediate. Stem Cells 28, 1019-1029

64. Lino, M. M., Merlo, A., and Boulay, J. L. (2010) Notch signaling in glioblastoma: a developmental drug target? BMC Med 8, 72

65. Zhu, T. S., Costello, M. A., Talsma, C. E., Flack, C. G., Crowley, J. G., Hamm, L. L., He, X., Hervey-Jumper, S. L., Heth, J. A., Muraszko, K. M., DiMeco, F., Vescovi, A. L., and Fan, X. (2011) Endothelial cells create a stem cell niche in glioblastoma by providing NOTCH ligands that nurture self-renewal of cancer stem-like cells. Cancer research 71, 6061-6072

231

66. Zhang, X., Chen, T., Zhang, J., Mao, Q., Li, S., Xiong, W., Qiu, Y., Xie, Q., and Ge, J. (2012) Notch1 promotes glioma cell migration and invasion by stimulating beta-catenin and NF-kappaB signaling via AKT activation. Cancer Sci 103, 181-190

67. Tchorz, J. S., Tome, M., Cloetta, D., Sivasankaran, B., Grzmil, M., Huber, R. M., Rutz-Schatzmann, F., Kirchhoff, F., Schaeren-Wiemers, N., Gassmann, M., Hemmings, B. A., Merlo, A., and Bettler, B. (2012) Constitutive Notch2 signaling in neural stem cells promotes tumorigenic features and astroglial lineage entry. Cell Death Dis 3, e325

68. Floyd, D. H., Kefas, B., Seleverstov, O., Mykhaylyk, O., Dominguez, C., Comeau, L., Plank, C., and Purow, B. (2012) Alpha-secretase inhibition reduces human glioblastoma stem cell growth in vitro and in vivo by inhibiting Notch. Neuro-oncology 14, 1215-1226

69. Reardon, D. A., Nabors, L. B., Stupp, R., and Mikkelsen, T. (2008) Cilengitide: an integrin-targeting arginine-glycine-aspartic acid peptide with promising activity for glioblastoma multiforme. Expert Opin Investig Drugs 17, 1225-1235

70. Scaringi, C., Minniti, G., Caporello, P., and Enrici, R. M. (2012) Integrin inhibitor cilengitide for the treatment of glioblastoma: a brief overview of current clinical results. Anticancer Res 32, 4213-4223

71. Jo, J., Schiff, D., and Purow, B. (2012) Angiogenic inhibition in high-grade gliomas: past, present and future. Expert Rev Neurother 12, 733-747

72. Lu, K. V., Chang, J. P., Parachoniak, C. A., Pandika, M. M., Aghi, M. K., Meyronet, D., Isachenko, N., Fouse, S. D., Phillips, J. J., Cheresh, D. A., Park, M., and Bergers, G. (2012) VEGF inhibits tumor cell invasion and mesenchymal transition through a MET/VEGFR2 complex. Cancer Cell 22, 21-35

73. Cheng, S. Y., Huang, H. J., Nagane, M., Ji, X. D., Wang, D., Shih, C. C., Arap, W., Huang, C. M., and Cavenee, W. K. (1996) Suppression of glioblastoma angiogenicity and tumorigenicity by inhibition of endogenous expression of vascular endothelial growth factor. Proceedings of the National Academy of Sciences of the United States of America 93, 8502-8507

232

74. de Bouard, S., Herlin, P., Christensen, J. G., Lemoisson, E., Gauduchon, P., Raymond, E., and Guillamo, J. S. (2007) Antiangiogenic and anti-invasive effects of sunitinib on experimental human glioblastoma. Neuro-oncology 9, 412-423

75. Szerlip, N. J., Pedraza, A., Chakravarty, D., Azim, M., McGuire, J., Fang, Y., Ozawa, T., Holland, E. C., Huse, J. T., Jhanwar, S., Leversha, M. A., Mikkelsen, T., and Brennan, C. W. (2012) Intratumoral heterogeneity of receptor tyrosine kinases EGFR and PDGFRA amplification in glioblastoma defines subpopulations with distinct growth factor response. Proceedings of the National Academy of Sciences of the United States of America 109, 3041-3046

