vectores de clonacion m13

8/9/2019 Vectores de Clonacion M13

1/9

Gene, 26 (1983) 91-99Elsevier

GENE 897

Short Communications

New versatile cloning aad sequencing vectors based on bacteriophage Ml3

(Recombinant DNA; polylinker; oligonucleotide synthesis)

M.P. Kieny, R. Lathe * and J.P. Lecocq

(Received July 5th, 1983)

(Revision received August 2&h, 1983)(Accepted August 31st, 1983)

91

SUMMARY

A new pair of cloning and sequencing vectors based on bacte~oph~e M 13mp7 has been developed. Thesevectors (M13tg130 and M13tg131) contain, in addition to the EC&I, BamHI, HindIII, SmaI, Sal1 and &Isites present in other vectors [cf., M 13mpS and M13mp9, Messing and Vieira, Gene 19 (1982) 269-2761, uniquerestriction recognition sequences for the enzymes EcoRV, &&I, Sph I, SstI and XbaI. A restriction site for theenzyme BglII has been incorporated into the polylinker region of one of the vector pair to permit rapiddiscrimination between the two vectors.

INTRODUCHON

Ml3 is a male-specific fllamentous bacteriophageof Escherichia coli which, after infection, proliferates

as a double-stranded plasmid form within the host.V&ions cont~ning complete circular singe-str~dedgenomes are concomitantly exported from the cell.DNA packaging in Ml3 has no defined size limit,and DNA fragments inserted into the double-stranded phage replicative form can be recoveredfrom the phage particle in a unique single-stranded

* To whom all correspondence should be addressed.

Abbreviations: bp, base pairs; DMSO, dimethylsulfoxide; X-gal,5-bromo 4-chloro, indolyl ED-galactopyranoside. Restrictionrecognition sequences are presented as 5-3; the exact cleavagesite is presented by a slash (/).

0378-I 119/83/$03.00 0 1983 Elsevier Science Publishers

form. This property permits the rapid preparation ofsingle-stranded template material suitable for primeddideoxy sequencing (Sanger et al., 1977; 1980).Single-stranded bacteriophage vectors have also

proved to be of great utility in the local&d muta-genesis of inserted DNA fr~ents by either thebisuifite (Everett and Chambon, 1982; Weiher andSchalIer, 1982) or oligonucleotide-directed (Smithand Gillam, 1981) protocols. Such vectors havefurther allowed the preparation of strand-specificprobes for hybridisation studies (Hu and Messing,1982) and permitted the identification of specificclones by hybrid arrest translation (Chandler, 1982).

Messing et al. (1977) describe the incorporation ofa segment of the E. coli lac operon into bacteriophageM13. Here complementation between the phage-borne IacZ segment and a chromosomal lucZ mu-tation permits the production of functional j?-galac-


2/9

92

tosidase in the infected celI. Further manipulation ofthis hybrid (Messing et al., 1981) yielded a vector,M 13mp7, in which an array of restriction sites wasinserted, without disrupting the translation readingframe, into the N-terminal region of the phageP-galactosidase segment.

Messing and Vieira (1982) have reported the con-struction of two new advanced M 13 vectors,M13mp8 and M13mp9, whose polylinker regionscontain further unique restriction sites for enzymesHind111 and SmaI. In addition, they cite vectorsM 13mp 10 and M 13mp 11 containing unique sites forSstl and XbaI.

We have extended their approach to incorporatenew unique recognition sequences and the twovectors described here, M13tg130 and M13tg131,present a total of 11 unique restriction recognitionsequences suitable for cloning fragments with dis-similar termini in either orientation. In common withother Ml3 vectors, insertion of an exogenous DNAfragment may be recognized by the abolition ofcoloration with X-gal, a synthetic chromogenic sub-strate for the fl-galactosidase.

EXPERIMENTAL

(a) Incorporation of new unique restriction sites;design of the synthetic block

To improve the versatility of our M 13 vectors wejudged that the introduction of cleavage sequencesfor the enzymes EcoRV, HindIII, KpnI, Smal, Sph I,SstI and X6aI might prove to be the most useful.

