THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1988 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 263, No. 24, Issue of August 25. pp. 12049-12055,1988 Printed in U. S. A.

Multiple Genes Provide the Basis for Antifreeze Protein Diversity and Dosage in the Ocean Pout, Macroxoarces americanus”

(Received for publication, April 28, 1987, and in revised form, April 13, 1988)

Choy L. Hew, Nam-C. Wang, and Shashikant Joshi From the Research Institute, Hospital for Sick Children, Toronto and the Departments of Clinical Biochemistry and Biochemistry, University of Toronto, Toronto, Ontario M5G 1L5, Canada

Garth L. Fletcher From the Marine Sciences Research Laboratory, Memorial University of Newfoundland, St. John’s Newfoundland A l C 557, Canada

Gary K. Scott$, Pliny H. Hayes, Bert Buettner, and Peter L. Daviess From the Department of Biochemistry, Queen’s University, Kingston, Ontario K7L 3N6, Canada

The ocean pout (Macrozoarces americanus) pro- duces a set of antifreeze proteins that depresses the freezing point of its blood by binding to, and inhibiting the growth of, ice crystals. The amino acid sequences of all the major components of the ocean pout antifreeze proteins, including the immunologically distinct QAE component, have been derived by Edman degradation. In addition, sequences of several minor components were deduced from DNA sequencing of cDNA and ge- nomic clones. Fifty percent of the amino acids are perfectly conserved in all these proteins as well as in two homologous sequences from the distantly related wolffish. Several of the conserved residues are threo- nines and asparagines, amino acids that have been implicated in ice binding in the structurally unrelated antifreeze protein of the righteye flounders. Aside from minor differences in post-translational modifi- cations, heterogeneity in antifreeze protein compo- nents stems from amino acid differences encoded by multiple genes. Based on genomic Southern blots and library cloning statistics there are 150 copies of the 0.7-kilobase-long antifreeze protein gene in the New- foundland ocean pout, the majority of which are closely linked but irregularly spaced. A more southerly popu- lation of ocean pout from New Brunswick in which the circulating antifreeze protein levels are considerably lower has approximately one-quarter as many anti- freeze protein genes. Thus, there appears to be a cor- relation between gene dosage and antifreeze protein levels, and hence the ability to survive in ice-laden seawater. Southern blot comparison of the two popu- lations indicates that the differences in gene dosage were not generated by a simple set of deletions/dupli-

* This work was supported by grants from the Medical Research Council of Canada (to C. L. H. and P. L. D.) and from the Natural Sciences and Engineering Research Council of Canada (to G. L. F.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in thispaper has been submitted

and 503924. to the GenBankTM/EMBL Data Bank with accession number(s) J03923

Current address: University of California School of Medicine, Cancer Research Institute, ”1282, San Francisco, CA 94143-0128.

3 To whom correspondence should be addressed.

cations. They are more likely to be the result of differ- ential amplification.

The Newfoundland ocean pout, Macrozoarces arnericanus, produces a family of at least 10 active antifreeze polypeptides (AFP)l to prevent it from freezing (1). These AFP occur in concentrations of approximately 20-25 mg/ml in the serum during the winter months and are retained at much lower concentrations during the summer (2). Studies from our lab- oratories (1) have shown that the ocean pout AFP (type 111) are strikingly different in amino acid composition from the alanine-rich a-helical type I AFP isolated from winter founder (3-5) and shorthorn sculpin (6, 7), and the cystine-rich type I1 AFP of the sea raven (8). Ocean pout AFP are all in the molecular weight range of 6000-7000 but can be fractionated into five distinct groups based on their behavior on ion exchange chromatography. One group binds to QAE-Sepha- dex (QAE-1) and four to SP-Sephadex (SP-1 to -4) (1). On reverse phase high performance liquid chromatography (HPLC) the QAE-1 group shows a single peak while each of the SP groups contains several components. Besides the dif- ference in their binding properties on ion exchange chroma- tography, the QAE-1 group differs from all the SP components in immunological cross-reactivity. Antisera to QAE-1 react poorly to the SP components and vice versa (1).

