understandingthepolymerizationmechanismof … glycoside-hydrolasefamily70glucansucrases*...

Understanding the Polymerization Mechanism ofGlycoside-Hydrolase Family 70 Glucansucrases*

Received for publication, May 19, 2006, and in revised form, July 24, 2006 Published, JBC Papers in Press, July 24, 2006, DOI 10.1074/jbc.M604850200

Claire Moulis, Gilles Joucla, David Harrison, Emeline Fabre, Gabrielle Potocki-Veronese, Pierre Monsan,and Magali Remaud-Simeon1

From the Laboratoire de Biotechnologies-Bioprocedes, UMR CNRS 5504, UMR INRA 792, INSA, 135 avenue de Rangueil,31077 Toulouse Cedex 4, France

Glucan formation catalyzed by two GH-family 70 enzymes,Leuconostoc mesenteroides NRRL B-512F dextransucrase andL. mesenteroides NRRL B-1355 alternansucrase, was investi-gated by combining biochemical and kinetic characterization ofthe recombinant enzymes and their respective products. UsingHPAEC analysis, we showed that two molecules act as initiatorof polymerization: sucrose itself and glucose produced byhydrolysis, the latter being preferred when produced in suffi-cient amounts. Then, elongation occurs by transfer of the glu-cosyl residue coming from sucrose to the non-reducing end ofinitially formed products. Dextransucrase preferentially pro-duces an isomaltooligosaccharide series, whose concentration isalways low because of the high ability of these products to beelongated and form high molecular weight dextran. Comparedwith dextransucrase, alternansucrase has a broader specificity.It produces a myriad of oligosaccharides with various �-1,3and/or �-1,6 links in early reaction stages. Only some of themare further elongated.Overall alternanpolymer is smaller in sizethan dextran. In dextransucrase, the A repeats often found inC-terminal domain of GH family 70 were found to play a majorrole in efficient dextran elongation. Their truncation result inan enzyme much less efficient to catalyze high molecularweight polymer formation. It is thus proposed that, in dex-transucrase, the A repeats define anchoring zones for thegrowing chains, favoring their elongation. Based on theseresults, a semi-processive mechanism involving only oneactive site and an elongation by the non-reducing end is pro-posed for the GH-family 70 glucansucrases.

Glucansucrases from Glycoside-Hydrolase (GH)2-family 70(EC. 2.4.1.5) are extracellular enzymes produced by lactic acidbacteria of the genus Leuconostoc, Streptococcus, or Lactobacil-lus (1). From sucrose, they catalyze the synthesis of highmolec-ular weight glucans. They can also produce oligosaccharides orglucoconjugates by a transglucosylation reaction from thesucrose donor to an exogenous acceptor, and this so called“acceptor reaction” occurs at the cost of polymer synthesis (2,

3). An interesting diversity exists in the GH-family 70, wherethere are enzymes able to synthesize all the types of glucosidiclinkages, namely �-1,2; �-1,3; �-1,4; or �-1,6 glucosidic bonds.So, depending on the enzyme specificity, a wide range of glu-cans can be produced, varying in terms of size, structure, degreeof branches and spatial arrangements.Primary structures of at least 44 different glucansucrases are

now available in GH-family 70.3 With an average predictedmolecular mass of more than 160,000 Da, they all show thesame organization consisting of a variable region at the N ter-minus, a conserved catalytic domain, and a C-terminal domaintypically containing a series of homologous repeating units. In anumber of streptococcal glucansucrases, as well as for theL. mesenteroides NRRL B-512F dextransucrase, the repeatshave been demonstrated to play a role in enzyme glucan bind-ing. For this reason, this domain is also often called “glucanbinding domain” (5). In addition, these repeated units aresometimes found in the variable region, especially for Lactoba-cilli glucansucrases (6). The catalytic domain is predicted to beorganized in a (�/�)8-barrel resembling that of enzymes fromGH-family 13 (the �-amylase family); however probably circu-larly permuted (7). Both families belong to the same clan,named GH-H (4). Notably, some glucansucrases are alsoencountered in the GH-family 13, namely the amylosucrasefrom Neisseria polysaccharea (AS) (8) and that of Deinococcusradiodurans (DRAS) (9). They are shorter than GH-family 70glucansucrases and both synthesize amylose from sucrose, dis-playing a narrow specificity toward�-1,4 linkage synthesis. Thethree-dimensional structure ofN. polysacchareaASwas solved(10), allowing a better understanding of polymer formation bythis enzyme. The first step consists of the formation of a cova-lent glucosyl-enzyme intermediate (8, 11), involving a triad ofcatalytic residues conserved in all GH-family 13 enzymes: Asp-286 (AS numbering) acts as nucleophile, Glu-328 as generalacid/base catalyst (proton donor) and Asp-393 as a stabilizer ofthe glucosyl intermediate (8, 12). It was also demonstrated thatpolymer elongation occurred following a non-processive, ormultichain, process, by addition of the glucosyl units at thenon-reducing end of acceptor molecules (9, 13, 14).However, contrary to the mechanism of amylose formation

by amylosucrases, polymer formation by GH-family 70enzymes is still not clearly elucidated. In the early fifties, anal-yses of the kinetics of polymer formation from sucrose showed

* The costs of publication of this article were defrayed in part by the paymentof page charges. This article must therefore be hereby marked “advertise-ment” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1 To whom correspondence should be addressed. Tel.: 33-561-55-94-46; Fax:33-561-55-94-00; E-mail: [email protected].

2 The abbreviations used are: GH, Glycoside-Hydrolase; DSR-S, L. mesen-teroides NRRL B-512F dextransucrase; IMW, intermediate molecular weightpolymer; HMW, high molecular weight polymer; LMW, low molecularweight polymer.

3 Coutinho, P. M., and Henrissat, B. (1999) Carbohydrate-Active Enzymesserver.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 281, NO. 42, pp. 31254 –31267, October 20, 2006© 2006 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

31254 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 281 • NUMBER 42 • OCTOBER 20, 2006

by guest on May 24, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

that a high molecular weight polymer was formed very early,without release of detectable oligosaccharides of intermediatesize (15). A single chain, primer-dependentmechanismof elon-gation was proposed for dextran elongation, as it was generallyaccepted for polysaccharide biosynthesis at this period (2, 16,17). Working with the L. mesenteroidesNRRL B-512F dextran-sucrase (DSR-S), Tsuchiya et al. (16) proposed thus that inabsence of exogenous co-substrate, impurities in the crude dex-transucrase preparation or sucrose itself could act in the role ofprimer. Cheetham et al. (18) identified sucrose at the end of thedextran produced by the S. sobrinus glucansucrase GTF-S3(18), but attempts to identify it in various other glucan extrem-ities failed. Thus, from pulse/chase experiments using radiola-beled sucrose and immobilized dextransucrase, a different sin-gle chain mechanism was proposed by Robyt et al. (19). Itinvolved two nucleophilic active sites able to form glucosyl andglucanosyl covalent enzyme intermediates, and polymer syn-thesis was suggested to occur by the insertion of glucosyl resi-dues at the reducing end of the glucanosyl-enzyme intermedi-ate. Their work first performed on DSR-S was later confirmedfor glucansucrases from S. mutans and S. sanguis (20, 21).However, Mooser et al. (22, 23) trapped only one covalent

glucosyl enzyme intermediate from a quenched reaction ofS. sobrinus glucansucrase and radiolabeled sucrose, indicatingthat only one active site would be present. Sequence compari-sons betweenGH-families 70 and 13 enzymes enabled the iden-tification of only one catalytic triad composed of two asparticacids and one glutamic acid, similar to that of amylosucrases.Thus, Asp-551 (in DSR-S sequence) was proposed to act asnucleophile, Glu-589 as the acid-base catalyst and Asp-662 toassist the glucosyl-enzyme formation (7). These residues arestrictly conserved for all the GH-family 70 glucansucrases ofknown primary structure to date, and their mutation leads toinactive enzymes (24–26). In addition, no other putative activesites were identified from sequence analyses (7, 25). For a betterunderstanding, these two mechanisms are shown in Fig. 1.Regarding the acceptor reaction, since the pioneer work of

Koepsell et al. (2), all researchers agree with a multichain elon-gation mechanism, occurring by successive transfer of glucosylresidues at the non reducing end of the acceptor (in the case ofglucose, maltose, or isomaltose, for instance), and producingoligosaccharide series to the detriment of polymer formation(27). Awide range of exogenousmolecules can act this acceptorrole. Notably, water and fructose were also described to acceptthe glucosyl residue, resulting in sucrose hydrolysis, neo-syn-thesis of a sucrose molecule (“isotopic exchange”) (28), or theproduction of sucrose isomers, like leucrose (D-glucopyranosyl-�-1,5 -D-fructopyranose) (29). Su and Robyt proposed that thesynthesis of oligosaccharides occurred through the participa-tion of a third catalytic nucleophile site, however this requiredthe participation of one of the two nucleophilic sites, which arenormally associated with the polysaccharide synthesis (30).However, mutation of Asp-551 in DSR-S abolished both poly-mer synthesis from sucrose, or oligosaccharide production bythe acceptor reaction (26).In summary, many researchers now agreed to the fact that an

elongation mechanism resembling that used by GH-family 13amylosucrases could be used to explain the acceptor reactions

occurring in GH-family 70 glucansucrases. On this basis, the denovo polymer synthesis from the non reducing end involvingonly one active site could be suggested, but was however neverdemonstrated. In particular, the initiator molecule, the senseand mode of elongation (single or multichain, also called pro-cessive or non-processive) are still questionable when lookingat the literature. The aim of our study was thus to re-investigatethe mode of de novo polymer formation from a detailed bio-chemical study of the kinetics of polymer synthesis, using sen-sitive analytical methods. Two models of study were chosen inthe GH-family 70: the most intensively studied dextransucraseto date, theDSR-S from L. mesenteroidesNRRLB-512F specificfor �-1,6 linkage formation, and the alternansucrase fromL. mesenteroidesNRRLB-1355 (ASR), which has the particular-ity to alternate �-1,6 and �-1,3 links. These two enzymes werechosen to highlight their common features, but the role of spe-cific sites of protein sequence divergences were also closelystudied, in respect to the polymerization process and the link-age specificity displayed.

