timothy sveeggen capstone final paper

Mutagenesis of Magnetosome Protein, Mms6:Effects on Reductase Activity

Honors Capstone ProjectTimothy Sveeggen

Class of 2015

Mutagenesis of Magnetosome Protein, Mms6 Timothy Sveeggen

AbstractRecent investigations of the biochemical function of iron have presented many opportunities for

its use in various industries. For example, iron’s ability to form magnetic nanoparticles has many

implications in the development of new medical techniques, bioengineering, and other related

fields. Because the molecular specifics of iron manipulation within a cell are not well

understood, this project was intended to investigate the properties of Mms6, a protein component

of bacterial magnetosome membranes. Magnetosomes are iron-rich compartments containing

highly regulated magnetic iron-nanoparticles, which allow bacteria to orient themselves with

respect to the magnetic field. Mms6 is believed to use its iron-binding and reductase activities to

promote the development of these magnetic particles. While a previous study identified four

amino acids in Mms6 to be critical to iron binding, this experiment investigated the effects of

these mutations on reductase activity by testing double mutants of the protein that were predicted

to be inactive. Through mutagenesis of Mms6, this study was able to confirm that double

substitutions at serine 119 & serine 122, as well as serine 119 & glutamic acid 124, inhibited

reductase activity, giving insight to the mechanism of iron reduction by Mms6.

IntroductionThe magnetosome of magnetotactic bacteria is a fascinating organelle that gives cells the ability

to orient themselves through the magnetic field. A genomic island for the magnetosome (termed

MAI) has been identified within the genome of magnetotactic bacteria, and it has been shown

that these genes are responsible for the biogenesis of the magnetosome. A specific gene, Mms6,

is of particular interest. The protein encoded by this gene is bound tightly to the magnetite

particles of the magnetosome, indicating Mms6 plays an important regulatory role in magnetite

crystal shape and morphology of magnetotactic bacteria [1, 2]. Also interesting, is that Mms6

protein has been shown to promote formation of magnetite nanoparticles in vitro [3, 4, 5].

The in vitro function of Mms6 as a biomineralization protein of ferric iron has been well

investigated by Dr. Marit Nilsen-Hamilton’s lab here at Iowa State [5, 6]. Their studies have also

found reductase activity by the Mms6 protein. To understand how Mms6 functions as a

reductase and how it binds iron during in vitro magnetite synthesis, the lab conducted site-

directed mutagenesis to create a series of recombinant proteins, consisting of point mutations that

2


changed one amino acid to alanine in each protein. This process identified four amino acid

residues in the protein sequence that are important for structure and function [Unpublished data].

These mutated amino acids significantly decreased iron binding and reductase activity, but not

completely. It is my project through mutagenesis of Mms6 that provided two double mutants of

these four critical sites for me and others in the Nilsen-Hamilton lab to investigate iron binding

and reductase activities.

ObjectiveAs the four potential iron binding sites (Ser119, Ser122, Asp123, and Glu124) in Mms6 protein

are all polar amino acids that can chelate iron (see figure 1), it was predicted that replacing these

polar amino acids with nonpolar alanine would alter the process of crystal formation by

decreasing the iron binding ability of Mms6. The Nilsen-Hamilton lab previously found iron

binding decreases significantly when changing any of these single amino acids into alanine

[Unpublished data], but the iron binding and reductase activity in these mutants are not

completely eradicated, and the interactions between these sites (and possibly others) still needs to

be investigated. Therefore, double or triple mutations are necessary to completely remove these

activities.

For this project, only three amino acids were targeted – due to time constraints. Two mutant

strains were made, S119A/S122A & S119A/E124A. We hypothesized that substituting these

amino acids into alanine will greatly reduce reductase activity of the wild-type control Mms6

protein, which would in turn alter magnetite formation.

3


Figure 1 – Note difference in polarity as shown by the ovals.

MethodsTo mutate this gene, the Agilent QuikChange II Site-Directed Mutagenesis Kit [8] was used.

While the kit contained all the buffers and solutions needed to make the modification possible,

the specific DNA primers had to be designed. After determining the proper primers and mutation

sequence, they were sent to the ISU DNA sequencing lab to be made. Once obtained, they were

amplified by Polymerase Chain Reaction (PCR) according to the kit instructions. Once enough

of the mutated sequences were made, the process of modifying E. coli to express the modified

gene began [7, 8].

Sample SequenceWild-Type ………cgtgatatcgaatcggcgcagagcgacgaggaagtc………

S119A/S122A ………cgtgatatcgaagcggcgcaggcggacgaggaagtc………

S119A/E124A ………cgtgatatcgaagcggcgcagagcgacgcggaagtc………

4


The amplified sequences were digested using Dpn I, which cleaved the DNA to remove the

template strands before the copied DNA was taken up by the bacteria. This digested DNA was

added to samples of E. coli strains to be incubated on ice and heat pulsed at 42ᶱ C which allowed

uptake of the mutated plasmid by the bacteria. Successful transformation was confirmed by

culturing the bacteria on ampicillin-containing plates (the inserted plasmid also contains

ampicillin resistance) and sequencing through the Iowa State DNA facility [7, 8].