Recently, the amino acid sequences of the three components in the SP-1 group have been deduced by a combination of protein and cDNA sequencing (9). Whereas the sequence of winter flounder AFP enabled its secondary structure and a mechanism of action to be predicted directly (lo), the ocean pout AFP sequences do not provide any obvious clues to their secondary structure or to how they function as antifreezes. To see which amino acids are most conserved and might, therefore, play a key role in the structure and/or function of the ocean pout antifreezes we have determined the amino acid sequences of QAE-1 and the major components from SP-2, SP-3, and SP-4, and have derived other sequences from cDNA and genomic clones. In addition we have compared the ocean pout sequences to two AFP sequences derived from genomic clones of the wolffish (Anurhichas lupus), a related zoarcid from a different family (11). Approximately 50% of the 65

The abbreviations used are: AFP, antifreeze polypeptide(s); HPLC, high performance liquid chromatography.

12049

12050 Antifreeze Protein Multigene Family in the Ocean Pout

0 ‘ , I I I 4 I I 35 45 55 35 45 55

ELUTION TIME (mln)

FIG. 1. Analysis of ocean pout AFP on reverse-phase HPLC. Samples were analyzed on a Waters p-Bondapak C-18 column (7.8 mm, inner diameter X 30 cm) using a gradient of acetonitrile in 0.1% trifluoroacetic acid with a flow rate of 1 ml/min. a, G-75 AFP; b, QAE-1; c, SP-1; d, SP-2; e, SP-3; f, SP-4.

amino acids are perfectly conserved between all 13 sequences compared. Five of the conserved residues are aspargine and/ or threonine, amino acids which have been implicated in the binding of winter flounder AFP to ice crystals (10).

Ocean pout from New Brunswick, where winter seawater temperatures are appreciably higher than in Newfoundland, produce the same variety of AFP but in concentrations ap- proximately one-tenth those observed in the Newfoundland specimens (2). To determine the basis for the differential expression of antifreeze we have investigated the extent and organization of the AFP multigene family in the two popula- tions.

EXPERIMENTAL PROCEDURES AND RESULTS~

Fractionation of Ocean Pout AFP-As reported in earlier publications (1,9), ocean pout AFP initially purified by Seph- adex G-75 chromatography (G75-AFP) was separated into five distinct groups (QAE-1, SP-1, SP-2, SP-3, and SP-4) on ion exchange chromatography. On reverse phase HPLC (Fig. la) , G75-AFP was resolved into at least 12 components (HPLC-1 to -12). As opposed to QAE-1, which contained a single component (HPLC-12), all the SP fractions showed multiple peaks, which were further purified by HPLC (Fig. 1, b-f). SP-1 was made up of HPLC-4, -5, and -6; SP-2 contained two widely separated groups of components HPLC-1, -2, and -3 and HPLC-11; SP-3 was made up of HPLC-8, -9, and -10; and SP-4 was comprised mostly of HPLC-7. In subsequent discussions, the nomenclature of these components is based on their HPLC assignment (Fig. la). The amino acid se- quences of HPLC-4, -5, and -6 have been deduced recently in our laboratories and suggest that HPLC-5 could be a post- translational modification of HPLC-6 (9). Thus, in this in- vestigation we have focused on the structure of the other major components (HPLC-1, -7, -9, -11, and -12).

The Extent of Sequence Conservation in Ocean Pout AFP- The amino acid sequences of all the major ocean pout AFP components (HPLC-1, -4, -6, -7, -9, -11, and -12) are shown

* Portions of this paper (including “Experimental Procedures,” part of “Results,” Figs. 2 and 4-8, and Tables 1-3) are presented in miniprint at the end of this paper. Miniprint is easily read with the aid of a standard magnifying glass. Full size photocopies are included in the microfilm edition of the Journal that is available from Waverly Press.

aligned with the two sequences derived from cDNA cloning, two sequences predicted from genomic cloning (this study), and two from the related wolffish (31) (Fig. 3). The sequences range from 62 to 69 amino acids in length. Most of the length variation occurs at the termini and is due to post-translational processing (9). The overall sequence identity among the 13 components aligned is approximately 50%. Many of the non- identical residues include sets of conservative substitutions such as isoleucine for methionine or leucine, and valine for alanine. Sequence identity increases to 90% among the ocean pout SP components, and the two wolffish sequences are far more similar to these sequences (85% identical) than ocean pout SP sequences are to the QAE sequences (55% identical).