In the design of a synthetic polylinker segment amajor concern was to avoid the generation of hairpinstructures in the single-stranded poiylinker regionpresent in the mature bacteriophage genome whichinterfere with primed dideoxy sequencing. Invertedrepeated sequences as short as four in length can, incertain circumstances, cause significant distortion ofthe gel pattern obtained (see Sanger et al., 1977).Further, we felt it essential to conserve the readingframe of the /%galactosidase (cad) a-peptide intowhich the polylinker region was to be inserted. A

particular problem was encountered here with therecognition sequence of XbuJ (TCTAGA) whichcontains a potential stop codon. Our eventual

intention was to construct a second vector containingthe complete polylinker segment in the reverse orien-tation. As the sequence TAG occurs in both strands,many of our preliminary designs entailed an in-phasetranslation-termination codon. In addition, certainrecognition sequences (e.g., HindIII; AAGCTT andSs t I; GAGCTC) create a stop codon (here TGA)when placed side by side.

Computer assisted analysis (not presented) per-mitted the identification of a number of permissiblesequences, and the order of restriction sites EcuRI,SmaI, Sst I, EcoRV, SphI, KpnI, XbaI, HindIII,BarnHI, S&f, PstI was chosen for our final con-struction.

To minimize our requirements for synthetic oligo-

nucleotide synthesis, we elected to synthesise a blockcomprising the SmaI, Ss t I, EcoRV, Sph I, KpnI andXbaI recognition sequences. This was subsequentlyintroduced between the EcoRI and Hind111 sitesM13tg109 (Lathe et al., 1983b, see Fig. 1) to recon-struct the complete polylinker segment. To facilitatethis construction, the initial cloning of the syntheticblock was performed in a plasmid vector.

(h) Cloning of the synthetic polylinker segment

Oligonucleotides 5-dAATTCCCGGGAGAGC-TCGATATCGCAT-3 (27-mer) and 5-dAGCTT-CTTCTAGAGGTACCGCATGCGATA-3 (29mer) were synthesised using solid-phase phos-photriester techniques (Narang et al., 1980; Kohliet al., 1982) and purified by high-pressure liquidchromatography (Fritz et al., 1978; Gait andSheppard, 1977). After hybridisation of the 8-meroverlap at their 3 termini, DNA polymerase I(Klenow fragments was used to fiI1 in the singie-stranded regions to give a duplex 48-mer. At thesame time, plasmid pBR322 (Bolivar et al., 1977)was cleaved to completion with Clal (cleavage siteAT/CGAT) and Sal1 (G/TCGAC) and the cohesiveends filled in using DNA polymerase as before. Thisprocedure results in the generation of the 3-G at theC&I site and a 5-T at the SafI site, suitable for theregeneration of restriction recognition sequencesafter ligation to the duplex 48-mer (Fig. 2) *

* Our original intention was to ligate the two oligonucleotidcs

into termini generated by digestion with EcoRl and Hind111 in amanner analogous to the procedure for the terminal addition of


3/9

93

tll3mp7

Ml 3mp701

lMetThrMetIleThrAsnSerProAspProSerlhrCysArgSerlhrAspProGlyAmnSerL~uAlaATGACCATGATTACGAATTCCCCGGATCCGTCGACCTGCAGGTCGACGGAlCCGGGGAAllCAClGSCCTACTGGTACTAATGCTTAAGGGGCCTAGGCAGCTGGACGTCCAGClGCCTAGGCCCCTTAAGlGACCGG

****t* r****t *****t ***a** *****a

****** ******

ECORI BamHI Sal1 PstI SO11 B0mHI E c o R I

Hind11 Hind11

AccI AccI

tMetThrMetIleThrAsnSerProAspProSerThrCysSerAsnSarLauAlaATGACCATGATTACGAATTCCCCGGATCCGTCGACCTGCAGCAATTCACTGGCCTACTGGTACTAATGCTTAAGGGGCCTAGGCAGCTGGACGTCGTTAAGTGACCGG

**tt** *t**** *a**********

EcoRI BamHI Sal1 Pst IHind11AccI

M13tg109 t~etThrMetIleThrAsnSerProAspProLysLeuGlyIleArgArgProAlaAlaIloHisATGACCATGATTACGAATTCCCCGGATCCCAAGCTTGGGATCCGTCGACCTGCAGCAATTCACTACTGGTACTAATGCTTAAGGGGCCTAGGGTTCGAACCCTAGGCAGCTGGACGTCGTTAAGTG