Once the E. coli successfully incorporated the new plasmid, the mutated Mms6 strains were

made on a larger scale. The E. coli containing the double mutants were cultured and allowed to

express the protein through IPTG induction of the lac operon, which was then extracted and

purified using Talon resin. Talon resin binds to the protein at a specific His-poly (A) tag that is

already linked to the recombinant protein. Once bound to the resin, the material extracted from

the inclusion bodies with 7M urea was loaded onto a column which allowed unwanted cell

contents to pass through, leaving the protein attached to the resin [9]. The column was washed to

remove all unwanted proteins and the His-tagged protein was freed from the resin by competition

with imidazole. The purified protein was refolded by dialysis and then evaluated for reductase

activity.

Reductase activity was measured by loading the protein of interest into a lipid bicelle. As Mms6

is a membrane protein, this helps replicate a natural environment for in vitro assay. DHPC and

DMPC were the two lipids used to form the bicelle, which incorporated the protein during a

period of rapid freezing and thawing. Ferric citrate was the substrate used at differing

concentrations, and ferrozine was the marker for tracking reduction of ferric citrate over time. As

the protein reduces the ferric iron, ferrozine then irreversibly binds to it, causing a color change

to be read by a spectrometer based on absorbance at 562nm (A562).

ResultsNot surprisingly, double mutation at serine 119 & serine 122, showed essentially no reductase

activity compared to the wild-type. However, substitutions at serine 119 & glutamic acid 124

showed mixed results regarding reductase activity. The data shows a change in absorbance

greater than the wild-type, which leads us to think rapid precipitation of the sample may have

5


fooled the spectrometer. This is consistent with the observation that the end color change of

sample for S119A/E124A was the same as S119A/S119A, whereas the wild-type showed a much

more drastic change in color (Figure 4).

Figure 2 – A562 readings. Measurements were taken every minute for 6 hours. To examine reductase activity more

accurately, the time range of highest slope (absorbance/time) should be evaluated apart from the rest of the assay.

This is usually within the first hour of activity.

6

1 17 33 49 65 81 97 1131291451611771932092252412572732893053213373530

0.005

0.01

0.015

0.02

0.025

0.03

Wild-Type

0 uM80 uM160 uM320 uM

Abso

rban

ce (5

62nm

)

1 17 33 49 65 81 97 113129145161177193209225241257273289305321337353

-0.008-0.006-0.004-0.002

00.0020.0040.006

S119A/S122A

0 uM80 uM160 uM320 uM

Abso

rban

ce (5

62nm

)

1 17 33 49 65 81 97 113 129 145 161 177 193 209 225 241 257 273 289 305 321 337 3530

0.02

0.04

0.06

0.08

0.1

0.12

S119A/E124A

0 uM80 uM160 uM320 uM

Abso

rban

ce (5

62nm

)


Figure 3 – A562 measurements within the first hour. Slope from the equation of linear regression used to estimate the

change in absorbance.

7

1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 580

0.005

0.01

0.015

0.02

0.025

f(x) = 0.000191678243956655 x + 0.00167881355932204R² = 0.982806448471659f(x) = 0.000183578771881078 x + 0.00135084745762712R² = 0.977597280420958

f(x) = 0.000271992220061128 x + 0.00180423728813559R² = 0.973930734573993

f(x) = 0.000332967490969714 x + 0.00195282485875706R² = 0.977229083689173

Wild Type

0 uMLinear (0 uM)80 uMLinear (80 uM)160 uMLinear (160 uM)320 uMAb

sorb

ance

(562

nm)

1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 580

0.001

0.002

0.003

0.004

0.005

f(x) = 2.08946929702696E-05 x + 0.00132937853107345R² = 0.50905429093875f(x) = − 1.42539594331759E-05 x + 0.00253474576271187R² = 0.30723870542938

f(x) = − 1.02806335093083E-05 x + 0.00438022598870057R² = 0.245937568864921

f(x) = − 3.38983050847459E-06 x + 0.00277005649717514R² = 0.0263974035340788

S119A, S122A


sorb

ance

(562

nm)

1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 580

0.010.020.030.040.050.060.070.08

f(x) = 0.000473812170047235 x + 0.00830706214689267R² = 0.991312225098545f(x) = 0.000492859127535427 x + 0.00913446327683616R² = 0.968822932757201

f(x) = 0.000402709085857183 x + 0.0234590395480226R² = 0.93364343217356

f(x) = 0.000943901083634343 x + 0.0187610169491525R² = 0.978742364167374

S119A, E124A


sorb

ance

(562

nm)


Figure 4 – Samples after reductase assay. Note mutant samples have same color despite different A562

measurements.

