transposition of tn5096 and other is493 derivatives in … · vol. 173, no. 3 transposition...

Vol. 173, No. 3

Transposition of Tn5096 and Other IS493 Derivatives inStreptomyces griseofuscus

PATRICIA J. SOLENBERG* AND RICHARD H. BALTZ

Lilly Research Laboratories, Eli Lilly and Company, Indianapolis, Indiana 46285

Received 9 October 1990/Accepted 27 November 1990

TnSO96 was constructed by inserting an apramycin resistance gene, aac(3)IV, into IS493 from Streptomyceslividans. By using conventional and pulsed-field gel electrophoresis, Tn5O96 and related transposons wereshown to insert into many different locations in the Streptomyces griseofuscus chromosome and in two linearplasmids. On insertion into the target site CANTg, 3 bp appeared to be duplicated. Independent transpositionswere obtained by delivery of the transposon from a temperature-sensitive plasmid. The frequency ofauxotrophy among cultures containing transpositions was about 0.2%.

Transposable elements have been valuable tools in thegenetic analysis and molecular manipulation of bacteria (forreviews, see references 1 and 14). The development oftransposable elements for Streptomyces spp. should facili-tate the genetic analysis and exploitation of these versatilesecondary metabolite producers. The transposition charac-teristics of a few Streptomyces transposable elements havebeen studied in detail. IS110 (4, 5) and the 2.6-kb minicircle(17, 18), both isolated from Streptomyces coelicolor A3(2),appear to have strong target preferences. Tn4556, a class IItransposable element from the neomycin-producing Strepto-mycesfradiae, has been shown to transpose into many sites(6, 20, 26), though probably not entirely randomly (30).

IS493 is a 1.6-kb class I insertion sequence containinginverted repeats at its ends and two open reading frames(28). It is present in Streptomyces lividans in three copies.IS493 was identified by its ability to transpose into thelambda repressor gene, c1857, controlling the expression ofan apramycin resistance (Amr) gene, aac(3)IV (13), in Esch-erichia coli. This expression system was present on abifunctional plasmid designed to isolate transposable ele-ments from Streptomyces spp. Since IS493 was able totranspose into the lambda repressor gene, it seemed likelythat it would transpose into other segments of DNA. Be-cause of this, we were interested in determining if IS493could be developed into a transposon for general use inStreptomyces spp.We report here the construction of transposons TnS096

and TnS097 that contain the aac(3)IV gene inserted betweenthe open reading frames of IS493. TnS096 transposed intomany sites in the Streptomyces griseofuscus chromosomeand into two linear plasmids. We also inserted two antibioticbiosynthetic genes into TnS096 and showed that the resultingelement, TnS098, transposed in S. griseofuscus.

MATERIALS AND METHODS

Media. B agar was Bennett's medium (29) supplementedwith 2 ml of Czapek's mineral mix per liter. Czapek'smineral mix contained (per liter) 100 g of KCI, 100 g ofMgSO4 - 7H20, and 2.0 g of Fe2(SO4)3 - 7H20. CDA agarwas Czapek Dox broth (Difco) plus 2 g of asparagine per literand 15 g of agar. TSB was Trypticase soy broth (BBL

* Corresponding author.

Microbiology Systems). TY soft agar was TY agar (21)containing 6 g of agar per liter.

Bacterial strains, plasmids, and transposable elements.Strains, plasmids, and transposable elements are listed inTable 1. Construction of the plasmids and transposableelements is shown in Fig. 1.

Culture conditions and transformations. Propagation andtransformation of E. coli and Streptomyces cultures havebeen described elsewhere (21, 22). E. coli transformantswere selected for resistance to 100 jig of apramycin per ml.S. griseofuscus C581 transformants were selected for resis-tance to 25 p.g of thiostrepton or apramycin per ml. For bothorganisms, geneticin (G418) at 25 ,ug/ml can be substitutedfor apramycin.

Chemicals and enzymes. Apramycin was a gift of K.Merkel of Eli Lilly and Co. Thiostrepton and geneticin(G418) were purchased from Sigma Chemical Co. Restric-tion enzymes, DNA ligase, mung bean nuclease, calf alka-line phosphatase, and T4 polynucleotide kinase were usedaccording to the specifications of the suppliers.DNA isolation and recombinant DNA methods. DNA ma-

nipulations were performed as previously described (22)unless noted otherwise. Total genomic DNA and plasmidDNA were isolated from Streptomyces spp. as described byHopwood et al. (12). Methods for purification of DNAfragments, Southern hybridization, preparation of DNAprobes, and synthesis of oligonucleotides have been de-scribed previously (28).

Isolation of cultures containing transpositions. Transposi-tions of TnS096 and TnS097 were obtained by using plasmidspCZA163 and pCZA157, which cannot replicate in Strepto-myces spp., by transforming S. griseofuscus and selectingfor Amr. Transpositions of TnS096 were also obtained bygrowing S. griseofuscus transformants containing pCZA159for 5 to 7 days at 29°C in the absence of selection on B agar.Spores were harvested and replated for a second round ofsporulation. Colonies from the resulting spores were grownon B agar plus apramycin at 25 ,ug/ml and then screened forthiostrepton sensitivity (Tss) by patching cells on B agar plusthiostrepton at 25 ,ig/ml and incubating the plates for 2 daysat 29°C. Clones containing transpositions were identified bythe expression of an Amr Tss phenotype.

