University of Groningen

Acetylcholine beyond bronchoconstriction: a regulator of inflammation and remodelingKistemaker, Loes

IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite fromit. Please check the document version below.

Document VersionPublisher's PDF, also known as Version of record

Publication date:2015

Link to publication in University of Groningen/UMCG research database

Citation for published version (APA):Kistemaker, L. (2015). Acetylcholine beyond bronchoconstriction: a regulator of inflammation andremodeling. [S.l.]: [S.n.].

CopyrightOther than for strictly personal use, it is not permitted to download or to forward/distribute the text or part of it without the consent of theauthor(s) and/or copyright holder(s), unless the work is under an open content license (like Creative Commons).

Take-down policyIf you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediatelyand investigate your claim.

Downloaded from the University of Groningen/UMCG research database (Pure): http://www.rug.nl/research/portal. For technical reasons thenumber of authors shown on this cover page is limited to 10 maximum.

Download date: 26-02-2019

 

 

 

 

 

CHAPTER 7 

MURINE PRECISION‐CUT LUNG SLICES AS A MODEL TO STUDY 

TGF‐β AND BRONCHOCONSTRICTION‐INDUCED REMODELING 

 

 

 

 

 

 

Loes E.M. Kistemaker 

I. Sophie T. Bos 

Cécile M. Bidan 

Jürgen Wess 

Huib A.M. Kerstjens 

Herman Meurs  

Reinoud Gosens 

 

Chapter 7 

136 

Abstract 

Rationale 

Asthma  is  a  chronic  obstructive  airway  disease,  characterized  by  airway  remodeling. 

Airway remodeling is conventionally thought to be the result of airway inflammation, with 

inflammatory cells giving rise to the production of pro‐remodeling factors, such as TGF‐β. 

However, new  insights  suggest  that  airway  remodeling might  also or  alternatively be  a 

consequence  of  bronchoconstriction,  which  triggers  TGF‐β  release  via  biomechanical 

activation. Previously, we developed a model to study this phenomenon, using guinea pig 

lung  slices  treated  with  bronchoconstrictors  in  culture.  As  the  mouse  offers  species 

advantages with  respect  to  the availability of molecular and genetic  tools, we aimed  to 

develop a similar model using murine precision cut  lung slices.  In addition, we aimed to 

investigate  the  involvement  of  the  M3  receptor  in  bronchoconstriction‐induced 

remodeling. 

Methods 

Airway  constriction  in  response  to methacholine was  assessed  in  lung  slices  from wild‐

type  and M3R‐/‐ mice.  In  subsequent experiments,  lung  slices  from wild‐type  and M3R

‐/‐ 

mice were  stimulated with  TGF‐β1  (2  ng/ml)  or methacholine  (10  μM)  for  two  days  to 

induce  airway  remodeling.  Thereafter,  slices  were  used  for  gene  expression  analysis, 

Western Blot analysis, 2‐photon imaging, or for constriction experiments. 

Results 

Slices were viable for at least three days. Methacholine induced a dose dependent airway 

constriction in wild‐type mice, with a maximal effect of 80%. In M3R‐/‐ mice, a 35% airway 

constriction was observed.  TGF‐β  induced  a  2‐fold  increase  in  the mRNA  expression of 

fibronectin, collagen Iα1 and α‐sm‐actin in both wild‐type and M3R‐/‐ mice. Similar findings 

were observed on  the protein  level. 2‐Photon  imaging  revealed  that collagen and α‐sm‐

actin  expression  was  localized  around  the  airways.  No  effect  of  methacholine  on 

parameters of remodeling was observed. Stimulation with TGF‐β or methacholine did not 

alter  airway  constriction  induced by  the  thromboxane A2  agonist U46619  compared  to 

control conditions in both wild‐type and M3R‐/‐ mice. 

Conclusions 

Murine  lung  slices  are  suitable  to  study  TGF‐β‐induced  airway  remodeling, which was 

comparable  in  wild‐type  and M3R‐/‐ mice. Methacholine  did  not  induce  remodeling  in 

murine lung slices, suggesting that the mouse, in contrast to the guinea pig, is not a good 

model to study bronchoconstriction‐induced remodeling. Despite effects of TGF‐β on the 

expression of fibronectin, collagen Iα1 and α‐sm‐actin, this did not translate into changes 

in airway contractility. Further studies, using a pharmacological approach, are needed to 

Lung slices as a model to study remodeling 

 137 

investigate the potential  involvement of the M3 receptor  in bronchoconstriction‐induced 

remodeling. 

 

Introduction 

Asthma  is  a  chronic  obstructive  airway  disease,  which  is  characterized  by  structural 

changes  in  the  airways,  referred  to  as  airway  remodeling.  Airway  remodeling 

encompasses airway smooth muscle  thickening and excessive deposition of extracellular 

matrix proteins  (1). These airway  structural  changes are  considered  to be an  important 

component of airflow limitation in asthma and may contribute to an accelerated decline in 

lung  function  (2, 3).  In addition, asthma  is characterized by airway hyperresponsiveness, 

which  consists  of  an  excessive  airway  narrowing  in  response  to  bronchoconstricting 

stimuli, and by airway inflammation (4).  

It  is believed  that  airway  remodeling  is  the  result of ongoing  airway  inflammation.  For 

example, eosinophils are a rich source of the pro‐remodeling factor TGF‐β  (5). However, 

the severity of airway remodeling in patients with asthma is not related to the severity of 

inflammation,  and  treatment  with  corticosteroids,  which modify  airway  inflammation, 

does not affect the decline in lung function or the natural history of asthma (6‐8).  

