thigmomorphogenesis: morphological, biochemical · 1 thigmomorphogenesis: morphological,...

Draft

Thigmomorphogenesis: morphological, biochemical

changes, and transcriptional level changes in response to

mechanical stress in Acacia koa A. Gray

Journal: Canadian Journal of Forest Research

Manuscript ID cjfr-2016-0356.R2

Manuscript Type: Article

Date Submitted by the Author: 08-Dec-2016

Complete List of Authors: Ishihara, Kazue; University of Hawaii at Manoa, Department of Molecular

Biosciences and Bioengineering Lee, Eric; University of Hawaii at Manoa, Department of Molecular Biosciences and Bioengineering Borthakur, Dulal; University of Hawaii at Manoa

Keyword: Acacia koa, thigmomorphogenesis, mechanical stress, lignin, disease resistance

https://mc06.manuscriptcentral.com/cjfr-pubs

Canadian Journal of Forest Research

Draft

1

Thigmomorphogenesis: morphological, biochemical changes, and transcriptional level 1

changes in response to mechanical stress in Acacia koa A. Gray 2

3

Kazue L. Ishihara, Eric K.W. Lee, Dulal Borthakur 4

University of Hawaii at Manoa 5

Department of Molecular Biosciences and Bioengineering 6

1955 East-West Road, Agricultural Sciences 218 7

Honolulu, Hawaii 96822 8

9

Kazue L. Ishihara 10

[email protected] 11

Eric K.W. Lee 12


Dulal Borthakur 14

(808) 956-6600 15


17

1 Table and 5 Figures 18

Supplementary Information: 5 Tables and 1 Figure 19

20

Page 1 of 46



Draft

2

ABSTRACT 21

Acacia koa A. Gray, an economically important timber-wood tree growing in the 22

Hawaiian Islands, is affected by many environmental stresses, including drought, strong wind, 23

heavy rain, and infection by fungal pathogens. Previous studies have shown that some 24

morphological and biochemical changes that take place as a result of environmental stresses in 25

plants can be also induced by mechanical stresses, such as touching and bending. We studied 26

morphological and biochemical changes and levels of gene transcription in A. koa plants due to 27

mechanical stress. For a mechanical stress treatment, A. koa seedlings were gently bent in four 28

cardinal directions daily for 2-6 months, after which morphological and biochemical changes 29

were quantified. The stressed A. koa had significantly increased stem diameter, number of xylem 30

cells, anthocyanin and lignin contents, and significantly reduced stem length. The gene 31

expression analyses showed that 53 genes, including the genes for calcium signaling, ethylene 32

biosynthesis, abscisic acid degradation, stress-related transcriptional regulation, and disease 33

resistance, were induced more than twofold within 10-60 min following mechanical stress. The 34

observation that the genes for disease resistance, such as NBS-LRR, can be induced by 35

mechanical stress suggests that strong wind and rain in the natural forest may also induce disease 36

resistance in trees. 37

38

KEY WORDS 39

Acacia koa; thigmomorphogenesis; mechanical stress; lignin; disease resistance 40

41

Page 2 of 46



Draft

3

INTRODUCTION 42

Mechanical perturbations, such as predation, rain, and wind, are common environmental 43

stresses for plants. Because plants are sessile and cannot travel to a new habitat on their own, the 44

ability to sense, respond, and adapt to such environmental stresses is important for their survival. 45

Responses can be rapid and apparent in some plants with specialized sensory cells. For example, 46

Dionaea muscipula closes bi-lobed leaves as soon as an insect lands on the ventral leaf surface, 47

which has ‘trigger hairs’ with sensory cells at the base (Volkov et al. 2008). Another plant 48

species Mimosa pudica has specialized pulvinar motor tissues (Visnovitz et al. 2007), and the 49

leaflets fold up quickly after touch stimulation (Temmei et al. 2005; Volkov et al. 2010); this 50

behavior may protect the leaves from insect predation or damage during rain or windstorms 51

(Koller 2011). 52

Plants without specialized sensory cells also respond to mechanical stimuli; 53

morphological responses in such plants may not be noticeable immediately, but their growth and 54

development are slowly altered over time in response to prolonged mechanical stimulation. Such 55

physiological and developmental responses of plants to mechanical stimuli are called 56

thigmomorphogenesis (Jaffe 1973). For example, plants repeatedly swayed by wind typically 57

respond by growing shorter and stockier as to protect themselves from the stimuli (Jacobs 58

1954). In experimental studies, wind-induced motion of plants has been artificially generated 59

under controlled laboratory conditions by touching or bending stems back and forth (Mitchell et 60

al. 1975, Jaffe 1976, Biro et al. 1980, Biddington and Dearman 1985). Such mechanical 61

perturbations commonly result in decreased elongation and increased thickness, and plants 62

respond to wind in the same way (Telewski and Jaffe 1986a; Braam and Davis 1990; Lee et al. 63

2005). These typical thigmomorphogenetic responses are observed in various plants, including 64

Page 3 of 46



Draft

4

Arabidopsis thaliana, Carcica papaya, and woody plants, such as Populus plants, Abies fraseri, 65

and Pinus taeda (Jacobs 1953; Biro et al. 1980; Telewski and Jaffe 1986a 1986b; Pruyn et al. 66

2000; Lee et al. 2005; Porter et al. 2009). Similar morphological changes have been also 67

observed to other mechanical stimuli, such as rubbing and brushing of the stems, in various 68

plants, including Arabidopsis, Bryonia dioica, Phaseolus vulgaris, and Solanum lycopersicum 69

(Jaffe 1973; Saidi et al. 2009; Paul-Victor and Rowe 2011). 70

Interestingly, some plants do not show typical thigmomorphogenetic responses, and also 71

show other diverse responses. For example, Cucurbita pepo, Pisum sativum, Triticum aestivum 72

display little to no changes in elongation after mechanical perturbations (Jaffe 1973), and the 73

stem diameter, instead of increasing as in several other thigmomorphogenetic plants, decreased 74

in Brassica oleracea (Biddington and Dearman 1985). Different morphological changes have 75

been observed in different plant species, such as a delay in flowering and an increase in number 76

of rosette paraclades in Arabidopsis (Johnson et al. 1998), tissue outgrowths in petioles, and 77

decreased anthocyanin contents in C. papaya (Porter et al. 2009). 78

Although morphological changes occur gradually, genes induced by mechanical stimuli 79

are immediately detectable (Braam and Davis 1990; Lee et al. 2005; Porter et al. 2009). In 80

Arabidopsis, approximately 2.5% of all genes were upregulated at least twofold within 30 min 81

following mechanical stimulation (Lee et al. 2005). These induced genes encode proteins with 82

diverse functions, such as calcium-binding proteins, cell-wall-modifying enzymes, kinases, 83

transcription factors, and disease resistance proteins, indicating complex molecular mechanisms 84

involved in the perception of mechanical stimulation (Lee et al. 2005). Because some 85

thigmomorphogenetic responses appear to be species-specific, different pathways may be 86

Page 4 of 46



Draft

5

involved in the perception of mechanical stimulation in different plants; therefore, it is important 87

to study thigmomorphogenesis in various plants. 88

In this study, we present the occurrence of changes in morphology, biochemistry, and 89

levels of gene transcription in response to mechanical stimulation in Acacia koa (koa), a 90

leguminous timber tree endemic to the Hawaiian Islands. A. koa serves as a vital economical 91

resource for the Hawaiian Islands as its timber is a highly priced commodity due to the beautiful 92

texture, hardiness, and carving quality of the wood. With a current market value of up to $125 93

per board foot, the gross value of A. koa timber and the wood products produced is estimated to 94

be in the range of $20-$30 million annually (Yanagida et al. 2004; Baker et al. 2009). To grow A. 95

koa successfully under various conditions of mechanical stimulation, such as heavy rain, 96

predation, and wind, understanding how mechanical stimulation influences the plant growth and 97

development is crucial. This study of morphological, physiological, and molecular aspects of 98

thigmomorphogenesis may contribute towards A. koa improvement programs and further 99

understanding of this phenomenon. 100

101

MATERIALS AND METHODS 102

Plant growth and treatment 103

Seeds of A. koa were obtained from three different mother trees grown in the Maunawili 104

Research Station of Hawaii Agriculture Research Center (HARC), Kailua, Hawaii. In A. koa 105

improvement program, half-sib progenies grown from the seeds obtained from a single mother 106

tree are considered a family. The seeds were immersed in concentrated sulfuric acid for 10 min 107

for scarification, rinsed with sterilized water six times, and incubated in petri dishes with wet 108

paper towels at 28 ᵒC till they germinated in 3-5 days (Rushanaedy et al. 2012). The resulting 109

Page 5 of 46



Draft

6

germinated seedlings were then planted into 4-inch pots containing a vermiculite-perlite mixture 110

pre-wetted with Hoagland’s solution. The seedlings were grown in a controlled growth room at 111

25 °C ± 2 °C with a 16/8-h light/dark photoperiod with an irradiance of 30 µmol s-1 m-1 for a 112

month. Plants were watered with Hoagland’s solution once in two days. For a mechanical stress, 113

stems were gently bent from their position at 90º with the ground level to a position at 114

approximately 60º with the ground level in each of all the four cardinal directions manually. 115

Plants were mechanically treated daily starting from a week after seedlings were transferred to 116

pots. The seedlings in the control group were maintained similarly, except that they were not 117

given the mechanical stress. 118

119

Phenotypic measurements and microscopy 120

Plant heights, stem diameters, and fresh and dry weights of stems, roots, and leaves of 2- 121

and 6-month-old koa seedlings were quantified. Plant heights were measured from the base of 122

the stem to the shoot tip. Stem diameters were measured at the stem base using a 5-inch digital 123

caliper. Each of the stressed and unstressed groups represented 39 2-month-old individual 124

seedlings and 15 6-month-old individual seedlings. For microscopic analysis, 2-month-old koa 125

seedlings were used; 30-µm cross-sections of stems at 5 mm below the top of the hypocotyls 126

were made using a VT1000S vibratome (Leica Biosystems Inc., IL, USA), and the cross-sections 127

were observed under an inverted microscope DMIL (Leica Biosystems Inc.). The number and 128

area of the xylem cells in three radial files were manually quantified using the images obtained 129

from the microscope. Three plants were randomly selected from each of the stressed and 130

unstressed groups for this analysis. Statistical significance for change in the stressed plants 131

compared to unstressed plants was determined by comparing the average of the two groups 132

Page 6 of 46



Draft

7

through Student’s two-tailed t-test with a cutoff p-value of 0.05. Similarly, the stem cross-133

sections of 3-month old unstressed plants were analyzed and compared with those of the 2-month 134

old stressed plants. 135

136

Chlorophyll, anthocyanin, and lignin quantification 137

Stem tissue of 2-month-old koa seedlings was frozen in liquid nitrogen and ground using 138

a mortar and pestle for tissue homogenization. For every 0.1g of the stem tissue, 1.0 mL of EtOH 139

containing 1% HCl was used to extract anthocyanin. After mixing the tissue and the solution, 140

each sample was incubated at 4 ºC overnight and then centrifuged for 10 min at 20,000 rcf. 141

Absorbance of the supernatant was quantified at 529 nm and 650 nm using a UV-visible 142

spectrophotometer, UV-1600PC (VWR, PA, USA). The equation below was used to calculate 143

the corrected anthocyanin absorbance. 144

Anthocyanin absorbance = A529 – (0.228) (A650) (1) 145

The anthocyanin concentration was calculated using the Beer-Lambert expression, A = εcl, 146

where A is absorption, ε is a molar absorbance coefficient, c is concentration, and l is path length. 147

The molar absorbance coefficient ε of anthocyanin at 529 nm was assumed to be 30,000 L mol-1 148

cm-1 (Sims and Gamon 2002). Similarly, chlorophyll was extracted using 1.0 mL of 80% acetone 149

per 0.1 g of sample. Absorbance of the supernatant was quantified at 647 nm, and 664 nm, and 150

the following equations were used to calculate the concentrations of chlorophyll a, chlorophyll b, 151

and total chlorophyll (Porra 2002). For quantification of anthocyanins and chlorophylls, 15 152

individual plants were analyzed for each of the stressed and unstressed groups. 153

Page 7 of 46



Draft

8

Chlorophyll a (µg/mL) = 12.25 (A664) - 2.55 (A647) (2) 154

Chlorophyll b (µg/mL) = 20.31 (A647) - 4.91 (A664) (3) 155

Total chlorophyll (µg/mL) = 17.76 (A647) + 7.34 (A664) (4) 156

Stem lignin analysis was conducted by the Agricultural Diagnostic Services Center, University 157

of Hawaii at Manoa through an ANKOM 200 Automated Fiber Analyzer (ANKOM Technology, 158

Macedon, NY) as described by the manufacturer’s protocol for lignin quantification in Method 8 159

(https://www.ankom.com/). Three biological replicates were analyzed, and each replicate 160

represented a pool of 10 hypocotyls. For each analysis, statistical significance for change in the 161

stressed plants relative to unstressed plants was determined by comparing the average of the two 162

groups through Student’s two-tailed t-test with a cutoff p-value of 0.05. 163

164

Plant treatment and RNA extraction 165

Stems were harvested via flash-freezing in liquid nitrogen after 10, 30, and 60 min 166

following the mechanical stress treatment. To extract total RNA, the frozen stems were ground to 167

a fine powder in liquid nitrogen with a mortar and a pestle that were baked for 6 h at 300 °C 168

prior to use. Total RNA was extracted with the modified method using Qiagen RNeasy Plant Kit 169