Transpositions of TnS096 and TnS098 were also obtainedby using temperature-sensitive plasmids. In one method, S.griseofuscus containing pCZA168 or pCZA172 was grown at39°C on B agar containing apramycin at 25 pkg/ml. After 7

1096

JOURNAL OF BACTERIOLOGY, Feb. 1991, p. 1096-11040021-9193/91/031096-09$02.00/0Copyright C) 1991, American Society for Microbiology

on April 1, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

TRANSPOSITION OF TnSO96 IN S. GRISEOFUSCUS 1097

TABLE 1. Bacterial strains, plasmids, and transposable elements

Strain, plasmid, or Relevant characteristics Source ortransposable element reference

Escherichia coli DH5a

Micrococcus luteusStreptomyces griseofuscusC581PS5PS7PS8PS9PS10Psi1PS13PS14PS15PS16PS17PS18PS19PS20PS21PS22PS23PS24PS25PS26PS27PS28PS29PS30PS31PS32PS33PS34

K-12 F- 480dlacZAM15 A(lacZYA-argF)U169 recAl endAlhsdR17 (rK- mK+) supE44 A- thi-l gyrA relAl

Lankacidin sensitive

Wild typeC581fl17[chr::Tn5O97] Phe-C581fll[chr::TnSO96]C581fl2[chr: :TnSO96]C581Q3[chr::TnSO96]C581f4[chr::TnSO96]C581f5[chr::TnSO96]C581f7[chr::TnSO96]C581Q8[chr::TnSO96]C581Q9[pSGF3: :TnSO96]C581fQ10[chr::Tn5O96]C581Q111[chr::TnSO96]C581Qf12[chr::TnSO96], sporulation defectiveC581fl13[chr::TnSO96]C581Q14[chr::TnSO96]C58lfll5[chr: :Tn5O96]C581Q16[chr: :TnSO96]C581lf18[pSGF2::Tn5O96], sporulation defectiveC58lfll9[chr::TnSO961 Lan-C581f20, contains pCZA190, Lan-C581fQ21, contains pCZA191, Lan-Contains pCZA168 sequencesContains pCZA168 sequencesContains pCZA168 sequencesC581Q25 C581: :TnSO96C581Q26 C581::TnSO96C581Q27 C581::Tn5O96C581fl28 C581: :TnSO96C581fl29 C581::TnSO96

22

ATCC 9341

ATCC 23916; 7This workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis workThis work

pUC19 derivative containing IS493pUC19 derivative containing Tn5O96pUC19 derivative containing TnS097pHJL401 derivative containing Tn5096pUC19 derivative containing TnS096 flanked with linkerspGM160 derivative containing Tn5096pGM160 derivative containing Tn5O98pSGF2 derivative containing Tn5096pSGF2 derivative containing Tn5O96Streptomyces temperature-sensitive replicon and ColEl repliconS. griseofuscus C581 200-kb linear plasmidS. griseofuscus C581 60-kb linear plasmidUnstable Streptomyces replicon and ColEl repliconContains aac(3)IV geneContains tylF and tyU genesColEl replicon

S. lividans insertion sequenceIS493 derivative containing aac(3)IVIS493 derivative containing aac(3)IVTn5096 derivative containing tylF and tyUl

days, spores were collected and screened for Amr Tss asbefore. In the second method, S. griseofuscus containingeither plasmid was grown in TSB plus thiostrepton at 25p.g/ml, homogenized, and plated on B agar plus apramycin at25 ,ug/ml to obtain about 20 to 100 isolated colonies per plate.The plates were incubated at 29°C for 2 to 3 days and thenincubated at 39°C for 10 to 14 days. At 39°C, cells containingtranspositions of TnSO96 into the S. griseofuscus genomecontinued to grow and formed sectors. Cells from the sectors

were picked and streaked to B agar plus apramycin at 25,ug/ml and incubated at 39°C to further purify the culture.After 2 days, colonies were screened for Tss to identifystrains containing transpositions.For each delivery system, several putative transpositions

were analyzed by hybridizing Southern blots to probesspecific for the transposon or the vector. Hybridization onlyto the transposon probe confirmed transposition events.

Pulsed-field gel electrophoresis. Agarose-embedded DNA

pCZA142pCZA156pCZA157pCZA159pCZA163pCZA168pCZA172pCZA190pCZA191pGM160pSGF2pSGF3pHJL401pOJ107pSFH52pUC19

IS493Tn5O96TnSO97Tn5O98

28This workThis workThis workThis workThis workThis workThis workThis work19This workThis work1523a9a31

28This workThis workThis work

VOL. 173, 1991


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

1098 SOLENBERG AND BALTZ

MCS

pOJ 107Xmn I-Sma I fragment

St4.8-kb Sty I fragmentmung bean nuclease

linkers A andB/BKsan1.6fra

linker A Tn5O96 linker B

p I pH Sa Ks KsH

linker APiH B

MCS MCSSa mcsHSa

pCZAI56 PCZA1576.2kb y Ks 6.2kb

/Ks3.5-kb

I-kb Sau I Hind IIIp632 I fragment fragmentid5kb Ksp 632 1 5.8-kb HindIll fragment pHJL401igment

BoH

B

E

pCZA168

9.2 kb j4

,1

N

Tn5O98 linker B

qE H

B.