****** ****** **t*** ****** ******

******EcoRI BamHI Hind111 BamHI Sal1 Pot I

Hind11AccI

M13tgllO CMatThrMetIleThrAsnSerProAspProSerLysLeuGlyProAlaAlaIleHi6ATGACCATGATTACGAATTCCCCGGATCCGTCCAAGCTTGGACCTGCAGCAATTCACTACTGGTACTAATGCTTAAGGGGCCTAGGCAGGTTCGAACCTGGACGTCGTTAAGTG

***t** *t**** ****** ******

EcoRI BamHI Hind111 Pst I

M13tg115 CHetThrM~tIleThrGlnIleCysProGlySerValGlnA~aTrpThrCysSerA~nSarLeuAlaATGACCATGATTACGCAGATCTGCCCCGGATCCGTCCAAGCTTGGACCTGCAGCAATTCACTGGCC

TACTGGTACTAATGCGTCTAGACGGGGCCTAGGCAGGTTCGAACCTGGACGTCGTTAAGTGACCGG****** ****t* ***t** ******

BglII BamHI Hind111 Pt I

M13tg119 fMetThrfletIleThrGlnIleCysSerAsnSerLeuAlaATGACCATGATTACGCAGATCTGCAGCAATTCACTGGCCTACTGGTACTAATGCGTCTAGACGTCGTTAAGTGACCGG

***********t

GglII PstI

M13tg120 f~etThrMetIleThrGlnIlcCysArgSerThrAspProGlyAsnSerLeuAlaATGACCATGATTACGCAGATCTGCAGGTCGACGGATCCGGGGAATTCACTGGCCTACTGGTACTPATGCGTCTAGACGTCCAGCTGCCTAGGCCCCTTAAGTGACCGG

****** ****** ********w.** ******

BglII PstI Sal1 BamHI EcoRIHind11AccI

Fig. 1. Nuckot ide sequences of vector phage M13mp7 (Messing et al., 1981) M13mp701 (Bentley, D.R., personal communication),

M13tgIO9 and 110 (Lathe et al., 1983b) and M13tgl15, 119 and 120 (this work) in the N-terminal section of the p-galactosidase (lucZ)gene. Restriction recognition sequences are indicated.

adaptor ohgonucleotides described previously (Lathe et al.,

1982). Here oligonucleotides complementary to the singlc-

stranded extension produced by certain enzymes are able to

hydrogen-bond with and be ligated into such termini. Subsequent

repair in vitro should, in theory, reconstruct a viable circular

molecule having incorporated the polylinker segment (see also

Messing et al., 1981). This approach was not successful,


4/9

94

pBR322

C/a1 S/k Sal1 site5--ATCGATp GTCGAC -- 33--TAGCTA CAGCTG -- 5

OLIGONUCLEOTIDES

5AATTCCCGGGAGAGCTCGATATCGCAT 33,ATAGCGTACGCCATGGAGATCTTCTTCGA 5,

Cbl+

Sal1 pal I (Klenow)

5AATTCCCGGGAGAGCTCGATATCGCATGCGGTACCTCTAGAAGAAGCT3

,TCGAC --

G-- 3,TTAAGGGCCCTCTCGAGCTATAGCGTACGCCATGGAGATCTTCTTCGA5--AT--TAGC

pol I (Klenowl

--ATCG 3--TAGC 5,

I

5TCGAC --3,AGCTG--

EcoRI .%a* Sst I Eco RV Sph I Kpn I Xba I Hind I I I

5*--ATC+i&&AG~&i?i??66%6i%t~AG&&$CGAC--3~--TAGCITTMGGGCCCTCTCGAGCTATAGCGTACGCCATGGAGATCTTCTTCGAIAGCTG--~

Fig. 2. Construction and cloning of a synthetic polylinker block. The C/al an d .Safl sites of pBR322 were cleaved and filled m using DNA

polymerase. The two synthetic oligonucleotides were hybridised together, the single-stranded extensions filled in and the duplex segmentinserted between the tilled in CIuI and Sal1 sites of plasmid pBR322 to regenerate the EcoRI and Hind111 recognition sequences.