76. Liu, K. W., Hu, B., and Cheng, S. Y. (2011) Platelet-derived growth factor receptor alpha in glioma: a bad seed. Chin J Cancer 30, 590-602

77. Walbert, T., and Mikkelsen, T. (2011) Recurrent high-grade glioma: a diagnostic and therapeutic challenge. Expert Rev Neurother 11, 509-518

78. Moriyama, T., Kataoka, H., Koono, M., and Wakisaka, S. (1999) Expression of hepatocyte growth factor/scatter factor and its receptor c-Met in brain tumors: evidence for a role in progression of astrocytic tumors (Review). Int J Mol Med 3, 531-536

79. Lal, B., Xia, S., Abounader, R., and Laterra, J. (2005) Targeting the c-Met pathway potentiates glioblastoma responses to gamma-radiation. Clin Cancer Res 11, 4479-4486

80. Eckerich, C., Zapf, S., Fillbrandt, R., Loges, S., Westphal, M., and Lamszus, K. (2007) Hypoxia can induce c-Met expression in glioma cells and enhance SF/HGF-induced cell migration. International journal of cancer. Journal international du cancer 121, 276-283

81. Huang, P. H., Mukasa, A., Bonavia, R., Flynn, R. A., Brewer, Z. E., Cavenee, W. K., Furnari, F. B., and White, F. M. (2007) Quantitative analysis of EGFRvIII cellular signaling networks reveals a combinatorial therapeutic strategy for glioblastoma. Proceedings of the National Academy of Sciences of the United States of America 104, 12867-12872

233

82. Bowers, D. C., Fan, S., Walter, K. A., Abounader, R., Williams, J. A., Rosen, E. M., and Laterra, J. (2000) Scatter factor/hepatocyte growth factor protects against cytotoxic death in human glioblastoma via phosphatidylinositol 3-kinase- and AKT-dependent pathways. Cancer research 60, 4277-4283

83. Kuan, C. T., Wikstrand, C. J., and Bigner, D. D. (2000) EGFRvIII as a promising target for antibody-based brain tumor therapy. Brain Tumor Pathol 17, 71-78

84. Gan, H. K., Kaye, A. H., and Luwor, R. B. (2009) The EGFRvIII variant in glioblastoma multiforme. J Clin Neurosci 16, 748-754

85. Lefranc, F., Brotchi, J., and Kiss, R. (2005) Possible future issues in the treatment of glioblastomas: special emphasis on cell migration and the resistance of migrating glioblastoma cells to apoptosis. J Clin Oncol 23, 2411-2422

86. Wen, P. Y., Lee, E. Q., Reardon, D. A., Ligon, K. L., and Alfred Yung, W. K. (2012) Current clinical development of PI3K pathway inhibitors in glioblastoma. Neuro-oncology 14, 819-829

87. McDowell, K. A., Riggins, G. J., and Gallia, G. L. (2011) Targeting the AKT pathway in glioblastoma. Current pharmaceutical design 17, 2411-2420

88. Akhavan, D., Cloughesy, T. F., and Mischel, P. S. (2010) mTOR signaling in glioblastoma: lessons learned from bench to bedside. Neuro-oncology 12, 882-889

89. Bouterfa, H. L., Sattelmeyer, V., Czub, S., Vordermark, D., Roosen, K., and Tonn, J. C. (2000) Inhibition of Ras farnesylation by lovastatin leads to downregulation of proliferation and migration in primary cultured human glioblastoma cells. Anticancer Res 20, 2761-2771

90. Albert, L., Karsy, M., Murali, R., and Jhanwar-Uniyal, M. (2009) Inhibition of mTOR Activates the MAPK Pathway in Glioblastoma Multiforme. Cancer Genomics Proteomics 6, 255-261

91. Edwards, L. A., Verreault, M., Thiessen, B., Dragowska, W. H., Hu, Y., Yeung, J. H., Dedhar, S., and Bally, M. B. (2006) Combined inhibition of the

234

phosphatidylinositol 3-kinase/Akt and Ras/mitogen-activated protein kinase pathways results in synergistic effects in glioblastoma cells. Molecular cancer therapeutics 5, 645-654