HindIII Bg I I Nsi I Kpn I IS493-End I Sau I

iner ATAGCTTAGATCTATGCATGGTACCAGTGAGCGT TTTTCAACCLinkerAATCTAGATACGTACCATGGTCACTCGCAAAAAGTTGGAGT

Nsi IKsp632 I Xba I Bgf II Hind III

G C C T C T A G A T G C A T A G A T C T A

Llnlk rB AG A T C T ACG T A T C T AG A T T CG A

FIG. 1. (A) Construction of plasmids and transposons. Only pertinent restriction sites are shown. Abbreviations: B, BamHI; Bg, BgII;E, EcoRI; H, HindlIl; K, KpnI; Ks, Ksp6321; N, NsiI; Sa, Saul; Sc, Scal; St, Styl; X, XbaI; MCS, multiple cloning site of pUC19. (B)Linkers A and B. Linkers contain restriction sites not present in TnS096 which permit easy subcloning.

J. BACTERIOL.

A.

H

pUC 19


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


-. 'r "Is O'\ .PN -rc. roqs\ coO,.3\ AN' ,xS 6, 03 \.N' \.\, "\"8i5.,\.v 1, Q (a \ _

- .r 1. .cj.py .. .s kV c'09) (

Tn5O963.0 kb

IR

ORFA ORFB177 AA 233 AA

IR

0,

IR S, -ORF A aac(3)IV

(V N-.4

IR

ORF B

tk'NN

'N161.. '3. Nlli) -ro",.-t. Z.,.A.s -1.1 119'5

ell ( ) I-S\3

IR FA t tyiFORF A tylJ tylF

C,

aac(3)IV

-.0IR

ORF B

FIG. 2. Restriction maps of transposable elements IS493, TnS096, and Tn5098. TnSO97 is similar to TnS096 but contains the aac(3)IV genein the opposite orientation.

of S. griseofuscus cultures was prepared by the methods ofSchwartz and Cantor (24) with modifications (9, 13a, 27).Specifically, 10-ml cultures grown overnight in TSB plusglycine (0.4%) were homogenized and washed twice with 0.3M sucrose and then resuspended in 10 ml of TSE (25 mMTris, 0.3 M sucrose, 25 mM EDTA [pH 8.0]). Mycelialfragments (2 ml) were mixed with 2 ml of 2% Incert agarose

AKb

23-9.4-6.7-4.4-

2.3_2.0-

1.35-1.1-.87-.6-

.3-

wtl 2 34 57 89

*,* .... .9..ii,

7:_

B 11 12131415 16 X 2526272829Kb

23- 023* .,.9.4-s *

2.0-0

6.7-0

4.4- _

2.0- 0

1.35-1.1- ai

FIG. 3. Southern hybridization analysis of transpositions fromvarious vectors. Genomic DNA of Amr Tss S. griseofuscus cloneswas digested with BamHI and probed with TnS096. Since thetransposon contains one BamHI site, two bands are seen. Lanes arelabeled with the insertion number (Ql). wt, C581 wild-type DNA; fll,transposition from pCZA157; Q12 through fQ5, Q8, and [19, transpo-sitions from pCZA159; [7, transposition from pCZA163; Q111through [16, transpositions from pCZA168 from cured spores; [125through [129, transpositions from pCZA168 from sectors; X, DNAthat hybridizes to both transposon and plasmid sequences.

(FMC Bioproducts) in TSE at 50°C. The mixture was quicklypoured into a 100-mm petri plate (prewarmed to 50°C) toform a thin layer of embedded cells. The plates were cooledto 4°C for 1 h to solidify the agarose. The embedded cellswere then overlaid with 10 ml ofTSE plus 1 mg of lysozymeper ml and incubated at 30°C for 2 h, washed with TSE (twotimes), overlaid with 1% lauryl sarcosine-0.5 M EDTA-10mM Tris (pH 9.5)-i mg of proteinase K per ml (ESP buffer)and incubated at 50°C for 24 h, washed with TE (pH 8.0)(22), overlaid with 0.1 mM phenylmethylsulfonyl fluoride (inTE) and incubated at 25°C for 16 h, washed with TE,overlaid with TE and RNase at 10 ,ug/ml and incubated at25°C for 1 h, and washed with TE. Embedded DNA overlaidwith TE can be stored for at least 6 months at 4°C.

Pulsed-field gel electrophoresis was performed by using aCHEF-DR II system (dynamically regulated clamped homo-geneous electric field; BioRad). Separation of DNA wasperformed in 1.0% FastLane agarose (FMC Bioproducts) in0.1 x TBE (22) buffer at 16°C by using 170 V and a 25-s pulsefor 24 h. DNA size standards were yeast chromosomes(Beckman), lambda DNA concatamers (FMC Bioproducts)and BamHI- and EcoRI-digested adenovirus (type 2) DNA(International Biotechnologies, Inc.).

Small blocks of agarose-embedded DNA were cut byusing glass coverslips. Restriction digestions were per-formed by first incubating the blocks in about 300 ,ul ofrestriction enzyme buffer for 15 min, removing the buffer,and then adding fresh buffer and 20 U of SspI. Digestionswere performed in tilted petri plates to facilitate handling ofthe blocks. Plates were kept in an airtight container duringdigestion at 37°C for 16 h to reduce evaporation. Before thegel was loaded, the agarose blocks were soaked in 0.1 x TBEfor 15 min. To load the gels, the solidified agarose frombehind the wells was removed and the blocks containing

IS4931.6 kb

Tn5O985.3 kb

VOL. 173, 1991

.1 a


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


embedded DNA were placed against the gel in the impres-sion left by the comb. The missing gel region was thenrepoured.