MATERIALS AND METHODS

The enzyme constructs chosen for this study are theDSR-S vardel �4N and the ASR C-APY del. Both enzymesare variants of L. mesenteroides NRRL B-512F dextransu-crase (DSR-S) and L. mesenteroides NRRL B-1355 alternan-sucrase (ASR) truncated of part of the C-terminal domain.Some of them also show an additional N-terminal trunca-tion. The construction of these variants was undertaken toreduce the problems of glucansucrase degradation occurringduring heterologous enzyme expression by Escherichia coli.These two truncated variants have previously been shown todisplay the same behavior than the wild-type enzyme in termof specificity and products synthesized, and are thus consid-ered here as models of study (31, 32).

Bacterial Strains, DNA Manipulation, andMutant Constructions

The pBad/TOPO Thiofusion vector (Invitrogen) was usedfor cloning and expression of truncated ormutated dsrS and asrgenes, under the control of L-arabinose promoter. It permits thefusion of the gene to a His6 tag at the C-terminal end, and to athioredoxin tag at N-terminal extremity. To be used as tem-plate, genomic DNA was extracted from L. mesenteroidesNRRL B-512F and B-1355 using the Blood and Cell cultureDNA maxi kit (Qiagen). The strains were provided by theNCAUR stock culture collection in Peoria, IL. E. coliOne ShotTOP10 (Invitrogen) was used for expression of truncated ormutated dsrS and asr genes. Restriction enzymes were pur-chased from New England Biolabs and used according to themanufacturer’s instructions. DNA purification was per-formed using QIAquick (PCR purification and gel extrac-tion) and QIAprep (plasmid purification) from Qiagen.Dextransucrase Variants—Truncated DSR-S variants were

constructed by PCR amplification of the dsrS gene from L. mes-enteroidesNRRLB-512F genomicDNA (GenBankTMaccessionnumber I09598), using the Long ExpandHigh Fidelity polymer-ase (RocheApplied Science) and the following primers (given in5�3 3�, sense): 1) The DSR-S vardel �4N construct was previ-

Polymerization Mechanism of GH-family 70 Glucansucrases

OCTOBER 20, 2006 • VOLUME 281 • NUMBER 42 JOURNAL OF BIOLOGICAL CHEMISTRY 31255


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

ously described (31), and contains amino acids Thr-152 to Ser-1450. 2) The DSR-S vardel �2 was constructed using PbadDSR-S vardel: 454acacaacaagttagcggcaagtacgttgaaaaagac490 andPbad �2: 4194ctgatttgtgatcaaatttcctgtgttatc4164. The proteincontains the DSR-S amino acids Thr-152 to Gln-1398. 3) TheDSR-S vardel�3 was constructed using Pbad DSR-S vardel andPbad �3: 4086cccgtctgcatcaatgaattcacc4062. The protein con-tains the DSR-S amino acids Thr-152 to Gly-1362. 4) TheDSR-S vardel Core was obtained using Pbad DSR-S vardel andPbad Core: 3489-gccagtttctgacagatcattagttaactg-3459. The

protein contains the DSR-S aminoacids Thr-152 to Gly-1162. 5) TheDSR-S Core �A was created usingPbad DSR-S cat: 843ggcttctctggtgt-gattgatggtcaa870 and Pbad Core.The protein contains the DSR-Samino acids Gly-282 to Gly-1162. 6)Site-directed mutations were per-formed in the Thio-DSR-S vardel�4N-His protein, using the “mega-primer” method (33) and the PfuDNA polymerase (Stratagene). Aninitial PCR reaction was carried outusing the Thio-DSRS vardel �4N-His plasmid template, one of themut primer (see below) and thehelper primer rev, 3447gtcaccatcct-cagtgttcgaaacg3422, including theBstBI site (underlined). The PCRproduct was then used as a reversemegaprimer in a second PCR,together with a forward primerlocated upstream of the SpeI site:forw, 1329caaccacagtggaatgaaac-tagtc1354. This product was thendigested by BstBI and SpeI asdescribed by the enzyme suppliers(New England Biolabs) and clonedinto the Thio-DSRS vardel �4N-His. Themutprimerswere designedso as to introduce a new uniquerestriction site to select the positiveclones.Mut Primers—S663Y mutant

was constructed using 1965agctttgta-cgagctcacgactacgaagtgcaaacggtt2004(SacI site); S663Y:E664D:V665Awith 1965agctttgtacgagctcacgactacg-acgcgcaaacggtt2004 (SacI site);S663N:E664N:V665S with 1965agct-ttgtacgagctcacgacaacaactcgcaaacg-gtt2004 (SacI site); S663K:E664G:T667E:V668K:I669V with 1974cacg-aca-agggagtgcaagagaaagttgcccaaat-tgtttcagatctgtatcc2033 (BglII), andthe mutant N553F:V554I:D555H:A556N: L558T:L559I:I560R:S663K:E664G:T667E:V668K:I669V using

1654gatgactttatccataatgatacgatacaacgtgctgccgattatttcaagctagc1713(NheI) as the mut primer, and S663K:E664G:T667E:V668K:I669Vmutant as template for PCR reaction. Each constructionwas sequenced by Millegen SA, Toulouse, France. For sakeof clarification, these mutants will be named S663Y,SEV663YDA, SEV663NNS, SEVQTVI663KGVQEKV,respectively.Alternansucrase Variants—The ASR C-APY del was con-

structed by PCR amplification of the asr gene from L. mesen-teroides NRRL B-1355 genomic DNA (Genbank accession

FIGURE 1. Schematic representation of the two polymerization mechanisms of glucansucrases proposedin the literature. A, mechanism involving only one active site, as suggested by Mooser (47) and resemblingthat of �-retaining transglucosidases (4); B, mechanism involving two active sites, as proposed by Robyt et al. in1974 (19).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

number no. AJ250173), using the Long Expand High Fidelitypolymerase and the primers Bad dir (forward 5� to 3�) 1atggaa-caacaagaaacagttacccgt27 and Bad C-del 2 (reverse 5� to 3�)4275ccctcgagacatagtcccatcaacatttaagtg4243. The protein con-tains theASR amino acidsMet-1 toGly-1425. The site-directedY768S:D769E:A770V mutation was introduced by PCR usingthe ForAsrCat primer 1690ggaaataacagaaaactaggacgtcaacc1718(AatII), annealing upstream the region to be modified and thereverse primer RevAsr YDA768SEV 2324ctaattggatcctgaacttcg-gaatcatgtgc2293 (BamHI). The amplified product was then usedas megaprimer in combination with the RevAsrCat primer4288caaatttaaatagtcctcgagacatagtccc4258 (XhoI). The finalamplification product was then inserted in the [pBad asrC-APY-del] between the AatII and XhoI restriction sites. Themutantwill be namedYDA768SEV.All constructionswere ver-ified by DNA sequencing (Millegen SA, Toulouse, France).

Enzyme Extraction Methods

Dextransucrase Variants—E. coli TOP10 cells carrying therecombinant plasmids encoding dsrS variants were grownunder conditions optimized forDSR-S expression (31), at 23 °C,in aerated 2� YT medium supplemented with 100 mM Tris/HCl, pH 6.4 and 100 �g/ml ampicillin, and inducted with0.002% (w/v) of L-arabinose at 0.5 A600 nm. Cell growth andDSR-S production were monitored over 24 h after induction.For enzyme extraction, cells were harvested by centrifugation(8,000 � g, 10 min, 4 °C), resuspended and concentrated to anA600 nm of 80 in sodium acetate buffer 50mM, pH5.2 containing0.05 g/liter CaCl2 and 1 mM phenylmethylsulfonyl fluoride. Allpreparations were centrifuged to eliminate cell debris. Charac-terizations were performed on highly purified DSR-S vardel�4N as described before (31). For other DSR-S-truncated vari-ants, it was verified by activity Schiff-staining gel electrophore-sis that only the entire form was active (condition of Schiff-staining gel as described before (34)). No change of expressionlevels or degradationwas observed for site-directedmutants com-pared with DSR-S vardel �4N extracts on electrophoresis gel.Alternansucrase Variants—Bacterial cells were grown on LB

medium with 100 �g/ml of ampicillin. Induction was per-formed using 0.02% arabinose (w/v). Cells were harvested after19 h by centrifugation (4,500 � g, 10 min, 4 °C) and resus-pended to A600 nm of 80 in lysis buffer (20 mM sodium acetatebuffer pH 5.4, 1% Triton X-100, 1 mg/ml lysozyme, and 5mg/ml DnaseI) before sonication. The protein extractsobtainedwere centrifuged (27,000� g, 30min, 4 °C), to removecell debris. Electrophoresis analyses confirmed that site-di-rectedmutagenesis did not change the expression profiles com-pared with the wild-type.