(Valencia, CA, USA) and Fruit-mate (Takara, Japan) as described by Ishihara et al. (2016). RNA 170

was treated with TURBO DNA-free Kit (Ambion, CA, USA) to remove genomic DNA 171

contamination. The quantity and quality of the RNA were assessed at wavelengths of 230, 260, 172

and 280 nm using a NanoDrop ND-1000 (NanoDrop Technologies, DE, USA). The integrity of 173

RNA was confirmed with RNA Integrity Numbers (RIN) of ≥ 9 obtained through an Agilent 174

2100 Bioanalyzer (Agilent Technologies, CA, USA). 175

Page 8 of 46



Draft

9

176

Microarray analysis 177

Relative gene expression levels of the stressed plants relative to the unstressed control 178

were determined through a microarray analysis. An equal amount of extracted RNA of the A. koa 179

seedlings harvested at 10, 30, and 60 min following the mechanical stress treatment was pooled 180

for the analysis. The RNA extracted from the seedlings without the mechanical stress treatment 181

was used as the unstressed control. A 4x72K microarray analysis was performed by the Roy J. 182

Carver Center for Genomics at the University of Iowa to compare gene expression levels of 2 183

biological replicates of 30 stressed plants (10 plants/time point) and 2 biological replicates of 20 184

unstressed control plants. From the previous study of transcriptome analysis (Ishihara et al. 185

2015), 4,000 cDNA sequences longer than 360 bp were selected on the basis of similarities with 186

genes that might be related to plant growth and development. Six 60-bp probes per sequence 187

were designed by the Carver Center for Genomics; each probe had three replicates in a DNA 188

chip. The designs of probes and microarray were deposited into GEO (Record No. GSE73889). 189

The array was scanned using a NimbleGen MS 200 Microarray Scanner (Roche NimbleGen, 190

Inc.). The NimbleScan software v.2.6 (Roche NimbleGen, Inc.) extracted raw intensities from 191

the images generated by the scanner, which were corrected for background noise and normalized 192

between arrays using a Robust Multichip Average (RMA) algorithm included in the NimbleScan 193

software. The normalized probe intensity values were averaged to give a single intensity value 194

per transcript and per sample. Statistical significance for change in the stressed plants relative to 195

unstressed plants was determined by comparing the average of the two groups through Student’s 196

two-tailed t-test with a cutoff p-value of 0.05. 197

198

Page 9 of 46



Draft

10

Confirmation of microarray data by NanoString nCounter and qRT-PCR 199

To verify if the 57 sequences shown to be upregulated in the microarray analysis were 200

truly upregulated, the NanoString nCounter System, a digital multiplexed gene-expression 201

analysis, was used at NanoString Technologies, Seattle WA. Briefly, total RNA extracted (100 202

ng) from seedlings at 10, 30, and 60 min following the stress treatment and from seedlings 203

without the stress treatment was prepared. Three biological replicates of RNA from ten stressed 204

plants for each time point were compared with three biological replicates of RNA from ten 205

unstressed plants. RNA was directly hybridized with gene-specific color-coded probes, and data 206

collection was carried out in the nCounter Digital Analyzer as described by the manufacturer 207

(NanoString Technologies). The NanoString Codeset (Supplementary Table S1) was designed 208

and synthesized by Nanostring Technologies, which included 3 reference genes, eflα, β-actin, 209

and ubiquitin; six positive-control and eight negative-control probes were also added to each 210

reaction to normalize the results. The data analysis was performed through nSolver Analysis 211

Software (Nanostring Technologies) using the default settings. Statistical significance for 212

increase in gene expression levels in the stressed plants compared to unstressed plants was 213

determined using Student’s one-tailed t-test with a cutoff p-value of 0.05. 214

The nCounter results were further confirmed through quantitative real-time PCR (qRT-215

PCR) analysis of five genes. Total RNA extracted prior to the mechanical stress treatment and 216

after 10, 30, and 60 min following the mechanical stress treatment was treated with TURBO 217

DNAfree Kit (Invitrogen, Carlsbad, CA) to remove any genomic DNA contamination. First-218

strand cDNA was synthesized from 2 µg of DNase-treated RNA using M-MLV Reverse 219

Transcriptase (Promega, WI, USA) with random hexamers according to the manufacturer’s 220

instructions. The qRT-PCR was performed using a 10 µL PCR reaction consisting of 0.25 µL 221

Page 10 of 46



Draft

11

forward primer (10 µM), 0.25 µL reverse primer (10 µM), 5 µL iQTM SYBR® Green Supermix 222

(Bio-Rad Laboratories, Hercules, CA), and 1 µL of first strand cDNA. Reaction conditions were 223

95 °C for 3 min, 35-40 cycles of 95 °C for 15 s, annealing for 30 s, and 72 °C for 30 s, followed 224

by melting curve analysis of the amplicon to confirm the specificities of primers. The annealing 225

temperature was at 54 °C for all the tested genes, except that 58 °C was used for the RING gene. 226

Each assay consisted of three biological and three technical replicates and was performed using 227

StepOne Real-Time PCR System (Applied Biosystems, Foster City, CA). The PCR protocol 228

produced a PCR efficiency of 90% to 110% for each primer set. The primer sequences used for 229

this study are listed in Supplementary Table S2. 230

To select internal reference genes for relative quantification of target gene expressions, 231

six candidate reference genes: ef1α, β-actin, 18S rRNA, 5.8S rRNA, ubiquitin-5, and tubulin-1 232

were tested on first strand cDNA samples from the A. koa stem with the primer sequences as 233

described in Negi et al. (2011). The qRT-PCR protocol was performed as described previously, 234

with the annealing temperature at 58 °C. The cycle threshold (Ct) values of the candidate genes 235

were used to evaluate their expression stability by using NormFinder applet for MS Excel 236

(Andersen et al. 2004). NormFinder allows the user to determine intra- and inter-group variances 237

as well as the stability value of each candidate gene. One gene or a combination of two genes 238

with the lowest stability value were selected as a reference control to normalize the expression 239

levels at each time point: a combination of two genes, 18S and ef1α, for the time point at 10 min 240

following the treatment, and 18S rRNA for the time points at 30 and 60 min following the 241

treatment (Supplementary Table S3). The fold changes of target gene expression levels relative 242

to the unstressed control plants were determined using the selected reference genes for 243

normalization through the 2-∆∆Ct method (Livak and Schmittgen 2001). Statistical significance for 244

Page 11 of 46



Draft

12

increase in gene expression levels in the stressed plants compared to unstressed plants was 245

determined using Student’s one-tailed t-test with a cutoff p-value of 0.05. 246

247

Page 12 of 46



Draft

13

RESULTS 248

Mechanical stress alters plant morphology by reducing stem elongation and increasing 249

stem diameter in A. koa 250

Following two months of the daily mechanical perturbation, the stressed A. koa seedlings 251

showed a decrease in stem elongation by 32.2% and an increase in hypocotyl diameter by 17.8% 252

(Fig. 1A, C, D). The mechanical stress also decreased the size of the leaflets by 19.8% and the 253

dry weight of root by 44.6% (Fig. 1E, F). After six months of the treatment, plants showed 254

greater developmental changes compared to the plants that were stressed for two months, except 255

for the root dry weight. The stressed plants were stunted by 60.9% and had a significantly 256

increased hypocotyl diameter by 23.6% (Fig. 1B, D, C). The leaflet size decreased approximately 257

by 32.2% (Fig. 1E). Interestingly, the root dry weight decreased by 27.2% (Fig. 1F), but the 258

percentage in decrease was greater after two months (44.6%) than after 6 months. There was no 259

significant difference in dry weight of hypocotyls in spite of the difference in height (data not 260

shown). 261

262

Mechanical stress increases anthocyanin and lignin but not chlorophyll 263

Mechanical stress increased the anthocyanin content in stems of the stressed seedlings by 264

91.0% following 2 months of the treatment (Fig. 2B). It was visually observable as well (Fig. 265

2A); the stressed seedlings exhibited anthocyanin accumulation in their stems with reddish color. 266

The lignin composition in the stressed stems also increased by 32.3% (Fig. 2C). There was no 267

significant difference in chlorophyll concentration (data not shown). 268

269

270

Page 13 of 46



Draft

14

271

Mechanical stress promotes xylem cell division 272

Microscopic analysis of hypocotyl cross-sections showed an increase in the density of 273

xylem cells (number of cells/10,000 µm2) by 45.7% in the stressed seedlings compared to 274

unstressed of the same age (2-month old; Fig. 3A, B, and E). The increase in cell density was due 275

to the reduction in the cell size, as the average size of a xylem cell was smaller in stressed plants 276

by 32.4% (Fig. 3D). Regardless of the increase in the cell density following the mechanical stress, 277

the ratio between the radii of the stem and the xylem did not change (data not shown). To 278

determine if xylem cell size was correlated with stem diameter, stem cross-sections of 2-month-279

old stressed seedlings were also compared with those of 3-month-old unstressed seedlings with 280

similar stem diameters; the xylem cell density of 2-month-old stressed plants was 66.3% higher 281

than 3-month-old unstressed plants whereas the cell size of the 2-month-old stressed plants was 282

lower by 40.5% than 3-month-old unstressed plants (Supplementary Table S4). The results 283

showed no correlation between the stem diameter and the xylem cell size, and 284

thigmomorphogenetic plants had higher cell density with smaller cells, while unstressed plants 285

had lower cell density with bigger cells. 286

287

Genes induced by mechanical stress 288

The microarray analysis indicated that out of the 4,000 cDNA sequences, 60 sequences 289

were upregulated more than twofold in the mechanically stressed plants within 60 min following 290

the treatment (Fig. 4). We grouped those 60 sequences by their putative functions; 28 were 291

classified in transcriptional regulation, 14 in signal transduction, 5 in carbohydrate metabolism, 4 292

in protein degradation, 3 in disease resistance, and 2 in hormone metabolism (Fig. 5). Some of 293

Page 14 of 46



Draft

15

the most upregulated genes are those that have homology with sequences encoding RING finger 294

proteins (>18-fold), zinc-finger transcription factors (>15-fold), ethylene-responsive-element 295

binding proteins (EREBPs; >9-fold), WRKY transcription factors (>8-fold), protein phosphatase 296

2C (>8-fold), dehydration responsive element binding (DREB) proteins, and disease resistance 297

proteins (>4-fold; Supplementary Table S5). 298

The Nanostring nCounter analysis verified upregulation of 53 sequences out of the 60, 299

which was further confirmed by qRT-PCR (Table 1; Supplementary Fig. S1). The expression 300

levels of most of the sequences were low (~2-fold) at 10 min following the stress treatment but 301

peaked at 30 min. Two sequences that have homology with sequences encoding a RING finger 302

protein or a zinc finger protein (Acc. No. GBYE01027655 and GBYE01019260, respectively) 303

had the highest fold-change of ~11 at 10 min, showing a rapid response of the plant to the 304

mechanical stimulus. The sequence encoding the putative RING finger protein had the highest 305

expression of 38.1-fold at 30 min after the treatment, whereas the sequence encoding the putative 306

zinc finger protein was upregulated 45-fold within 30 min. The most represented putative 307

function among the 53 upregulated sequences was ethylene-related transcription factors (9 308

sequences homologous to AP2/ERF, DREB, and EREBPs), followed by WRKY transcription 309

factors (6 sequences), and calcium-binding proteins (5 sequences). Three sequences homologous 310

to sequences encoding disease-resistance proteins were also confirmed to be induced by 311

mechanical stress, and they were upregulated more than 10 times at 30 min following the stress 312

treatment. 313

314

DISCUSSION 315

Page 15 of 46



Draft

16

Acacia koa inhabits a wide range of areas at elevations from the sea level to 2,000 m, in 316

wet or mesic forests with annual rainfall from 1,850 to 5,000 mm (Harrington et al. 1995; 317

Wilkinson and Elevitch 2005; Baker et al. 2009). A. koa trees show various sizes and shapes in 318

different geological locations, and it has been reported that wood properties of A. koa are also 319

influenced by environmental factors to a large extent (Loudat and Kanter 1996; Dudley and 320

Yamasaki 2000). Mechanical stimuli, such as rain and wind, are common environmental factors 321

that affect growth and development in plants. It is especially important to understand the effects 322

of wind on A. koa because in areas with steady winds, A. koa plants are reported to have 323

relatively slower growth (Elevitch et al. 2006). In this study, physical stress similar to that 324

produced by wind was artificially created in A. koa seedlings through bending stems in four 325

cardinal directions to observe morphological, physiological, and biochemical effects of such 326

mechanical stress. 327

328

Physical adaptation of A. koa to mechanical stress 329

Non-wounding swaying of stems in four cardinal directions had a profound effect on the 330

morphology of A. koa (Fig. 1), making it capable to withstand further mechanical stress. The 331

reduced height and increased stem diameter after the stress treatment resembled the 332

thigmomorphogenetic changes previously observed with other woody plants, such as Pinus taeda 333

(Telewski and Jaffe 1986a) and Ulmus americana (Telewski and Pruyn 1998), and other 334

dicotyledonous plants, including, Solanum lycopersicum (Coutand et al. 2000), and Nicotiana 335

tabacum (Anten et al. 2005). Interestingly, little to no overall changes have been reported in 336

some plants, in which the cambium is limited or absent; for example, there were a little change in 337

inflorescence stem diameter of Arabidopsis and no change in stem diameter of Helianthus annus 338