Four of the perfectly conserved residues (14,18,47, and 55) are threonines or asparagines. In addition, position 8 is oc- cupied by threonine or asparagine, and position 15 by threo- nine, except in cDNA c10 where this residue is replaced by serine. The potential significance of this observation lies in the fact that the structurally different AFP of the flounder (type I AFP) also has six or seven conserved threonine and asparagine residues (23) that are believed to be responsible for binding to ice crystals (10).

A F P Gene Dosage Differs Markedly between the Newfound- land and New Brunswick Populations-Southern blotting shows New Brunswick ocean pout to have approximately one- fifth to one-quarter the number of AFP genes of Newfound- land fish (Fig. 1OA). Even more striking, the patterns of hybridizing fragments are different between the two popula- tions, indicating that one could not be generated from the other by a deletion or a simple set of duplications. Indeed, differences in the banding pattern between the two New Brunswick individuals suggest that the organization of the AFP gene locus might be quite fluid. In contrast, the dispo- sition of genes in the 8-tubulin multigene family is indistin- guishable between both individuals and populations (Fig. 1OB).

DISCUSSION

Size and Organization of the A F P Multigene Family-An estimate of the number of AFP genes in the ocean pout genome can be made on the basis of the frequency with which AFP genomic clones appeared in the library screenings. A total of 20 clones was detected in 1.2 X lo4 recombinant phage screened. Given a haploid genome size for the ocean pout of 1 X lo9 base pairs, an observed average phage insert length of 1.7 x lo4 base pairs, and an average of 1.5 AFP genes/clone, the estimated AFP gene copy number for the Newfoundland fish is 150. This is not an unreasonable figure in light of the number and intensity of hybridization signals seen on the genomic Southern blot (Figs. 6 and 10). Since none of the enzymes used to prepare this blot cut within the genes or cDNAs analyzed, it appears that each band on the genomic blot represents at least one gene. In effect the genes are so short (-0.7 kilobase pair) and so closely linked that several may be present in some of the longer hybridizing restriction fragments. Indeed, based on the maps of XOP 6, 12, 21, and 23, there are genomic EcoRI and BamHI fragments with at least two AFP genes apiece. Also, as mentioned previously several of the hybridizing bands in the genomic blot appear to be comprised of signals from multiple restriction fragments. For example, the maps in Fig. 7 show that XOP 5,12,19, and 23 each contain a 2-kilobase pair HindIII fragment that hybridizes to the cDNA probes and that could contribute to the intense band of hybridization in this size range in the HindIII lane of the genomic Southern blot. These observa-

Antifreeze Protein Multigene Family in the Ocean Pout 12051

( + I . .. . ( + I

c DNA CDNA qenonic HPLC HPLC HPLC HPLC HPLC HPLC WOl f f i s h wolffish HPLC qenomic

c10 c7 A5 1 4 6 7 9 11

1.5 1.9

12 13

FIG. 3. Compendium of sequences for type I11 AFP. Sequences were derived from ocean pout HPLC components, cDNA clones, and genomic clones as indicated, and from two wolffish genomic clones (W 1.5 and W 1.9). Regions of identity are boxed. Spaces were introduced to optimize the alignment. Asterisks mark conserved threonines or asparagines, while asterisks in parentheses indicate positions occupied by either of these residues or aspartic acid.