92. Patil, C. G., Nuno, M., Elramsisy, A., Mukherjee, D., Carico, C., Dantis, J., Hu, J., Yu, J. S., Fan, X., Black, K. L., and Bannykh, S. I. (2013) High levels of phosphorylated MAP kinase are associated with poor survival among patients with glioblastoma during the temozolomide era. Neuro-oncology 15, 104-111

93. Barazzuol, L., Jena, R., Burnet, N. G., Meira, L. B., Jeynes, J. C., Kirkby, K. J., and Kirkby, N. F. (2013) Evaluation of poly (ADP-ribose) polymerase inhibitor ABT-888 combined with radiotherapy and temozolomide in glioblastoma. Radiat Oncol 8, 65

94. Nogueira, L., Ruiz-Ontanon, P., Vazquez-Barquero, A., Lafarga, M., Berciano, M. T., Aldaz, B., Grande, L., Casafont, I., Segura, V., Robles, E. F., Suarez, D., Garcia, L. F., Martinez-Climent, J. A., and Fernandez-Luna, J. L. (2011) Blockade of the NFkappaB pathway drives differentiating glioblastoma-initiating cells into senescence both in vitro and in vivo. Oncogene 30, 3537-3548

95. Gomez del Pulgar, T., Benitah, S. A., Valeron, P. F., Espina, C., and Lacal, J. C. (2005) Rho GTPase expression in tumourigenesis: evidence for a significant link. BioEssays : news and reviews in molecular, cellular and developmental biology 27, 602-613

96. Heid, I., Lubeseder-Martellato, C., Sipos, B., Mazur, P. K., Lesina, M., Schmid, R. M., and Siveke, J. T. (2011) Early requirement of Rac1 in a mouse model of pancreatic cancer. Gastroenterology 141, 719-730, 730 e711-717

97. Akunuru, S., Palumbo, J., Zhai, Q. J., and Zheng, Y. (2011) Rac1 targeting suppresses human non-small cell lung adenocarcinoma cancer stem cell activity. PLoS One 6, e16951

98. Rozenveld-Geugien, M., Baas, I. O., van Gosliga, D., Vellenga, E., and Schuringa, J. J. (2007) Expansion of normal and leukemic human hematopoietic stem/progenitor cells requires rac-mediated interaction with stromal cells. Exp Hematol 35, 782-792

235

99. Surviladze, Z., Young, S. M., and Sklar, L. A. (2012) High-throughput flow cytometry bead-based multiplex assay for identification of Rho GTPase inhibitors. Methods Mol Biol 827, 253-270

100. Marchioni, F., and Zheng, Y. (2009) Targeting rho GTPases by peptidic structures. Current pharmaceutical design 15, 2481-2487

101. Nassar, N., Cancelas, J., Zheng, J., Williams, D. A., and Zheng, Y. (2006) Structure-function based design of small molecule inhibitors targeting Rho family GTPases. Curr Top Med Chem 6, 1109-1116

102. Montalvo-Ortiz, B. L., Castillo-Pichardo, L., Hernandez, E., Humphries-Bickley, T., De la Mota-Peynado, A., Cubano, L. A., Vlaar, C. P., and Dharmawardhane, S. (2012) Characterization of EHop-016, novel small molecule inhibitor of Rac GTPase. The Journal of biological chemistry 287, 13228-13238

103. Ortiz-Sanchez, J. M., Nichols, S. E., Sayyah, J., Brown, J. H., McCammon, J. A., and Grant, B. J. (2012) Identification of potential small molecule binding pockets on Rho family GTPases. PLoS One 7, e40809

104. Murray, B. W., Guo, C., Piraino, J., Westwick, J. K., Zhang, C., Lamerdin, J., Dagostino, E., Knighton, D., Loi, C. M., Zager, M., Kraynov, E., Popoff, I., Christensen, J. G., Martinez, R., Kephart, S. E., Marakovits, J., Karlicek, S., Bergqvist, S., and Smeal, T. (2010) Small-molecule p21-activated kinase inhibitor PF-3758309 is a potent inhibitor of oncogenic signaling and tumor growth. Proceedings of the National Academy of Sciences of the United States of America 107, 9446-9451

105. Blangy, A., and Fort, P. (2012) Using a modified yeast two-hybrid system to screen for chemical GEF inhibitors. Methods Mol Biol 928, 81-95