Isolation and sequencing of transposon insertion sites.Southern blots containing genomic digests (BglII for thestrain containing fll or XmaI for the strains containing Q2,M3, Q5, and O16) were hybridized with Tn5O96 DNA. Theregions of the genomic digests which hybridized were iso-lated from a second gel. These DNA fragments were puri-fied, ligated into BamHI- or XmaI-digested pUC19, andtransformed into E. coli. Amr cells, which contained thetransposon and the adjacent genomic DNA, were selected.DNA sequencing of the insertion sites was performed on

both strands by the method of Sanger et al. (23) by usingTaqTrack sequencing systems (Promega) on double-stranded DNA templates (8). The outward primers for end Iand end II of the transposons were 5'TGAGCTTCGAGCGCAAC and 5'CTCCGTTGCTCGACCAC, respectively. Prim-ers for generation of the reverse-strand sequence weredesigned by complementing the sequence determined withthe outward primers. The 3' ends of the 17-bp reverse-strandprimers annealed to the DNA 60 to 100 bp from the insertionsite of the transposon.Lankacidin production and auxotrophy. S. griseofuscus

strains were patched onto B agar, and the production of theantibiotic lankacidin was assayed after 3 days of growth at29°C. A 5-mm plug of mycelia was placed on a plate of TYagar overlaid with 3 ml ofTY soft agar inoculated with 25 ,ulof an overnight culture of Micrococcus luteus. Lankacidinproduction was indicated by a zone of inhibition of growth ofthe M. luteus.Auxotrophic mutants were identified by a lack of growth

on CDA agar and were further characterized for nutritionalrequirements.

RESULTS

Construction of IS493 derivatives. Transposons Tn5O96and TnSO97 were constructed by inserting an Amr gene,aac(3)IV, in either orientation into the StyI site between twoopen reading frames in the insertion element IS493 (Fig. 2).TnSO98 was constructed by inserting the tylJ and tyIF genesbetween the EcoRl and BamHI sites on Tn5O96 (Fig. 2).

Construction of vectors. Several transposon delivery vec-tors were constructed (Fig. 1A). Plasmids pCZA156 andpCZA157 were pUC19-based vectors that cannot replicate inStreptomyces spp. Plasmid pCZA163, also a pUC19 deriva-tive, contained linkers flanking the transposon. The bifunc-tional plasmid pCZA159, a derivative of pHJL401, wasunstable in Streptomyces spp. in the absence of selection.The bifunctional plasmids pCZA168 and pCZA172, deriva-tives of pGM160, were temperature sensitive for replicationin Streptomyces spp. above 34°C.

Transposition of IS493 derivatives. IS493 derivatives trans-posed from several different delivery vectors into manylocations in the S. griseofuscus chromosome (Fig. 3).Tn5O96 and Tn5O97 transposed from the nonreplicatingvectors, pCZA163 and pCZA157, at a frequency of about 1transposition per ,ug of DNA when introduced into S.griseofuscus protoplasts.TnSO96 transpositions from the unstable vector,

pCZA159, were isolated after two rounds of sporulation inthe absence of selection. Transpositions into different loca-tions in the S. griseofuscus genome were observed, butcultures containing identical insertions were often present.The locations of the transposons in cultures containing the

FIG. 4. Amr sectors of growth containing transpositions ofTnWO96. S. griseofuscus containing pCZA168 was grown for 2 daysat 29°C on B agar containing apramycin at 25 ,ug/ml and then grownfor 10 days at 39°C, a nonpermissive temperature for plasmidpCZA168 replication.

same insertion differed from experiment to experiment,suggesting that these cultures represented siblings ratherthan independent insertions into a hot spot.Tn5O96 and Tn5O98 also transposed from the temperature-

sensitive plasmids pCZA168 and pCZA172, respectively. Aswith plasmid pCZA159, cultures containing the same inser-tion were evident when transpositions were isolated by usingcured spores.The generation of Amr sectors of growth at 39°C was used

to isolate a large number of independent transpositionevents. The formation of sectors from the colonies appeareddependent on the degree of colony crowding and the age ofthe colonies. Sectors were most abundant on plates contain-ing 20 to 100 colonies that were grown 2 to 3 days at 29°Cbefore being shifted to 39°C. After 10 to 14 days at 39°C,usually one or two sectors per colony were evident (Fig. 4).Approximately 95% of the sectors picked were Amr Tss.Although the majority of Amr Tss isolates obtained by

using either plasmid pCZA159 or plasmid pCZA168 con-tained transpositions, a small percentage of these containedplasmid sequences integrated into the chromosome. In thesecases, multiple bands hybridized to plasmid or transposon

0.

J. BACTERIOL.

..fflml

-qww".


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


AATCGGTGTCAATGAGCGTTTTT GAAAACGCTCAATGGATAACTGA...

GGTTGTCGACACTGAGCGTTTTT GAAAACGCTCACTAAGTCGGGCA...

CTTCCAGACCACTGAGCGTTTTT GAAAACGCTCACTCTGTCCAAGT...

CGGTTAAGGCACTGAGCGTTTTT......GAAAACGCTCACTGCATTAACGG...

ATCGCTAGTCAGTGAGCGTTTTT......GAAAACGCTCAGTGGCCTGAAGA...

4 - lS493 (1.6 kb) or derivative (3.0 kb)End I End II

G+C(%)

50 ...CACCGCAGCGAAAAATCGGTGTCAATGGATAACTGACACATGGTGGCGAT.