A AAGCTTCATGGAAAAGTACAAGCATTTTGCACATATCATTCTGTATTTTTCCAATAGCACAATGTCATCGTGACATCATGCTATTGGATAGAAGAGACCAGCTGATCTAGACAGTTGATA K O 120

T C A T G A T T A A C A G C C C C A A A C A A C A A G T G T G C A T G T G T G A G G A G T G A T T G G C A G A T G T A T G A G A A C A A T T G A C A T A A G G A G G T T T G A C A C A G T G A C C T A C T T T C A G G ~ G G A A A C G 180 240

G G A T A T G C C G G A T A A G T C C T C C C A C A T A C T ~ A G A T G C A G C A C A T G A A C C T T T C C T G T C A G A A G T C T C A G C T A C A G C T T T C A C T T C G T T C T C C G C T A A T T A A T T A A T T A C T A A T T 300 360

420

AATTAAGTCTCAGCCACAGCCATGAAGTCAGTCATTTTAACTGGTTTGCTTTTCGTCCTCCTTTGTGTCGACCACATGAGTTCAGCCAACCAGgtgagata t tc t tgc tccacaaaaaaa MetLysSerValIleLeuThrGlyLeuLeuPheValLeuLeuCysValAspHisMetSerSerAlaAsnGln 480

tattcaaaaatgtgagccacagtaaaattcaattgttttctgtttagaaagaca~agaacctcgatgaaaacatttttgaaattgttttttcaactgtgccatgagaacaataataatgt 540 600

S e r V a l V a l A l a T h r G l n L e u I l e P r o I l e A s n T h r A l a L e u T h r L e u V a l M e t M e t T h r T h r A r g V a l I l e T y r P r o T h r G l y I l e P r o 660 720

c t g a c c t t t t a t t t t c c a t t c t t c a a g g a g T C C G T G G T G G C C A C C C A G C T G A T C C C C A T A A A T A C T G C C C T G A C T C T G G T G A T G A T G A C G A C A C G G G T T A T C T A C C C A A C G G G C A T C C C C

AlaGluAspIleProArgLeuValSerMetGlnValAsnGlnAlaValProMetGlyThrThrLeuMetProAspMetValLysPheTyrCysLeuCysA~aProLysAsnTer 840 G C C G A G G A C A T T C C C C G A T T A G T C T C A A T G C A A G T G A A C C A G G C A G T G C C G A T G G G C A C A A C C C T C A T G C C A G A C A T G G T G A A A T T T T A C T G C C T C T G C G C G C C G A A G A A C T G A A G G T G C

CAAGGAGTTTCTTCCCAAAACCAAAAGAAGAAATGCCTCCTCTCACAATTAACCTTGTTTTTGTCACAAACCCAAGTCTGTCCGTATGTTAACTGAACATGTCAAAACCTGTGGAGACTA 900 960

TGTTGAGATTTGATGTTCTGAAAAGATAAATCATTTAAATAAAATGTTGCCCAAATTTCCTGCCTGAGGTTATTCCTTGTCTTTGCTACATCGCTTTGCTGCTCGGATCGACTCACTCTG 1020 1080

TGTATGCCACATTCACTTTGTACTCTCCTTCTCACGGTAGGTTTATTATTGTTAGATGTGCAGTTAGTTTCTGTGAAATAACATACCACACACTGATATTGTGTGTGCATTGACTTGGTG 1140 1200

780

AGTGCACATTGTTTTTGATC

B A A G C T T G T G A T A G T T T G G A C A A A A A C A A G T T A T A C T T T A C T T A T A A G A A T A T A A A A T T T C C A T T G C A A T T G G C A T A A G G A G G T G T G A C A C A G T G A C C T A C T T T C A G G ~ G G A A A

C G G G A T A T G C C G G T T A A G T C C T C C C A C A T A C T G ~ G A T G C A G C A C A T G G A C C T G T C C T G T C A G A A G T C T C A G C T A C A G C T T T C A C T T C G A T C T C C G A T A A T T A A T T A A T T A A T T A