New insights suggest that airway remodeling might also or alternatively be a consequence 

of bronchoconstriction.  In patients with asthma, repeated challenges with methacholine, 

inducing  bronchoconstriction,  induced  features  of  airway  remodeling, without  affecting 

eosinophilic  inflammation.  Interestingly,  these  effects  could  be  prevented  when 

methacholine  was  combined  with  the  β2‐agonist  albuterol,  suggesting  that 

bronchoconstriction  is  importantly  involved  (9).  Furthermore,  in  a  mouse  model  of 

asthma, we demonstrated that ovalbumin‐induced remodeling is prevented in muscarinic 

M3  receptor  deficient  (M3R‐/‐) mice,  in which  bronchoconstriction  is  almost  completely 

abolished,  without  affecting  the  inflammatory  response  (chapter  6).  Together,  these 

studies indicated that airway remodeling is not merely induced by inflammation, but may 

also  be  a  consequence  of  mechanical  forces  applied  to  the  airways  during 

bronchoconstriction. 

The notion that mechanical forces could promote airway remodeling is also supported by 

in vitro evidence. For example, compression of epithelial cells  increases the activation of 

TGF‐β (10), the epithelial thickness (11), and the expression of fibronectin and collagen in 

a  co‐culture  system  with  fibroblasts  (12).  Moreover,  in  airway  smooth  muscle  cells, 

muscarinic receptor stimulation and mechanical strain  induces TGF‐β activation  (13) and 

Chapter 7 

138 

myosin expression (14). Clearly, mechanical forces have an impact on multiple cell types in 

the airway, and might thereby enhance remodeling of the airways.  

Recently we developed a model to study bronchoconstriction‐induced remodeling ex vivo, 

using  guinea  pig  precision‐cut  lung  slices  (PCLS).  Oenema  et  al.  demonstrated  that 

stimulation of  guinea pig PCLS with methacholine or other bronchoconstrictors  induces 

airway  remodeling  (15). The effects of methacholine were  comparable  to  the effects of 

TGF‐β, and were shown to be mediated via TGF‐β (15). In this study, we aimed to develop 

a  model  to  study  bronchoconstriction‐induced  remodeling  using  murine  PCLS  as  the 

mouse offers species advantages with respect to the availability of molecular and genetic 

tools. In addition, we aimed to investigate the potential involvement of the M3 receptor in 

these responses, for which PCLS from M3R‐/‐ mice were used.  

 

Methods 

Animals 

Homozygous,  inbred,  specific‐pathogen‐free  breeding  colonies  of  M3R‐/‐  mice  and 

C57Bl/6NTac  wild‐type  mice  with  the  same  genetic  background  were  obtained  from 

Taconic  (Cambridge  City,  Indiana,  USA).  The  M3R‐/‐  mice  used  were  on  a  129  Sv/J 

background  and  backcrossed  for  at  least  10  generations  onto  the  C57Bl/6NTac 

background. M3R‐/‐ mice did not differ  from  their wild‐type  littermates  in overall health, 

fertility and  longevity  (16). Animals were housed conventionally under a 12‐h  light‐dark 

cycle  and  received  food  and  water  ad  libitum.  All  experiments  were  performed  in 

accordance with  the  national  guidelines  and  approved  by  the  University  of  Groningen 

Committee for Animal Experimentation (DEC5463I and DEC6792A). 

Precision‐cut lung slices 

Mouse PCLS were prepared, according  to a protocol described previously  for guinea pig 

PCLS  by  our  lab  (15). Male mice  (6‐8  weeks  old)  were  euthanized  by  intraperitoneal 

pentobarbital  injection  (400  mg/kg,  hospital  pharmacy,  University  Medical  Center 

Groningen),  after  which  the  lungs  were  filled  with  1.5  ml  low  melting‐point  agarose 

solution  (1.5%  final  concentration  (Gerbu  Biotechnik  GmbH, Wieblingen,  Germany)  in 

CaCl2  (0.9 mM), MgSO4  (0.4 mM),  KCl  (2.7 mM), NaCl  (58.2 mM), NaH2PO4  (0.6 mM), 

glucose  (8.4  mM),  NaHCO3  (13  mM),  Hepes  (12.6  mM),  sodium  pyruvate  (0.5  mM), 

glutamine (1 mM), MEM‐amino acids mixture (1:50), and MEM‐vitamins mixture (1:100), 

pH=7.2). The agarose was solidified for 15 minutes by placing the lungs on ice. Lungs were 

harvested and individual lobes were sliced at a thickness of 250 µm in medium composed 

of CaCl2  (1.8mM), MgSO4  (0.8 mM), KCl  (5.4 mM), NaCl  (116.4 mM), NaH2PO4  (1.2 mM), 

Lung slices as a model to study remodeling 

 139 

glucose  (16.7 mM), NaHCO3  (26.1 mM), Hepes  (25.2 mM), pH = 7.2, using a tissue slicer 

(Compresstome™  VF‐300  microtome,  Precisionary  Instruments,  San  Jose  CA,  USA). 

Thereafter, slices were kept at 37°C  in a humidified atmosphere of 5% CO2 and washed 

every  30  minutes  for  four  times  to  remove  the  agarose  and  cell  debris  in  medium 

composed of CaCl2 (1.8mM), MgSO4 (0.8 mM), KCl (5.4 mM), NaCl (116.4 mM), NaH2PO4 

(1.2 mM),  glucose  (16.7 mM), NaHCO3  (26.1 mM), Hepes  (25.2 mM),  sodium  pyruvate 

(1mM),  glutamine  (2  mM),  MEM‐amino  acids  mixture  (1:50),  MEM‐vitamins  mixture 

(1:100,) penicillin (100 U/mL) and streptomycin (100 µg/mL), pH = 7.2. Average diameter 

of the airways was 179 µM ± 82 µM. 