106. Schmidt, S., Diriong, S., Mery, J., Fabbrizio, E., and Debant, A. (2002) Identification of the first Rho-GEF inhibitor, TRIPalpha, which targets the RhoA-specific GEF domain of Trio. FEBS Lett 523, 35-42

107. Bouquier, N., Vignal, E., Charrasse, S., Weill, M., Schmidt, S., Leonetti, J. P., Blangy, A., and Fort, P. (2009) A cell active chemical GEF inhibitor selectively targets the Trio/RhoG/Rac1 signaling pathway. Chem Biol 16, 657-666

236

108. Tang, Y., Dai, Y., Grant, S., and Dent, P. (2012) Enhancing CHK1 inhibitor lethality in glioblastoma. Cancer Biol Ther 13, 379-388

109. McEllin, B., Camacho, C. V., Mukherjee, B., Hahm, B., Tomimatsu, N., Bachoo, R. M., and Burma, S. (2010) PTEN loss compromises homologous recombination repair in astrocytes: implications for glioblastoma therapy with temozolomide or poly(ADP-ribose) polymerase inhibitors. Cancer research 70, 5457-5464

110. Russo, A. L., Kwon, H. C., Burgan, W. E., Carter, D., Beam, K., Weizheng, X., Zhang, J., Slusher, B. S., Chakravarti, A., Tofilon, P. J., and Camphausen, K. (2009) In vitro and in vivo radiosensitization of glioblastoma cells by the poly (ADP-ribose) polymerase inhibitor E7016. Clin Cancer Res 15, 607-612

111. Nadkarni, A., Shrivastav, M., Mladek, A. C., Schwingler, P. M., Grogan, P. T., Chen, J., and Sarkaria, J. N. (2012) ATM inhibitor KU-55933 increases the TMZ responsiveness of only inherently TMZ sensitive GBM cells. Journal of neuro-oncology 110, 349-357

237

APPENDIX E - PERMISSION TO USE COPYRIGHTED MATERIAL

1) Section “TWEAK-Fn14 signaling in glioblastoma” reproduced with permission, from:

Bo Hu, Marc Symons, Bodour Salhia, Shannon P. Fortin, Nhan L. Tran, James Rutka,

and Shi-Yuan Cheng. (2012). Rho GTPases and Their Activators, Guanine Nucleotide

Exchange Factors (GEFs): Their Roles in Glioma Cell Invasion. In A. Fatatis (Ed.)

Signaling Pathways and Molecular Mediators in Metastasis. (pp 143-169). Springer

Science+Business Media B.V. Publishing.

<http://www.springer.com/biomed/cancer/book/978-94-007-2557-7>. The original

publication is available at www.springerlink.com.

239

2) Appendix A reproduced with permission, from: Fortin SP, Ennis MJ, Schumacher CA,

Zylstra-Diegel CR, Williams BO, Ross JT, Winkles JA, Loftus JC, Symons MH, Tran

NL. 2012, Mol Cancer Res. 2012 Jul;10(7):958-68.

“Authors of articles published in AACR journals are permitted to use their article or parts of their article in the following ways without requesting permission from the AACR. All such uses must include appropriate attribution to the original AACR publication. Authors may do the following as applicable:

1. Reproduce parts of their article, including figures and tables, in books, reviews, or subsequent research articles they write;

2. Use parts of their article in presentations, including figures downloaded into PowerPoint, which can be done directly from the journal's website;

3. Post the accepted version of their article (after revisions resulting from peer review, but before editing and formatting) on their institutional website, if this is required by their institution. The version on the institutional repository must contain a link to the final, published version of the article on the AACR journal website. The posted version may be released publicly (made open to anyone) 12 months after its publication in the journal;

4. Submit a copy of the article to a doctoral candidate's university in support of a doctoral thesis or dissertation.”

Statement from: (http://www.aacrjournals.org/site/misc/permissions.xhtml)