50 100

170 220

MetLysSerValIleLeuThrGlyLeuLeuPheValLeuLeuCysValAspHisMetThrAlaSerGln 290 340

ATTATTAATTAATTAAGTCTCAGCCACAGCCATGAAGTCCGTTATTTTAACCGGTTTGCTTTTCGTCCTCCTTTGTGTCGACCACATGACAGCCAGCCAGgtgagata t tc t tgc tccac

410 t a a a a a a t a t t c a a a a a t g t g a g c t a c a g t a a a a t t c a a c a g t g t t c t g t t t a g a a a g a c a g a g a a c c t t t t a a g t a a a c a t t t t t a g a a t t t t c t t t t t c a a c t g t g c c a t g a g a a c a a

460

530 S e r V a l V a l A l a T h r G l n L e u I l e P r o I l e A s n T h r A l a L e u T h r P r o V a l M e t M e t G l u G l y L y s V a l T h r A s n P r o

t a a t a a c g t c t g a c c t t t t a t c t t c c a t t c t t c a a c g g t c a g T C C G T G G T G G C C A C C C A G C T G A T C C C C A T A A A T A C T G C C C T G A C T C C G G T G A T G A T G G A G G G G A A G G T G A C C A A C C C A

580

650 IleGlyIleProPheAlaGluMetSerGlnIleValGlyLysGlnValAsnThrProValAlaLysGlyGlnThrLeuMetProAsnMetValLysThrTyrAlaAlaGlyLysTer ATAGGCATCCCGTTCGCAGAGATGTCCCAAATAGTGGGGAAGCAAGTGAACACGCCAGTGGCTAAGGGCCAAACCCTCATGCCAAACATGGTGAAAACGTACGCCGCGGGAAAGTAGT~~

700

T G A G G G T G C C A A G G A G C T T C T T C C C A A A A C C A A A A G A A G A A A T G C C C C C T C T C A C A A T T A A C C C T G T T T T T G T C A C A A A C C C A A G T C T G T T A A C T G A A C A T G T C A A A A C C T G T G G A G ~ ~ ~ 770 azo

GTTGAGATTTGATGTTCTGAAAAGATAAAGCCTATAAATAAAATGTTGCCCAAATTTCCTGCCTGATGTTTTTCTTTGTCGTTGCTACATGGCTTTGCTGCTCGGAT~ ago 940

FIG. 9. DNA sequence of ocean pout AFP genes. A, the gene from XOP 3; B, the gene from XOP 5. Bases are numbered from the 5’ end Hind11 site. The intervening sequence is written in lower case letters, and the putative “CAAT and “TATA sequences are boxed.

12052 Antifreeze Protein Multigene Family in the Ocean Pout

FIG. 10. A, population differences in the AFP multigene family. Southern blot of testis DNA from two Newfoundland ( N f d ) and two New Brunswick ( N B ) ocean pout digested with BamHI ( B ) or SstI ( S ) and probed with cloned AFP cDNA (9). B, the same blot reprobed with cloned chicken @-tubulin cDNA (30).

A Nfd

1 2 B S B S

L,

B . NB Nfd . NB 3 4 1 2 3 4

B S B S B S B S B S B S L,

23.1 -

9.4-

6.7-

4.4-

2.3- 2.0-

tions can account for much of the differential hybridization to bands on the Southern blot.

Based on the analysis of genomic clones the majority of the AFP genes appear to be closely linked. However, they are not regularly spaced, and they lack a repeating pattern of restric- tion sites around the genes. Thus, in comparing their organi- zation to the arrangements of type I AFP genes found in the winter flounder, they resemble the 10-12 irregular spaced genes rather than the set of 220 genes in regular tandem direct repeats (14).