Activity Assay

Activity was assayed using the dinitrosalicylic acid method(35). For dextransucrase variants, one unit is defined as theamount of enzyme that catalyzes the formation of 1 �mol offructose/min at 30 °C in 50 mM sodium acetate buffer pH 5.2,0.05 g/liter CaCl2 and 100 g/liter sucrose. For alternansucrasevariants, activity was determined in the same conditions exceptthat the buffer was replaced by a 20 mM sodium acetate bufferpH 5.4, without CaCl2.

Polymer Synthesis and Acceptor Reactions

With DSR-S variants, polymer syntheses were carried outwith 1 unit/ml of enzyme, at 25 °C in sodium acetate buffer 50mM, pH 5.2 supplemented with 0.05 g/liter CaCl2 and 290 mM

sucrose. Buffer was replaced by 20 mM sodium acetate pH 5.4(withoutCaCl2), and 1.6 units/mlwere used for alternansucrasevariants. Acceptor reactions were performed following thesame conditions, except that 145 mM maltose was added asacceptor. Complete sucrose depletion was monitored byHPAEC-PAD (see below), and reactions were stopped by 5minof incubation at 95 °C.

Glucan Analysis

Alternan—The high molecular weight polymer was precipi-tated by addition of 1 volume of ethanol, recovered by centrif-ugation and washed three times with water. The supernatantcontaining lowmolecularweight oligosaccharides (DP� 8)waspurified from mono and disaccharides by size exclusion chro-matography on Biogel P2 Gel Fine (Bio-Rad) column of 318 mlof resin, at a flow-rate of 0.5 ml/min. Samples were collectedevery 10 min, for 600 min of analysis. Purified alternan andoligosaccharides were freeze-dried before NMR and methyla-tion analysis. Alternan and oligosaccharides were dissolved at50 mg/ml in D2O. 13C NMR (75.468 MHz) analyses wererecorded on a Bruker Avance 300 spectrometer. Spectra wererecorded at 333 K, from 1.445 s acquisition time and 12,288scan accumulations. For two-dimensional NMR, HSQC, andHMBCwere registered on a Bruker-ARX 400 spectrometer, 1Hspectra were recorded at 400.130 MHz and 13C spectra at100.612 MHz, at 300 K in both case. For HSQC, 1.343 s acqui-sition time and 4 scans were accumulated, 0.852 s acquisitiontime and 8 scans, in case of HMBC.Glycosidic linkage composition was determined by methyla-

tion. The polymers and oligosaccharides were methylatedaccording to the modified procedure from Ciucanu and Kerek(36), hydrolyzed with 2 N trifluoroacetic acid at 110 °C for 2 h,reduced with NaBD4 10mg/ml in NH4OH/C2H5OH, (1:1, v/v),freshly prepared and peracetylated with acetic anhydride 1 h at110 °C. The alditol acetates were solubilized in cyclohexanebefore analysis by gas chromatography (GC) and gas chroma-tography coupled tomass spectrometry (GC-MS). GCwas per-formed on a Girdel series 30 equipped with an OV1 capillarycolumn (0.22 mm � 25 m), using helium at a flow rate of 2.5ml/min and with a flame ionization detector at 310 °C. Theinjector temperature was 260 °C and the temperature separa-tion program ranged from 100 to 290 °C with 3 °C/min speed.GC-MS analyses were performed on a Hewlett-Packard 5889Xmass spectrometer (electron energy, 70 eV)working in electronimpact coupledwithHewlett-Packard 5890 gas chromatographseries II fitted with a similar OV1 column (0.30 mm � 12 m).Dextran—Digestions by Chaetomium gracile endodextra-

nase (Sankyo Co.) were performed during 16 h at 37 °C with 3units of enzymeperml of polymer synthesismedium.Digestionproducts were analyzed by HPAEC-PAD in conditionsdescribed below.Digestions by Saccharomyces cerevisiae invertase (Fluka), a

�-fructofuranosidase, which catalyzes sucrose hydrolysis to




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

produce glucose and fructose, were performed during 15min at25 °C with 20 units of enzyme per ml of reaction medium read-justed at pH 4,5. Digestion products were also analyzed byHPAEC-PAD in conditions described below.

HPLC Analysis

Monosaccharide and oligosaccharide analyses were per-formed by HPAEC-PAD using a 4 � 250 mm Dionex Carbo-pack PA100 column.A gradient of sodiumacetate from6 to 300mM in 28 min in 150 mM NaOH was applied at 1 ml/min flowrate. Detection was performed using a Dionex ED40 modulewith a gold working electrode and an Ag/AgCl pH reference.Glucan molecular weights were determined by high-perfor-

mance size-exclusion chromatography (HPSEC). For dextrananalyses, two Shodex OH-Pack SB-805 and SB-802.5 columnswere maintained in series, using an eluent containing 0.45 M ofNaNO3 and 1% (v/v) of ethylene glycol at a flow rate of 0.3ml/min (31). Columns and guard column were maintained at70 °C, and samples were filtered through a 0.45 �m-pore sizefilter (Sartorius) before injection. Alternan analyses were per-formed using a Jordi DVD-glucose 1000A column (Altech), at aflow rate of 0.6 ml/min of water/Me2SO (80/20) (v/v), and col-umn was maintained at 50 °C. In both cases, calibration stand-ards used were commercial dextrans of 2,000, 530, 70, and 10kDa, isomaltotriose, sucrose, and fructose (Sigma).Glucose, fructose, and leucrose concentrations were deter-

mined by HPAEC-PAD analysis. The percentages of glucosylresidues coming from sucrose incorporated into free glucose(%Gglucose) and leucrose (%Gleucrose) were calculated by the for-mula in Equation 1,

%Gglucose ��glucosetf�

�sucroset0�, %Gleucrose �

�leucrosetf�

�sucroset0�(Eq. 1)

where [glucosetf ] and [leucrosetf ] correspond to the final con-centrations of glucose and leucrose (in mM) at the end of thereaction, and [sucroset0] to the initial substrate one (in mM).The percentage of glucosyl residues incorporated into high

molecular weight (HMW) polymer and dextrans of 10,000 Da(%Gdextran) were determined by HPSEC analysis following theformula in Equation 2,

%Gdextran �areadextran tf

areasucrose t0 � 162/342(Eq. 2)

where areadextran tf correspondsto the area of the dextran peakestimated on HPSEC chromato-gram at the end of reaction, andareasucrose t0 to that of sucrose atthe initial time. Indeed, for a givenconcentration, the area obtainedby refractometry is identical, what-ever the sugar is.The proportion of glucose incor-

porated into IMWpolymer or oligo-saccharides (%GIMW) for which theconcentration cannot be directlyquantified by HPAEC-PAD orHPSEC analyses is determined by

the formula in Equation 3.

%G IMW � 100 � %Gglucose � %Gleucrose � %Gdextran (Eq. 3)

RESULTS

To investigate the de novo polymer formation by glucansu-crases from GH-family 70, two models of study were chosen:the DSR-S vardel �4N and the ASR C-APY del. Both enzymeswere recently demonstrated to possess the same specificity andbehavior than the full-length enzymes, namely DSR-S fromL. mesenteroides NRRL B-512F (31) and ASR from L. mesen-teroides NRRL B-1355 (32). DSR-S vardel �4N displays a dex-transucrase specific for �-1,6 linkages of more than 95%, andASR C-APY del displays alternansucrase activity, capable ofproducing alternate �-1,6 and �-1,3 linkages in themain chain.