Plasmid pBR322 cut with CIaI and Sal1 and

repaired with DNA polymerase I Klenow fragmentwas ligated overnight with an excess of polylinkerduplex. Since the synthetic oligonucleotide lacks 5terminal phosphate groups ligation was restricted toone strand at the oligonucleotide-vector junction.This resulted in termini carrying single-stranded andcomplementary oligonucleotides which permit recir-cularisation of the vector in vivo (for a discussion ofthis strategy see Lathe et al., 1983a). Following an80 C heat step to dissociate the duplex, excess oligo-nucleotides were removed by precipitation with sper-mine (Hoopes and McClure, 1981) in the presenceof 30% DMSO. After rehybridisation of the oligonu-cleotide-tailed extremities to permit recircularisation,this material was transformed into E. co/i 8759(Murray et al., 1977) and ampicillin-resistant colo-nies were selected.

A total of 150 colonies were screened by a modili-cation of the procedure of Wallace et al. (198 1 b) forsequences hybridising to the *P-labelled oligonu-

cleotides. Ten colonies gave a positive signal with the29-mer and nine with the 27-mer. Only one gave,under our conditions of hybridisation, a positivesignal with both probes (clone 3). These clones wereexamined by direct plasmid sequencing (Wallaceet al., 198 la) using an oligonucleotide primer capableof generating sequence data from the region imme-diately flanking the ClaI site of plasmid pBR322.

All clones examined were found to have incorpo-rated only a section of the complete polylinkerduplex. We have no clear explanation for this result.Nevertheless, two plasmids (clones 3 and 7) hadincorporated segments of the polylinker duplex sui-table for reconstruction of the complete segment byconventional restriction and religation.

(c) Construction of ptg130 by recombining polylinkersegments

Clone 3 contains the right hand (SstI, EcoRV,Sph I, KpnI, X6a1, HindIII) segment of the synthetic


5/9

95

M13tg130__- __---

fMetThrMetIleThrAsnSerArgGluSerSerIleSerHisAlaValProLeuGluGluAlaTrpA~pPr~CysThrCysSerAsnSerLeuATGACCATGATTACGAATTCCCGGGAGAGCTCGATATCGCATGCGGTA&CTCTAGAAGAAGCTT~GGATCCGTCGAC~TG~AGCAATTCACTGTACTGGTACTAATGCTTAAGGGCCCTCTCTCGAGCGTACGCCATGGAGATCTTCTTCGAACC~TAGGCAG~TGGACGTCGTTAAGTGAC

*****I* *ux**I ****** ****** xx**** ****** ******

*****x *****a ****** ******EcoRI SmaI SstI EcoRV SphI KpnI Xbal Hind111 BemHI Sal1 PstI

AccIHind11

M13tg131__----__

fMetThrMetIleThrGlnIleCysArgSerThrAspProLy~LeuLeuLeuGluValProHisAlaIleSerSerSerProGlyAsnSerLeuATGACCATGATTACGCAGATCTGCAGGTCGACGGATCCCAAGCTTCTTCTAGAGGTACCGCATGCGA~ATCGAGCTCTCCCGGGAATTCACTGTACTGGTACTAATGCGTCTAGACGTCCAGCTGCCTAGGGTTCGAAGAAGATCTCCATGGCGTACGCTATAGCTGCAGAGGGCC~TTAAGTGAC

****** *****x ****I* ****** ****** ****** ******I%%c*XV x*x*** ****** ****I* ***x*x

83111 PstI Sal1 BamHI Hind111 XbaI KpnI SphI ECORV SstI SmaI EcoRIHind11AccI

Fig. . Nucleotide sequences of M13tgl30 and M 13tg13 1 in the N-terminal section of the lucZ gene. In both the reading frame of the1ucZ gene is conserved. Restriction recognition sequences are indicated.

block, whereas clone 7 carries the left-hand (EcoRI,SmaI, Ss61, EcoRV) section (not shown). The twosegments were therefore combined through their Sst Isites, taking advantage of an outside Pst I site presentin the Ap gene of the plasmid vector. The twoplasmids were cleaved to completion with PstI andSst I and ligated in equimolar propo~ions. Three outof twelve Ap transformants contained plasmidssensitive to cleavage with both SmaI and XbaI, andsequence analysis revealed that these plasmidscarried the complete synthetic block (ptgl30).