The dramatic difference in the size of the AFP gene family between the Newfoundland and New Brunswick ocean pout populations can largely account for the order of magnitude difference in their circulating AFP concentrations (2). A similar correlation between gene dosage and AFP levels has been noted before in closely related species of righteye floun- ders (26). However, in this instance the difference occurs within a single species, which shortens the potential time frame for its development. As pointed out above, a comparison of the patterns of AFP gene hybridization between the New- foundland and New Brunswick ocean pout (Fig. 10) suggests that one has not been derived from the other by a simple set of deletions/duplications since so many of the gene fragments are of different lengths in the two populations, and even between the two New Brunswick individuals. Instead, the AFP gene locus appears to be subject to extensive re- arrangement. We suggest that the periodicity of Cenozoic glaciation in the Northern hemisphere has provided intense but sporadic selection for ocean pout that produce high levels of AFP. This challenge has been met on a number of occasions by AFP gene amplification through some form of dispropor- tionate DNA replication (27,28). Subsequently, during glacial minima, a net loss of AFP genes that can be predicted from the potential for internal recombination (29) would not be selected against until the onset of another glacial episode. Thus, the combination of an AFP gene locus predisposed to amplification and a periodic selection pressure might account for the current geographical and individual variation in the locus.

23.1 -

9.4-

6.7-

4.4-

2.3- 2.0-

Functionality of the Genes-It is difficult to say how many of the 150 AFP genes are functional. Protein sequence analy- sis indicates that of the eight major HPLC components ana- lyzed here and in Ref. 9, only one, HPLC-5, can be produced as a post-translational modification of another. In addition there are several minor components not yet sequenced, such as HPLC-2 and -3, that could potentially correspond to the cDNA sequences of clones 7 and 10 or the genomic sequence in XOP 5. Other minor components flank HPLC-7, -9, and -11. Based on these estimates there are 10-15 different AFP components. However, the number of functional genes is likely to be larger since sequence analysis of cDNA clones 36 and 77 obtained from an individual fish has shown that the same mRNA (HPLC-6) is produced from a t least two genes that differ by silent base changes (9). Some of the genes may even be exact duplicates. To obtain a more accurate figure for the number of functional AFP genes it would be necessary to sequence a large number of them. The two genes (AOP 3 and 5) that have been sequenced both appear to be functional although they do not code for any of the major components. They show extensive DNA sequence conservation around the putative control elements and even in their intervening se- quences.

The Type IIIAntifeeze-Through a combination of protein and DNA sequencing a fairly complete picture of ocean pout AFP component heterogeneity has emerged (Fig. 3). Perhaps the most surprising feature is the extensive sequence differ- ence between the SP and QAE components. This difference is greater than might be predicted from a comparison of their amino acid compositions and chromatographic properties but is in line with immunological data (1). Their comparison does, however, serve to identify conserved residues that might be important in ice binding or in the folding of the type I11 AFP in such a way as to present the ice-binding residues in the correct configuration. This information will be especially val- uable when the first type I11 AFP tertiary structure is derived by physical methods.

Acknowledgments-We thank the diving facilities at the Marine

Antifreeze Protein Multigene Family in the Ocean Pout 12053

Sciences Research Laboratory, Memorial University of Newfound- land and the Huntsman Marine Laboratory, St. Andrews, New Bruns- wick for collection of ocean pout tissue, Sherry Gauthier for DNA sequence analysis on XOP 3 and 5, Dr. Don Cleveland for the gift of the chicken @-tubulin cDNA clone, and Angela L'Abb6 for typing the manuscript.

REFERENCES 1. Hew, C. L., Slaughter, D., Joshi, S. B., Fletcher, G. L., and

Ananthanarayanan, V. S. (1984) J. Comp. Physiol. B Biochem. Syst. Enuiron. Physiol. 155 , 81-88

2. Fletcher, G. L., Hew, C. L., Li, X. M., Haya, K., and Kao, M. H. (1985) Can. J . Zool. 63,488-493

3. Hew, C.-L., and Yip, C. (1976) Biochem. Biophys. Res. Commun.

4. Duman, J. G., and DeVries, A. L. (1976) Comp. Biochem. Physiol.

5. Fourney, R. M., Joshi, S. B., Kao, M. H., and Hew, C . L. (1984)

6. Hew, C. L., Fletcher, G. L., and Ananthanarayanan, V. S. (1980)

7. Hew, C. L., Joshi, S., Wang, N.-C., Kao, M.-H., and Ananthan-

8. Ng, N. F., Trinh, K.-Y., and Hew, C. L. (1986) J. Biol. Chem.

9. Li, X."., Trinh, K.-Y., Hew, C. L., Buettner, B., Baenziger, J., and Davies, P. L. (1985) J. Biol. Chem. 260,12904-12909