To better gauge reductase activity, the change in absorbance had to be normalized against the

molar extinction coefficient of the protein (predetermined), by dividing the slope by the

coefficient. This provides the initial velocity of enzyme activity, which is a better comparison

between similar proteins.

Samples Concentration Slope Molar Extinction Coefficient Initial Velocity (Slope/ME)

Wild-type

0 uM 0.000

2

28000 7.14286E-09

80 uM 0.000

2

28000 7.14286E-09

160 uM 0.000

3

28000 1.07143E-08

320 uM 0.000

3

28000 1.07143E-08

S119A/S122A

0 uM 28000 0

80 uM 28000 0

160 uM 28000 0

320 uM 28000 0

8

S119A/E124AWild-type

S119A/S122ANo Protein

0uM 80uM 160uM 320uM


S119A/

E124A

0 uM 0.000

5

28000 1.78571E-08

80 uM 0.000

5

28000 1.78571E-08

160 uM 0.000

4

28000 1.42857E-08

320 uM 0.000

9

28000 3.21429E-08

Having the initial velocities also allows us to determine the saturation (equilibrium)

concentration for the investigated proteins. However, the data for this experiment did not yield

fine enough results for confident values. The data is able to suggest the wild-type protein nears

saturation around 160-320 uM, as the slope nears zero in this range. This means the enzyme is

nearing its maximum rate of activity; it is fully saturated.

Figure 5 – The saturation plot is a measure of change in initial velocity as the concentration of substrate increases.

When the initial velocity no longer changes, the enzyme is saturated.

DiscussionA single reductase assay is able to provide a lot of information regarding a protein’s behavior.

Because of this information, it is also easier to visualize the impact mutations have on protein.

Such impacts are certainly apparent in this experiment. While further testing is needed to

confirm these results and address outliers in the data, it’s clear that replacing multiple residues of

9


Mms6’s putative activity center with alanine (that lacks a hydroxyl group and cannot chelate

iron) will have significant effects on reductase activity.

Aside from repeating reductase assays, evaluating the iron-binding of these mutants will be the

next step to further understand how Mms6 functions at a molecular level. It is expected that these

mutants will have decreased iron-binding to match their reduced reductase activity, given that the

reduced iron-binding of single amino acid substitutions has already been observed.

ConclusionUnderstanding the biological use of iron is critical for many industries. Within medicine,

biotechnology, and others, manipulation of iron is revealing new possibilities that change how

we think about molecular biology. By understanding the reductase activity of Mms6, we have

better insight towards the biological manipulation of iron at a molecular level. This project may

also provide better understanding of the manipulation of iron by Mms6 protein, which could

contribute to development of better iron nanocrystals in vitro.

Citations

1. Amemiya Y, Arakaki A, Staniland SS, Tanaka T, Matsunaga T. Controlled Formation of

Magnetite Crystal by Partial Oxidation of Ferrous Hydroxide in the Presence of

Recombinant Magnetotactic Bacterial Protein Mms6. Biomaterials. 2007; 28:5381-5389.

2. Arakaki, A.; Webb, J.; Matsunaga, T., A novel protein tightly bound to bacterial

magnetic particles in Magnetospirillum magneticum strain AMB-1. J Biol Chem 2003,

278, (10), 8745-50.

3. Tanaka, M.; Mazuyama, E.; Arakaki, A.; Matsunaga, T., MMS6 protein regulates crystal

morphology during nano-sized magnetite biomineralization in vivo. J Biol Chem 2011,

286, (8), 6386-92.

4. Feng S, Wang L, Palo PE, Liu X, Mallapragada SK, and Nilsen-Hamilton M. Integrated

Self-Assembly of the Mms6 Magnetosome Protein to Form an Iron-Responsive

Structure. Int. J. Mol. Sci. 2013; 14:14594-14606.

10


5. Wang L, Prozorov T, Palo PE, et al. Self-Assembly and Biphasic Iron-Binding

Characteristics of Mms6, A Bacterial Protein That Promotes the Formation of

Superparamagnetic Magnetite Nanoparticles of Uniform Size and Shape.

Biomacromolecules. 2012; 13:98−105.

6. Pierre JL, Fontecave M, Crichton RR. Chemistry for an Essential Biological Process: The

Reduction of Ferric Iron. BioMetals 2002. 15:342-346.

7. DiStefano JK. Disease Gene Identification. Methods in Molecular Biology. 2011; 700.

8. QuikChange II Site-Directed Mutagenesis Kit: Instruction Manual (Revision C). Agilent

Technologies Inc; 2010.

9. Clontech Laboratories Inc. Talon® Metal Affinity Resins User Manual. Catalog Number

PT1320-1 (102612).

11

timothy sveeggen capstone final paper

Documents