(d) Construction of bacteriophage M13tg130

Bacteriophage M13tg109 (Lathe et al., 1983b)contains the following series of restriction sites at theN-terminus of the IacZ gene: EcoRI-BarnHI--~~~dIII-~~rnHI-~a~I-P~t I (see Fig. 1). The poly-linker segment present in ptgl30 comprises a total ofsix additional restriction recognition sequencesflanked by EcoRI and Hind111 sites. We thereforeinserted the EcoRI-Hind111 section from ptgl30between the EcoRI and Hind111 sites of Ml3t8109to create the complete polylinker segment. Thisexchange deletes the first BamHI site presentin Ml3tg109, the second site becoming unique.Double-stranded DNAs from M13tg109 and ptgl30

were digested to completion with EcoRI and Hind111and ligated together prior to transfection of M 13 hoststrain JM103 (Messing et al., 1981). Lac plaqueswere picked from a background of parentalM13tg109 lac- plaques and subjected to dideoxysequencing (Sanger et al., 1977) using a commerciallyavailable primer 5-dT~A~GACG~GT-3 or asecond primer 5-dAGTCACGACGTTGTA-3synthesised in this laboratory. Ten out of ten bac-teriophages presented the correct nucleotide se-quence (Fig. 3) and one such isolate, M13tg130, wasretained.

(e) Construction of a vector permitting inversion ofinserted DNA fragments

The rapid sequencing protocols described bySanger et al. (1980) and Messing et al. (1981)generate sequence data from one end of a particularinserted DNA fragment. Only if the fragment isflanked by identical termini can the orientation of theinsert be easily reversed. Although it is possible insome cases to obtain sequence data directly from theother extremity of an inserted fragment (Hong,1981), the required manipulations are technicallycomplex.

It was therefore of interest to construct a vector


6/9

M 13tg 13 1, in which the array of cloning sites is in the

opposite orientation to that in M13tg130. Sincereversal of the orientation of an inserted DNA frag-ment ultimately involves mixing material derivedfrom both vectors, we felt it necessary to have a

means for discriminating the reversed vector

(M13tg131) from its complement (M13tg130)without recourse to nucleic acid sequencing. To thisend an additional BglII recognition sequence was

introduced into the cloning region of M 13tgllO as afirst step towards the construction of M13tg131.In the construction of vector phage M 13mp7, aBgfIIrecognition sequence was acquired at the Ace1 site ofM 13 (see Messing et al., 198 1). The presence of thisBglII site prohibits the insertion of a second site

BglII by the addition of linker oligonucleotides, forthe required cleavage with BglII after linker additionwould result in cleavage at the outside site. Linkeroligotlucleotides lacking 5-terminal phosphategroups were used to limit ligation to only one strandat each linker-vector junction (linker tailing). This

results in termini carrying single-stranded and com-plementary oligonucleotides which permit recirculari-sation in vivo, eliminating the necessity for subse-quent cleavage by the cognate restriction enzyme

(Lathe, R., Kieny, M.P., Skory, S. and Lecocq, J.P.,in preparation).

Bacteriophage M 13tgl10 is a derivative of vectorM13mp701 (Bentley, D.R., personal communica-

tion) in which the Sal1 site has been replaced by aHind111 site. This replacement disrupts the lacZreading frame to give a luc - vector. M 13tgllO waschosen since the construction will reconstitute thereading frame to generate a lac + phage. The nucleo-tide sequence at the beginning of the I&Z gene ispresented in Fig. 1.

Replicative form DNA from M 13tg 110 was cleav-ed with EcoRI, the single-stranded protrusions re-moved by treatment with S 1 nuclease, and the flushtermini ligated overnight with an excess of non-phosphorylated linker oligonucleotides 5 -dCA-GATCTG-3. Following precipitation with spermineand reannealing the linker-tailed vector was trans-fected into E. coli, and 15 out of 24 luc + phages werefound to have incorporated a BglII recognitionsequence at the EcoRI site (M13tg11.5; see Fig. I).

In vector phage M13mp7 (Messing et al., 198 I)the arrangement of sites in the N-terminal section ofthe iucZ gene is, schematically, ATG-EBSPSBE,

where ATG codes for the N-terminal methioninc offl-galactosidase and E, B, S, and Pare the recognitionsequences for EroRI, BN/~~HI, S~rl1 (AccI. NirrdII)

and Y.cf respectively. In M 13mp701 (Bentley. D.K..personal coIn~llun~c~~ti~~n) the second repcat has

been deleted to generate ATG-EBSP where the Ps? Irecognition sequence now abuts sequences formerlyadjacent to the distal EcoRI site (see Fig. 1).