64 ...CCAATCCGCGACAGGTTGTCGACACTAAGTCGGGCAGGGGCGTGCAGCCT72 ...GCCCGCCGGCGAGCTTCCAGACCACTCTGTCCAAGTTCGCCGCGCTCGGC..

58 ...GCCCAGCCACGGCCGGTTAAGGCACTGCATTAACGGTTTTCCAATTGCCG...

50 ...TGTGGGGAAAGTTATCGCTAGTCAGTGGCCTGAAGAGACGTTTGGCTGAT...

Pu CANTg Py

FIG. 5. Transposon insertion sites. (A) Sequence of transposable element and host DNA junctions. Boxed sequences indicate probableduplicated host DNA. IS493 insertion into the c1857 gene was previously described (28). (B) Host sequences containing target sites. Targetsites were deduced from sequences in panel A. The moles percent G+C was determined for the 50-bp regions shown. The target siteconsensus sequence is identified by solid arrows. Nearby positions containing only pyrimidines (Py) or purines (Pu) are noted by dashedarrows. Bases common to the c1857 insertion and the Q3 and Q16 insertions are underlined. Host sequences are shown with respect to anend I-to-end II orientation of insertion of the elements. Comparison of the complementary strands of host DNA to the sequences in the figuredid not show any additional target site similarities.

DNA probes, indicating complex and variable rearrange-ments.

Twenty-five transpositions of Tn5096 in S. griseofuscushave been compared by Southern hybridization of BamHIgenomic digests. Of these insertions, 24 were into differentlocations. However, one transposition of TnS096 frompCZA159, Q3, and one transposition of TnSO96 frompCZA168, Q16, inserted into the same location in the S.griseofuscus genome on the basis of sequence data ofapproximately 100 bp in both directions from the target sites(partial data shown in Fig. 5) and Southern hybridizations ofboth BamHI and SspI genomic digests (Fig. 3 and 6D).

Analysis of insertions by pulsed-field gel electrophoresis.Pulsed-field gel electrophoresis analysis indicated that thetransposons inserted into locations throughout the S. griseo-fuscus chromosome and into two linear plasmids. Electro-phoresis of uncut genomic DNA and Southern hybridizationwith TnS096 DNA showed that Tn5096 had inserted intoplasmids in strains containing insertions Q19, M18, 20, andQ121 (Fig. 6A and B). SspI digests of the genomic DNA of thestrains containing the transpositions gave at least 27 bands,including the linear plasmids which were not cut by SspI(Fig. 6C and D). Tabulation of the TnSO96 insertions indi-cated that 15 randomly picked transpositions (f1 thoughQ16 [excluding Q6, a sibling of (13]) occurred in 10 of 27bands. Five additional insertions, (17 through 121, were instrains picked because they had an identifiable phenotype.When all 20 transpositions were considered, 12 bands con-tained insertions (Table 2). Southern hybridization to partialSspI digests showed the same hybridizing pattern for theinsertions in a particular band, ruling out the possibility thatsome insertions were in different fragments of a doublet. Thetotal genome size was estimated to be 6,400 to 7,500 kb,depending on the nature of the more intense bands.

Linear plasmids. S. griseofuscus contained plasmids mi-grating at 200 and 65 kb, which we have named pSGF2 and

pSGF3, respectively. The plasmid migrating at 200 kb hasbeen observed previously (10). The plasmids appeared to belinear on the basis of their pulse-dependent migration in gelson which pulses of 25 and 60 s and 10 min were used.Circular plasmids exhibit pulse-independent migration (11).In addition, the sum of the sizes of hybridizing fragments inBamHI genomic digests equaled approximately 65 kb whenthe DNA was probed with pSGF3 and approximately 90 kbwhen the DNA was probed with pSGF2. However, some ofthe latter bands appeared to be doublets or triplets, and thesewere not added to the total. Insertions in pSGF2 ((118) andpSGF3 (Q19) were observed. Insertions in plasmids pCZA190and pCZA191 (120 and 121), which were uncharacterized invivo derivatives of pSGF2, were also observed.

Analysis of target sites. Host DNA flanking insertions ofIS493 (28), Tn5096, and TnS097 was sequenced. Three basepairs of host DNA probably was duplicated on insertion(Fig. 5A). End I of the transposable elements contained aterminal G. End II probably contained a terminal C (seeDiscussion). On the basis of six insertions, the target siteconsensus sequence was CANTg (Fig. SB).The DNA for 25 bp on either side of the insertion sites

ranged from 50 to 72% G+C. Two of the insertions into theS. griseofuscus genome (Q1 and (2) appeared to be protein-coding regions on the basis of the distribution of G+Ccontent in positions 1, 2, and 3 of putative codons. (Strep-tomyces genes have an average of 70, 50, and 91% G+C inpositions 1, 2, and 3 of the codons, respectively [2, 25].)

Lankacidin production, auxotrophy, and sporulation. Ap-proximately 130 sectors of growth containing transpositionsof TnS096 were generated by using pCZA168. Three lanka-cidin-nonproducing strains (Lan-) and one auxotroph(Phe-) were found. The three Lan- strains, PS24, PS25, andPS26, showed changes in plasmid profiles. PS24, containingthe (19 insertion, lacked autonomous pSGF2 (althoughsome pSGF2 sequences remained in the genome) and con-

A. Insertion

tS3, Q 16U 1Q2

C1857::1S493

B. Insertion

Q3, Q16

S 2US1Qc5c1857::1S493

VOL. 173, 1991


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


Y 6 ' 94 40 .31 1 1314 1611123B.