Mitochondrial activity assay 

Viability  of  lung  slices was  assessed  by  a mitochondrial  activity  assay  performed  after 

culturing  the  slices  for  different  time  periods  in  Dulbecco’s  Modification  of  Eagle’s 

Medium (DMEM) supplemented with sodium pyruvate (1 mM), non‐essential amino acid 

mixture (1:100), gentamycin (45 µg/mL), penicillin (100 U/mL), streptomycin (100 µg/mL) 

and  amphotericin  B  (1.5  µg/mL)  at  37°C‐5%  CO2.  Slices  were  incubated  with  Hanks’ 

balanced  salt  solution  (pH  7.4),  containing  10%  Alamar  blue  solution  (BioSource, 

Camarillo,  CA),  for  30  min  at  37°C‐5%  CO2.  Mitochondrial  activity  was  assessed  by 

conversion of Alamar blue into its reduced form, as described previously (17).  

Treatment of lung slices 

Lung  slices  were  incubated  in  Dulbecco’s  Modification  of  Eagle’s  Medium  (DMEM) 

supplemented with  sodium pyruvate  (1 mM), non‐essential amino acid mixture  (1:100), 

gentamycin  (45  µg/mL),  penicillin  (100  U/mL),  streptomycin  (100  µg/mL)  and 

amphotericin B (1.5 µg/mL) at 37°C‐5% CO2 in a 12‐well plate, using 3 slices per well. The 

slices were treated with vehicle (CTR), 2 ng/ml TGF‐β1 (R&D systems, Abingdon, UK) or 10 

μM methacholine  (MCh;  ICN  Biomedicals,  Zoetermeer,  the  Netherlands)  for  two  days. 

After  two  days,  slices were  collected  for  contraction  studies,  gene  expression  analysis, 

Western Blot analysis, or for 2‐photon imaging. 

Airway narrowing studies 

Airway narrowing studies were performed on naïve lung slices and on slices treated with 

vehicle, TGF‐β or methacholine  (MCh)  for  two days. On naïve  lung slices, dose response 

curves for MCh (10‐9M ‐ 10‐3M) were recorded, as well as constriction after a single dose of 

MCh (10‐4M), after which the airways were dilated with the bitter taste receptor agonist 

chloroquine (10‐3M, Sigma‐Aldrich, Zwijndrecht, The Netherlands). On slices treated with 

vehicle, TGF‐β or MCh  for  two days, dose response curves  towards  the  thromboxane A2 

agonist U‐46619 (10‐10M ‐ 10‐5M, Sigma‐Aldrich) were recorded. As described previously, a 

Chapter 7 

140 

nylon mesh and metal washer were used  to keep  the  lung slice  in place  (18). Lung slice 

images were  captured  in  time‐lapse  (1  frame  per  2  seconds)  using  an  inverted  phase 

contrast microscope  (Eclipse,  TS100; Nikon).  Airway  luminal  area was  quantified  using 

image acquisition software (NIS‐elements; Nikon).  

Gene expression analysis 

Total RNA was extracted from lung slices by automated purification using the Maxwell 16 

instrument  and  the  corresponding  Maxwell  16  LEV  simply  RNA  tissue  kit  (Promega, 

Madison, USA) according to the manufacturer's instructions. Equal amounts of total mRNA 

were  then  reverse  transcribed  and  cDNA was  subjected  to  real‐time  qPCR  (Westburg, 

Leusden, The Netherlands). Real time PCR was performed with denaturation at 94°C for 30 

seconds, annealing at 59°C  for 30  seconds and extension at 72°C  for 30  seconds  for 40 

cycles  followed  by  10  minutes  at  72°C.  Real‐time  PCR  data  were  analyzed  using  the 

comparative  cycle  threshold  (Ct:  amplification  cycle  number) method.  The  amount  of 

target gene was normalized  to  the endogenous  reference gene 18S  ribosomal RNA. The 

specific forward and reverse primers used are listed in table 1. 

Western Blot analysis 

Lung slices were washed once with ice‐cold phosphate‐buffered saline (PBS, composition: 

NaCl (140 mM), KCl (2.6 mM), KH2PO4 (1.4 mM), Na2HPO4 (8.1 mM), pH 7.4), followed by 

lysis using ice‐cold SDS‐lysis buffer (Tris‐HCl (62.5 mM), SDS (2 %), NaF (1 mM), Na3VO4 (1 

mM),  aprotinin  (10  μg/mL),  leupeptin  (10  μg/mL),  pepstatin  A  (7  µg/mL)  at  pH  8.0). 

Protein  amounts  were  determined  by  Pierce  and  equal  amounts  of  protein  were 

separated  on  SDS  polyacrylamide  gels,  transferred  onto  nitrocellulose  membranes, 

followed  by  standard  immunoblotting  techniques.  All  bands were  normalized  either  to 

lamin AC or to tubulin. 

 

Table 1. Primers used for qRT‐PCR analysis. 

Gene  Primer sequence  NCBI accession 

number 

Fibronectin  Forward – ACCACCCAGAACTACGATGC 

Reverse – GGAACGTGTCGTTCACATTG 

NM_010233.2 

Collagen Iα1  Forward – CACCCTCAAGAGCCTGAGTC 

Reverse – GTTCGGGCTGATGTACCAGT 

NM_007742.3  

α‐sm‐actin  Forward – CTGACAGAGGCACCACTGAA 

Reverse – CATCTCCAGAGTCCAGCACA 

X13297.1 

18S  Forward – AAACGGCTACCACATCCAAG 

Reverse – CCTCCAATGGATCCTCGTTA 

NR_003278 

 

Lung slices as a model to study remodeling 

 141 

2‐photon imaging 

An  immunofluorescent  antibody  staining was  used  to  visualize  α‐smooth muscle‐actin, 

and 2‐photon imaging was used to visualize collagen. For α‐smooth muscle‐actin staining, 

lung slices were washed two times with cytoskeleton buffer (CB: MES (10 mM), NaCl (150 

mM),  EGTA  (5 mM), MgCl2  (5 mM),  and  glucose  (5 mM)  at  pH=6.1)  and  fixed with CB 

containing 3% paraformaldehyde (PFA) for 15 min. Thereafter, slices were incubated with 