To generate a vector of structure ATG - PSBE (the

opposite orientation to that of M 13mp701) WGpositioned a PsrI recognition sequence close to thesite originally occupied by the proximal EcoRI recog-nition sequence of M 13mp7 by fusing the distal Pst Isite of M 13mp701 with the proximal BglII sitepresent in M 13tgl15. Double-stranded replicative

form DNA M 13tg 115 was cleaved with Pst I, partial-ly digested with BglII. and religated in the presenceof B&II-PstI adaptor oligonucleotide 5-dGA-TCTGCA-3 (Lathe et al., 1982). to fuse the P.FIIand Bg/II sites and regenerate both recognitionsequences. Eleven out of twelve Lac plaques

emerging after transfection presented the desirednucleotide sequence (M 13tgl19; see Fig. 1).

In a subsequent step we linked the proximal Pst Isite deriving from M 13tg 119 to the distal EcoRI site

from M 13mp7 through the array of restriction recog-nition sequences present in M 13mp70 1. Replicativeform DNA from M13tg119 was cleaved with PstIand additionally at the unique external Bg/I site and

dephosphorylated using calf intestinal phosphatase.M 13mp70 1 and M 13mp7 were cleaved with Pst I +EcoRI and EcoRI + BglI respectively. After ligationand transfection into E. cd, four out of luc + phagesyielded the correct restriction profile and ofthese twohad the desired nucleotide sequence (M 13tg120; seeFig. 1).

(f) Construction of the complementary vector:M13tg.131

This final construction involved the insertion ofthe complete polylinker segment of M 13tg130 intothe intermediate vector M13tg120. Replicative formDNAs of M13tg130 and M13tg120 were cleavedwith Pst I and EcoRI, ligated, and transfected intoJM 103. About 30/, of lac + phages examined pres-

ented the desired sequence (M 13tg 13 1; see Fig. 3).The various manipulations performed upon the mul-tiple restriction site segment to generate M13tg130


7/9

91

f 3 CHEMICAL

6

Fig. 4. Schematic summary of the construction of M13tg130 and M13tg131. Only the multiple restriction site (polylinker) segmentsare presented. Restriction sites which are unique in each bacteriophage are presented above the line; sites occurring more than onceare below the line. The various steps in the construction were: (1) Deletion of the second EcoRI-P&I repeat in M13mp7 to generateM13mp701 (Bentley, D.R., personal comm~ication); (2) insertion of H&d111 linker oligonucleotides at the BumHI or Sal1 sites of

M13mp701 to generate Ml3tg109 and M13tgllO (Lathe et al., 1983b); (3) insertion of a EglII linker into the EcoRI site of MlkgllOto generate M13tgl15; (4) fusion of the Bg/II and PsrI sites of M13tgl15 using an adaptor oligonucleotide such as to regenerate bothrecognition sequences; (5) insertion of the polylinker segment from M13mp701 in the reversed orientation to generate M13tg120; (6)insertion of the synthetic polyli~er segment from ptgi30 between the EcoRI and Hind111 sites of M13tglO9 to generate M13tg130; (7)insertion of the complete polylinker segment from M13tg130 between the EcoRI and &I sites of Ml3tg120, reversing the orientationof the segment to generate M13tg131.


8/9

98

and M13tg13 1 are outlined in Fig. 4. A detailed mapof M13tg130 and 131 is presented in Fig. 5.

(g) A new pair of versatile Ml3 vectors; M13tg130and M13tg131

To extend the range and versatility of M 13 vectors,we have constructed a new pair of bacteriophages,M13tg130 and M13tg131, which comprise a total of

eleven unique restriction sites. As with other vectors,insertion of exogenous DNA fragments into thepolylinker region may be detected by the abolition ofcoloration with X-gal. These vectors, deriving from

the parental bacteriophage M 13mp7 (Messing et al.,1981), lack extraneous DNA and give reliable se-

quence data with all primers tested *. In our designof the vectors we attempted to remove all possiblesecondary structure generated by the polylinkerregion, and this is evidenced by the uniformity of thegel patterns obtained (not shown).