Polymerization Reaction with Dextransucrase

Characterization of the Products Synthesized from 290 mM

Sucrose—Products formed after complete sucrose depletionwere analyzed by HPSEC (Fig. 2A). Elution profile revealed thepresence of two main populations: a peak of HMW dextraneluted from35 to 45min and a second peak eluted from68 to 80min, corresponding principally to the fructose released. HMWdextran was previously estimated to be larger than 107 g/mol(i.e. a degree of polymerization (DP) superior to 61,700). Dex-trans of intermediate size (IMW)were also present, as indicatedby the perturbations of the base line between the two mainpeaks. Complementary analysis was performed on HPAEC-PAD, revealing that the medium contained at the end of reac-tion 47% of fructose, 4.6% of free glucose, 12.6% of leucrose(D-glucopyranosyl-�-1,5 fructopyranose), and oligosaccharidesvarying from DP2 to 25 (Fig. 2B). In this population, the pre-dominant products were isomaltooligosaccharides, but oligo-saccharides of unknown structure were also detected. By com-bining HPSEC and HPAEC-PAD analyses, the population ofIMW dextrans was estimated to represent 32% of the availableglucosyl residues (Table 1).Kinetics of Polymer Synthesis—At the beginning of the reac-

tion, glucose, fructose, and a few oligosaccharides were pro-duced, as shown by HPAEC-PAD analyses (Fig. 3A). After 1min of reaction, 2.54 mM of fructose and 0.24 mM glucose werereleased for 5.02 mM sucrose consumed, and oligosaccharidesof unknown structure were detected after 2 min of reaction.

FIGURE 2. Analysis of the products synthesized by DSR-S vardel �4N from 290 mM sucrose. A, HPSECchromatogram after total sucrose consumption, and B, HPAEC-PAD profile. DP1, monosaccharides, I3 to I25,isomaltooligosaccharides of DP2 to DP25; ?, products of unknown structure.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

The presence of glucose indicates that some glucosyl residueswere transferred onto water. However, the excess of fructose,comparedwith glucose, clearly indicates that a glucosyl transfer

also occurred onto a molecule other than water. The deficitobserved in the fructose released compared with the sucroseconsumed suggests that besides the water molecules, the majoracceptormolecule could be sucrose. This glucosyl transfer ontosucrose is corroborated by the presence of oligosaccharides ofunidentified structure, which are neither isomaltooligosaccha-rides (IMO) nor sucrose isomers. To identify the structure ofthese products, a 6-h reaction mixture was digested by invert-ase, a �-fructofuranosidase able to cleave the linkage betweenthe glucosyl and fructosyl moieties of sucrose. HPAEC-PADanalyses of the digest revealed that invertase hydrolyzed prod-ucts of unknown structure with a concomitant increase of iso-maltooligosaccharides and fructose, showing that the productsdiffering from isomaltooligosaccharides contain sucrose attheir extremity (Fig. 3C). Leucrose was detected after only 10min, and was followed by isomaltose and isomaltotriose at 20

and 25 min, respectively (Fig. 3B).Thus, glucose and fructose alsobecome acceptors, however later inthe reaction compared with sucroseand water. At 30min, a series of iso-maltooligosaccharides was clearlyvisible on the chromatograms, andtheir size increased until completesucrose depletion. Oligosaccharidesof unknown structure did notexceed a DP higher than 12 (com-paredwith a series of IMO),whereasIMO reached a DP of at least 25 atthe end of reaction. Glucose, isoma-ltose and isomaltotriose did notexceed respectively 7.03, 1.02, and1.41 mM at the end of reaction,showing that all these productsremained at low concentration dur-ing all the synthesis. Glucosyl resi-dues were then always preferablytransferred to produce oligosaccha-rides of higher DP and above all,HMW polymer. HMW dextran wassufficiently concentrated to bedetected by HPSEC after 45-minreaction time, corresponding to asucrose consumption of 23%. Untilthe end of the reaction, the polymersize did not significantly change(Fig. 3D).

Polymerization Reaction withAlternansucrase

Characterization of the ProductsSynthesized from 290 mM Sucrose—Alternansucrase produced HMWalternan estimated to be of 1.7 mil-lion Da (i.e. a DP of 10,500), but alsoquantities of IMW products as seenon the HPSEC chromatogram (Fig.4), of which a major population was

FIGURE 3. Kinetics of oligosaccharide and polysaccharide production during polymerization catalyzedby DSR-S vardel �4N. A, HPAEC-PAD chromatograms, reaction analyzed at initial time, 10, 60, 180, and 300min. B, products formed during the first 45 min. C, HPAEC-PAD chromatogram of products formed after 6 h ofreaction, before and after specific digestion with invertase. D, HPSEC analysis during the polymerization reac-tion, after 0, 20, 30, 45, 120, 240, 360, and 480 min of reaction. G, glucose; F, fructose; S, sucrose; L, leucrose; I2,I3, I4, to I19 correspond to isomaltooligosaccharides of DP2 to DP19; DP2, disaccharides; DP1, monosaccharides.

TABLE 1Relative amount of glucosyl units incorporated into the productssynthesized by DSR-S vardel �4N and ASR C-APY del, after completedepletion of 290 mM sucrose

DSR-S vardel �4N ASR C-APY del% %

HMW glucana 60 28IMW glucanb 32 54cLeucrosed 6 13Glucosed 2 5

a Quantified by HPSEC.b Estimated by difference between HPSEC and HPAEC-PAD analyses.c Products of DP � 8 represent 76% of this population.d Quantified by HPAEC-PAD.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

oligodextrans ofDP 3 toDP 8.Globally, IMWproducts (includ-ing products of DP 3 to 8) represent �47% of the transferredglucose (Table 1). HPAEC-PADanalyses also revealed the pres-ence of a myriad of peaks corresponding to the oligosaccharidepopulation identified by HPSEC (Fig. 5A, t � 196 min). In thispopulation, there are some products from the isomaltooligo-saccharide series (containing only �-1,6 linkages), but alsomany other compounds of unknown structure. Because of thevery low concentration of these products and the poor resolu-tion, it was impossible to separately isolate them for character-ization. Therefore, the whole oligosaccharide population waspurified byHPSEC fromHMWpolymer and fructose, and thensubmitted to methylation and GC-MS analyses. The results ofmethylation showed that both the polymer and the oligosac-charides contained �-1,6- and �-1,3-linked residues in the lin-ear chain, revealed by the presence of 2,4,6 and 2,3,4O-methyl-D-glucose (Table 2). Some branched residues also occurred, asrevealed by the presence of 2,4O-methyl-D-glucose, but only asa small fraction compared with the linearly linked compounds.Finally, the 2,3,4,6 O-methyl-D-glucosyl residues, accountingfor the residues located at the non-reducing end, are morenumerous in the oligosaccharide population than in HMWalternan. However, in addition to the methylation productsusually found in alternan, we also found 3,4,6O-methyl-D-fruc-tose in the oligosaccharides. Such a fructose residue suggests

the presence of fructose or sucrose located at the oligosaccha-ride extremity. 13C NMR revealed the presence of a distinctivecarbon at 104.3 ppm with no J1 coupling with any proton(HSQCanalysis, data not shown). Accordingly, this carbon cor-responds to theC2 of fructose engaged in the glucosidic linkage,characteristic of sucrose molecule. Occurrence of a sucrosemoiety was also confirmed by 1HNMR because of the presenceof a doublet at 5.63 ppm, that corresponds to the proton linkedto the anomeric carbon of the glucose engaged in the glucosidiclinkage (18). As expected, this doublet “couples” with C2 offructose on J3 (HMBC analysis, data not shown). The protonquantification showed that each sucrose accounts for 18 trans-ferred glucose moiety. This result confirmed that sucrose playsthe role of acceptor.Kinetics of Polymer Synthesis—Within the first 2 min of the

reaction, the products detected were fructose and glucose, butnot in equal amount (Fig. 5B). Rapid sucrose depletion was notfollowed by an equivalent increase in fructose release, whichcan be explained by the fact that sucrose acts as acceptor, aswellas undergoing hydrolysis. Leucrose and isomaltose were alsorapidly detected, 5 min after the reaction starts, showing thatalternansucrase recognizes glucose and fructose as acceptorsmore rapidly than dextransucrase (Fig. 5B). After 20 min ofreaction, oligosaccharides of longer size are produced. Thispopulation contains IMO, but these compounds are clearly notpredominant. Oligosaccharides of different structures areindeed formed. From GC/MS analysis, we can propose thatthey correspond to oligosaccharides containing �-1,6/�-1,3linkages in their main chain or at branched points, with eithersucrose, glucose, or fructose at their reducing end. Finally, weakconcentrations of turanose and trehalulose were also clearlyidentified after 196 min of reaction. On HPSEC analyses, thepopulation of oligosaccharides of DP 3 to DP 8 was sufficientlyconcentrated to be detected after 20 min reaction time, rapidlyfollowed by theHMWalternan detected at a reaction time of 30min. After 30min, steady-state synthesis of all the products wasachieved, and we noticed that the average molecular weight ofthe two major populations was slightly increasing over time,contrary to what was observed for the polymer synthesized bythe dextransucrase (curved arrows, Fig. 4, inset compared with

straight arrows, Fig. 3C).Comparison of Polymer Forma-

tion Catalyzed by Dextransucraseand Alternansucrase—Like dex-transucrase, alternansucrase firstcatalyzes the transfer of the glucosylmoiety onto water and sucrose.However, glucosyl transfer ontoglucose and fructose occurs earlierin the reaction process than for dex-transucrase. In addition, alternan-sucrase produces a wider diversityof oligosaccharides containing both�-1,6 and �-1,3 linkages whereasdextransucrase produces mainlyisomaltooligosaccharides, which isin agreement with the high regio-specificity of this enzyme.