10. DeVries, A. L., and Lin, Y. (1977) Biochim. Biophys. Acta 495,

11. Nelson, J. S. (1984) Fishes of the World, 2nd Ed., John Wiley &

12. Operator's Manual, PicotagTMAmino Acid Analysis System (1984)

7 1,845-850

B Comp. Biochem. 54,375-380

Can. J. Zool. 6 2 , 28-33

Can. J. Biochem. 58,377-385

arayanan, V. S. (1985) Eur. J. Biochem. 151 , 167-172

261,15690-15695

388-392

Sons, New York

Millipore Waters Chromatography Division, Milford, MA

Supplementary Haterlal to "Multiple genes provlde the basls tor

MaCrOTOarceS amerlcanus". Choy L. HeU, Nam-C. Wang. Shashlkant antifreeze protein dlversity and dosage ~n the acean pout,

Joshl. Garth L. Fletcher, Gary K. Scott. Pllny H. Hayes, Bert Beuttnei. and Peter L. Dav~es.

EXPERIMENTAL PROCEDURES Collection of tissue. ocean pout, nacrozoarces americanus. were collected by divers from waters around the AYalon Peninsula. Newfoundland. and from Passaaaquoddy Bay. New Brunsvlck. The flsh were held I" aquaria at ambient temperature and photoperiod prior to sampling ( 2 ) . Serum wa5 prepared by aentrlfugation (4,000 x g for 15 m i n ) of clotted blood and stored at -2O'C. Liver and testes were removed Into liauid Nq and stored at -6O'C

PUrlflcation of Ocean Pout AFP. The procedure for the purlflca- tion of ocean pout AFP has been described (1 .91. Briefly, the serum was initially chromatographed On a Sephadex C - 7 5 column (2.5 x 8 6 c m ) . The thermal hysteresis actlvlty of each fractlon vas measured With a freerinq point osmometer. Active fractions were pooled and designated as 6-75 AfP. To fractionate the AFP

A-25 Sephadex column in 5 mn Tris HC1. pH 9.5. All of the SP into SP and QAE components. G-75 AFP was chromatographed on a QAE

coapanents passed through the Column allowing QAE-1 to he eluted

On SP-Sephadex of the nonretarded materials from the QAE A-25 by a NaCl gradient as a ~ l n g l e peak. Subsequent chromatography

The hamoqenelty of these tractions was examined by reverse phase solumn resolved the fractions lntO 4 groups, SP-l to SP-4 ( 9 ) .

HPLC using a Wafers ygondapak C-18 column ( 7 . 8 m m x 3 0 c m l ulth a 0.1% trlfluOrOaCetiC aald-acetonltrile gradlent, and thelr antifreeze activities were confirmed uslnq a nanoliter osmometer (Clifton Technxcal Phy51C5. Hartford, N.Y.).

Cleavage of AFP ComLmnent QAE-1. QAE-1 (1.5 mql was digested with trypsin ( 1 5 yql or chymotrypsin (15 uq) In 0.2 M NHIHCO~. at 37'C. After 3 h the dlgest was lyophliized, redissolved in 5%

column. For cleavage at methionine. QAE-1 ( 1 mq) In 70% formlc formlc dcld. and analyzed on the Waters C-16 reverse phase

acid (0.1 ml) was treated with CNBr at 2 2 ° C for 2 4 h. The reaction mixture was lyophillled afLer ten-fold dllutlon with water.