CB buffer  containing 3% PFA and 0.3% Triton‐X‐100  for 5 min,  followed by  two washes 

with CB buffer. Lung slices were blocked for 1 h in cyto‐TBS (Tris‐base (20 mM), NaCl (154 

mM),  EGTA  (2.0 mM)  and MgCl2  (2.0 mM),  pH=7.2),  supplemented with  BSA  (1%)  and 

normal  donkey  serum  (2%).  Thereafter,  lung  slices were  stained with  rabbit  anti‐alpha 

smooth muscle actin antibody (Abcam, Cambridge, UK) overnight at 4°C. After washing 3 

times with  cyto‐TBS  containing 0.1% Tween‐20  (cyto‐TBS‐T)  for 10 min,  incubation with 

the secondary antibody  (FITC) was performed during 2 hour at room temperature. Lung 

slices were then washed 3 times for 15 min in cyto‐TBS‐T, followed by 3 washes with ultra‐

pure water.  The  slides were mounted with ProLong Gold  anti‐fade  reagent  (Invitrogen, 

Breda,  The Netherlands).  The  slides were  then  analyzed  using  a  fluorescence  confocal 

microscope (Leica) equipped with a multiphoton laser. The α‐sm‐actin staining was excited 

at  100  nm  and  collected  at  500  nm, whereas  the  collagen  bundles  excited  at  820  nm 

naturally emitted a second harmonic generation signal collected around 410 nm. 

Statistical analysis 

Data  are presented  as mean  ±  s.e. of  the mean.  Statistical differences between means 

were  calculated using  a paired  Student’s  t‐test with  two‐tailed distribution. Differences 

were considered significant at p<0.05. 

 

Results 

Viability of lung slices 

Viability of the  lung slices was assessed by a mitochondrial activity assay after 1, 2 and 3 

days  of  culturing.  As  depicted  in  figure  1,  no  significant  differences were  observed  in 

mitochondrial  activity  for  up  to  three  days  after  culturing.  This  indicates  that  the  lung 

slices are viable for at least three days and can be used for experiments within this period. 

Methacholine‐induced constriction 

MCh  induced a dose‐dependent airway constriction  in PCLS  from wild‐type mice, with a 

maximal effect of 80% airway closure compared to the initial airway lumen (figure 2A). In 

PCLS  from M3R‐/‐ mice,  the airways were more  sensitive  to MCh compared  to wild‐type 

PCLS, but the maximal airway narrowing was only 35% (figure 2A).  

Chapter 7 

142 

 Figure 1. Viability of  lung  slices  is preserved  for  three days. Mitochondrial activity, assessed by  conversion of 

Alamar blue into its reduced form, was not significantly different in the first three days of culture. Data represent 

mean ± s.e. of the mean of 4 animals, 2 slices per animal.  

 

As depicted  in  figure 2B, MCh  induced 40% airway closure  in PCLS  from wild‐type mice 

after  a  single dose of MCh  (10‐4M),  and  airway dilation was obtained  after  subsequent 

addition of chloroquine (10‐3M). In contrast to PCLS from wild‐type animals, in PCLS from 

M3R‐/‐ mice  there was  a  lag  time  after  addition  of MCh  before  the  airway  constriction 

started.  However,  the  constriction  rate was  higher,  and  a  plateau  phase was  reached 

earlier in slices from M3R‐/‐ mice compared to wild‐type mice. The maximal effect of MCh 

in PCLS from M3R‐/‐ mice was 30% closure, and the airways similarly dilated after addition 

of chloroquine  (figure 2B). Oscillations  in airway constriction were observed  in  the PCLS 

from M3R‐/‐ mice, as is demonstrated in figure 2C for a single experiment in which strong 

oscillations were observed. The oscillations can also be observed  in the plateau phase of 

constriction  in figure 2B; however, the effect of the strong oscillations observed  in single 

experiments is leveled out by averaging multiple experiments. 

Lung slices as a model to study remodeling 

 143 

 Figure  2. Methacholine‐induced  airway  constriction  in  PCLS  from  wild‐type  and  M3R

‐/‐  mice.  A:  Airway 

constriction  in response to  increasing concentrations of methacholine (MCh)  in PCLS from wild‐type and M3R‐/‐ 

mice. Data  represent mean ±  s.e. of  the mean, n=8  for wild‐type mice, n=4  for M3R‐/‐ mice, 2‐3 airways were 

quantified  for  each  animal. B: Airways were  constricted with MCh  (10‐4M)  and  after  10 minutes dilated with 

chloroquine (Cq, 10‐3M). Data represent mean of 8 mice, 3‐7 airways were quantified for each animal. For clarity 

reasons,  error  bars  are  omitted.  C. A  single  trace  of  airway  contraction  in  an M3R‐/‐ mouse,  in which  strong 

oscillations can be observed. 

 

Remodeling in PCLS from wild‐type animals 

In order to assess remodeling effects  in PCLS from wild‐type animals, slices were treated 

with  vehicle,  TGF‐β  or MCh  for  two  days,  and  expression  of  the  extracellular  matrix 

proteins fibronectin and collagenIα1, and the contractile protein α‐sm‐actin, was assessed. 

Stimulation with  TGF‐β  for  two  days  induced  a  1.7‐fold  increase  in  fibronectin mRNA 

expression (figure 3A), a 2.4‐fold increase in collagen Iα1 mRNA expression (figure 3B) and 

Chapter 7 

144 

a 2.0‐fold increase in α‐sm‐actin mRNA expression (figure 3C) compared to vehicle control. 