Page 16 of 46



Draft

17

following mechanical stress (Smith and Ennos 2003; Paul-Victor and Rowe 2011). Therefore, 339

elevated cambial activity may be a major factor that increases the overall stem diameter (Biro et 340

al. 1980; Jacobs 1953; Pruyn et al. 2000; Telewski and Jaffe 1986a, 1986b); as such, increase in 341

xylem cells, which are derived from the cambium (Lev-Yadun and Flaishman 2001), was 342

observed in several mechanically perturbed plants, such as Phaseolus vulgaris (Biro et al. 1980) 343

and N. tabacum (Hepworth et al. 1999). Similarly, in the stressed A. koa, there was an increase in 344

number of xylem cells (Fig. 3A, B); however, the ratio of diameters between xylem and stem and 345

between pith and stem showed no significant difference between the stressed and unstressed A. 346

koa (data not shown). Therefore, expansion of xylem and also other tissues appeared to 347

contribute to the increase in overall stem thickness. In addition, the stressed A. koa had denser 348

xylems with smaller cells (Fig. 3D), and similar xylem characteristics were observed in 349

mechanically stressed Abies fraseri (Telewski 1989). Therefore, thigmomorphogenetic responses 350

in A. koa may include the enhancement of secondary growth and modification of wood 351

properties; further analysis of responses to mechanical stimuli in A. koa may reveal unique 352

genetic and physiological responses that will help study wood formation and development. 353

354

Increase in phenylpropanoid biosynthesis in stems of thigmomorphogenetic A. koa 355

The significant elevation of lignin and anthocyanin contents in the stressed A. koa 356

indicated that thigmomorphogenesis affected the phenylpropanoid biosynthesis pathway, which 357

is responsible for synthesis of a wide variety of secondary metabolites, including monolignols 358

and flavonoids (Mayer et al. 2001; Fig. 2). Monolignols are monomers of lignin, which is an 359

important component of wood, constituting 25-35% of the secondary cell wall (Plomion et al. 360

2001); the stressed A. koa should have higher deposit of lignin and therefore may have thicker 361

Page 17 of 46



Draft

18

cell walls and stronger structural support (for review, see Vanholme et al. 2010) so that they 362

would have higher resistance against the swaying movement. In Bryonia dioica and S. 363

lycoperisicum, increased lignin and elevated activities of enzymes involved in lignification, such 364

as phenylalanine ammonia-lyase (PAL) and cinnamyl alcohol dehydrogenase (CAD), have been 365

observed 6 h following the mechanical stimulus (Saidi et al. 2009; de Jaegher et al. 1985). 366

However, the genes for enzymes involved in the monolignol biosynthesis, including PAL and 367

CAD, were not induced in A. koa within 60 min following the mechanical stress. Since we did 368

not determine the expression levels of the genes beyond 60 min, further studies in future will be 369

needed to elucidate effects of mechanical stress treatment on the transcription of the 370

phenylpropanoid pathway genes in A. koa. 371

We observed elevated concentration of anthocyanins, a type of flavonoids, in the stressed 372

A. koa; such increases in anthocyanin levels due to the mechanical stress have not been reported 373

in other studies of thigmomorphogenesis. On the contrary, decrease in anthocyanin content has 374

been observed in thigmomorphogenetic C. papaya (Porter et al. 2009). It shows that molecular 375

responses to mechanical stress vary among species as anthocyanin production was repressed in 376

the stressed C. papaya, while it was enhanced in the stressed A. koa. Anthocyanins and other 377

flavonoids are derived from p-coumaroyl CoA, a major pivotal intermediate of the 378

phenylpropanoid pathway, which is also an intermediate product for biosynthesis of monolignols 379

and other phenylpropanoids. It is the substrate for the monolignol biosynthesis enzymes, 380

including hydroxycinnamoyl-CoA shikimate/quinate hydroxycinnamoyl transferase (HCT) and 381

caffeoyl-CoA O-methyltransferase (CCoAOMT), as well as for the flavonoid biosynthesis 382

enzyme chalcone synthase (CHS). Therefore, it is likely that p-coumaroyl CoA accumulated in 383

response to the mechanical stress, feeding both pathways of monolignol and flavonoid 384

Page 18 of 46



Draft

19

biosynthesis. Lignin production is shown to be induced by mechanical perturbations in several 385

other plants (de Jaegher et al. 1985; Bourgeade et al. 1989; Porter et al. 2009) while anthocyanin 386

production is not; therefore, the anthocyanins in the stressed A. koa may be inadvertently 387

produced due to enhancement of the lignin biosynthesis pathway. It is thus possible that 388

thigmomorphogenetic A. koa produced other phenylpropanoids, such as coumarins, tannins, and 389

other aromatic compounds, from p-coumaryol CoA, (VanEtten et al. 1989; Vogt 2010). 390

The thigmomorphogenetic plants produced in this research can be considered as 391

phenotypic mutants for biosynthesis of lignin, its precursor phenolic compounds, and 392

anthocyanins. Many of the phenolic compounds, including lignin, are known to be involved in 393

plant defense mechanisms in various plants (Uppalapati et al. 2009; Kamphuis 2012; Purwar et 394

al. 2012; Boubakri et al. 2013). Therefore, besides being more tolerant to mechanical stress, the 395

thigmomorphogenetic A. koa plants may also grow more tolerant to other stresses, including 396

resistance to pathogens and insects, compared to the unstressed A. koa plants; further analysis of 397

the mechanically stressed plants by exposing them to pathogens will verify if mechanical stress 398

induces disease resistance in plants. We may be able to relate this mutant phenotype with aspects 399

of wood quality in future studies. Lignin is a major component of the cell wall, and its 400

composition is one of the major determinants of physical characteristics of wood (Novaes et al., 401

2010). Wood stiffness and strength have been shown to be related to the lignin composition 402

(Voelker et al. 2011). Woods of transgenic poplars containing a higher syringyl lignin content 403

have been shown to be resistant to decay by wood-decaying fungi (Skyba et al. 2013); therefore, 404

we can expect that A. koa wood having higher lignin content may also be resistant to decay by 405

such fungi. In addition to lignin, anthocyanins may be a determinant of wood characteristics. 406

Anthocyanins are known to accumulate in the vacuole (Evert 2006; Zhao et al. 2006). It is likely 407

Page 19 of 46



Draft

20

that they are converted into anthocyanidins through removal of the sugar group by vacuole 408

glycosidase under certain physiological conditions. Anthocyanidins, which are also stored in the 409

vacuole, are important because they are oligomers of proanthocyanidins (condensed tannins; 410

Zhao et al. 2006); proanthocyanidins are known to be involved in wood color and defense 411

mechanisms in plants (Hon and Minemura 2000; War et al. 2012; Constabel et al. 2014). Thus, 412

lignin and anthocyanins may be used as biochemical markers for seedling selection in both 413

disease resistance and wood quality improvement programs for A. koa as well as for other timer-414

wood tree species. 415

Regulation of chlorophyll biosynthesis in leaves or total tissues in thigmomorphogenetic 416

plants has been reported. For instance, chlorophyll content went up in Medicago truncatula, 417

Apium graveolens, Lactuca sativa, and S. lycopersicum (Biddington and Dearman 1985; Mitchell 418

et al. 1975; Tretner et al. 2008) whereas it decreased in B. oleracea and C. papaya (Biddington 419

and Dearman 1985; Porter et al. 2009). On the contrary, in the present study, chlorophyll content 420

in the stem, including petioles, did not show any significant difference between the mechanically 421

stressed and unstressed A. koa. Chlorophyll content of the leaves was not determined in this 422

study. 423

424

Calcium signaling in thigmomorphogenesis of A. koa 425

Calcium (Ca2+) is one of the major signaling molecules released from the endoplasmic 426

reticulum to the cytosol in response to mechanical perturbations (Braam 2005; Telewski 2006; 427

Chehab et al. 2009). Studies have shown upregulation of genes for calmodulins and calmodulin-428

related proteins in various plants, including Arabidopsis, C. papaya, Brassica napus, and Vigna 429

radiata (Braam and Davis 1990; Botella and Arteca 1994; Botella et al. 1996; Oh et al. 1996; 430

Page 20 of 46



Draft

21

Lee et al. 2005; Porter et al. 2009). The gene for calmodulin was one of the first identified touch-431

inducible (TCH) genes (TCH1; Acc. No. AAA32762.1; Braam and Davis 1990) in Arabidopsis, 432

and its homolog in A. koa (Acc. No. GBYE01000487; 97.6% sequence identity) was among the 433

5 sequences coding for putative calcium-binding proteins that are upregulated in response to 434

mechanical stress (Table 1). Moreover, in stressed A. koa, two putative mitogen-activated protein 435

kinase (MAPK) sequences were upregulated more than 20-fold within 30 min following the 436

stress treatment. MAPK sequences are known to be indirectly or directly regulated by Ca2+ in 437

plants (Wurzinger et al. 2011). The increased expression levels of genes encoding MAPK and 438

other protein kinases, possibly calcium-dependent, following mechanical stimulation have been 439

observed in other plants (Seo et al. 1995; Mizoguchi et al. 1996; Bögre et al. 1997). Therefore, it 440

is possible that calcium signaling may induce MAPK cascades in the stressed A. koa as well. 441

442

Regulation of phytohormones in thigmomorphogenesis in mechanically stressed A. koa 443

Ethylene, a plant growth hormone, appears to be involved in early thigmomorphogenic 444

responses in A. koa. A sequence for putative 1-aminocyclopropane 1-carboxylate synthase 445

(ACS), a key enzyme for ethylene production, was rapidly induced within 10 min following the 446

stress (Table 1). In addition, the expression of nice sequences for putative ethylene-responsive 447

transcription factors was also enhanced. In other plants, ethylene production is shown to be one 448

of the early thigmomorphogenetic responses (de Jaegher et al. 1987; Botella et al. 1995; Arteca 449

and Arteca 1999; Tatsuki and Mori 1999). Increase in the activity of ACS and upregulation of an 450

ethylene-responsive transcription factor were also observed rapidly following mechanical 451

stimulation in Phaseolus vulgaris and Arabidopsis (Biro and Jaffe 1984; Lee et al. 2005). 452

Subsequent to exogenous application of ethylene, stunted growth was observed in various plants, 453

Page 21 of 46



Draft

22

resembling thigmomorphogenic responses (Jaffe and Biro 1979; de Jaegher et al. 1987; Erner 454

and Jaffe 1982). However, ethylene-insensitive Arabidopsis mutants still showed 455

thigmomorphogenetic changes following mechanical stimulation, so ethylene is unlikely to be 456

the ‘primary’ signaling molecule (Johnson et al. 1998), at least in Arabidopsis. 457

Another growth phytohormone, abscisic acid (ABA) may be involved in 458

thigmomorphogenesis in A. koa. Many plants, such as H. annuus and Zea mays, had increased 459

ABA levels following the mechanical stimulation (Whitehead and Luti 1962; Beyl and Mitchell 460

1983), and exogenous application of ABA also led to morphological changes similar to 461

thigmomorphogenetic responses (Erner and Jaffe 1982). On the contrary, a sequence for a key 462

enzyme for ABA degradation, ABA 8’-hydroxylase, was upregulated in the stressed A. koa (> 463

35.8-fold within 60 min following the stress); thus, the induction of the gene would result in 464

reduction of ABA levels in thigmomorphogenetic A. koa. It may be possible that ABA synthesis 465

was downregulated due to feedback inhibition. Different plants respond to mechanical stress 466

differently; further analyses on phytohormones and their quantification in the stressed and 467

unstressed A. koa may elucidate their roles in thigmomorphogenesis. 468

469

Abiotic- and biotic-stress-related genes induced by mechanical stress in A. koa 470

The gene expression analyses suggested that thigmomorphogenetic responses in A. koa 471

might influence a wide range of cellular mechanisms, such as transcriptional regulation, signal 472

transduction, carbohydrate metabolism, and hormone metabolism. Interestingly, many of them 473

are related to abiotic and biotic stresses as well as plant growth and development. Among the 474

upregulated 23 sequences coding for transcription factors, 15 sequences encode putative WRKYs, 475

MYBs, NACs, DREBs, and zinc finger proteins, many of which are known to be involved in 476

Page 22 of 46



Draft

23

disease resistance, defense, and abiotic stress tolerance, such as drought and high-salinity 477

stresses (Lata and Prasad 2011; Nuruzzaman et al. 2013; Ambawat et al. 2013; Bakshi and 478

Oelmüller 2014). Among the transcription factors, two sequences for zinc finger proteins were 479

highly upregulated within 10 min after the treatment, and they were found to be homologous to a 480

ZAT-10 protein, which is expressed in response to drought, cold, salt, and photo-oxidative 481

stresses in Arabidopsis (Mittler et al. 2006; Rossel et al. 2007). Among the 57 tested sequences 482

in the nCounter analysis, it is one of the most rapidly upregulated genes in response to the 483

mechanical stress. The upregulation of these abiotic stress-related transcription factors suggests 484

that the mechanically stressed A. koa may also develop higher tolerance to other environmental 485

stresses. 486

It is notable that sequences for disease resistance (R) proteins, or nucleotide-binding site 487

leucine-rich repeat (NBS-LRR) proteins, were induced by mechanical perturbations in A. koa. R 488

proteins are involved in disease resistance as they recognize invading pathogens by directly 489

binding to or indirectly monitoring effector molecules secreted by pathogens (McHale et al. 490

2006). Although the mechanically stressed A. koa were not exposed to pathogens, three 491

sequences encoding R proteins were upregulated over 10-fold within 30 min after the stress 492

treatment (Table 1). Similarly, the microarray analysis of the mechanically inducible genes in 493

Arabidopsis showed upregulation of 14 R proteins (> 2-fold; Lee et al. 2005). In addition to R 494

proteins, ATL family RING finger ubiquitin ligase is shown to regulate defense mechanisms and 495

cell death regulations in response to pathotoxins (Guzmán 2012). One homolog of ATL family 496