Kb

560) -440 -

13 31 '41 1 171)B*4 :Sh.iu f.J. A ~ 13.9 1 j, I 2 1 14 3 ,:

M82 4ku P a,_ w; p EL '-- i4mw 4*Mm mao.*.pW44 w -- w .

330 -

270 -

20C-

0

Lair~~~P Fl [D V'2 :-Y' L. 1 2 3 J4 5 6 7 8 9 10 1112 1314 1516 17 18 192021222324 ¢;

Kb560-

440

330-

270-200-194-

145-97-48_36 _.-21-14`10

4.7_4.0o

..D. 2 3i 4 5 6 7 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24A4 Aa.

FIG. 6. Analysis of transposition by pulsed-field gel electrophoresis. (A) Uncut DNA. (B) Southern hybridization of uncut DNA withTn5096 DNA. (C) SspI-digested DNA. (D) Southern hybridization of SspI-digested DNA with Tn5O96 DNA. Gels were run by using a 25-spulse and 170 V for 24 h. Lanes 1 through 21 contain DNA from strains containing the corresponding insertion number (Q). Lanes 22 through24 contain DNA from strains PS27, PS28, and PS29 which contain Tn5O96 and plasmid sequences. Ad, adenovirus (type 2) DNA digested withBamHI and EcoRI; Y, yeast chromosomes; L, lambda DNA ladder; P, transposon inserted into a plasmid; W, sporulation-deficient strain;B, bald strain lacking aerial mycelium; wt, S. griseofuscus C581 wild-type strain.

tained TnSO96 inserted in band A. PS25 and PS26, containingthe Q20 and Q21 insertions, lacked pSGF3 and containedTn5O96 insertions in the pSGF2 derivatives, pCZA190 andpCZA191. Approximately 2,500 sectors containing transpo-sitions were generated by using pCZA172. Four auxotrophs(Pro-, Thi-, MetB-, and MetB-) were identified among thestrains containing TnSO98. The MetB- cultures may containidentical transpositions on the basis of Southern hybridiza-tions ofBamHI genomic digests. The characterized auxotro-phies occurred at a frequency of about 0.2%.

Several sporulation-defective mutants were observed, andtwo were analyzed by Southern hybridization. PS23 con-tained an insertion, Q18, in pSGF2. PS18 contained aninsertion, Q12, in band Q and was deleted for bands D and P,which represent about 574 kb of DNA. PS18 was alsodeleted for about 180 kb of band A, as were all strainscontaining insertions fQll through Q24 (Fig. 5C). These

strains were derived from the same primary transformantcontaining pCZA168 and, except for PS18, had no apparentphenotypic change from the wild type.

DISCUSSION

IS493 was used to construct transposons functional in S.griseofuscus. A TnS096 derivative, TnS098, containing tylFand tylJ genes inserted adjacent to the Amr gene, transposedin S. griseofuscus, suggesting that IS493-based transposonsmight be generally useful to insert heterologous DNA intoStreptomyces genomes. Cultures containing transpositionswere most efficiently isolated by using a temperature-sensi-tive plasmid as a delivery vehicle.

Pulsed-field gel electrophoresis and Southern hybridiza-tion of uncut and SspI-digested S. griseofuscus genomicDNA showed that TnSO96 transposed into different regions

A.

Kb

.:,;GO.... ;} _,,

C.

Kb

;- 4 {}-

)4.(0-

194-

9 748\-

:36t241$

J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

TRANSPOSITION OF Tn5O96 IN S. GRISEOFUSCUS 1103

TABLE 2. Distribution of transposition events in theS. griseofuscus genome

SspI band Size (kb)' Transpositionsb

A 980 (800C) fiQ0, Q19B 605C 450D 440E 424 D7F 393 M17Gd 379 P4, £11, M14H 327I 285J 252 Q5Kd 233 £13, M13, Q16Ld 211M 200 Q1lMie 200 M18, 20, 21Nd 1750 150P 134Qd 109 XR 97 M15S 81T 65T'f 65 Q19U 48V 42 02, QW 36X 30Y 24

a Fragment sizes were determined from pulsed-field gels by using a pulsetime of 25 or 60 s.

b Underlined transposition events were picked randomly.c Band A is 800 kb for cultures containing insertions £ll1 through Q21.d Band appears more intense and may be doublets.e pSGF2.f pSGF3.

of the chromosome and into two linear plasmids. Thetranspositions may have some insertion site bias, since theSspI bands G and K each appeared to have three hits, and asmall band of 42 kb, V, had two hits. The insertions infragment G and V were at different sites. However, the £3and £16 insertions were at the same site in fragment K,although the £13 insertion was different. Overall, for 25strains containing transpositions (Table 1) that were com-pared by using conventional or pulsed-field gel electropho-resis, insertions into 24 different locations were observed.DNA sequencing showed that the target for insertion was

CANTg, in which C, A, and T were invariant and the g wasobserved in four of six cases. The central position had C inthree of six cases but had A in the identical £3 and £16insertions. Thus, the tendency for C in the central positionmay be a reflection of the overall high G+C content instreptomycete DNA rather than a target preference. Otherfeatures that may be significant for target specificity werepurines at the position 2 bp upstream and pyrimidines at theposition 3 bp downstream from the CANTg target site. Withonly 3 bases apparently strongly preferred at the target site,IS493 derivatives should be able to insert into many loca-tions in streptomycete genomes.DNA sequence analysis of the host DNA flanking the

insertion sites suggested a possible preference for regionscontaining lower G+C content than the average 70% ob-served in streptomycetes. The apparent hot spot defined by£3 and £16 may be a reflection of the 50% G+C content inthese regions. However, TnSO96 inserted into a 72% G+C

region in £2 and a 64% G+C region in £1, which bothappeared to be in protein-coding regions typical for strepto-mycetes. Thus, the utility of IS493-derived transposons isclearly not limited to AT-rich regions of DNA outside ofstructural genes.