Similar findings were observed on the protein  level for all markers (1.8‐3.2 fold  increase, 

data  not  shown).  In  addition,  to  evaluate  bronchoconstriction‐induced  remodeling,  the 

effects of MCh were assessed. As shown in figure 3, MCh did not induce an increase in the 

mRNA expression of fibronectin, collagenIα1 or α‐sm‐actin. 

 

  

Figure 3. TGF‐β, and not methacholine, induces remodeling in PCLS from wild‐type mice. Lung slices from wild‐

type mice were treated with TGF‐β (2 ng/ml) or methacholine (MCh, 10 µM) for two days. mRNA expression of 

fibronectin (A), collagen  Iα1 (B) and α‐sm‐actin (C) was analyzed. Data represent mean ± s.e. of the mean, n=8 

animals, * p<0.05; ** p<0.01 compared to vehicle treated controls (CTR).  

 

Lung slices as a model to study remodeling 

 145 

Remodeling in M3R‐/‐ animals 

To  investigate  the  potential  involvement  of  the M3  receptor  in  remodeling,  PCLS  from 

M3R‐/‐ mice were treated  in the same way as PCLS from wild‐type animals. Treatment of 

PCLS  from M3R‐/‐ mice with TGF‐β  induced a similar  increase  in  the mRNA expression of 

fibronectin (1.9‐fold, figure 4A), collagen Iα1 (2.1‐fold, figure 4B) and α‐sm‐actin (2.0‐fold, 

figure 4C) as observed in wild‐type animals. Similar to wild‐type animals, stimulation with 

MCh  for  two  days  in M3R‐/‐  mice  did  not  affect  the  expression  levels  of  fibronectin, 

collagen Iα1 or α‐sm‐actin (figure 4). 

  

Figure 4. TGF‐β, and not methacholine,  induces  remodeling  in PCLS  from M3R‐/‐ mice.  Lung  slices  from M3R

‐/‐ 

mice were  treated with  TGF‐β  (2  ng/ml)  or methacholine  (MCh,  10  µM)  for  two  days. mRNA  expression  of 

fibronectin (A), collagen  Iα1 (B) and α‐sm‐actin (C) was analyzed. Data represent mean ± s.e. of the mean, n=6 

animals, * p<0.05; ** p<0.01 compared to vehicle treated controls (CTR). 

Chapter 7 

146 

Localization of α‐sm‐actin and collagen 

To  study  the  localization  of  the  extracellular matrix  and  contractile  protein  expression, 

lung  slices  were  stained  for  α‐sm‐actin  and  visualized  using  a  fluorescent microscope 

equipped  with  a  multiphoton  laser  to  collect  in  addition  the  second  harmonic  signal 

generated  by  the  collagen  bundles  under  a  specific  wave  length. We  confirmed  that 

virtually  all  α‐sm‐actin  and  collagen were  located  around  the  airways,  and  not  in  the 

parenchyma, as is shown by a representative image from a control animal in figure 5. No 

obvious  differences  in  localization  were  observed  after  stimulation  with  TGF‐β  or 

methacholine (data not shown). 

 

Figure 5. Expression of collagen and α‐sm‐actin is localized around the airways. PCLS were stained for α‐sm‐actin 

and  visualized using 2‐photon  imaging,  to  also  visualize  collagen. A  representative  image of  a  control  slice  is 

shown. Red: collagen bundles, green: α‐sm‐actin.

 

Functional effects of remodeling 

Finally, we  investigated whether  stimulation with  TGF‐β  or MCh  for  two  days  affected 

airway  constriction  in  PLCS  from  wild‐type  and  M3R‐/‐  mice  compared  to  control 

conditions. Because PCLS were stimulated with MCh  for two days, desensitization might 

occur. Therefore, we examined  airway  constriction  in  response  to  the  thromboxane A2 

agonist  U46619.  U46619  induced  constriction  in  vehicle  treated  PCLS  from  wild‐type 

animals, with a maximal  closure effect of 55%  compared  to  initial airway  lumen  (figure 

6A). No differences in airway constriction were observed in slices pretreated with TGF‐β or 

MCh  for  two  days.  As  depicted  in  figure  6B,  the maximal  effect  of U46619  on  airway 

closure in PCLS from M3R‐/‐ mice was comparable to that observed in PCLS from wild‐type 

mice, however, this effect was achieved at lower doses of the contractile agonist. Similar 

to wild‐type animals, no effect of pretreatment with TGF‐β or MCh on airway constriction 

to U46619 was observed in PCLS from M3R‐/‐ mice. 

Lung slices as a model to study remodeling 

 147 

 Figure 6. Pretreatment of PCLS with TGF‐β or methacholine does not affect U46619‐induced constriction. Lung 

slices from wild‐type and M3R‐/‐ mice were pretreated with vehicle (CTR), TGF‐β (2 ng/ml) or methacholine (MCh, 

10 µM)  for  two days. Airway constriction  in  response  to  increasing concentrations of U46619 was assessed  in 

wild‐type mice (A) and in M3R‐/‐ mice (B). Data represent mean ± s.e. of the mean of 4 animals, 2‐3 airways were 

quantified for each animal.

 

Discussion 

We hypothesized that mouse PCLS would be a good model to study bronchoconstriction‐

induced airway remodeling and its functional consequences, and aimed to investigate the 

involvement of  the M3  receptor  in  this  response. However,  although TGF‐β  induced  an 

increase  in the expression of fibronectin, collagen and α‐sm‐actin  in the airways of wild‐

type mice and M3R‐/‐ mice, no effect of methacholine on airway remodeling was observed. 