RING finger ubiquitin ligases was highly upregulated in response to the mechanical stress in A. 497

koa, increasing by over 10-fold within 10 min and over 38-fold within 30 min following the 498

mechanical stress (Table 1). Higher expression levels of the R proteins and ATL family RING 499

Page 23 of 46



Draft

24

finger proteins in the stressed A. koa indicates that mechanical stimulation may also induce 500

tolerance to pathogens. 501

502

Conclusion 503

In this study, morphological, biochemical changes and levels of gene transcription due to 504

mechanical stress were determined in A. koa. Prolonged mechanical stimulation led to stunted 505

stem length and thickened stem diameter with a greater number of xylem cells. Anthocyanin and 506

lignin were accumulated in the stems of mechanically stressed A. koa, indicating that mechanical 507

stress induces the phenylpropanoid biosynthesis pathway. The gene expression analyses showed 508

upregulation of genes in a wide range of cellular mechanisms in response to mechanical stress, 509

suggesting complex signaling pathways of thigmomorphogenesis. Genes for calcium signaling, 510

such as calmodulin and MAPK, ethylene and ABA metabolisms, and stress-related 511

transcriptional regulation were highly expressed. Two of the most rapidly upregulated genes 512

encoding a putative RING finger protein and a zinc finger protein may be related to both abiotic 513

and biotic stresses, such as drought and disease resistance. Surprisingly and interestingly, genes 514

for disease resistance, which are generally induced as a result of biotic stress, were also induced 515

by mechanical stress alone. This result suggests that trees may develop disease resistance in 516

response to mechanical stress applied by strong wind and heavy rain in natural forests. It also 517

suggests that a simple mechanical stress may be used to identify genetic and biochemical factors 518

that influence disease resistance; these molecules may be useful as potential markers for seedling 519

selection in A. koa improvement programs. 520

521

ACKNOWLEDGEMENTS 522

Page 24 of 46



Draft

25

We would like to acknowledge Tyler Jones and Nick Dudley from HARC for providing 523

A. koa seeds. We would also like to acknowledge Bradley Porter for his useful discussion. This 524

work was supported by the USDA National Institute of Food and Agriculture, the McIntire-525

Stennis Grant HAW00597-M, managed by the College of Tropical Agriculture and Human 526

Resources (CTAHR). KI was supported by a Monsanto Graduate Fellowship. 527

Page 25 of 46



Draft

26

REFERENCES

Ambawat, S., Sharma, P., Yadav, N.R., and Yadav, R.C. 2013. MYB transcription factor genes as regulators for plant responses: An overview. Physiol Mol Biol Plants. 19(3), 307–321. doi:10.1007/s12298-013-0179-1.

Andersen, C.L., Jensen, J.L., and Ørntoft, T.F. 2004. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64(15): 5245–5250. doi:10.1158/0008-5472.CAN-04-0496.

Anten, N.P.R., Casado-Garcia, R., and Nagashima, H. 2005. Effects of mechanical stress and plant density on mechanical characteristics, growth, and lifetime reproduction of tobacco plants. Am. Nat. 166(6): 650–660. doi:10.1086/497442.

Arteca, J.M., and Arteca, R.N. 1999. A multi-responsive gene encoding 1-aminocyclopropane-1-carboxylate synthase (ACS6) in mature Arabidopsis leaves. Plant Mol. Biol. 39(2): 209–219. doi:10.1023/A:1006177902093.

Baker, P.J., Scowcroft, P.G., and Ewel, J.J. 2009. Koa (Acacia koa) ecology and silviculture. USDA Forest Service, General Technical Report - Pacific Southwest Research Station, PSW-GTR-211.

Bakshi, M., and Oelmüller, R. 2014. WRKY transcription factors: Jack of many trades in plants. Plant Signal. Behav. 9(1): 1–18. doi:10.4161/psb.27700.

Beyl, C.A., and Mitchell, C.A. 1977. Automated mechanical stress application for height control of greenhouse chrysanthemums. Hort. Scient. 12: 575-577.

Biddington, N.L., and Dearman, A.S. 1985. The effect of mechanically induced stress on the growth of cauliflower, lettuce and celery seedlings. Ann. Bot. 55(1): 109–119.

Biro, R., and Jaffe, M. 1984. Thigmomorphogenesis: ethylene evolution and its role in the changes observed in mechanically perturbed bean plants. Physiol. Plant. 62(3): 289–296. doi:10.1111/j.1399-3054.1984.tb04575.x.

Biro, R., Hunt, E.R., Erner, Y., and Jaffe, M.J. 1980. Thigmomorphogenesis: changes in cell division and elongation in the internodes of mechanically-perturbed or ethrel-treated bean plants. Ann. Bot. 45(6): 655-664.

Bögre, L., Ligterink, W., Meskiene, I., Barker, P., Heberle-Bors, E., Huskisson, N., and Hirt, H. 1997. Wounding induces the rapid and transient activation of a specific MAP kinase pathway. Plant Cell 9(1): 75–83. doi:10.1105/tpc.9.1.75.

Botella, J.R., and Arteca, R.N. 1994. Differential expression of two calmodulin genes in response to physical and chemical stimuli. Plant Mol. Biol. 24(5): 757–766. doi: 10.1007/BF00029857.

Botella, J.R., Arteca, R.N., and Frangos, J.A. 1995. A mechanical strain-induced 1-aminocyclopropane-1-carboxylic acid synthase gene. Proc. Natl. Acad. Sci. USA. 92(5): 1595–1598. doi:10.1073/pnas.92.5.1595.

Botella, J.R., Arteca, J.M., Somodevilla, M., and Arteca, R.N. 1996. Calcium-dependent protein kinase gene expression in response to physical and chemical stimuli in mungbean (Vigna

radiata). Plant Mol. Biol. 30(6): 1129–1137. doi:10.1007/BF00019547. Boubakri, H., Poutaraud, A., Wahab, M.A., Clayeux, C., Baltenweck-Guyot, R., Steyer, D.,

Marcic, C., Mliki, A., and Soustre-Gacougnolle, I. 2013. Thiamine modulates metabolism of the phenylpropanoid pathway leading to enhanced resistance to Plasmopara viticola in grapevine. BMC Plant Biol. 13(1): 31. doi:10.1186/1471-2229-13-31.

Page 26 of 46



Draft

27

Bourgeade, P., Boyer, N., de Jaegher, G., and Gaspar, T. 1989. Carry-over of thigmomorphogenetic characteristics in calli derived from Bryonia dioicainternodes. Plant Cell Tiss. Organ Cult. 19(3): 199–211. doi:10.1007/BF00043347

Braam, J., and Davis, R.W. 1990. Rain-, wind-, and touch-induced expression of calmodulin and calmodulin-related genes in Arabidopsis. Cell 60(3): 357–364. doi:10.1016/0092-8674(90)90587-5.

Braam, J. 2005. In touch: plant responses to mechanical stimuli. New Phytol. 165(2): 373–89. doi:10.1111/j.1469-8137.2004.01263.x.

Chehab, E.W., Eich, E., and Braam, J. 2009. Thigmomorphogenesis: a complex plant response to mechano-stimulation. J. Exp. Bot. 60(1): 43–56. doi:10.1093/jxb/ern315.

Constabel, C.P., Yoshida, K., Walker, V. 2014. Diverse Ecological Roles of Plant Tannins: Plant Defense and Beyond. In: (Romani, A., Lattanzio, V., QuideauS., eds.) Recent Advances in Polyphenol Research, Volume 4. John Wiley & Sons, Ltd, Chichester, UK. doi: 10.1002/9781118329634.ch5.

Coutand, C., Julien, J.L., Moulia, B., Mauget, J.C., and Guitard, D. 2000. Biomechanical study of the effect of a controlled bending on tomato stem elongation: global mechanical analysis. J. Exp. Bot. 51(352): 1813–1824. doi:10.1093/jexbot/51.352.1813.

de Jaegher, G., Boyer, N., and Gaspar, T. 1985. Thigmomorphogenesis in Bryonia dioica: changes in soluble and wall peroxidases, phenylalanine ammonia-lyase activity, cellulose, lignin content and monomeric constituents. Plant Growth Regul. 3(2): 133-148. doi:10.1007/BF01806053

de Jaegher, G., Boyer, N., Bon, M.C., and Gaspar, T. 1987. Thigmomorphogenesis in Bryonia

dioica: early events in ethylene biosynthesis pathway. Biochem Physiol Pflanz 182(1): 49–56. doi:10.1016/S0015-3796(87)80037-9.

Dudley, N.S., and Yamasaki, J. 2000. A Guide to Determining Wood Properties of Acacia koa. Hawaii Agriculture Research Center, Forestry Report 3.

Elevitch, C.R., Wilkinson, K.M., and Friday, J.B. 2006. Acacia koa (koa) and Acacia koaia (koai‘a). In Species Profiles for Pacific Island Agroforestry. Edited by C.R. Elevitch. Permanent Agriculture Resources, Holualoa, HI. Available from www.traditionaltree.org [accessed 7 April 2013].

Erner, Y., and Jaffe, M.J. 1982. Thigmomorphogenesis: the involvement of auxin and abscisic acid in growth retardation due to mechanical perturbation. Plant Cell Physiol. 23(6): 935–941.

Guzmán, P. 2012. The prolific ATL family of RING-H2 ubiquitin ligases. Plant Signal. Behav. 7(8): 1014–21. doi:10.4161/psb.20851.

Evert, R.F. 2006. The Protoplast: Endomembrane System, Secretory Pathways, Cytoskeleton, and Stored Compounds. In: Esau's Plant Anatomy: Meristems, Cells, and Tissues of the Plant Body: Their Structure, Function, and Development, Third Edition. John Wiley & Sons, Inc., Hoboken, NJ, USA. doi: 10.1002/0470047380.ch3.

Harrington, R.A., Fownes, J.H., Meinzer, F.C., and Scowcroft, P.G. 1995. Forest growth along a rainfall gradient in Hawaii: Acacia koa stand structure, productivity, foliar nutrients, and water- and nutrient-use efficiencies. Oecologia 102(3): 277–284. doi:10.1007/BF00329794.

Hepworth, D., and Vincent, J. 1999. The growth response of the stems of genetically modified tobacco plants (Nicotiana tabacum “Samsun”) to flexural stimulation. Ann. Bot. 83(1): 39–43. doi:10.1006/anbo.1998.0784.

Page 27 of 46



Draft

28

Hon, D.N.S., Minemura, N. 2000. Color and Discoloration. In: (Hon, D.N.S., Minemura, N., eds.) Wood and cellulosic chemistry, second edition, revised and extended. Marcel Dekker Inc., New York, NY. pp. 385-442.

Ishihara, K., Lee, E.K.W., Rushanaedy, I., and Borthakur, D. 2015. Illumina-based de novo transcriptome analysis and identifications of genes involved in the monolignol biosynthesis pathway in Acacia koa. Am. J. Bioinforma. 4(1): 7–27. doi:10.3844/ajbsp.2015.7.27.

Ishihara, K., Lee, E.K.W., and Borthakur, D. 2016. An improved method for RNA extraction from woody legume species Acacia koa A. Gray and Leucaena leucocephala (Lam.) de Wit. Int. J. Forestry Wood Sci. 3(1): 31-35.

Jacobs, M.R. 1954. The effect of wind sway on the form and development of Pinus radiata. Austral J. of Bot. 2(1): 35-51.

Jaffe, M.J., and Biro, R. 1979. Thigmomorphogenesis: the effect of mechanical perturbation on the growth of plants, with special reference to anatomical changes, the role of ethylene, and interaction with other environmental stresses. In Stress physiology of crop plants. Edited by H Mussel and R.C. Staples. John Wiley and Sons, New York, NY. pp. 25–29.

Jaffe, M.J. 1973. Thigmomorphogenesis: The response of plant growth and development to mechanical stimulation. Planta. 114(2): 143–157. doi: 10.1007/BF00387472.

Johnson, K.A., Sistrunk, M.L., Polisensky, D.H., and Braam, J. 1998. Arabidopsis thaliana responses to mechanical stimulation do not require ETR1 or EIN2. Plant Physiol. 116(2): 643–9.

Kamphuis, L.G., Williams, A.H., Küster, H., Trengove, R.D., Singh, K.B., Oliver, R.P., and Ellwood, S.R. 2012. Phoma medicaginis stimulates the induction of the octadecanoid and phenylpropanoid pathways in Medicago truncatula. Mol. Plant Pathol. 13(6): 593–603. doi:10.1111/j.1364-3703.2011.00767.x.

Koller, D. 2011. The restless plant. Edited by E.V. Volkenburgh. Harvard University Press, Cambridge, MA.

Lata, C., and Prasad, M. 2011. Role of DREBs in regulation of abiotic stress responses in plants. J. Exp. Bot. 62(14): 4731-48. doi:10.1093/jxb/err210.

Lee, D., Polisensky, D.H., and Braam, J. 2005. Genome-wide identification of touch- and darkness-regulated Arabidopsis genes: a focus on calmodulin-like and XTH genes. New Phytol. 165(2): 429–44. doi:10.1111/j.1469-8137.2004.01238.x.

Lev-Yadun, S., and Flaishman, M.A. 2001. The effect of submergence on ontogeny of cambium and secondary xylem and on fiber lignification in inflorescence stems of Arabidopsis. IAWA J. 22(2): 159–169. doi:10.1163/22941932-90000275

Livak, K.J., and Schmittgen, T.D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4): 402–408. doi:10.1006/meth.2001.1262.

Loudat, T.A., and Kanter, R. 1996. The economics of commercial koa culture in Hawaii. In Koa: A Decade of Growth Proceedings of the Symposium, Honolulu, HI, 18-19 November 1996. Edited by L. Ferentinos and D. Evans. Hawaii Forest Industry Association, Honolulu, HI. pp. 124–147.