FIGURE 4. HPSEC chromatograms of the products synthesized by ASRC-APY del during the polymerization reaction from 290 mM sucrose.Insert corresponds to an enlargement around the HMW and IMW regions. Thereaction medium was analyzed at 0, 20, 30, 40, 50, 60, 70, 94, 196, and 376 min.DP2, disaccharides; DP1, monosaccharides. Arrows indicate an increase ordecrease of the products over time.

FIGURE 5. Kinetics of oligosaccharide synthesis during polymerization catalyzed by ASR C-APY del. A,HPAEC-PAD chromatograms, reaction medium was analyzed at initial time, 2, 20, 94, and 196 min. B, kinetics ofproduct release during initial reaction phase. G, glucose; F, fructose; S, sucrose; Tre, Trehalulose, Tur, Turanose;L, leucrose; I2, I3, I4 correspond to isomaltooligosaccharides of DP2 to DP4.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Anothermajordifferenceconcerns the sizeof theHMWglucanformed. Dextran produced by the dextransucrase is much largerthan alternan formed by alternansucrase (about DP 61,000 versus10,500), and the population of oligosaccharides fromDP3 toDP8is insignificant compared with that synthesized by alternansu-crase. The dextransucrase is thus amuchmore efficient polymer-ase.Withcomparisonto theamylosebindingsites identifiedonAS(13, 14), this ability to form long oligosaccharides and polysaccha-rides is possibly because of the presence of oligodextran bindingsites that could increase the enzyme affinity for long oligosaccha-rides. Truncated forms of dextransucrase were thus designed inattempt to localize such regions.

Dextransucrase-truncated Variants and Identification ofDextran Binding Zones

The primary structure of the full-length DSR-S containsnumber of repeated units in both the C-terminal domain and atthe end of the variable region (Fig. 6) (37). As theHMWdextranchain reached its maximum size after only 45 min (23% ofsucrose consumed), it can be proposed that the enzyme inter-acts very strongly with the polymer chain during growing. Thiscould also explain the very low accumulation of dextran ofintermediate size in the medium. Successive deletions of theC-terminal domain were thus undertaken to identify putativeregions involved in the elongation process. For each construc-tion, it was verified by endodextranase digestions that the link-age specificity of DSR-S was conserved (data not shown).With reference to DSR-S vardel �4N, the construct DSR-S

vardel �2 was truncated of one additional N and C repeat from

C-terminal extremity (Fig. 6). Theenzyme activity was reduced by50%, but no significant change inproduct formation was observed byHPSEC (data not shown). On thecontrary, deletion of an additional Arepeat at the C-terminal end, in thevariant DSR-S vardel �3, resulted ina dramatic decrease of initial activ-ity (99%). However, this variant wasable to consume 290 mM sucrose at1 unit/ml of reaction medium andproduce polymers. Surprisingly, anew population of Low MolecularWeight (LMW) dextran was ob-served in addition to the HMWpolymer, with an average molecularmass of about 10,000 Da (Fig. 7A).This LMW population has never

previously been described, and accounts for 25% of the trans-ferred glucosyl residues (Table 3). A DSR-S vardel Core variantwas also constructed (Fig. 6), in which the whole C-terminaldomain was truncated. This variant also synthesized a LMWdextran of about 10,000 Da, at the cost of HMW polymer syn-thesis, which accounts for less than 10% of the glucosyl unitsavailable from sucrose (Table 3 and Fig. 7A). The reaction wasfollowed over an 8-h period, showing that LMW dextranincreased from 6,000 to 10,000 Da (Fig. 8), after 1–8 h ofreaction.Finally, the variant DSR-S Core �A was constructed, in

which the single A repeat localized in the variable region wasalso removed, thus deleting all the repeated units present in theenzyme. The variant produced only a LMW dextran of about13,000 Da from 100 g/liter sucrose (Table 3 and Fig. 7A), high-lighting the crucial role of the A repeats for dextran elongation.HPAEC-PAD analysis performed after total sucrose deple-

tion showed that isomaltooligosaccharides were present in allthe reaction media. They were, however, in more abundanceand showed higher DP for the A truncated forms, comparedwith those produced by the DSR-S vardel �4N (Fig. 7B). Inparticular, a series of isomaltooligosaccharides of DP varyingfrom 2 to about 60 was clearly observed for the DSR-S Core�Areaction, in agreement with the HPSEC profile.The effect of initial sucrose concentration on the product

pattern was also studied. For all dextransucrase variants,increasing the initial sucrose concentration from 290 to 730mM favored the synthesis of LMW dextran to the detriment

FIGURE 6. Schematic representation of the DSR-S-truncated variants and their relative activity. The fourdifferent domains: (i) signal peptide, (ii) variable region, (iii) catalytic domain, and (iv) C-terminal domain, andthe repeated units A, C, and N (shaded boxes) are localized according to Monchois et al. (37).

TABLE 2Mole percentage of methylated D-glucose and methylated D-fructose fragments from hydrolyzates of methylated polymersand oligosaccharides synthesized by the ASR C-APY del

O-methyl-D-glucoseO-methyl-D-fructosea 2 3,4,6

2,3,4,6-tetra 2,4,6-tri 2,3,4-tri 2,4-diPolymer (alternan) 13.3 25.0 53.6 8.1 0.0Oligosaccharidesb 25.8 20.5 48.8 4.9 3.6

a Molar percentage against total glucose and fructose.b The oligosaccharides were purified from fructose and leucrose.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

of HMW polymer. Most significant results were observedwith DSR-S vardel �3, for which this LMW populationincreased from 24 to 71% of the glucosyl units issued fromsucrose by multiplying by 2.5 the initial sucrose concentra-tion (Fig. 9A). With DSR-S vardel �4N, this new populationis clearly identifiable on HPSEC chromatogram using 440mM sucrose instead of 290 mM, representing then 16% ofglucosyl residues. Finally, using DSR-S vardel Core, theHMW dextran synthesis was totally abolished using 580 mMsucrose, the reaction instead mainly producing LMW dex-tran (74% of the total glucosyl units, data not shown). Similarresults were obtained with the alternansucrase, for which,the oligosaccharide population from DP 3 to DP 8 rangedfrom 34 to 73% of glucosyl residues transferred using 300 to1000 mM sucrose, to the detriment of the HMW alternansynthesis (Fig. 9B).

Linkage Specificity

Dextransucrase and alternansucrase linkage specificities areclearly different. The C-terminal domain of dextransucrasedoes not seem to be involved in linkage specificity, as theDSR-SCore�Acatalyzesmainly�-1,6 linkages like the native enzyme.

However, glucansucrase sequence analysis has revealed thatwithin the highly conserved regions of the catalytic domain,there exist small areas of divergence from the consensus. This isespecially true for enzymes displaying unusual specificitiessuch as the L. mesenteroides NRRL B-1355 alternansucraseASR, the L. mesenteroidesNRRLB-1299 dextransucrase DSR-E(�-1,2 linkage specificity), or the Lactobacillus reuteri 121reuteransucrase GTF-A (�-1,4 linkage specificity) (38–40).These divergent amino acids are located near the catalytic

residues of the triad (Asp-551, Glu-589, and Asp-662 for DSR-S), and in an area proposed to be in contact with substrates andproducts. The crystal structure of AS soaked with maltohep-taose allowed the mapping of the subsites �1 to 5 followingthe nomenclature proposed by Davies et al. (41), and revealedinteractions of the Asp-394, Thr-398, and Phe-399 located justafter the acid/base general catalyst with glucosyl units in posi-tions 1 and 2 (Asp-394), 3 (Thr-398) and 4 (Phe-399)(14) (Fig. 10). By sequence and functional similarities betweenGH-family 13 amylosucrases andGH-family 70 glucansucrases,we propose that residues located immediately downstream theacid/base catalyst of GH-family 70 glucansucrases are impor-tant in forming the subsites1 tonwhich in term dictate the

binding of the acceptor mole-cules prior to elongation. This re-gion should thus have a particularinfluence on the glucansucraseregiospecificity.To further investigate this hy-

pothesis, we constructed severaldextransucrase mutants. Thesewere made by replacing up to sevenresidues located immediately down-stream of Asp-662 of DSR-S by theequivalent residues found in ASR,L. mesenteroides NRRL B-1299DSR-E (second catalytic domainE2), and GTF-A sequences. Alter-nansucrase was alsomutated down-stream the aspartic acid Asp-767, byswapping of three residues withthose found in the DSR-S sequence(Fig. 10).Characterization of Dextransu-

crase Variants—Tomimic the alter-nansucrase sequence, one singlemutant S663Y and one triple mu-tant SEV663YDA were constructed.One triple mutant SEV663NNSwas constructed to mimic the reu-

FIGURE 7. A, HPSEC and B, HPAEC-PAD profiles of products synthesized from 290 mM sucrose by (a) DSR-Svardel �4N, (b) DSR-S vardel �3, (c) DSR-S vardel Core, and (d) DSR-S Core �A. LMW 10,000 Da, short populationof dextran of about 10,000 Da; DP1, monosaccharides; I3 to I60: isomaltooligosaccharides of DP 3 to 60.