Previously, it has been shown by our lab that methacholine can induce airway remodeling 

in guinea pig PCLS (15). Therefore, species differences could underlie the lack of effect of 

methacholine in mouse PCLS. It is known that maximal contraction towards methacholine 

is higher  in guinea pig PCLS  compared  to mouse PCLS, and  that  the  relative amount of 

airway smooth muscle in the airways is considerably higher in the guinea pig compared to 

the mouse. Moreover,  whereas  guinea  pig  PCLS  stay  contracted  over  48  hours  while 

continuously  stimulated with methacholine, our unpublished observations  indicate  that 

contraction  in  response  to  methacholine  is  rapidly  lost  in  mouse  PCLS  (not  shown). 

Therefore,  the  mouse  PCLS  preparation  may  not  be  a  good  model  to  study 

bronchoconstriction‐induced remodeling, which might be explained by species differences 

between guinea pigs and mice.  

Chapter 7 

148 

TGF‐β  did  induce  features  of  airway  remodeling  in mouse  PCLS, which  is  in  line with 

previous studies (15, 19). However, despite the clear effect of TGF‐β on the expression of 

fibronectin,  collagen  Iα1  and  α‐sm‐actin,  this  did  not  translate  into  changes  in  airway 

contractility. Generally,  it  is assumed that airway remodeling affects airway contractility. 

Here, we were not able to demonstrate such a direct link. Chew et al. demonstrated that 

although  ovalbumin  challenge,  leading  to  airway  remodeling,  induced  airway 

hyperresponiveness  in  vivo,  airway  constriction  of  mouse  PCLS  in  response  to 

acetylcholine  ex  vivo  was  not  altered  (20).  Using  a  similar  approach,  Donovan  et  al. 

demonstrated airway hyperresponiveness to methacholine in vivo and in isolated trachea 

in vitro after ovalbumin challenge, however, in PCLS, airway narrowing was slower and the 

potency  of  methacholine  was  reduced  in  ovalbumin‐challenged  mice  compared  to 

controls  (21).  Although  PCLS  come  closer  to  the  in  vivo  situation  than  single  cells  or 

smooth muscle strips,  it may still be possible  that mechanical differences exist.  It might 

therefore be difficult to demonstrate a direct link between airway remodeling and airway 

contractility.  

Muscarinic  receptor  stimulation  can  augment  TGF‐β‐induced  expression  of  contractile 

proteins  and  extracellular  matrix  proteins  in  airway  smooth  muscle  cells  (22‐24). 

Moreover, Oenema et al. demonstrated in guinea pig PCLS that methacholine can induce 

remodeling via enhanced  release of TGF‐β  (15). Furthermore,  the muscarinic antagonist 

tiotropium has been shown to  inhibit ovalbumin‐induced TGF‐β release, and also airway 

remodeling,  in a mouse model of asthma  (25). Morevoer, TGF‐β  release  is decreased  in 

M3R‐/‐  animals  (chapter  3). Methacholine  has  also  been  shown  to  increase  TGF‐β  and 

collagen  levels  in  biopsies  of  asthma  patients  (9).  Therefore,  methacholine‐induced 

bronchoconstriction,  and  subsequent  TGF‐β  release, may  enhance  airway  remodeling. 

Since we have  shown here  that murine  PCLS may not be  an  adequate model  to  study 

bronchoconstriction‐induced  remodeling,  future  studies  to  investigate  mechanisms 

involved  in  this  response  and  the  potential  involvement  of  the M3  receptor  are  better 

performed using guinea pig or human lung slices. 

In our study, we found limited contraction towards methacholine in M3R‐/‐ mice, which is 

in  line with  previous  studies  using  lung  slices  from M3R‐/‐ mice  (26).  Although  the M3 

receptor is the dominant receptor in mediating airway smooth muscle contraction (27), it 

has been shown that after knock out of the M3 receptor, some contraction can be elicited 

via M2 receptors, and that airway contraction is only completely abolished after knock out 

of  both M2  and M3  receptors  (26,  28,  29).  Therefore,  the  observed  contraction  in  the   

M3R‐/‐ mice might  be mediated  via M2  receptors  in  our  study.  Clearly, methacholine‐

induced  contraction  is  regulated  via  at  least  partially  different  mechanisms  in  M3R‐/‐ 

Lung slices as a model to study remodeling 

 149 

animals than in wild‐type animals. Not only is there a lag time in effect, the contraction in 

M3R‐/‐ mice  also  seemed  to  be  sensitive  to  lower  doses  of methacholine  compared  to 

contraction in WT animals. Using airway smooth muscle strips, Kume et al. demonstrated 

that  contraction  in wild‐type  animals  at  low  concentrations  of methacholine  could  be 

completely  inhibited  by  the M2  antagonist  AF‐DX  116  and  by  pertussis  toxin, whereas 

contraction at higher  concentrations was only partially  inhibited by pertussis  toxin, and 

almost completely mediated via M3 receptors  (30). Similar  findings were observed using 

ileal  smooth  muscle  strips,  in  which  80%  of  the  contraction  was  inhibited  at  low 

concentrations of agonist by pertussis toxin, whereas contraction at higher concentrations 

was not altered by pertussis  toxin and  completely mediated via M3  receptors  (28). This 

might  explain  the  effect  of methacholine  at  low  concentrations  via M2  receptors  after 

knock‐out of the M3 receptors compared to wild‐type animals. Future studies are needed 

to  elucidate  the  exact  mechanisms  underlying  airway  contraction  in  M3R‐/‐  mice.  For 

example, experiments under calcium free conditions, or pretreatment with an M2 receptor 

selective antagonist or pertussis toxin, to uncouple Gi proteins, might help to explain the 

mechanisms involved. 