When inverting the orientation of an inserted

DNA fragment by transfer between vectors, it isuseful to have a means of distinguishing the parentalfrom the inversion vector. A final modificationinvolved the inclusion of a restriction recognition site

(BglII) in the polylinker region of one of the twobacteriophages (M13tg131), to permit the rapiddiscrimination between the two vectors by directrestriction analysis of their replicative form DNAs.

In the accompanying paper, Norrander et al.

(1983) describe the preparation of two new vectors,M13mp18 and 19, with characteristics broadlysimilar to the vectors described here.

ACKNOWLEDGEMENTS

We thank D.R. Bentley (Sir William Dunn Schoolof Pathology, University of Oxford) for vectorM 13mp70 1. We gratefully acknowledge technicalassistance from A. Findeli, D. Schmitt, S. Skory andD. Villeval, and thank I. Batra for help in preparingthe text. We are particularly indebted to A. Ballandand V. Kohli (Department of Chemistry, Transg&neS.A.) for their synthesis of the long oligonucleotidesdescribed in this paper. We thank P. Kourilsky and

P. Chambon for their continued interest in this workand M. Gottesman for critical comments on themanuscript.

Fig.5. Map of M13tg130 and M13tg131. Numerbering of

nucleotides and Ml3 structural genes is according to Van

Wezenbeek et al. (1980). Major restriction sites are indicated;

the position of each si te is defined by the first nucleotide of the

recognition sequence. Coordinates for the polylinker segment

correspond to theEcoR1 sites ofM13tg130(6231)and M13tg131

(6300). on: origin of Ml 3 replication. lack : inactive C-terminalsegment of the luc repressor gene. IacZ : N-terminal section ofthe fl-galactosidase gene coding for a peptide active in alpha

complementation; the promoter forlutZ transcription is locatedbetween the lucl and IucZ genes.

* We have routinely observed that certain vector-primer combi-

nations cannot be used to generate sequence data by the dideoxy

technique. For instance, under standard conditions. we have

been unable to use the commercially-available primers S-

dTCACGACGTTGT-3, 5.dTCCCAGTCACGACGT-3 and

5.dCCCAGTCACGACGTT-3 to sequence material inserted

into the polylinker region ofbacteriophage M13mp9, whereas the

same primers can be used to success with M13mp8 (Findeli, A.,

Kieny, M.P. and Lathe, R., unpublished data). Similar incompa-

tability has been observed with our own primer 5-dAGCTAC-

GACGTTGTA-3. In contrast, the longer primer 5-

dGATCCGGACGTTGTAAAACGACGGCCAGTG-3 (also

available commercially) and a downstream primer 5-dAAGGC-

GATTAAGTTG-3 prepared in this laboratory give reliable

sequence data with both bacteriophages. We have used the

downstream primer to demonstrate that the phenomenon is not

due to mutation in the primer-complementary region of

M13mp9. We cannot exclude the possibility that this effect is

linked to the 370-bp Htr~Il fragment of pBR322 DNA present,

in M 13mp9 but not in M 13mp8, at the Narl site of the lcrcl gene

segment (see addendum in Messing and Vieira, 1982). M13tg130

and 131 have been examined for their compatibility with the

various primers, and all tested were found to give reliablesequence data.


9/9

99

REFERENCES

Bolivar, F., Rodriguez, R.L., Greene, P.J., Betlach, M.C.,Heynecker, H.L., Boyer, H.W., Crosa, J.H. and Falkow, S.:Construction and characterization of new cloning vehicles,

II. A multipurpose cloning system. Gene 2 (1977) 95-113.Chandler, P.M.: The use of single-stranded phage DNAs inhybrid arrest and release translation. Analyt. Biochem. 127(1982) 9-16.

Everett, R. and Chambon, P.: A rapid and efficient method forregion and strand-specific mutagenesis of cloned DNA.EMBO J. (1982) 433-437.

Fritz, H.J., Belagaje, R., Brown, E.L., Fritz, R.H., Jones, R.A.,Lees, R.G. and Khorana, H.G.: High pressure liquid chroma-tography in polynucleotide synthesis. Biochemistry 17 (1978)1257-1267.

Gait, M.J. and Sheppard, R.C.: Rapid synthesis of oligodeoxynu-cleotides: a new solid phase method. NucL Acids Res. 4(1977) 1135-1158.

Hong, G.F.: A method for sequencing single-stranded clonedDNA in both directions. Biosci. Rep. 1 (1981) 243-252.