Analysis of the host DNA and transposable elementjunctions suggests that IS493-type elements duplicated theinternal 3 bp of the 5-bp target sequence on insertion. Fromthe insertions sequenced (Fig. 5), it is apparent that the G atthe terminus of end I is part of the transposon. A 4-bpduplication cannot be ruled out, but this would occur only ifthe C at the terminus of end II were not part of the element.It is not apparent from these insertions if the C is part of thetransposon or duplicated host DNA, but it is likely that theC is part of the inverted repeat of the transposon. A 1- or2-bp duplication also cannot be ruled out.

Pulsed-field gel electrophoresis of uncut or SspI-digestedgenomic DNA illustrated the genomic instability commonfor Streptomyces spp. (3, 16). Strains containing the inser-tions £111 through 121 were all progeny of a single S.griseofuscus cell transformed with pCZA168. These strainswere deleted for 180 kb of DNA from fragment A comparedwith the wild type and, except for PS18, showed no apparentdifferences in colony morphology and were prototrophic.PS18 containing £12 lost an additional approximately 574kb, because band D and band P were also missing. Thisstrain was sporulation deficient. It is not known if thedeletion(s) in this strain is associated with the transpositionevent which occurred in band Q.Three lankacidin-nonproducing strains, PS24, PS25, and

PS26, were found among the 130 transposon-containingstrains tested. Deletions in pSGF2 were a feature common tothese three strains, suggesting that this plasmid may playsome role in the biosynthesis of lankacidin. It is not knownif the transpositions in these strains led to the plasmidinstability or if the insertions themselves resulted in loss oflankacidin production.Auxotrophy occurred at a frequency of about 0.2% among

cultures containing transpositions. For the five auxotrophsidentified, four phenotypes were observed (Phe-, Pro-,Thi-, and MetB-). The MetB- auxotrophies occurred intwo independent isolates and appeared to be the result oftranspositions into the same site. Thus, the gene involvedmay contain a favored site of insertion that occurred in 2 ofca. 2,600 transpositions.

In summary, our data suggest that IS493-based trans-posons insert into many locations with relatively low inser-tion site specificity and thus may be useful for many appli-cations in S. griseofuscus. We have recently shown thatTnSO96 transposes in Streptomyces thermotolerans, Strep-tomyces ambofaciens, S. coelicolor, and the tylosin-produc-ing S. fradiae (28a), suggesting that it may have broad utilityin streptomycetes.

ACKNOWLEDGMENTSWe thank C. L. Hershberger, B. E. Schoner, R. Stanzak, and W.

Wohlleben for providing plasmids; T. Bennett, S. G. Burgett, M.Bruns, B. Glover, and I. Jenkins for technical assistance; C. L.Hershberger, D. A. Hopwood, and P. L. Skatrud for suggestionsregarding pulsed-field gels; and S. R. Jaskunas for critical reading ofthe manuscript.

REFERENCES1. Berg, C. M., D. E. Berg, and E. A. Groisman. 1989. Transpos-

able elements and the genetic engineering of bacteria, p. 879-925. In D. E. Berg and M. M. Howe (ed.), Mobile DNA.American Society for Microbiology, Washington, D.C.

VOL. 173, 1991


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

1104 SOLENBERG AND BALZ B

2. Bibb, M. J., P. R. Findlay, and M. W. Johnson. 1984. Therelationship between base composition and codon usage inbacterial genes and its use for the simple and reliable identifi-cation of protein-coding sequences. Gene 30:157-166.

3. Birch, A., A. Hausler, and R. Hutter. 1990. Genome rearrange-ments and genetic instability in Streptomyces spp. J. Bacteriol.172:4138-4142.

4. Bruton, C. J., and K. F. Chater. 1987. Nucleotide sequence ofISI10, an insertion sequence of Streptomyces coelicolor A3(2).Nucleic Acids Res. 15:7053-7065.

5. Chater, K. F., C. J. Bruton, S. G. Foster, and I. Tobek. 1985.Phy. ical and ger tic analysis of ISI10, a transposable elementof S.reptomyces coelicolor A3(2). Mol. Gen. C-enet. 200:235-239.

6. Chung, S.-T. 1987. Tn4556, a 6.8-kilobase-pair transposableelement of Streptomyces fradiae. J. Bacteriol. 169:4436-4441.

7. Cox, K. L., and R. H. Baltz. 1984. Restriction of bacteriophageplaque formation in Streptomyces spp. J. Bacteriol. 159:499-504.

8. Del Sal, G., G. Manfioletti, and C. Schneider. 1989. Th, 'TAB-DNA precipitation method: a common mini-scale prepa. "ion oftemplate DNA from phagemids, phages or plasmids suitable forsequencing. Biotechniques 7:514-520.

9. Hausler, A., A; Birch, W. Krek, J. Piret, and R. Hutter. 1989.Heterogeneous genomic amplification in Streptomycesglaucescens: structure, location andjunction sequence analysis.Mol. Gen. Genet. 217:437-446.