Mayer, M.J., Narbad, A., Parr, A.J., Parker, M.L., Walton, N.J., Mellon, F.A., and Michael, A.J. 2001. Rerouting the plant phenylpropanoid pathway by expression of a novel bacterial enoyl-CoA hydratase/lyase enzyme function. Plant Cell 13(7): 1669–1682. doi:10.1105/TPC.010063.

McHale, L., Tan, X., Koehl, P., and Michelmore, R.W. 2006. Plant NBS-LRR proteins: adaptable guards. Genome Biol. 7: 212. doi:10.1186/gb-2006-7-4-212.

Page 28 of 46



Draft

29

Mitchell, C.A., Severson C.J., Wott J.A., and Hammer P.A. 1975. Seismomorphogenic regulation of plant growth. J. Amer. Soc. Hort. Sci. 100: 161–165.

Mittler, R., Kim, Y., Song, L., Coutu, J., Coutu, A., Ciftci-Yilmaz, S., Lee, H., Stevenson, B., and Zhu, J.K. 2006. Gain- and loss-of-function mutations in Zat10 enhance the tolerance of plants to abiotic stress. FEBS Lett. 580(28-29): 6537–6542. doi:10.1016/j.febslet.2006.11.002.

Mizoguchi, T., Irie K., Hirayama, T., Hayashida, N., Yamaguchi-Shinozaki, K., Matsumoto, K., Shinozaki, K.. 1996. A gene encoding a mitogen-activated protein kinase kinase kinase is induced simultaneously with genes for a mitogen-activated protein kinase and an S6 ribosomal protein kinase by touch, cold, and water stress in Arabidopsis thaliana. Proc. Natl. Acad. Sci. USA. 93(2): 765-9.

Negi, V.S., Pal, A., Singh, R., and Borthakur, D. 2011. Identification of species-specific genes from Leucaena leucocephala using interspecies suppression subtractive hybridisation. Ann. Appl. Biol. 159(3): 387–398. doi: 10.1111/j.1744-7348.2011.00506.x.

Novaes, E., Kirst, M., Chiang, V., Winter-Sederoff, H., and Sederoff, R. 2010. Lignin and biomass: A negative correlation for wood formation and lignin content in trees. Plant Physiol. 154: 555-561. doi:10.1104/pp.110.161281

Nuruzzaman, M., Sharoni, A.M., and Kikuchi, S. 2013. Roles of NAC transcription factors in the regulation of biotic and abiotic stress responses in plants. Front Microbiol. 4:248. doi:10.3389/fmicb.2013.00248.

Oh, S.A., Kwak, J.M., Kwun, I.C., and Nam, H.G. 1996. Rapid and transient induction of calmodulin- encoding gene(s) of Brassica napus by a touch stimulus. Plant Cell Rep. 15(8): 586–590. doi: 10.1007/BF00232458.

Paul-Victor, C., and Rowe, N. 2011. Effect of mechanical perturbation on the biomechanics, primary growth and secondary tissue development of inflorescence stems of Arabidopsis thaliana. Ann. Bot. 107(2): 209–218. doi:10.1093/aob/mcq227.

Porra, R. 2002. The chequered history of the development and use of simultaneous equations for the accurate determination of chlorophylls a and b. Photosynth. Res. 73(1): 149–156. doi:10.1023/a:1020470224740.

Porter, B.W., Zhu, Y.J., Webb, D.T., and Christopher, D. a. 2009. Novel thigmomorphogenetic responses in Carica papaya: touch decreases anthocyanin levels and stimulates petiole cork outgrowths. Ann. Bot. 103(6): 847–58. doi:10.1093/aob/mcp009.

Pruyn, M.L., Ewers III, B.J., and Telewski, F.W. 2000. Thigmomorphogenesis: changes in the morphology and mechanical properties of two Populus hybrids in response to mechanical perturbation. Tree Physiol. 20(8): 535–540. doi:10.1093/treephys/20.8.535.

Purwar, S. 2012. Enzymes of phenylpropanoid metabolism involved in strengthening the structural barrier for providing genotype and stage dependent resistance to karnal bunt in wheat. Am. J. Plant Sci. 03(02): 261–267. doi:10.4236/ajps.2012.32031.

Rossel, J.B., Wilson, P.B., Hussain, D., Woo, N.S., Gordon, M.J., Mewett, O.P., Howell, K.A., Whelan, J., Kazan, K., and Pogson, B.J. 2007. Systemic and intracellular responses to photooxidative stress in Arabidopsis. Plant Cell 19(12): 4091–4110. doi:10.1105/tpc.106.045898.

Rushanaedy, I., Jones, T.C., Dudley, N.S., Liao, R.J.F., Agbayani, R., and Borthakur, D. 2012. Chitinase is a potential molecular biomarker for detecting resistance to Fusarium oxysporum in Acacia koa. Trop. Plant Biol. 5(3): 244–252. doi:10.1007/s12042-012-9108-7.

Saidi, I., Ammar, S., Demont-Caulet, N., Thévenin, J., Lapierre, C., Bouzid, S., and Jouanin, L. 2009. Thigmomorphogenesis in Solanum lycopersicum: morphological and biochemical

Page 29 of 46



Draft

30

responses in stem after mechanical stimulation. Plant Sci. 177(1): 1–6. doi:10.1016/j.plantsci.2009.03.002.

Seo, S., Okamoto, M., Seto, H., Ishizuka, K., Sano, H., and Ohashi, Y. 1995. Tobacco MAP kinase: a possible mediator in wound signal transduction pathways. Science 270(5244): 1988–92. doi:10.1017/CBO9781107415324.004.

Sims, D.A., and Gamon, J.A. 2002. Relationships between leaf pigment content and spectral reflectance across a wide range of species, leaf structures and developmental stages. Remote Sens. Environ. 81(2-3): 337–354. doi:10.1016/S0034-4257(02)00010-X.

Skyba, O., Douglas, C.J., Mansfield S.D. 2013. Syringyl-rich lignin renders poplars more resistant to degredation by wood decay fungi. Appl. Environ, Microbiol. 79(8):2560-2571. doi:10.1128/AEM.03182-12.

Smoth, V.C., and Ennos, A.R. 2003. The effects of air flow and stem flexure on the mechanical and hydraulic properties of the stems of sunflowers Helianthus annuus L. J. Exp. Bot. 54(383):845–849. doi:10.1093/jxb/erg068.

Tatsuki, M., and Mori, H. 1999. Rapid and transient expression of 1-aminocyclopropane-1-carboxylate synthase isogenes by touch and wound stimuli in tomato. Plant Cell Physiol. 40(7): 709–15. doi:10.1093/oxfordjournals.pcp.a029597.

Telewski, F.W. 1989. Structure and function of flexure wood in Abies fraseri. Tree Physiol. 5(1): 113–21. doi:10.1093/treephys/5.1.113.

Telewski, F.W. 2006. A unified hypothesis of mechanoperception in plants. Am. J. Bot. 93(10): 1466–76. doi:10.3732/ajb.93.10.1466.

Telewski, F.W., and Jaffe, M.J. 1986a. Thigmomorphogenesis: Field and laboratory studies of Abies fraseri in response to wind or mechanical perturbation. Physiol. Plant. 66(2): 211–218. doi:10.1111/j.1399-3054.1986.tb02411.x.

Telewski, F.W., and Jaffe, M.J. 1986b. Thigmomorphogenesis: anatomical, morphological and mechanical analysis of genetically different sibs of Pinus taeda in response to mechanical perturbation. Physiol. Plant. 66: 219–26. doi:10.1111/j.1399-3054.1986.tb02412.x.

Telewski, F.W., and Pruyn, M.L. 1998. Thigmomorphogenesis: a dose response to flexing in Ulmus americana seedlings. Tree Physiol. 18: 65–68. doi:10.1093/treephys/18.1.65.

Temmei, Y., Uchida, S., Hoshino, D., Kanzawa, N., Kuwahara, M., Sasaki, S., and Tsuchiya, T. 2005. Water channel activities of Mimosa pudica plasma membrane intrinsic proteins are regulated by direct interaction and phosphorylation. FEBS Lett. 579(20): 4417–22. doi:10.1016/j.febslet.2005.06.082.

Tretner, C., Huth, U., and Hause, B. 2008. Mechanostimulation of Medicago truncatula leads to enhanced levels of jasmonic acid. J. Exp. Bot. 59(10): 2847–2856. doi:10.1093/jxb/ern145.

Uppalapati, S.R., Marek, S.M., Lee, H.-K., Nakashima, J., Tang, Y., Sledge, M.K., Dixon, R. a, and Mysore, K.S. 2009. Global gene expression profiling during Medicago truncatula-Phymatotrichopsis omnivora interaction reveals a role for jasmonic acid, ethylene, and the flavonoid pathway in disease development. Mol. Plant. Microbe. Interact. 22(1): 7–17. doi:10.1094/MPMI-22-1-0007.

VanEtten, H.D., Matthews, D.E., and Matthews, P.S. 1989. Phytoalexin detoxification: importance for pathogenicity and practical implications. Annu. Rev. Phytopathol. 27: 143–164. doi:10.1146/annurev.py.27.090189.001043.

Vanholme R., Demedts B., Morreel K., Ralph J., Boerjan W. 2010. Lignin biosynthesis and structure. Plant Physiol 153(3): 895-905. doi:10.1104/pp.110.155119.

Page 30 of 46



Draft

31

Voelker, S.L., Lachenbruch, B., Meinzer F.C., Strauss S.H. 2011. New Phytol. 189:1096-1109. doi: 10.1111/j.1469-8137.2010.03572.x.

Visnovitz, T., Világi, I., Varró, P., and Kristóf, Z. 2007. Mechanoreceptor cells on the tertiary pulvini of Mimosa pudica L. Plant Signal. Behav. 2(6): 462–6. doi:10.4161/psb.2.6.4743.

Vogt, T. 2010. Phenylpropanoid biosynthesis. Mol. Plant 3(1): 2–20. doi:10.1093/mp/ssp106. Volkov, A.G., Adesina, T., Markin, V.S., and Jovanov, E. 2008. Kinetics and mechanism of

Dionaea muscipula trap closing. Plant Physiol. 146(2): 694–702. doi:10.1104/pp.107.108241. Volkov, A.G., Foster, J.C., Ashby, T.A., Walker, R.K., Johnson, J.A., and Markin, V.S. 2010.

Mimosa pudica: Electrical and mechanical stimulation of plant movements. Plant. Cell Environ. 33(2): 163–73. doi:10.1111/j.1365-3040.2009.02066.x.

War, A.R., Paulraj, M.G., Ahmad, T., Buhroo, A.A., Hussain, B., Ignacimuthu, S., et al. 2012. Mechanisms of plant defense against insect herbivores. Plant Signal. Behav. 7:1306–20. doi: 10.4161/psb.21663.

Whitehead, F.H., and Luti, R. 1962. Experimental studies on the effect of wind on plant growth and anatomy: I. Zea mays. New Phytol. 61(1): 56–58. doi:10.1111/j.1469-8137.1962.tb06273.x

Wilkinson, K.M., Elevitch, C.R. 2005. Propagation protocol for koa (Acacia koa Gray). Native Plants J. 6(3): 228-232. doi: 10.2979/NPJ.2005.6.3.228.

Wurzinger, B., Mair, A., Pfister, B., and Teige, M. 2011. Cross-talk of calcium-dependent protein kinase and MAP kinase signaling. Plant Signal. Behav. 6(1): 8–12. doi:10.4161/psb.6.1.14012.

Yanagida, J.F., Friday, J.B., Illukpitiya, P., Mamiit, R.J., and Edwards, Q. 2004. Economic value of Hawaii’s forest industry in 2001. In Economic Issues 7. College of Tropical Agriculture and Human Resources. University of Hawai’i at Manoa.

Zhao, J., Pang, Y., Dixon, R.A. 2010. The mysteries of proanthocyanidin transport and polymerization. Plant Physiol. 153:437-443. doi: 10.1104/pp.110.155432.