TABLE 3Relative amount of glucosyl units incorporated into the products synthesized by DSR-S vardel �4N, DSR-S vardel �3, DSR-S vardel Core, andDSR-S Core �A after complete depletion of 290 mM sucrose

DSR-S vardel �4N DSR-S vardel �3 DSR-S vardel Core DSR-S Core �AHMWDextran 59.62 39.16 11.34Dextran � 10,000 g/mol 24.74 59.51 60.16IMWDextrana 32.24 27.15 16.18 23.97Leucrose 5.8 5.41 6.51 12.77Glucose 2.3 3.54 6.46 3.1

a Intermediate products of 10,000 Da � MW � 108 Da.




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

teransucrase (GTF-A), and one quintuple mutantSEVQTVI663KGVQEKVwas constructed tomimic the secondcatalytic domain of DSR-E (Fig. 10).By testing partially purified samples, it was seen that all of

these mutants suffered a drastic loss of activity with only 4%residual activity for S663Y, 3% for SEV663YDA, 2% forSEV663NNS, and 0.5% for SEVQTVI663KGVQEKV. They werecharacterized in respect to their ability to synthesize HMW dex-tran in the presence of sucrose and to produce isomaltooligosac-charides by acceptor reaction withmaltose and sucrose.All of these mutants consumed more than 80% of substrate

without being able to form dextran. The product pattern didnot reveal the presence of any product of DP superior to 7 (datanot shown). Mutant SEV663YDA was further purified follow-ing protocol optimized for DSR-S vardel �4N, and specificactivity was determined at only 9 unit/mg, corresponding to a98% loss compared with the wild-type. After purification, thevariant was more stable and able to consume the 100 g/litersucrose.However, sucrosehydrolysis appears tobe largely favored,as 32% of glucosyl residues are transferred onto water. Part of theglucose released then acted the role of acceptor, resulting in themajor synthesis of isomaltose (Glcp-(�136)-Glcp), correspond-ing to 47% of glucosyl residues transferred. Traces of isomaltotri-ose,maltoseornigerosewerealso identified, aswas thepresenceofother oligosaccharides of unknown structures probably resultingfrom glucosyl transfers onto sucrose (data not shown).Acceptor reactions with maltose gave additional information.

Mutant S663Y mainly catalyzed sucrose hydrolysis, and produc-tion of low amount of isomaltose (Fig. 11). For the SEV663YDAmutant, hydrolysiswas still themajor reaction catalyzed, butmalt-

ose was also recognized as an acceptor, resulting in the formationof panose (Glcp-(�136)-maltose). Transglucosidase ability of thetriplemutantSEV663NNSwas less affected.Hydrolysiswasmain-tained at low level compared with the first variants, and oligodex-trans of DP up to 4 were observed (Glcp-(�136)- Glcp-(�136)-maltose). Isomaltose was however produced to a less extentcomparedwithSEV663YDA,whereaspanosewas themajorprod-uct. Leucrosewas present in small amounts, showing that fructosewas also recognized as acceptor. Products of unknown structuremay correspond to transfers onto sucrose, and theywere observedat low concentrations for all the variants. Finally, the quintuplemutant SEVQTVI663KGVQEKV was still able to produce littleamounts of oligodextrans until DP 5 (Fig. 11). However, no oligo-saccharides containing�-1,2 linkagesweredetected.Asecond runof mutation was undertaken on this construct, downstream thenucleophile Asp-551, resulting in a variant which completely lostany activity, and was thus impossible to characterize.Alternansucrase Site-directed Mutagenesis—Activity of

mutant YDA768SEV was estimated at 9% of that of the wild-type. The mutant was also analyzed in respect to its ability tosynthesize oligosaccharides and polymer in the presence ofsucrose alone and to produce oligoalternans by acceptor reac-tions with maltose and sucrose.The mutant was strongly affected for its ability to synthesize

HMWpolymer (Fig. 12A), and preferentially synthesized oligo-saccharides. HPAEC-PAD analyses further revealed that itmainly produced isomaltooligosaccharides compared with thewild-type enzyme (Fig. 12B).Acceptor reactions confirmed that linkage specificity was

altered. The mutant did not produce oligoalternans of DPhigher than 4 but did producemore oligodextrans (�-1,6-linkedglucosyl residues onto maltose). The variant was still able tosynthesize OA4 (oligoalternan of DP4, Glcp-(�133)-Glcp-(�136)-maltose), representing 46% of the total oligosaccha-rides produced comparedwith 22% for theASRC-APYdel (Fig.12C). Thus, this mutant can transfer glucosyl residues ontopanose through either �-1,6 or �-1,3 linkage formation, seem-ingly without regiospecificity. However, the OA4 is not recog-nized as an acceptor, and consequently, the OA4 accumulates,almost no oligoalternans of higher DP are synthesized, andmore oligosaccharides of the oligodextran series are produced.

DISCUSSION

Family 70 of the Glycoside-Hydrolases contains polymeraseswhich, by utilizing sucrose, can catalyze production of HMW

glucans. Previous work includingsequence analysis and secondarystructure predictions, especially incomparison with enzymes fromGH-family 13, suggested that themode of action of these catalysts islikely to resemble that of the �-re-taining transglucosidases ofGH-fam-ily 13 (7, 13, 24–26). Clearly, thefirst step of polymer synthesis con-sists in the formation of a covalentglucosyl-enzyme intermediate, asindicated by Mooser & Iwaoka (22),

FIGURE 8. Analysis of the products synthesized by DSR-S vardel Core from290 mM sucrose at 0, 15, 30, 45, 60, 120, 180, 240, 300, 360, 420, and 480min of reaction. LMW 10,000 Da, short population of dextran of about 10,000Da; DP2, disaccharides; DP1, monosaccharides. Arrows indicate an increase ordecrease of the products over time.

FIGURE 9. HPSEC profiles showing the effect of initial sucrose concentration on product synthesis by A,DSR-S vardel �3 (from 290 to 730 mM sucrose) and B, ASR C-APY del (from 50 to 1000 mM substrate).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

and recently proved for the N. polysaccharea amylosucrase(11). The subsequent steps of the reaction are however less wellunderstood. The previous work dealing with the mode of poly-mer formation of GH-family 70 enzymes suggested that elon-gation followed a single chain (or processive) mechanism,which occurred from the reducing end and involved two activesites (19).On the contrary, amylosucrases ofGH-family 13wereshown to follow a non-processive mechanism involving onlyone active site, with elongation occurring at the non reducingend of the growing chain (13).Thus, a clear discrepancy exists between the closely related

GH-families 13 and 70 and the difference of their two proposedmechanisms. The aim of our work was to characterize in detailthe first steps of the polymer formation by GH-family 70enzymes, with the advantage of using more sensitive analyticalmethods than those employed in previous studies. By this, wehoped to get insight into the initial phase of polymer formation,the mode of elongation (single or multichain), and the regio-specificity of these catalysts. TwoGH-family 70 glucansucrases

of distinct specificities were thuschosen, in order to highlight theircommon features, but also studytheir differences.Initial Phase of Polymer For-

mation—For both dextransucraseand alternansucrase, the use ofHPAEC-PAD enabled the identifi-cation of products formed from 290mMsucrosewhen less than 1%of thesubstrate was consumed. Theseanalyses clearly demonstrate thatcatalysis starts by sucrose hydroly-sis, as glucose and fructose are theonly carbohydrates detected in thereaction medium during the firstminutes of reaction. Rapidly,sucrose can start to act in the role ofacceptor (after 2 min), latter fol-lowed by glucose. Initial sucrose

glucosylation leads to the formation of oligosaccharides. Thepresence of a sucrose molecule in the glucan produced byGH-70 glucansucrase from S. sobrinus GFT-S3 was also previ-ously proposed by Cheetham et al. (18) and consequently prob-ably is a common feature for most of GH-70 enzymes. In addi-tion, it was demonstrated for both dextransucrase andalternansucrase that increasing the initial sucrose concentra-tion favored the acceptor reaction onto sucrose and redirectsthe glucan synthesis toward oligosaccharide production.Elongation—The elongation process occurs by addition of

glucosyl residues onto the non reducing end of previouslyformed acceptors. With dextransucrase, a series of isomaltoo-ligosaccharides of increasing DP is preferentially formed,sucrose acceptor reaction products being minor products.These products are still present at the end of the reaction. Thisis in agreement with the high �-1,6 linkage specificity of theenzyme. Glucose released is subsequently used as an acceptorto form isomaltose, that is released and glucosylated to formisomaltotriose, and so forth until formation of a HMWdextranof molecular weight up to 107–108 Da. Transfers onto fructoseare favored at the end of the reaction, when fructose is in largeexcess, and results in leucrose synthesis (not exceed 22 mM).Alternansucrase elongation results in various series of oligosac-charides, mainly containing �-1,6 and �-1,3 linkages in themain chain, as shownbymethylation analysis. Someof themarealso branched, and contain sucrose, glucose or fructose at theirreducing extremity. Part of these oligosaccharides will not beelongated andwill accumulate in themedium (DP� 8)whereasthe others will be elongated until formation of aHMWalternan(1.7 � 106 Da).