Finally,  strong  oscillations  in  airway  constriction were  observed  in M3R‐/‐ mice  after  a 

single dose of methacholine, which was not observed in wild‐type animals. Previously, we 

have shown that levels of fibronectin and collagen are lower in the airways of M3R‐/‐ mice 

(chapter 3). Decreased levels of these extracellular matrix proteins might result in altered 

mechanical  stability  of  the  airways  and  thereby  affect  the  capacity  of  the  airway  to 

maintain a  sustained  contraction  in M3R‐/‐ mice. Altered mechanical  stability might also 

explain the enhanced contraction rate  in M3R‐/‐ mice compared to wild‐type mice after a 

single  dose  of  methacholine.  Moreover,  this  might  explain  the  enhanced  airway 

constriction in M3R‐/‐ mice compared to wild‐type mice observed at low concentrations of 

methacholine,  but  also  at  low  concentrations  of U46619.  Increased  sensitivity  for both 

methacholine and U46619 might suggest that this is not a receptor driven process, but is 

rather caused by intrinsic differences in the airways of M3R‐/‐ mice compared to wild‐type 

mice, involving reduced mechanical stability.  

In conclusion, murine PCLS are suitable to study TGF‐β‐induced airway remodeling, but are 

most  likely not an appropriate model  to  study bronchoconstriction‐induced  remodeling. 

This is in contrast to guinea pig PCLS, which are well suited to study this response. 

 

 

 

Chapter 7 

150 

Acknowledgements 

We  would  like  to  thank  the  Netherlands  Lung  Foundation  (grant:  3.2.08.014)  and 

Boehringer Ingelheim (contract number: 43054530) for financial support. Part of the work 

has been performed at the University Medical Center Groningen Imaging and Microscopy 

Center (UMIC), which is sponsored by NWO‐grants 40‐00506‐98‐9021 and 175‐010‐2009‐

023.   

Lung slices as a model to study remodeling 

 151 

References 

(1) Jeffery PK. Remodeling in asthma and chronic obstructive lung disease. Am J Respir Crit Care Med 

2001;164:S28‐S38.  

(2) An SS, Bai TR, Bates JH, Black JL, Brown RH, Brusasco V, Chitano P, Deng L, Dowell M, Eidelman 

DH,  Fabry  B,  Fairbank  NJ,  Ford  LE,  Fredberg  JJ,  Gerthoffer WT,  Gilbert  SH,  Gosens  R,  Gunst  SJ, 

Halayko AJ,  Ingram RH,  Irvin CG,  James AL,  Janssen LJ, King GG, Knight DA, Lauzon AM, Lakser OJ, 

Ludwig MS, Lutchen KR, Maksym GN, Martin JG, Mauad T, McParland BE, Mijailovich SM, Mitchell 

HW, Mitchell RW, Mitzner W, Murphy TM, Pare PD, Pellegrino R, Sanderson MJ, Schellenberg RR, 

Seow CY, Silveira PS, Smith PG, Solway  J, Stephens NL, Sterk PJ, Stewart AG, Tang DD, Tepper RS, 

Tran  T, Wang  L.  Airway  smooth muscle  dynamics:  a  common  pathway  of  airway  obstruction  in 

asthma. Eur Respir J 2007;29:834‐860.  

(3)  Pare PD, Roberts CR, Bai  TR, Wiggs BJ.  The  functional  consequences of  airway  remodeling  in 

asthma. Monaldi Arch Chest Dis 1997;52:589‐596.  

(4) Lemanske RF,Jr, Busse WW. Asthma: clinical expression and molecular mechanisms. J Allergy Clin 

Immunol 2010;125:S95‐102.  

(5) Minshall EM, Leung DY, Martin RJ, Song YL, Cameron L, Ernst P, Hamid Q. Eosinophil‐associated 

TGF‐beta1 mRNA  expression  and  airways  fibrosis  in  bronchial  asthma. Am  J  Respir  Cell Mol  Biol 

1997;17:326‐333.  

(6)  Benayoun  L,  Druilhe  A,  Dombret  MC,  Aubier  M,  Pretolani  M.  Airway  structural  alterations 

selectively associated with severe asthma. Am J Respir Crit Care Med 2003;167:1360‐1368.  

(7) Guilbert TW, Morgan WJ, Zeiger RS, Mauger DT, Boehmer SJ, Szefler SJ, Bacharier LB, Lemanske 

RF,Jr,  Strunk  RC,  Allen DB,  Bloomberg GR, Heldt G,  Krawiec M,  Larsen G,  Liu  AH,  Chinchilli  VM, 

Sorkness CA, Taussig  LM, Martinez FD.  Long‐term  inhaled  corticosteroids  in preschool  children at 

high risk for asthma. N Engl J Med 2006;354:1985‐1997.  

(8)  Murray  CS,  Woodcock  A,  Langley  SJ,  Morris  J,  Custovic  A,  IFWIN  study  team.  Secondary 

prevention  of  asthma  by  the  use  of  Inhaled  Fluticasone  propionate  in Wheezy  INfants  (IFWIN): 

double‐blind, randomised, controlled study. Lancet 2006;368:754‐762.  

(9) Grainge CL, Lau LC, Ward JA, Dulay V, Lahiff G, Wilson S, Holgate S, Davies DE, Howarth PH. Effect 

of bronchoconstriction on airway remodeling in asthma. N Engl J Med 2011;364:2006‐2015.  

(10)  Ressler  B,  Lee  RT,  Randell  SH,  Drazen  JM,  Kamm  RD. Molecular  responses  of  rat  tracheal 

epithelial cells to transmembrane pressure. Am J Physiol Lung Cell Mol Physiol 2000;278:L1264‐72.  

(11) Choe MM, Sporn PH, Swartz MA. An in vitro airway wall model of remodeling. Am J Physiol Lung 

Cell Mol Physiol 2003;285:L427‐33.  

(12)  Swartz  MA,  Tschumperlin  DJ,  Kamm  RD,  Drazen  JM.  Mechanical  stress  is  communicated 

between different  cell  types  to elicit matrix  remodeling. Proc Natl Acad  Sci U  S A  2001;98:6180‐

6185.  