240

APPENDIX F - ABSTRACTS AND PUBLICATIONS PUBLICATIONS

Bo Hu, Marc Symons, Bodour Salhia, Shannon P. Fortin, Nhan L. Tran, James Rutka, and Shi-Yuan Cheng. (2012). Rho GTPases and Their Activators, Guanine Nucleotide Exchange Factors (GEFs): Their Roles in Glioma Cell Invasion. In A. Fatatis (Ed.), Signaling Pathways and Molecular Mediators in Metastasis. (pp. 143-170). New York:Springer Publishing. Fortin SP, Ennis MJ, Schumacher CA, Zylstra-Diegel CR, Williams BO, Ross JT, Winkles JA, Loftus JC, Symons MH, Tran NL. Cdc42 and the guanine nucleotide exchange factors Ect2 and Trio mediate Fn14-induced migration and invasion of glioblastoma cells. Mol Cancer Res. 2012 Jul;10(7):958-68. Kwiatkowska A, Didier S, Fortin S, Chuang Y, White T, Berens ME, Rushing E, Eschbacher J, Tran NL, Chan A, Symons M. The small GTPase RhoG mediates glioblastoma cell invasion. Mol Cancer. 2012 Sep 11;11(1):65. Fortin Ensign S, Mathews I, Symons M, Sarkaria J, Tran N. SGEF is overexpressed in high grade gliomas and promotes Fn14-induced cell migration and invasion via TRAF2. (submitted March 2013, Journal of Biological Chemistry). Whitsett T, Fortin Ensign S, Kurywchak P, Inge L, Dhruv H, Weiss G, Tran N. Fn14 Expression Correlates with c-Met in NSCLC and Promotes Tumor Invasion and Metastasis. To be submitted summer 2013. Fortin Ensign S, Mathews I, Rollo J, Whitsett T, Symons M, Loftus J, Sarkaria J, Tran N. SGEF expression is regulated via TWEAK-Fn14 signaling through NF-κB and promotes cell survival in glioblastoma. (Manuscript in preparation). Fortin Ensign S, Mathews I, Tran N. GEFs in Glioma Review. (Manuscript in preparation).

241

SGEF is over-expressed in advanced glial tumors and mediates glioma cell invasion and survival Shannon P Fortin, John Rollo, Kimberly Paquette, Amanda Chan, Juli Ross, Ian Mathews, Marc H. Symons, Nhan L. Tran. Cellular and Molecular Biology (Abstract # 3846) April 2011. American Association for Cancer Research, Orlando, FL. Glioblastoma multiforme (GBM) is the most malignant of all primary adult brain tumors, histopathologically characterized by the infiltrative capacity of glioma cells to diffuse into the surrounding normal brain. There are currently no anti-invasion therapies available, and thus the identification and functional understanding of genes that mediate malignant tumor cell dispersion could lead to the discovery of molecular targets which have the potential to respond to therapeutics. We have previously shown that several guanine nucleotide exchange factors for Rho family small GTPases are overexpressed in GBM tumors and play important roles in glioma invasion. Here we report a role for SGEF, a guanine nucleotide exchange factor (GEF) for RhoG, in mediating glioma invasion. SGEF mRNA expression increases in correlation with glioma grade and, within GBM tumors, levels of SGEF expression inversely correlate with patient survival. siRNA-mediated depletion of SGEF decreases in vitro glioma cell migration and ex vivo glioma cell invasion. In addition, genome-wide determination of NF-κB controlled genes in temozolomide-resistant primary GBM xenografts (GBM14-TMZ-R) revealed an increased occupancy of NF-κB on the SGEF gene promoter region via ChIP-on-chip analysis as compared to the parent primary line. In fact, increased phosphorylation of IkBa was detected in GBM-14-TMZ-R. Moreover, inhibition of NF-κB in GBM14-TMZ-R significantly decreases SGEF gene expression, and activation of the NF-κB pathway by TWEAK in GBM cells induces SGEF mRNA expression. Furthermore, siRNA-mediated depletion of SGEF expression enhances chemotherapy-induced cell death in glioma cells. Understanding the role of SGEF in promoting cell motility and chemotherapeutic resistance may direct the development of novel targeted therapeutics for GBM.