Page 31 of 46



Draft

32

TABLES

Table 1. Fold change of the genes at 10, 30, and 60 min following stress treatment, comparing stressed to unstressed determined using NanoString nCounter analysis. Acc. No. Putative function Expression fold change

10 min 30 min 60 min

Ratio SE Ratio SE Ratio SE

Protein degradation (4) GBYE01027655 RING finger protein, ALT family 10.68 0.72 38.06 2.38 18.81 1.47 GBYE01011012 RING finger protein 5.93 0.33 15.73 0.65 7.20 0.46 GBYE01014767 RING finger protein, ALT family 1.87 0.18 3.41 0.22 3.41 0.16 GBYE01007181 E3 ubiquitin ligase 1.81 0.15 3.50 0.11 4.48 0.15 Transcriptional regulation (23) GBYE01007979 AP2 domain class transcription factor 2.45 0.33 3.66 0.30 3.58 0.29 GBYE01025728 AP2 domain-containing transcription 2.90 0.14 18.74 1.93 31.43 4.86 GBYE01041899 AP2/ERF domain-containing protein 2.49 0.34 6.24 0.92 3.57 0.54 GBYE01036775 AP2/ERF domain-containing protein 2.69 0.23 6.66 0.57 3.54 0.33

GBYE01014032 Auxin-induced protein (1.36) 0.29 4.74 0.69 3.81 0.48 GBYE01048118 DRE binding protein 6.33 0.33 18.15 0.88 4.06 0.45 GBYE01071204 DRE binding protein 7.95 1.40 56.91 6.13 66.68 11.17 GBYE01008127 Ethylene-responsive element-binding protein 3.71 0.24 8.63 0.40 6.08 0.60 GBYE01017658 Ethylene-responsive transcription factor 4.61 0.33 26.58 2.11 21.16 2.05 GBYE01005208 Ethylene-responsive transcription factor 2.12 0.24 5.65 0.27 8.92 0.55 GBYE01026684 MYB transcription factor 1.40 0.04 6.09 0.59 11.36 1.06 GBYE01030298 MYB transcription factor 1.47 0.08 5.55 0.47 9.98 0.80 GBYE01024450 NAC domain protein 1.68 0.18 10.27 1.10 26.38 3.46 GBYE01010007 NAC domain protein 2.44 0.49 6.88 0.46 7.91 0.72 GBYE01039799 WRKY transcription factor 5.25 0.76 58.71 5.25 37.01 5.82 GBYE01016099 WRKY transcription factor 2.13 0.25 15.47 1.03 14.31 1.81 GBYE01050872 WRKY transcription factor 2.19 0.40 11.64 1.10 13.39 1.24 GBYE01005028 WRKY transcription factor 1.68 0.15 3.68 0.21 3.51 0.30 GBYE01041303 WRKY transcription factor 4.72 1.04 70.75 10.92 55.66 11.37 GBYE01004300 WRKY transcription factor 2.15 0.26 9.32 0.82 14.86 1.62

GBYE01019260 Zinc finger protein 11.42 0.87 45.00 2.23 31.36 2.93 GBYE01019654 Zinc finger protein 5.21 0.30 27.14 1.02 13.22 1.34 GBYE01022591 Zinc finger protein 2.93 0.21 7.41 0.48 7.99 0.71 Disease resistance (3) GBYE01072738 CC-NBS-IRR resistance protein 8.72 2.17 19.15 2.31 10.29 1.60 GBYE01078745 NBS-LRR disease-resistance protein 5.08 0.80 15.17 2.13 5.32 1.19 GBYE01050160 NBS-LRR disease-resistance protein 3.93 0.15 10.41 0.56 6.09 0.47 Signal transduction (12) GBYE01006842 Calcium-binding EF-hand protein 1.99 0.03 7.25 0.28 8.12 0.65 GBYE01006511 Calcium-binding protein 1.72 0.06 7.12 0.68 15.96 1.25 GBYE01005328 Calcium-binding protein 1.59 0.09 4.13 0.30 5.16 0.44 GBYE01000487 Calmodulin 1.23 0.05 2.47 0.08 3.67 0.19 GBYE01007399 Calmodulin binding protein 2.30 0.11 7.49 0.36 5.66 0.53 GBYE01012536 Lectin protein kinase family protein 2.13 0.26 7.22 0.64 9.31 1.13 GBYE01007796 LysM type receptor kinase 2.53 0.22 12.02 0.97 12.29 0.77 GBYE01008850 Mitogen-activated protein kinase 5.00 0.40 24.10 1.24 23.69 2.03 GBYE01006033 Mitogen-activated protein kinase 4.31 0.31 23.17 1.05 23.20 1.94 GBYE01052680 Octicosapeptide/Phox/Bem1p (PB1) 6.60 0.45 8.67 0.34 8.56 0.98 GBYE01013735 Protein phosphatase 2C 4.89 0.28 19.97 0.74 20.03 1.57 GBYE01026109 Protein phosphatase 2C 4.71 0.35 20.52 0.70 7.30 1.18 Carbohydrate metabolism (3) GBYE01003680 UDP-D-glucuronic acid 4-epimerase 3.14 0.09 10.34 0.66 11.14 0.82 GBYE01007604 UDP-glucosedehydrogenase 1.40 0.06 4.87 0.25 6.25 0.72 GBYE01001472 UDP-glucuronate 5-epimerase 2.80 0.11 10.83 0.71 11.61 0.87 Hormone metabolism (2) GBYE01025591 1-aminocyclopropane 1-carboxylate synthase 3.51 0.67 17.56 1.58 16.44 1.88 GBYE01014926 Abscisic acid 8'-hydroxylase 2.62 0.18 29.96 1.37 35.80 3.87 Protein transport and sorting (2) GBYE01041529 Syntaxin 1.43 0.18 8.38 0.63 9.91 1.39 GBYE01007398 Syntaxin 1.97 0.18 5.15 0.18 5.33 0.54 Others (2) GBYE01000347 Lignin biosynthetic peroxidase (0.91) 0.15 1.69 0.29 3.38 0.57 GBYE01000925 Metal ion binding protein 2.65 0.32 6.57 0.38 5.69 0.31

NOTE: n = 3 for each treatment, where n represents 10 A. koa stems; p < 0.05 unless in prentices; p ≥ 0.05 for those in prentices.

Page 32 of 46



Draft

33

FIGURE LEGENDS

Fig. 1. Phenotypical quantifications of A. koa seedlings following two and six months of the mechanical stress treatment. The stressed and unstressed plants are labeled as S and U, respectively: (A) Visual growth differences between stressed and unstressed after two months of treatment and (B) six months of treatment; (C) quantification of the stem thickness of stressed and unstressed; (D) quantification of the stem heights of stressed and unstressed; (E) quantification of the maximum leaflet length of stressed and unstressed; (F) quantification of the root dry weight of stressed and unstressed; In (C-F) n = 39 for each of the 2-month-old stressed and unstressed groups, and n = 15 for each of the 6-month-old stressed and unstressed groups. An asterisk (*) indicate significant changes in the stressed compared to unstressed by two-tail t-test (p < 0.05), and error bars represent standard errors.

Fig. 2. Quantifications of anthocyanin and lignin from stems of A. koa seedlings following two months of mechanical stress treatment. The stressed and unstressed plants are labeled as S and U, respectively: (A) Visual stem anthocyanins in stressed and unstressed; (B) quantification of anthocyanin concentration in stems of stressed and unstressed; (C) quantification of lignin composition in hypocotyls of stressed and unstressed. In (B), n = 14 for each of the stressed and unstressed group; in (C), n = 3 for each of the stressed and unstressed group, where n represents a pool of 10 hypocotyls. An asterisk (*) indicate significant changes in the stressed compared to unstressed by two-tail t-test (p < 0.05), and error bars represent standard errors. Fig. 3. Microscopic analysis of cross-sections of xylem in two-month-old stressed and unstressed A. koa seedlings; (A) stem cross-section of the stressed; (B) stem cross-section of the unstressed; (C) quantification of average xylem cell size in the stressed and unstressed; (D) quantification of xylem cell density in the stressed and unstressed A. koa seedlings. In (C) and (D), n = 3 for each of the stressed and unstressed group. An asterisk (*) indicate significant changes in the stressed compared to unstressed by two-tail t-test (p < 0.05), and error bars represent standard errors. Fig. 4. Microarray analysis of 4,000 genes that may be related to disease resistance and wood formation and development. A scatter plot of log2 of the signal intensities comparing the gene expressions in stressed (S) and unstressed (U). Each group had two biological replicates (n = 2). In stressed, n represents pools of stems from 30 plants collected at 10, 30, and 60 min after the treatment (10 plants for each time point); in unstressed, n represents pools of 20 unstressed stems. The two lines represent a cutoff for > 2-fold change in expression; those genes induced more than 2-fold were analyzed in detail. Fig. 5. Functional categorization of genes determined to be upregulated by mechanical stress through the microarray analysis. Sixty sequences shown to be upregulated by mechanical stress more than twofold were categorized into functional groups according to their closest annotations obtained from Blastx.

Page 33 of 46



Draft

Ishihara, et al. 2016

P a g e | 34

SUPPLEMENTARY DATA

Table S1. Probe sequences used for the NanoString nCounter analysis. Table S2. Primer sequences used for the qRT-PCR analysis. Table S3. Stability values of candidate reference genes for qRT-PCR analysis determined by NormFinder. Table S4. Microscopic analysis of cross-sections of xylems in two-month-old stressed, two- and three-month-old unstressed A. koa seedlings. Table S5. Microarray analysis of sequences induced by mechanical stress in A. koa.

Fig. S1. Verification of expression levels obtained from the NanoString nCounter analysis by qRT-PCR.

Page 34 of 46



Draft

Fig. 1. Phenotypical quantifications of A. koa seedlings following two and six months of the mechanical stress treatment. The stressed and unstressed plants are labeled as S and U, respectively: (A) Visual

growth differences between stressed and unstressed after two months of treatment and (B) six months of

treatment; (C) quantification of the stem thickness of stressed and unstressed; (D) quantification of the stem heights of stressed and unstressed; (E) quantification of the maximum leaflet length of stressed and unstressed; (F) quantification of the root dry weight of stressed and unstressed; In (C-F) n = 39 for each of the 2-month-old stressed and unstressed groups, and n = 15 for each of the 6-month-old stressed and unstressed groups. An asterisk (*) indicate significant changes in the stressed compared to unstressed by

two-tail t-test (p < 0.05), and error bars represent standard errors.

109x155mm (300 x 300 DPI)

Page 35 of 46



Draft

Fig. 2. Quantifications of anthocyanin and lignin from stems of A. koa seedlings following two months of mechanical stress treatment. The stressed and unstressed plants are labeled as S and U, respectively: (A) Visual stem anthocyanins in stressed and unstressed; (B) quantification of anthocyanin concentration in

stems of stressed and unstressed; (C) quantification of lignin composition in hypocotyls of stressed and unstressed. In (B), n = 14 for each of the stressed and unstressed group; in (C), n = 3 for each of the stressed and unstressed group, where n represents a pool of 10 hypocotyls. An asterisk (*) indicate

significant changes in the stressed compared to unstressed by two-tail t-test (p < 0.05), and error bars represent standard errors.

155x43mm (300 x 300 DPI)

Page 36 of 46



Draft

Fig. 3. Microscopic analysis of cross-sections of xylem in two-month-old stressed and unstressed A. koa seedlings; (A) stem cross-section of the stressed; (B) stem cross-section of the unstressed; (C)

quantification of average xylem cell size in the stressed and unstressed; (D) quantification of xylem cell

density in the stressed and unstressed A. koa seedlings. In (C) and (D), n = 3 for each of the stressed and unstressed group. An asterisk (*) indicate significant changes in the stressed compared to unstressed by

two-tail t-test (p < 0.05), and error bars represent standard errors.

419x106mm (300 x 300 DPI)

Page 37 of 46



Draft

Fig. 4. Microarray analysis of 4,000 genes that may be related to disease resistance and wood formation and development. A scatter plot of log2 of the signal intensities comparing the gene expressions in stressed (S) and unstressed (U). Each group had two biological replicates (n = 2). In stressed, n represents pools of 30

stems collected at 10, 30, and 60 min after the treatment; in unstressed, n represents pools of 20 unstressed stems. The two lines represent a cutoff for > 2-fold change in expression; those genes induced

more than 2-fold were analyzed in detail.

103x94mm (300 x 300 DPI)

Page 38 of 46



Draft

Fig. 5. Functional categorization of genes determined to be upregulated by mechanical stress through the microarray analysis. Sixty sequences shown to be upregulated by mechanical stress more than twofold were

categorized into functional groups according to their closest annotations obtained from Blastx.

109x71mm (300 x 300 DPI)

Page 39 of 46



Draft

Table S1. Probe sequences used for the NanoString nCounter analysis AccessionNo. ProbeA ProbeB