9a.Hershberger, C. L. Unpublished data.10. Hershberger, C. L., B. Arnold, J. Larson, P. Skatrud, P.

Reynolds, P. Szoke, P. R. Rosteck, Jr., J. Swartling, and D.McGilvray. 1989. Role of plasmids in the biosynthesis of mac-rolide and polyketide antibiotics, p. 147-155. In C. L. Hersh-berger, S. W. Queener, and G. Hegeman (ed.), Genetics andmolecular biology of industrial microorganisms. American So-ciety for Microbiology, Washington, D.C.

11. Hightower, R. C., D. W. Metge, and D. V. Santi. 1987. Plasmidmigration using orthogonal-field-alternation gel electrophoresis.Nucleic Acids Res. 15:8387-8398.

12. Hopwood, D. A., M. J. Bibb, K. F. Chater, T. Kieser, C. J.Bruton, H. M. Kieser, D. J. Lydiate, C. P. Smith, J. M. Ward,and H. Schrempf. 1985. Genetic manipulation of Streptomyces:a laboratory manual. The John Innes Foundation, Norwich,England.

13. Kaster, K. R. S. G. Burgett, R. N. Rao, and T. D. Ingolia. 1983.Analysis of a bacterial hygromycin B resistance gene by tran-scriptional and translational fusion and by DNA sequencing.Nucleic Acids Res. 11:6895-6911.

13a.Kieser, H. M., and D. A. Hopwood. Personal communication.14. Kleckner, N., J. Roth, and D. Botstein. 1977. Genetic engineer-

ing in vivo using translocatable drug-resistance elements. J.Mol. Biol. 116:125-159.

15. Larson, J. L., and C. L. Hershberger. 1986. The minimalreplicon of a Streptomycete plasmid produces an ultrnhigh levelof plasmid DNA. Plasmid 15:199-209.

16. Leblond, P., P. Demuyter, J. M. Simonet, and B. Decaris. 1990.

Genetic instability and hypervariability in Streptomyces ambo-faciens: towards an understanding of a mechanism of genomeplasticity. Mol. Microbiol. 4:707-714.

17. Lydiate, D. J.; A. M. Ashby, D. J. Henderson, H. M. Kieser, andD. A. Hopwood. 1989. Physical and genetic characterization ofchromosomal copies of the Streptomyces coelicolor mini-circle.J. Gen. Microbiol. 135:941-955.

18. Lydiate, D. J., H. Ikeda, and D. A. Hopwood. 1986. A 2.6 kbDNA sequence of Streptomyces coelicolor A3(2) which func-tions as a transposable element. Mol. Gen. Genet. 203:79-88.

19. Muth, G., B. Nussbaumer, W Wohileben, and A. Puihler. 1989.A vector system with temper.ure-sensitive replication for genedisruption and mutational cloning in streptomycetes. Mol. Gen.Genet. 219:341-348.

20. Olson, E. R., and S.-T. Chung. 1988. Transposon Tn4556 ofStreptomyces fradiae: nucleotide sequence of the ends and thetarget sites. J. Bacteriol. 170:1955-1957.

21. Rao, R. N., M. A. Richardson, and S. Kuhstoss. 1987. Cosmidshuttle vectors for cloning and analysis of Streptomyces DNA.Methods Enzymol. 153:166-198.

22. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, New York.

23. Sanger, F., S. Nicklen, and A. B. Coulson. 1977. DNA sequenc-ing with chain-terminating inhibitors. Proc. Natl. Acad. Sci.USA 74:5463-5467.

23a.Schoner, B. E., and R. Stanzak. Unpublished data.24. Schwartz, D. C., and C. R. Cantor. 1984. Separation of yeast

chromosomal-sized DNA's by pulsed field gradient gel electro-phoresis. Cell 37:67-75.

25. Seno, E. T., and R. H. Baltz. 1989. Structural organization andregulation of antibiotic biosynthesis and resistance genes inactinomycetes, p. 1-48. In S. Shapiro (ed.), Regulation ofsecondary metabolism in actinomycetes. CRC Press, BocaRaton, Florida.

26. Siemieniak, D., J. L. Slightom, and S.-T. Chung. 1990. Nucleo-tide sequence of Streptomyces fradiae transposable elementTn4556: a class II transposon related to Tn3. Gene 86:1-9.

27. Skatrud, P. L., and S. W. Queener. 1989. An electrophoreticmolecular karyotype for an industrial strain of Cephalosporiumacremonium. Gene 78:331-338.

28. Solenberg, P. J., and S. G. Burgett. 1989. Method for selectionof transposable DNA and characterization of a new insertionsequence, IS493, from Streptomyces lividans. J. Bacteriol.171:4807-4813.

28a.Solenberg, P. J., M. A. McHenney, and R. H. Baltz. Unpub-lished data.

29. Waksman, S. A. 1961. The Actinomycetes, vol. II. Classifica-tion, identification and description of genera and species, p.328-334. The Williams & Wilkins Co., Baltimore.

30. Yagi, Y. 1990. Transposition of Tn4560 in Streptomyces aver-mitilis. J. Antibiot. 43:1204-1205.

31. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. ImprovedM13 phage cloning vectors and host strains: nucleotide se-quences of the M13mpl8 and pUC19 vectors. Gene 33:103-119.

J. BACTERIOL.


http://jb.asm.org/

Dow

nloaded from
http://jb.asm.org/

transposition of tn5096 and other is493 derivatives in … · vol. 173, no. 3 transposition...

Documents