242

SGEF is overexpressed in glioblastoma and mediates tumor cell invasion and survival Shannon P. Fortin, Ian T. Mathews, Jonathan Rollo, Marc H. Symons, Jann N. Sarkaria, Nhan L. Tran. Tumor Invasion and Metastasis (Abstract # 1642) December 2012. American Society for Cell Biology, San Francisco, CA. Glioblastoma (GB) is the highest grade and most common form of primary adult brain tumors. GB tumors are characterized by a poorly defined mass due to a highly invasive cell population attributed with having a decreased sensitivity to radiation and chemotherapy with temozolomide (TMZ). Importantly, current therapies for GB do not target invading cells. Thus, the identification and characterization of genes important for cell motility could direct the development of therapies targeting invading cells in an effort to confer an increased sensitivity to radiation and TMZ. We have previously shown that several guanine nucleotide exchange factors (GEFs) for Rho family small GTPases are overexpressed in GB tumors and play important roles in glioma invasion. Here we report a role for SGEF, a RhoG specific GEF, in mediating glioma invasion and survival. A genome-wide determination of NF-κB controlled genes in TMZ-resistant primary GB tumor grafts (GB14-TMZ-R) revealed an increased occupancy of NF-κB on the SGEF gene promoter region via ChIP-on-chip analysis, and SGEF mRNA and protein expression were found to be inducible under the pro-survival and pro-invasive TWEAK-Fn14 cytokine-receptor signaling axis in an NF-κB dependent manner. Moreover, the resistant line GB14 TMZ-R migrated at an increased rate compared to non TMZ treated GB14. In addition, among human tumor specimens, SGEF mRNA expression is increased in high grade gliomas and levels of SGEF expression in GB tumors inversely correlate with patient survival. The laser capture microdissection of GB tumors showed that SGEF mRNA expression is increased at the invasive tumor rim relative to tumor core levels, and the targeted depletion of SGEF expression by shRNA oligonucleotides decreases in vitro glioma cell migration and ex vivo glioma cell invasion without affecting cell proliferation. In addition, inhibition of SGEF expression sensitizes glioma cells to TMZ-induced apoptosis and impairs colony formation following TMZ insult. Understanding the role of SGEF in promoting cell motility and chemotherapeutic resistance may direct the development of novel targeted therapeutics for invasive GB cells.

243

SGEF is overexpressed in glioblastoma and mediates TWEAK-Fn14 induced cell survival Shannon P. Fortin Ensign, Ian T. Mathews, Jonathan Rollo, Julianna T.D. Ross, Marc H. Symons, Jann N. Sarkaria, Nhan L. Tran. Molecular and Cellular Biology (Abstract # 4108) April 2013. American Association for Cancer Research, Washington D.C. Glioblastoma (GB) is the highest grade and most common form of primary adult brain tumors. Despite surgical removal followed by concomitant radiation and chemotherapy with the alkylating agent temozolomide (TMZ), GB tumors develop treatment resistance and recur, invading brain tissue. Impaired response to treatment occurs rapidly conferring a median survival of just fifteen months. Thus, it is necessary to identify the genetic and signaling mechanisms that promote tumor resistance and spread in order to develop targeted therapies to combat this refractory setting. Our lab has previously published a role for the TWEAK-Fn14 ligand-receptor system in GB cell invasiveness and survival. Here we report that SGEF, a RhoG specific guanine nucleotide exchange factor (GEF), is overexpressed in GB tumors and we hypothesize that SGEF plays an important role in promoting TWEAK-Fn14 mediated glioma invasion and survival. We show that upon TWEAK binding to Fn14, SGEF is recruited to the Fn14 cytoplasmic tail. The Fn14-SGEF interaction requires TRAF2 recruitment and leads to activation of Rac1. Importantly, SGEF mRNA expression is elevated in TMZ-resistant primary GB tumor grafts compared to those with known TMZ sensitivity. SGEF mRNA and protein expression are regulated by the TWEAK-Fn14 signaling axis in an NF-κB dependent manner and inhibition of SGEF expression via shRNA shutdown sensitizes glioma cells to TMZ-induced apoptosis and impairs colony formation following TMZ insult. Furthermore, gene expression analysis of SGEF depleted GB cells revealed impaired expression of a network of DNA repair and survival genes including ATM, ATR, BRCA2, and XIAP among others, as well as increased expression of the pro-apoptotic gene BAD. Understanding the role of SGEF in promoting chemotherapeutic resistance may direct the development of novel targeted therapeutics for TMZ refractory, invasive GB cells.

the tweak-fn14 ligand receptor axis promotes glioblastoma … · 2020. 4. 2. · 2 the university...

Documents