GBYE01000072 CAATATCGATTGTGATTCCTCTTTCACGCTCAGCCTTGAGCTTGTCCAGCCTCAAGACCTAAGCGACAGCGTGACCTTGTTTCA

CGAAAGCCATGACCTCCGATCACTCGGCGTCAATGACTGTGCAGTAGTACTTGGTGGTCTCGAATTTCCAGAGAG

GBYE01000611 AGAGAGAGAACAGCCTGGATGGCAACATACATGGCAGGGACATTAAAGGTCATCCTCTTCTTTTCTTGGTGTTGAGAAGATGCTC

CGAAAGCCATGACCTCCGATCACTCCACCATCACCAGAGTCCAAAACAATACCGGTTGTACGACCACTAGCATAT

GBYE01000815 CTGCTCTCGACCTCGAGAGTTATGGTCTTCCCTGTAAGGGTTTTAACGAACACAATTCTGCGGGTTAGCAGGAAGGTTAGGGAAC

CGAAAGCCATGACCTCCGATCACTCGGATGCCTTCCTTGTCTTGAATCTTAGCCTTAACATTGTCGATGGTGTCG

GBYE01027655 GAGCGGCGGCGGAGTCTTCGTAGAATACAAGGTGAGAGACTGCGTGAGCGCTGTTGAGATTATTGAGCTTCATCATGACCAGAAG

CGAAAGCCATGACCTCCGATCACTCGAGAGACATGAGTAGAGATGAGTCAAGACCGCGCGTTGAGGCCACGACAG

GBYE01019654 GACTCTCCACCTCTTGCTCTACACCGATCTTCTTCATCCCAGAATAATCGCAAAGACGCCTATCTTCCAGTTTGATCGGGAAACT

CGAAAGCCATGACCTCCGATCACTCGGTAAAAAGCAAACGTCTTCTCTTATTACCGGCGGCAGCCACCGGCAACG

GBYE01019260 TCTCTTGGAACGCTTGCGCTTGGTCCATGACTCCAAGGAGTGAAGATTGGCGAACCTAACTCCTCGCTACATTCCTATTGTTTTC

CGAAAGCCATGACCTCCGATCACTCCGAGATACTCTTCCTCGGAGGTGCATGACGAGGGATGGTCGAGACGGGA

GBYE01017658 TGCGGAAGAGTGCCAGGAAACACGGTAGCCGGCAACGGGAACTGCTGCTGCCAATTTGGTTTTACTCCCCTCGATTATGCGGAGT

CGAAAGCCATGACCTCCGATCACTCCCGCCATGCTTGCACGGAAGACCGCGTCGAAGTAAAACGCCTGATTCACC

GBYE01026109 CAAACCCCACGGCATAAATCAACATAGCCACCTGTGGTCTCAATTCTGTCCTTTCGGGTTATATCTATCATTTACTTGACACCCT

CGAAAGCCATGACCTCCGATCACTCAATACCGATCTCCAATTCCTCTGGAAACGGCTAGGGACCCCTGAATCCTC

GBYE01048118 AGAGTTGGCTGCTCGAAACCAATCAAGTTTTGGTTGCTGAATAACCCGTCCAACAGCCACTTTTTTTCCAAATTTTGCAAGAGCC

CGAAAGCCATGACCTCCGATCACTCGTTGAAACTGGTCGGTCTGAGACAGAGTCTGGTTGTTGAGCCCAAAAGGA

GBYE01041303 TCATTCTCTAGTGCCAAGGAAGGCAAACTGTAACTTTCTGCTGGTGTCATCACCGTGTGGACGGCAACTCAGAGATAACGCATAT

CGAAAGCCATGACCTCCGATCACTCGCGTATTTGGAGATAGCAAGTCTGTTTGTGAAAGGTTCCTCCAGAAGGGA

GBYE01039799 ACTAGGTAATACTGGCCCCGTGGGAAGAGAATTGGTATTTGAGTTTGATGCCTGGAGTTTATGTATTGCCAACGAGTTTGTCTTT

CGAAAGCCATGACCTCCGATCACTCTCATCTCTGAAAGGACTTACGTTGACAGATATTGGAGACTCTGGTGGCAA

GBYE01011012 CGGCGGAACCCTTGTCTGCTGAAATCGTAAGAAGTAGGAGCTGAATCGGGCAGATAAGGTTGTTATTGTGGAGGATGTTACTACA

CGAAAGCCATGACCTCCGATCACTCGAACAATAACAGGGTTAAAGGGAGATCTGTTGCCTGCGTTGCGGCGTCTT

GBYE01078745 ATGACAAATATCTTTTGAGGAGTCCCCAAGTTCAAAGTTTCTAGATTCCACTTCCTTCCTGTGTTCCAGCTACAAACTTAGAAAC

CGAAAGCCATGACCTCCGATCACTCTATAAAGATGCCTTAGTCTCTTGAGCTTCCACATTTCAATGTTGAAGTTT

GBYE01016099 TTGTGTTGTGAAGCGAATTTGTGAAACTCGATTTGCCGGGATAGCTGGTCCATAAAATTGGTTTTGCCTTTCAGCAATTCAACTT

CGAAAGCCATGACCTCCGATCACTCCATGTCAAATGGGAATGGCTCTTGACTTGCAGATGTTGTTGTTGATTGAC

GBYE01007796 CTTTGTAGATTTTAACGGCGGCATCGTCTCCTTTAAACGTTGCTCTGTATCTGGTCAAGACTTGCATGAGGACCCGCAAATTCCT

CGAAAGCCATGACCTCCGATCACTCGTTGGTGTGGTTGAGTCGCTTAAGAATGCTGATCTCTTTCGAGACGTCGC

GBYE01072738 ATCTGTTCAATCTTCTGTTTAATATCTCAATCTCCTCGATTACAGGAGTTCTTTCGTTGGGACGCTTGAAGCGCAAGTAGAAAAC

CGAAAGCCATGACCTCCGATCACTCACCATCTTCCAGCAATCTCATCAACACAATAGTTTCTCTTCCATATTCTA

GBYE01022591 CTCTTCTTCTCCGATCTTCACACTCTTCCCGTCTGCCAGCAGACCTGCAATATCAAAGTTATAAGCGCGT

CGAAAGCCATGACCTCCGATCACTCATGAACAAACGAGGCTTCTTGGCGGCGGCCATCGGTAACGGGCTCTCCAC

GBYE01013735 TCGGTTTCATCCTCAAGGCCGCCAAAACAGCGTTCCAGACTTCCATAAAACCTGCCAATGCACTCGATCTTGTCATTTTTTTGCG

CGAAAGCCATGACCTCCGATCACTCAGAAATCACCAGAGGCGTGTGGCTTCAAGTCCGAGTGCCAGAGAAGACCG

GBYE01014926 AGATCCTCTCTGTATAAAATCTCATCTTTTCCGAAGATCGAGAGCAGAGCCAAACTGGAGAGAGAAGTGAAGACGATTTAACCCA

CGAAAGCCATGACCTCCGATCACTCTAATTGGCATTGAGTTGTAACCTCTCTCCAGAATGTAGTAGCAGCGTTTC

GBYE01008127 AGTCACTCGAAGCTGCGCTTCCCATTTTGGTCTTAACGTCGACCGACAAACGATTGCTGCATTCCGCTCAACGCTTGAGGAAGTA

CGAAAGCCATGACCTCCGATCACTCGAGATTAATGGCTTTCTTCGGCTGGCAATCAACGACGGAGGAGGAATCGG

GBYE01008850 TCAGTATCCATAAGTTCCGTGGTCATGTAGACATCGGTAAACTCTCTACGCTGAGGCTGTTAAAGCTGTAGCAACTCTTCCACGA

CGAAAGCCATGACCTCCGATCACTCGGCAGTGCTCCTCCGAGAGATTTTGATTTGAACGGATGATGTGGTGAAGA

GBYE01006033 TCATCAACTCCATGAAGATGCAACCTACAGACCACACATCTATGGCAGAGCTAGGACGCAAATCACTTGAAGAAGTGAAAGCGAG

CGAAAGCCATGACCTCCGATCACTCTAAGCGCATCTGATGCACATGATCCTTGCCGGGAAATAGAGGCTTTTTAT

GBYE01000925 TTCTGATAATAGTTCTGATAGGCTTTAAGAAGATCAGCGACTTGTTCCTTCCACGCGATGACGTTCGTCAAGAGTCGCATAATCT

CGAAAGCCATGACCTCCGATCACTCTGGCATAATAAGTAGGATGTTGAGGATAGTAGTATTGTGTTTTCATCTGA

GBYE01025591 TGGGATGAAACGGATCGTTTTCGTAAGCCTTCCAGCCATCAAAGTACGGGCATTTGGAATGATGTGTACTGGGAATAAGACGACG

CGAAAGCCATGACCTCCGATCACTCGAGCTGATTTTCAGCCAGACCCATCTGAATAACCCCATTAGAGTTTTTGG

GBYE01024450 CTGGGTGTTGTATTTCTCAATCACACCTTTCTTGTTGTAAATCCGGCACACACAAGAATCCCTGCTAGCTGAAGGAGGGTCAAAC

CGAAAGCCATGACCTCCGATCACTCGTTTCGTGCTCATCCACATCTGAGGAAACAAACCCGCTCGATTTCTGATC

GBYE01003680 AGGTGCATTACGTGCGTGAAGGCAACGGTGTCGAAAAGCTTCGCCAGAAGCTTGACGTAGATTGCTATCAGGTTACGATGACTGC

CGAAAGCCATGACCTCCGATCACTCCATAGGAGTTTGGATTCTCAATAGCATACCTAACACCGGCTTGAGCCGCC

GBYE01050160 TACTCTCAGATATGCATAGTTCTCTCAGAAGATCATGGATGCAACATGTCCTTACAGATCGTGTGCTCATGACTTCCACAGACGT

CGAAAGCCATGACCTCCGATCACTCTTCCTCCAAAATGTCTACATCCCTACAAACTTCAAAAGCTTTCTCGTCCC

GBYE01005208 CGCCCCAATTGTCCGTCAAACACGGGTACAAGCTGCTGAAACTGGAGCTCCTTGGAGGAGTTGATAGTGGTAAAACAACATTAGC

CGAAAGCCATGACCTCCGATCACTCCGTAGACCACCATGTCTTCGGAATCGTCCTCCTTGAGCGGCAATT

GBYE01041529 GCTTTACGAAGGAAAGTCTCACTCTCACCTGTAGAAATCAGGAGGTCGATCCTACGTATATATCCAAGTGGTTATGTCCGACGGC

CGAAAGCCATGACCTCCGATCACTCGAATTTCATTGATGGTGTCCAGTATTCTTCCTCTACCTTGTTCTTGGATG

GBYE01050872 AATTTTATCCTTTGTATCAAATTCCTCTGTTTTAACTTCAACCTCTGCTCCAGCAAGAAGGAGTATGGAACTTATAGCAAGAGAG

CGAAAGCCATGACCTCCGATCACTCTCTTCATTCTCAGATCCTATTGACGCGTAAGGGAAGCAAAAGGGTTCGAA

GBYE01001472 TTCCTCTTCGCCTTCACCTTCAAGTGACTCTCAAGGATACTCACTAATTTCACCCCTCCAAACGCATTCTTATTGGCAAATGGAA

CGAAAGCCATGACCTCCGATCACTCTATTGGCGTGTGTGAACGGAACGTCGCCGTTTCCGGGCATGTCTACGATC

GBYE01052680 AGCAGTTGTGACAGATAAGGCGATAGGCCATCGAATAAGGCAAGGACTCGCCCGAAGCAATACTGTCGTCACTCTGTATGTCCGT

CGAAAGCCATGACCTCCGATCACTCAAACTTAGGGCTCCCGCTATGGACACCGATTGGATATGCAACCGGCGGTG

GBYE01026684 GAATCTGAATCTTCTGTGACTCCTTCAAATCGGGTCCCTGGGTGTACAGACCGGGAATCGGCATTTCGCATTCTTAGGATCTAAA

CGAAAGCCATGACCTCCGATCACTCCAACTTCTCAGACTGCCTTTGTACCTTGGCCTTAAAACCAGGAGGACTCG

GBYE01025728 GATACCCATGATCCCCAGCTTCTCATTCTCACTCCCCGATCTTCATAACGGACAAACTGAACGGGCCATT

CGAAAGCCATGACCTCCGATCACTCCAGCCATATTCTTGTTTTCTGGTTAGGTGCTCTGATCTCT

GBYE01006842 TAACACGGATCTCAATTCGTCGACGGTGATGAAGCCGTCGCTGTTTTGGTCGCTATGCAGACGAGCTGGCAGAGGAGAGAAATCA

CGAAAGCCATGACCTCCGATCACTCTTCCTGCAATCTTCGACCGCTCTTCCCTGTTTCAACCCAAGCGACGA

Page 40 of 46



Draft

Table S1 (cont.). Probe sequences used for the NanoString nCounter analysis AccessionNo. ProbeA ProbeB