In similarity with amylosucrase from N. polysaccharea, thepolymerization mechanism we describe here for both enzymesrequires only one active site, capable of both glucan synthesisand exogenousmolecule glucosylation. Thismechanism agreeswith the fact that only one catalytic site was found by primarystructure analysis in all glucansucrases known, and that muta-tion of the catalytic residue Asp-551 of the DSR-S in aspargin-

FIGURE 10. Sequence alignment of regions flanking the catalytic residues of glucansucrases of variouslinkage specificities. GTF-I (S. downei), GTF-C (S. mutans), and GTF-L (S. salivarius) are specific for �-1,3 link-ages, GTF-D (S. mutans), DSR-S (L. mesenteroides NRRL B-512F), DSR-C (L. mesenteroides NRRL B-1355), andDSR-E1 (L. mesenteroides NRRL B-1299) are specific for �-1,6 linkages, ASR (L. mesenteroides NRRL B-1355) spe-cific for alternated �-1,6 and �-1,3 linkages, DSR-E2 (L. mesenteroides NRRL B-1299) is specific for �-1,2 linkages.GTF-A (Lactobacillus reuteri 121) catalyzes the synthesis of a glucan composed of about 50% of �-1,4 linkages.AS (N. polysaccharea) is specific for �-1,4 linkages and is the only glucansucrase classified in GH-family 13. �,�-strands from the putative (�/�)8 barrel. 134 represent AS subsites shown to accept the molecules to beelongated (14). Catalytic amino acids are in bold. Residues which differ significantly from the consensus are inbold and underlined.

FIGURE 11. Acceptor reactions with DSR-S vardel �4N mutants. Productidentification: G, glucose; F, fructose; S, sucrose; L, leucrose; I2, isomaltose, P,panose; OD4, oligodextran of DP4 (Glcp-(�136)-Glcp-(�136)-maltose).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

ine destroyed both the polymer synthesis from sucrose alone, asthe acceptor glucosylation reaction (26).Single or Multichain Mechanism—Concerning dextransu-

crase, HMW dextran detectable by HPSEC analysis after only23% of sucrose consumption is already at its maximum size, aspreviously described (15). Hence, elongation would seem to bea single chain process. However, HPSEC coupled to HPAEC-PAD analysis revealed that dextrans of intermediate molecularweight were also formed, corresponding to 32% of the trans-ferred glucosyl residues at the end of reaction. Their abundanceis very low and they represent a large range of different molec-ular weights, explaining why they were never detected before.As presented here, the study of truncated forms of dextransu-crase revealed that theA repeats localized in bothN- andC-ter-minal sides of DSR-S play a major role in the polymerization

process of DSR-S. These truncated variants are much less effi-cient polymerases than the wild-type, synthesizing a secondpopulation of LMWdextran to the detriment ofHMWpolymerproduction. HPSEC analyses clearly showed an increase of theLMW dextran average molecular weight with reaction time.Thus, comparison of products synthesized by DSR-S vardel�4N with its mutants devoid of their A repeats allows us tosuggest that these repeats interact with dextran during polymersynthesis and possibly aide the anchoring of the growing poly-mer to the enzyme surface, thus leading to efficient elongationof large size products. Funane et al. (42) previously suggestedthat A repeats could be involved in DSR-S glucan binding abil-ity. Particularly interesting is the behavior of DSR-S Core �Awhich is completely incapable of producing polymer larger than13,000 Da. Sensitive HPAEC-PAD analyses clearly showed aseries of isomaltooligosaccharides or oligodextrans from DP2to about DP60, i.e. a molecular mass of about 10,000 Da. Prod-ucts of higher DP were not separated by HPAEC-PAD, andappeared as a large peak (probably at the separation limit of thesystem). This shows that this mutant possesses a clear non-processive mechanism of polymerization similar to that of theN. polysaccharea amylosucrase. It is of interest to note thatamylosucrases are the only glucansucrases that does not pos-sess repeated units in their C-terminal domain (8, 9).Concerning the alternansucrase, two major populations of

products are formed, increasing concomitantly after 30 min ofreaction (Fig. 5B). The diversity of oligosaccharide structuresobserved on HPAEC-PAD chromatograms suggests thatamong the structures initially formed, some of them may havebetter affinity with the enzyme and are preferentially elongated.Thus, the population of oligosaccharides of DP � 8 would rep-resent less efficient acceptors which accumulate in themedium. In similarity to the situation with the dextransucrase,we suggest that longer alternan molecules are capable of inter-acting with surface alternan binding site and hence promotetheir own elongation.Consequently, taking into account the dual nature of the

elongation mechanism highlighted, we propose here a semi-processive mechanism of polymerization for GH-70 glucansu-crases. Comparison of dextransucrase and alternansucrasekinetic of polymer formation also permit to conclude that glu-can binding zones (like those found at the C-terminal end ofDSR-S) support elongation and the efficiency of polymer for-mation. These zones can be proposed to act as mediator of theshift between the processive and non processive elongationprocess.One must also keep in mind that the size of the polymer

formed is also dependant on the intrinsic physicochemicalproperty of the reaction product, all these factors being part ofthe variety in size of the glucans formed by glucansucrases. Ofcourse, resolution of the three-dimensional structure of oneglucansucrase of this GH-family 70 is now attempted to con-firm this model.Linkage Specificity—Dextransucrase mutants constructed in

this study all retained the wild-type linkage specificity but wereseverely affected in their activity, loosing their ability to formglucan. For instance the purified mutant SEV663YDA dis-played a specific activity reduced by 98% compared with the

FIGURE 12. Effect of mutations on alternansucrase activity. Effect onpolymer synthesis analyzed by HPSEC (A) and HPAEC-PAD (B). Effect onacceptor reaction with maltose, analyzed by HPAEC-PAD (C). I2, isomalto-oligosaccharide of DP2; M, maltose; P, panose; OD4, oligodextran of DP4(Glcp-(�136)-Glcp-(�136)-maltose); OA4, oligoalternans of DP4 (Glcp-(�133)-Glcp-(�136)-maltose).




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

wild type. It can be seen in this example that our attempt to alterlinkage specificity instead resulted in a destruction of enzymeactivity. By modifying the residues immediately downstream ofAsp-662, which we proposed were responsible in forming sub-sites 1 and 2 using AS as model, we have inadvertentlyseverely restricted acceptor recognition. As previously shown,the DSR-S linkage specificity is susceptible to change, as themutation of the Thr-667 (corresponding to subsite 3 for AS)to arginine increased the �-1,3 linkage content of polymer syn-thesized from less than 5% to 13% (43). Recently, Funane et al.(44) also shown that it was possible to introduce �4% of �-1,2linkages in the dextran synthesized by a DSR-S variant wherelysine replaced two residues at positions Thr-350 and Ser-445.In that example, the mutations were however not localizedwithin the ((�/�)8 barrel.

Concerning the alternansucrase, the mutant YDA768SEVclearly looses the ability to alternate linkage formation.While itwas able to create an �-1,3 linkage after an �-1,6 one (i.e. DP4oligoalternan), it was unable to recognize this �-1,3-linked glu-cosyl as an acceptor and extend it on turn. Consequently, themutant synthesized a high content of oligodextrans composedof �-1,6-linked glucosyl residues compared with the wild-type.As for the S663Y mutation in DSR-S sequence, the aromatictyrosine modified to serine is the most significant change, andprobably at the origin of the strong effect on the catalysis. Con-sidering that the tyrosine Tyr-768 in the alternansucrase alignwith the Asp-394 residue of N. polysaccharea AS (Fig. 10),which as been shown to have interactions with glucosyl units inpositions 1 and 2 on the protein, we propose here that thealternansucrase aromatic residue displays stacking interactionswith the glucosyl in position 2. After the formation of thecovalent glucosyl-enzyme intermediate, the non-reducing endof the acceptor would bind into the 1 subsite with the C3 orthe C6 hydroxyl orientated so to attack the C1 of the glucosylcovalently linked to the enzyme.We suggest here that the non-reducing end of the acceptor, positioned in 1 subsite, is notwell stabilized in the alternansucrase. On the contrary, the glu-can in the 2 subsite would be more stabilized through inter-actions via the aromatic residue 768. Taking into account theseconsiderations, C3 and C6 accessibility would depend on thelinkage between the 1 and 2 glucosyl units. As a conse-quence, an�-1,6 linkage induces the formation of an�-1,3 link-age, and an �-1,3 linkage induces the formation of an �-1,6linkage. Such a model could explain the catalytic property ofalternansucrase that alternate linkages. Accordingly, the muta-tion of the Tyr-667 removes the staking interactions and thusaffects the alternating process, redirecting the synthesis to the�-1,6 linkage formation, amore favorable reaction probably forsteric hindrance or energy reasons. Indeed, according to Robyt(45), the �-1,6 link requires less energy to be formed than the�-1,2;�-1,3 or�-1,4. These considerationsmay explainwhy thereplacement of the three residues YDA with SEV in alternan-sucrase permitted an increase of �-1,6 links in glucans synthe-sized, whereas it was impossible to change the linkage patternof the DSR-S. Similar arguments may explain why it wasrecently shown that mutation of the peptide NNS in SEV in theL. reuteri GTF-A permitted the rational transformation of thereuteransucrase into a dextransucrase (46).