(13) Tatler AL, John AE, Jolly L, Habgood A, Porte J, Brightling C, Knox AJ, Pang L, Sheppard D, Huang 

X,  Jenkins G.  Integrin alphavbeta5‐mediated TGF‐beta activation by airway smooth muscle cells  in 

asthma. J Immunol 2011;187:6094‐6107.  

Chapter 7 

152 

(14) Wahl M,  Eddinger  TJ,  Hai  CM.  Sinusoidal  length  oscillation‐  and  receptor‐mediated mRNA 

expression  of myosin  isoforms  and  alpha‐SM  actin  in  airway  smooth muscle.  Am  J  Physiol  Cell 

Physiol 2004;287:C1697‐708.  

(15) Oenema  TA, Maarsingh H,  Smit M, Groothuis GM, Meurs H, Gosens  R.  Bronchoconstriction 

Induces  TGF‐beta  Release  and  Airway  Remodelling  in  Guinea  Pig  Lung  Slices.  PLoS  One 

2013;8:e65580.  

(16) Yamada M, Miyakawa T, Duttaroy A, Yamanaka A, Moriguchi T, Makita R, Ogawa M, Chou CJ, 

Xia B, Crawley JN, Felder CC, Deng CX, Wess J. Mice lacking the M3 muscarinic acetylcholine receptor 

are hypophagic and lean. Nature 2001;410:207‐212.  

(17) Gosens  R,  Baarsma HA, Heijink  IH, Oenema  TA, Halayko  AJ, Meurs H,  Schmidt M. De  novo 

synthesis  of  {beta}‐catenin  via H‐Ras  and MEK  regulates  airway  smooth muscle  growth.  FASEB  J 

2010;24:757‐768.  

(18) Rosner SR, Ram‐Mohan S, Paez‐Cortez JR, Lavoie TL, Dowell ML, Yuan L, Ai X, Fine A, Aird WC, 

Solway  J,  Fredberg  JJ,  Krishnan  R.  Airway  contractility  in  the  precision‐cut  lung  slice  after 

cryopreservation. Am J Respir Cell Mol Biol 2014;50:876‐881.  

(19) Halwani  R,  Al‐Muhsen  S,  Al‐Jahdali H, Hamid Q.  Role  of  transforming  growth  factor‐beta  in 

airway remodeling in asthma. Am J Respir Cell Mol Biol 2011;44:127‐133.  

(20)  Chew  AD,  Hirota  JA,  Ellis  R, Wattie  J,  Inman MD,  Janssen  LJ.  Effects  of  allergen  on  airway 

narrowing dynamics as assessed by lung‐slice technique. Eur Respir J 2008;31:532‐538.  

(21) Donovan C, Royce SG, Esposito J, Tran J, Ibrahim ZA, Tang ML, Bailey S, Bourke JE. Differential 

effects of allergen challenge on large and small airway reactivity in mice. PLoS One 2013;8:e74101.  

(22) Goldsmith AM, Bentley  JK,  Zhou  L,  Jia  Y, Bitar KN,  Fingar DC, Hershenson MB.  Transforming 

growth  factor‐beta  induces  airway  smooth  muscle  hypertrophy.  Am  J  Respir  Cell  Mol  Biol 

2006;34:247‐254.  

(23) Oenema TA, Mensink G, Smedinga L, Halayko AJ, Zaagsma J, Meurs H, Gosens R, Dekkers BG. 

Cross‐talk  between  transforming  growth  factor‐beta(1)  and muscarinic M(2)  receptors  augments 

airway smooth muscle proliferation. Am J Respir Cell Mol Biol 2013;49:18‐27.  

(24) Oenema TA, Smit M, Smedinga L, Racke K, Halayko AJ, Meurs H, Gosens R. Muscarinic receptor 

stimulation augments TGF‐beta1‐induced  contractile protein expression by airway  smooth muscle 

cells. Am J Physiol Lung Cell Mol Physiol 2012;303:L589‐97.  

(25) Ohta S, Oda N, Yokoe T, Tanaka A, Yamamoto Y, Watanabe Y, Minoguchi K, Ohnishi T, Hirose T, 

Nagase H, Ohta K, Adachi M. Effect of tiotropium bromide on airway inflammation and remodelling 

in a mouse model of asthma. Clin Exp Allergy 2010;40:1266‐1275.  

(26)  Struckmann  N,  Schwering  S,  Wiegand  S,  Gschnell  A,  Yamada  M,  Kummer  W,  Wess  J, 

Haberberger  RV.  Role  of muscarinic  receptor  subtypes  in  the  constriction  of  peripheral  airways: 

studies on receptor‐deficient mice. Mol Pharmacol 2003;64:1444‐1451.  

(27) Roffel AF, Elzinga CR, Van Amsterdam RG, De Zeeuw RA, Zaagsma J. Muscarinic M2 receptors in 

bovine  tracheal  smooth  muscle:  discrepancies  between  binding  and  function.  Eur  J  Pharmacol 

1988;153:73‐82.  

(28) Unno  T, Matsuyama H,  Sakamoto  T, Uchiyama M,  Izumi  Y, Okamoto H,  Yamada M, Wess  J, 

Komori S. M(2) and M(3) muscarinic receptor‐mediated contractions in longitudinal smooth muscle 

of the ileum studied with receptor knockout mice. Br J Pharmacol 2005;146:98‐108.  

Lung slices as a model to study remodeling 

 153 

(29) Ehlert FJ. Pharmacological analysis of the contractile role of M2 and M3 muscarinic receptors in 

smooth muscle. Receptors Channels 2003;9:261‐277.  

(30) Kume H, Mikawa K, Takagi K, Kotlikoff MI. Role of G proteins and KCa channels in the muscarinic 

and beta‐adrenergic regulation of airway smooth muscle. Am J Physiol 1995;268:L221‐9.