GBYE01014767 CACACAACTTCGGACTCCGCCAGTTCAGGATCGGCCTCCACAGAATGCATTCGCAACCATGTGAAGTAATGTGAGCGTACTT

CGAAAGCCATGACCTCCGATCACTCCGATCGAGACCCTCGCGTTGTGCGGTTCTGTTTCACCGTCTGATTAAGG

GBYE01012536 CAAAGTCTCCCAACTTGGCCGTGAAGTCTGAGTCCAACAATATGTTGCTGCACCAGTTAGCGTGGCGTATACCATGTTGTTAACA

CGAAAGCCATGACCTCCGATCACTCTTTTGTTGAGTGGTGAGTTTCATCTCTCTTCTGAATGGTACGAGCCAGAC

GBYE01000421 GGTTCGCAGTGAAGAGTGCCAATAGGAGAAATAGAGAAGGCAACAAGGCCCCTGAATCAATAGAACAATATCAGTTATGGCGGTG

CGAAAGCCATGACCTCCGATCACTCGTTGCCCATCATGCCATAACAAACACCGATCTGAGCATCTGAGATGTGAA

GBYE01004300 GACTTCCTTTTCTTTGATGGGATGTTGGTGGTGTTAAGATCCTTTTGAGGCGGTTGTTAATATGACAGGCCGCTAAAGACGTTCT

CGAAAGCCATGACCTCCGATCACTCCCATGGGATTACTATTAGAGTTGTTGTTGGTAGTGGTGATGCTGGTATCA

GBYE01021991 CATTAGGCTCGTTTATGGTAACCCAATACTTCACTCTATCCCCAAACTTCCCGTCTCAGATGAGTGGGTTAATCAATCAAGTATG

CGAAAGCCATGACCTCCGATCACTCGCATCTTGAAGGAGGCCAAATTCCTTTTCTGTACCCTCTAATTACTGCTA

GBYE01071204 CCCACTTGCCAGAGTTCCTCCTCCGAATACCGCGGCTGACACATTAGTAACGTCGGCAAGCACTTAGTCG

CGAAAGCCATGACCTCCGATCACTCTCTCGTCTTCTTATTGGGCTCCCTCACTTCACACA

GBYE01007399 TTCAGGAAGAGACAGTATAGGCACAGTTTGGCTTGGTAGAGAATCAGAACCGTGAACCAGATTATGTATGGACGCGCAATAGATA

CGAAAGCCATGACCTCCGATCACTCGCAGCAGCATCAAGCTCACTTTTGGGTCTTGGTGAAGAGAAAATTACTTC

GBYE01006511 AAAGGCCTCTCTCAACTCCTCGGAATCGCAATCCGGCTCGCACGCCGAACCATACGAAATTTGAGCAAGCAATTGAAGGCTTAGA

CGAAAGCCATGACCTCCGATCACTCTTAAGTTCCTCCGCCGAGATTTTCCCGTCGTGATCCGTGTCAAAAATGGC

GBYE01007979 AAGTGTGTTTCCTTAGCATATCGACGATCTCAGCTTTCGAATGCGCGTTGCTATCAGCTAATAGGGTCGGCTCAACAGTGTATCC

CGAAAGCCATGACCTCCGATCACTCTCCACCGTTAATCCGTTGTTTCGCTTGAACTGTTCCAGCTCATCATTGT

GBYE01005028 TAAGCACGAGGACAAGGGTTTCCCTTCGCCATTTTCTGTCCGTATTTTCGCTATCAATTCGTGACCCCGATCATCCAGTCCAGAA

CGAAAGCCATGACCTCCGATCACTCGTTGTACTTGTTTTCGAACTGGGCAACCGACGGCCATGGTGCATCTATAG

GBYE01000327 ACACCGCCGCTGACGTCGTCGCAGTTCTCGGCCAGCTTGAGCTCTAGGCCCAAAACGACCTTAATGGTCA

CGAAAGCCATGACCTCCGATCACTCTGAGCATCTTATTGAAGGTGTCCTTGGAGATGACGCTGCCGAGGGCATTT

GBYE01010007 ATTTTGTCGGTTCCAGTGGCTTTCCAGTACCCAGACTAGCCCAGATCCTACGAGATGAGCTACGTAACTA

CGAAAGCCATGACCTCCGATCACTCAGAAAACGAGAGCTTTCTTTATGCCAACCTTTCGACCAGCGGTGGTGATG

GBYE01041899 TGTTCCCAGCCAGAGGCGAGTCCTGTTTCGAGGAAGACGAATCTCCAAATGCACTCTATATGGAGGGAGAGTAGCTGGAT

CGAAAGCCATGACCTCCGATCACTCTTAAAGGCCTCGCGATCATAAGCCAGGGCAGCATCTTCAGCTGTGTCGAA

GBYE01007604 AAACAAATGCAGGCTTCCTCATGTTGTCGTAGATTCTCTGGTAATCCAGACCTGGTCTAGGTATCTAATTCGTGGGTCGGGTACT

CGAAAGCCATGACCTCCGATCACTCGAAGCCAATCTTCCTCAGCTTCCCAACATCCATAATGTTTCTTCCATCAA

GBYE01005328 CTAATCTTGCCGTCGCGGTCAAAGTCAAGGACATCGAATGCTGGTCGAAACATTAGCTCGGATGCTATCAGCTTGCGCCTATTAT

CGAAAGCCATGACCTCCGATCACTCCATCCCTGCCGGCGTAGAATGCCCGAAGATCGTCGCGG

GBYE01030298 GGTGTGAAGGACCGGTGCTCCACGTCCGGCGACAGCACGATCTGTATTTTGCACCTTTCGCTATGCTGAG

CGAAAGCCATGACCTCCGATCACTCCGAACTCTTTGTGGGCCTTGACGATGATCTCGTCTTCCTCC

GBYE01036775 AACACCTGCTGCTGATTTTGCGTCGCCTGAAACGGTGGGCGAAACGCCGGCTGTGTCCGTCTATACGCATACTGGTCCACATATA

CGAAAGCCATGACCTCCGATCACTCGGGCTAAGAATTGTGGGTACACCATGTTTGGCTGTTGGGACCCAAAAGAC

GBYE01000487 CTTCATCAGTAAGCTTCTCCCCAAGATTGGTCATCACATGGCGGAGCTCGCATGTTGGAGTTAACGGAGACCCGCCATCGTTTAC

CGAAAGCCATGACCTCCGATCACTCTATTTGGCCATCACCATCAACATCAGCCTCTCGAATCATCTCGTCAACTT

GBYE01016418 ATCAGCAATATGGGCCTCAAATTCAGAATCCAGCAACACATTACTAGCCTCGCTCATTTTGAACATACGATTGCGATTACGGAAA

CGAAAGCCATGACCTCCGATCACTCTGAGTCGACACATGAGAGGTCGAAGTATCAATCCTCCTAGCGAGACCAAA

GBYE01014032 TCCTCAGGCGAACATTTCCTTTTGCTTCCAACATTGCAACGTTTCTCTGGCCTATGCATCATGTGCCTCACTAGGACATCATGCT

CGAAAGCCATGACCTCCGATCACTCCTGACTGGTTATGATCACTTTTAGCGTCACTTCTATTGCCTGTTGATTCC

GBYE01007181 TATTCTCATCGCACAGTGAGAGATTCAAAATCGTGGTGACGCCGTACTCTCCTAAATTGGGAAAAAAGGTTTTAGCTATTGATGG

CGAAAGCCATGACCTCCGATCACTCGAGTGCTCGAACCAGAGGCTTTATTGCTCCTGACGAAACGATAAGCTCCT

GBYE01002764 AGATTCCCGCACAACCTTAGAGAAGAACTTCTGTGCATGGCTTCGAATCTCTTCAGTTAAAGGCTATCTTGCTCCGCTCGTTCTC

CGAAAGCCATGACCTCCGATCACTCCGAGGAGGTGGTATGTCAATTGGCTTTATAGAACTTTCAGTGCTACCCTC

GBYE01013774 AAGCAGCTCGAGCAACTATGGAACTTGTGATTGGTGGAATTATCTTACCGCTTAAAGCTATCCACGAATGTCAAAAATGTGGTTT

CGAAAGCCATGACCTCCGATCACTCGTACTCTATTGTCGATAGGATTTGCTCAACGATCTCTGTTTTCTTACCAA

GBYE01007398 GTGGACGCCATTTCGATGACATGATGGTCCGGCGATGGCTGCTCCCGAATGTATAATGCTGACGTTCTTGCTTTTGGC

CGAAAGCCATGACCTCCGATCACTCCACGTTGTCGAAGAACTTGTCGAGGTTGACACCGCCGGTGGGCGTC

GBYE01000347 TCGGGCTTCTCGGGTAAGAGCTTTACTTATTTCGCTGCGAACAATGGCCTCCTATTGAAGCAATCCTCTCCCCAATACTTAAAAA

CGAAAGCCATGACCTCCGATCACTCCCATTGACGAAGCAGTCGTGGAAGAAGAGACGGAGGATGGAGGCACCGAG

Page 41 of 46



Draft

Table S2. Primer sequences used for qRT-PCR analysis. Acc.no. Putativefunction Forwardprimer(5à3) Reverseprimer(5à3)GBYE01027655 RINGfingerprotein CACGCAGTCTCTCACCTTGT CATTCAACCTGCTCGGTGTGGBYE01048118 DREbindingprotein CTTCTTCCATTCCTCTCCT TTGAAACTGGTCGGTCTGGBYE01041303 WRKYtranscriptionfactor AATGCTCCTAAATCTCC CCTCTTGTAATGGCTCGTGBYE01019654 Zincfingerprotein GCCTTCAACTATGACCAAGAA GATGAGACAGAGAGCGAGGTGBYE01078745 NBS-LRRdisease-resistanceprotein TGGAATCTACACACCCTATCTT GCTTTGGGAATACACCTTTC

Page 42 of 46



Draft

Table S3. Stability values of candidate reference genes for qRT-PCR analysis determined by NormFinder. Genenames 10min 30min 60mintubulin 0.473 0.432 0.397ef1a 0.061 0.396 0.31718S 0.048 0.123 0.132ubq 0.073 0.322 0.2575.8S 0.255 0.301 0.267actin 0.165 0.535 0.520Thebestcombination* 0.039 0.157 0.153

*18S and ef1a for 10 min, 18S and 5.8S for 30 and 60 min

Page 43 of 46



Draft

Table S4. Microscopic analysis of cross-sections of xylem in two-month-old stressed and two- and three-month-old unstressed A. koa seedlings*. 2-month-old,stressed 2-month-old,unstressed 3-month-old,unstressedXylemcelldensity(cells/104µm2)

71.48±2.83a 49.07±3.85b 42.97±3.49b

Xylemcellsize(µm2)

140.43±5.63c 207.68±17.74d 235.97±19.52d

*Letters (a, b, c, d) indicate significant differences (P < 0.05) by t-test. Error bars represent standard error.

Page 44 of 46



Draft

Table S5. Microarray analysis of sequences induced by mechanical stress in A. koa.

Acc.No. putativefunction Microarray SE p-valueGBYE01027655 RINGfingerprotein 18.07 2.99 0.047GBYE01019260 Zincfingerprotein 15.18 0.81 0.018GBYE01019654 Zincfingerprotein 14.69 3.11 0.038GBYE01017658 Ethylene-responsivetranscriptionfactor 9.10 0.79 0.028GBYE01026109 Proteinphosphatase2C 8.85 0.73 0.011GBYE01048118 DREbindingprotein 8.83 0.95 0.037GBYE01041303 WRKYtranscriptionfactor 8.58 1.75 0.069GBYE01037314 WRKYtranscriptionfactor 8.31 0.30 0.012GBYE01039799 WRKYtranscriptionfactor 6.31 1.59 0.072GBYE01011012 RINGfingerprotein 6.16 0.60 0.024GBYE01016099 WRKYtranscriptionfactor 5.56 0.64 0.040GBYE01007796 LysMtypereceptorkinase 5.39 0.77 0.041GBYE01072738 CC-NBS-IRRresistanceprotein 4.95 0.96 0.059GBYE01078745 NBS-LRRdisease-resistanceprotein 4.94 1.66 0.053GBYE01013735 Proteinphosphatase2C 4.80 0.39 0.032GBYE01022591 Zincfingerprotein 4.66 1.08 0.006GBYE01014926 Abscisicacid8'-hydroxylase 4.62 0.31 0.021GBYE01008127 Ethylene-responsiveelement-bindingprotein 4.50 0.19 0.012GBYE01006033 Mitogen-activatedproteinkinase 4.25 0.43 0.008GBYE01008850 Mitogen-activatedproteinkinase 4.24 0.76 0.064GBYE01000925 Metalionbindingprotein 3.74 1.22 0.022GBYE01025591 1-aminocyclopropane1-carboxylatesynthase 3.73 0.13 0.000GBYE01024450 NACdomainprotein 3.52 0.17 0.009GBYE01050160 NBS-LRRdisease-resistanceprotein 3.48 0.54 0.044GBYE01005208 Ethylene-responsivetranscriptionfactor 3.41 0.18 0.006GBYE01003680 UDP-D-glucuronicacid4-epimerase 3.37 0.59 0.035GBYE01041529 Syntaxin 3.32 0.36 0.006GBYE01050872 WRKYtranscriptionfactor 3.19 0.64 0.022GBYE01001472 UDP-glucuronate5-epimerase 3.14 0.37 0.003GBYE01052680 Octicosapeptide/Phox/Bem1p(PB1) 3.12 0.77 0.031GBYE01026684 MYBtranscriptionfactor 3.09 0.84 0.121GBYE01025728 AP2domain-containingtranscription 3.02 0.26 0.040GBYE01006842 Calcium-bindingEF-handprotein 2.96 0.19 0.028GBYE01014767 RINGfingerprotein 2.79 0.30 0.026GBYE01000421 beta-1,3-glucanase 2.79 0.83 0.138GBYE01012536 Lectinproteinkinasefamilyprotein 2.78 0.39 0.006GBYE01004300 WRKYtranscriptionfactor 2.67 0.19 0.003GBYE01007399 Calmodulinbindingprotein 2.65 0.42 0.079GBYE01000327 Chitinase 2.58 0.83 0.152GBYE01071204 DREbindingprotein 2.57 0.83 0.054GBYE01006511 Calcium-bindingprotein 2.56 0.04 0.006GBYE01005028 WRKYtranscriptionfactor 2.53 0.23 0.017GBYE01010007 NACdomainprotein 2.46 0.09 0.005GBYE01041899 AP2/ERFdomain-containingprotein 2.45 0.46 0.061GBYE01018782 Auxin-inducedprotein 2.44 0.62 0.097GBYE01007979 AP2domainclasstranscriptionfactor 2.44 0.48 0.024GBYE01019214 Proteinphosphatase2C 2.43 0.62 0.050GBYE01007604 UDP-glucosedehydrogenase 2.29 0.44 0.033GBYE01008935 WRKYtranscriptionfactor 2.25 0.17 0.004GBYE01036775 AP2/ERFdomain-containingprotein 2.24 0.46 0.074GBYE01030298 MYBtranscriptionfactor 2.23 0.64 0.153GBYE01005328 Calcium-bindingprotein 2.23 0.42 0.021GBYE01016418 Ser/threproteinkinase 2.22 0.12 0.016GBYE01000487 Calmodulin 2.22 0.25 0.024GBYE01014032 Auxin-inducedprotein 2.16 0.52 0.084GBYE01013774 CytochromeP450 2.10 0.67 0.171GBYE01043450 Zincfingerprotein 2.08 0.13 0.021GBYE01007181 E3ubiquitinligase 2.07 0.35 0.019GBYE01053827 WRKYtranscriptionfactor 2.06 0.17 0.049GBYE01007398 Syntaxin 2.05 0.44 0.120

Page 45 of 46



Draft

Fig. S1. Verification of expression levels obtained from the NanoString nCounter analysis by qRT-PCR. The gene expression levels were verified in five sequences at three different time points 10, 30, and 60 min following the mechanical stress treatment. It shows the correlation between the data obtained from the two methods.

0.00

10.00

20.00

30.00

40.00

50.00

60.00

70.00

80.00

90.00

RINGfingerprotein DREbindingprotein WRKYtranscriptionfactor

Zincfingerprotein NBS-LRRdisease-resistanceprotein

Foldch

ange

Putativefunctions

10minnCounter

10minqRT-PCR

30minnCounter

30minqRT-PCR

60minnCounter

60minqRT-PCR

Page 46 of 46



thigmomorphogenesis: morphological, biochemical · 1 thigmomorphogenesis: morphological,...

Documents