Finally, this work highlighted the importance of gaining abetter understanding of the glucansucrase mode of action thusimproving rational engineering of these enzymes. Hopefully, inthe near future, it will be possible to rationally engineer glucan-sucrases so to have a better control of glucan size, structures,and physicochemical properties.

REFERENCES1. Monsan, P., Bozonnet, S., Albenne, C., Joucla, G., Willemot, R. M., and

Remaud-Simeon, M. (2001) Int. Dairy J. 11, 675–6852. Koepsell, H. J., Tsuchiya, H. M., Hellman, N. N., Kazenko, A., Hoffman,

C. A., Sharpe, E. S., and Jackson, R. W. (1953) J. Biol. Chem. 200,793–801

3. Richard, G., Morel, S.,Willemot, R.M., Monsan, P., and Remaud-Simeon,M. (2003) Carbohydr. Res. 338, 855–864

4. Uitdehaag, J. C. M., Mosi, R., Kalk, K. H., Van Der Veen, B. A., Dijkhui-zen, L., Withers, S. G., and Dijkstra, B. W. (1999) Nat. Struct. Biol. 6,432–436

5. Monchois, V., Willemot, R. M., and Monsan, P. (1999) FEMS Microbiol.Rev. 23, 131–151

6. Kralj, S., van Geel-Schutten, G. H., Dondorff, M.M., Kirsanovs, S., van derMaarel, M. J., and Dijkhuizen, L. (2004)Microbiology 150, 3681–3690

7. Macgregor, E. A., Jespersen,H.M., and Svensson, B. (1996)FEBSLett.378,263–266

8. Potocki DeMontalk, G., Remaud-Simeon, M., Willemot, R. M., Planchot,V., and Monsan, P. (1999) J. Bacteriol. 181, 375–381

9. Pizzut-Serin, S., Potocki-Veronese, G., van der Veen, B. A., Albenne,C., Monsan, P., and Remaud-Simeon, M. (2005) FEBS Lett. 579,1405–1410

10. Skov, L. K., Mirza, O., Henriksen, A., DeMontalk, G. P., Remaud-Simeon,M., Sarcabal, P., Willemot, R. M., Monsan, P., and Gajhede, M. (2001)J. Biol. Chem. 276, 25273–25278

11. Jensen, M. H., Mirza, O., Albenne, C., Remaud-Simeon, M., Monsan, P.,Gajhede, M., and Skov, L. K. (2004) Biochemistry 43, 3104–3110

12. Sarcabal, P., Remaud-Simeon, M., Willemot, R., Potocki, d. M., Svensson,B., and Monsan, P. (2000) FEBS Lett. 474, 33–37

13. Albenne, C., Skov, L. K., Mirza, O., Gajhede, M., Feller, G., D’Amico, S.,Andre, G., Potocki-Veronese, G., van der Veen, B. A., Monsan, P., andRemaud-Simeon, M. (2004) J. Biol. Chem. 279, 726–734

14. Skov, L. K., Mirza, O., Sprogoe, D., Dar, I., Remaud-Simeon, M., Albenne,C., Monsan, P., and Gajhede, M. (2002) J. Biol. Chem. 277, 47741–47747

15. Ebert, K. H., and Schenk, G. (1968) Adv. Enzymol. Relat. Areas Mol. Biol.30, 179–221

16. Tsuchiya, H. M., Hellman, N. N., and Koepsell, H. J. (1953) J. Am. Chem.Soc. 75, 757–758

17. Kobayashi,M., Yokoyama, I., andMatsumada, K. (1986)Agric. Biol. Chem.50, 2585–2590

18. Cheetham, N. H., Slodki, M. E., and Walker, G. J. (1991) Carbohydr.Polym. 16, 349–353

19. Robyt, J. F., Kimble, B. K., and Walseth, T. F. (1974) Arch. Biochem. Bio-phys. 165, 634–640

20. Ditson, S. L., and Mayer, R. M. (1984) Carbohydr. Res. 126, 170–17521. Robyt, J. F., and Martin, P. J. (1983) Carbohydr. Res. 113, 301–31522. Mooser, G., and Iwaoka, K. R. (1989) Biochemistry 28, 443–44923. Mooser, G., Hefta, S. A., Paxton, R. J., Shively, J. E., and Lee, T. D. (1991)

J. Biol. Chem. 266, 8916–892224. Kato, C., Nakano, Y., Lis, M., and Kuramitsu, H. K. (1992) Biochem. Bio-

phys. Res. Commun. 189, 1184–118825. Devulapalle, K. S., Goodman, S. D., Gao, Q., Hemsley, A., and Mooser, G.

(1997) Protein Sci. 6, 2489–249326. Monchois, V., Remaud-Simeon, M., Russell, R. R., Monsan, P., and

Willemot, R. M. (1997) Appl. Microbiol. Biotechnol. 48, 465–47227. Robyt, J. F., and Walseth, T. F. (1978) Carbohydr. Res. 61, 433–44528. Mayer, R. M., Matthews, M. M., Futerman, C. L., Parnaik, V. K., and Jung,

S. M. (1981) Arch. Biochem. Biophys. 208, 278–28729. Stodola, F. H. (1952) J. Am. Chem. Soc. 74, 3202–320330. Su, D., and Robyt, J. F. (1994) Arch. Biochem. Biophys. 308, 471–476




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

31. Moulis, C., Arcache, A., Escalier, P. C., Rinaudo, M., Bouchu, A., Monsan,P., Remaud-Simeon, M., and Potocki-Veronese, G. (2006) FEMS Micro-biol. Lett. 261, 203–210

32. Joucla, G., Pizzut-Serin, S., Monsan, P., and Remaud-Simeon, M. (2006)FEBS Lett. 580, 763–768

33. Barik, S. (1995)Mol. Biotechnol. 3, 1–734. Miller, A. W., and Robyt, J. F. (1986) Anal. Biochem. 156, 357–36335. Sumner, J., and Howell, S. (1935) J. Biol. Chem. 108, 51–5436. Ciucanu, I., and Kerek, F. (1984) Carbohydrate Res. 131, 209–21737. Monchois, V., Reverte, A., Remaud-Simeon, M., Monsan, P., and

Willemot, R. M. (1998) Appl. Environ. Microbiol. 64, 1644–164938. Arguello-Morales, M. A., Remaud-Simeon, M., Pizzut, S., Sarcabal, P.,

Willemot, R., and Monsan, P. (2000) FEMS Microbiol. Lett. 182, 81–8539. Bozonnet, S., Dols-Laffargue, M., Fabre, E., Pizzut, S., Remaud-Simeon,

M., Monsan, P., and Willemot, R. M. (2002) J. Bacteriol. 184, 5753–5761

40. Kralj, S., van Geel-Schutten, G. H., Rahaoui, H., Leer, R. J., Faber, E. J., vander Maarel, M. J., and Dijkhuizen, L. (2002) Appl. Environ. Microbiol. 68,4283–4291

41. Davies, G. J.,Wilson, K. S., andHenrissat, B. (1997) Biochem. J. 321, 557–55942. Funane, K., Ookura, T., and Kobayashi, M. (1998) Biosci. Biotechnol. Bio-

chem. 62, 123–12743. Remaud-Simeon, M., Willemot, R. M., Sarcabal, P., Potocki de Montalk,

G., and Monsan, P. (2000) J. Mol. Catal. B: Enzym. 10, 117–12844. Funane, K., Ishii, T., Ono, H., and Kobayashi, M. (2005) FEBS Lett. 579,

4739–474545. Robyt, J. F. (1995) Adv. Carbohydr. Chem. Biochem. 51, 133–16846. Kralj, S., van Geel-Schutten, I. G., Faber, E. J., van der Maarel, M. J., and

Dijkhuizen, L. (2005) Biochemistry 44, 9206–921647. Mooser, G. (1992) The Enzymes Vol. XX, pp. 188–225, Academic Press

Inc., New York




http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Potocki-Veronese, Pierre Monsan and Magali Remaud-SimeonClaire Moulis, Gilles Joucla, David Harrison, Emeline Fabre, Gabrielle

GlucansucrasesUnderstanding the Polymerization Mechanism of Glycoside-Hydrolase Family 70

doi: 10.1074/jbc.M604850200 originally published online July 24, 20062006, 281:31254-31267.J. Biol. Chem.

10.1074/jbc.M604850200Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

http://www.jbc.org/content/281/42/31254.full.html#ref-list-1

This article cites 45 references, 10 of which can be accessed free at


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M604850200

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;281/42/31254&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/281/42/31254

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=281/42/31254&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/281/42/31254

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/281/42/31254.full.html#ref-list-1

http://www.jbc.org/

understandingthepolymerizationmechanismof … glycoside-hydrolasefamily70glucansucrases*...

Documents