Hoopes, B.C. and McClure, R.R.: Studies on the selectivity ofDNA precipitation by spermine. Nucl. Acids Res. 9 (1981)5493-5504.

Hu, N.T. and Messing, J.: The making of strand-specific Ml3probes. Gene 17 (1982) 271-277.

Kohli, V., Balland, A., Wintzerith, M., Sauerwald, R., Staub, A.and Lecocq, J.P.: Silica gel: An improved support for thesolid-phase synthesis of oligonucleotides. Nucl. Acids Res. 10(1982) 7439-7448.

Lathe, R., Balland, A., Kohli, V. and Lecocq, J.P.: Fusion ofrestriction termini using synthetic adaptor oligonucleotides.Gene 20 (1982) 187-195.

Lathe, R., Lecocq, J.P. and Everett, R.: DNA engineering: theuse ofenzymes, chemicals and oligonucleotides to restructureDNA sequences in vitro, in Williamson, R. (Ed.), GeneticEngineering, Academic Press, London, 1983a, pp. l-56.

Lathe, R., Kieny, M.P., Schmitt, D., Curtis, P. and Lecocq, J.P.:Ml3 bacteriophage vectors for the expression of foreignproteins in E. coli: The rabies glycoprotein. J. Mol. Appl.Genet. (1983b) in press.

Messing, J., Gronenborn, B., Mtiller-Hill, B. and Hofschneider,P.H.: Filamentous coliphage Ml3 as a cloning vehicle:Insertion of a Hind11 fragment of the luc regulatory region inMl3 replicative form in vitro. Proc. Natl. Acad. Sci. USA 74(1977) 3642-3646.

Messing, J., Crea, R. and Seeburg, P.H.: A system for shotgunsequencing. Nucl. Acids Res. 9 (1981) 309-321.

Messing, J. and Vieira, J.: A new pair of M 13 vectors for selectingeither double-digest restriction fragments. Gene 19 (1982)269-276.

Murray, N.E., Brammar, W.J. and Murray, K.: Lambdoid phagesthat simplify the recovery of in vitro recombinants. Mol. Gen.Genet. 150 (1977) 53-61.

Narang, S.A., Brousseau, R., Hsiung, H.M. and Michniewicz,J.J.: Chemical synthesis of deoxyoligonucleotides by themodified triester method. Methods Enzymol. 65 (1980)610-620.

Norrander, J., Kempe, T. and Messing, J.: Construction of im-proved M 13 vectors using oligonucleotide-directed mutagen-esis. Gene 26 (1983) 101-106.

Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing withchain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74(1977) 5463-5467.

Sanger, F., Cot&on, A.R., Barre& B.G., Smith, A.J.H. and Roe,B.A.: Cloning in single-stranded bacteriophage as an aid torapid DNA sequencing. J. Mol. Biol. 143 (1980) 161-178.

Smith, M. and Gillam, S.: Constructed mutants using syntheticoligodeoxyribonucleotides as site-specific mutagens, in Set-low, J.K. and Hollaender, A. (Eds.), Genetic Engineering;Principles and Methods, Vol. 3, Plenum, New York, 1981,pp. I-32.

Van Wezenbeek, P.M.G.F., Hulsebos, T.J.M. and Schoen-makers, J.G.G.: Nucleotide sequence of the tilamentous bac-teriophage Ml3 DNA genome: Comparison with phage fd.Gene I I (1980) 129-148.

Wallace, R.B., Johnson, M.J., Suggs, S.V., Miyoshi, K.-i., Bhatt,R. and Itakura, K.: A set of synthetic ohgodeoxyribonucleo-tide primers for DNA sequencing in the plasmid vectorpBR322. Gene 16 (1981a) 21-26.

Wallace, R.B., Schold, M., Johnson, M.J., Dembek, P. andItakura, K.: Oligonucleotide directed mutagenesis of thehuman /?-globin gene: a general method for producingspecific point mutations in cloned DNA. Nucl. Acids Res. 9(1981b) 3647-3656.

Weiher, H. and Schaller, H.: Segment-specific mutagenesis:Extensive mutagenesis of a la c promoter/operator element.Proc. Natl. Acad. Sci. USA 79 (1982) 1408-1412.

Communicated by Z. HradeEnC.

vectores de clonacion m13

Documents