Alnlno acld analysis and automated Edman dearadatlon. Amlno acld analyses were carried out using the Waters picotag method ( 1 2 ) . After vapour phase hydrolysis wlth 6 N HCI at 110-C. the dried s a m ~ l e s were reacted with Dhenvlisothiocvanate IPITCi s o l u t i o n (Melhanoi:n,o:trlethyl~~i~~:~~~c' 7 : l : l : l ) . for 20 ml" at room temperature. The samples were drled. dissolved in buffer, and analyzed by reverse phase HPLC. For automated Edman deqrada- t l o n . pepf~de (2-10 nmoll was loaded into either a Beckman 890C or a Beckman B1OH sequencer u s ~ n g the 0 . 1 M Quadrol program in the presence of polybrene (pierce Chemlcall. After conversion I"

phenylthlohydantoin derivatives of the amino acids were analyzed the presence of 2 5 % trlfluoroacetic acid for 20 mi" at 70'C. the

by reverse phase HPLC. The repetitlve yleld of each Edman cycle Wac > 9 5 %

(Melhanoi:n,o:trlethyl~~i~~:~~~c' 7 : l : l : l ) . for 20 ml" at room temperature. The samples were drled. dissolved in buffer, and analyzed by reverse phase HPLC. For automated Edman deqrada- t l o n . pepf~de (2-10 nmoll was loaded into either a Beckman 890C or a Beckman B1OH sequencer u s ~ n g the 0 . 1 M Quadrol program in the presence of polybrene (pierce Chemlcall. After conversion I"

phenylthlohydantoin derivatives of the amino acids were analyzed the presence of 2 5 % trlfluoroacetic acid for 20 mi" at 70'C. the

by reverse phase HPLC. The repetitlve yleld of each Edman cycle Wac > 9 5 % Genomic Southern blotting. Genomic DNAs were prepared from the testes of indlvldudl fish by the method of Blin and Stafford ( 1 3 ) as modified by Scott et a. (14). Allqvots (15 P 9 ) were digested with restriction endonUCleaSe5, electrophoresed on 0 . 7 % agarose qels and Southern blotted Onto nitrocellulose (15). Blots were hybridlled as described 114.161 and were extensively washed at

autoradlography. 68.C in 0.3 x SSC confainlnq 0.2% sodium dodecyl sulfate prxor to

.. ""

ocean pout DNA was prepared and screened a 5 described by Scott RFP aenomic clones. A Charon 30 genomic library Of Newfoundland

et LL. ( 1 4 , ) . Recoeblnant phage w e r e plaque-purified On the basis

were prepared from liquid cultures (500 ml) by bandlng ~n cscl of hybridlaatlon to nick-translated A m =DNA clone r 3 6 (9) and

(17). Phage ONAS were released by formamide treatment and recovered by ethanol preclpitatlon (18).

13. Blin, N., and Stafford, D. W. (1976) Nucleic Acids Res. 3 , 2303-

14. Scott, G. K., Hew, C. L., and Davies, P. L. (1985) Proc. Natl.

15. Southern, E. M. (1975) J. Mol. Biol. 98,503-517 16. Davies, P. L., Hough, C., Scott, G. K., Ng, N., White, B. N., and

Hew, C. L. (1984) J. Biol. Chem. 259,9241-9247 17. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular

Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

18. Davis, R. W., Botstein, D., and Roth, J. R. (1980) in Advanced Bacterial Genetics: A Manual for Genetic Engineering, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

19. Land, H., Grez, M., Mauser, H., Lindenmaier, W., and Schutz, G. (1981) Nucleic Acids Res. 9,2251-2266

20. Grunstein, M., and Wallis, J. (1979) Methods Enzymol. 68,379- 389

21. Messing, J. (1983) Methods Enzymol. 1 0 1 , 20-78 22. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl.

Acad. Sci. U. S. A. 74,5463-5467 23. Scott, G. K., Davies, P. L., Shears, M. A., and Fletcher, G. L.

(1987) Eur. J. Biochem. 168 , 629-633 24. Buettner, G. B. (1986) Sequence of Antifreeze Proteins from the

Ocean Pout, Macrozoarces americanus Derived from cDNA Cloning. M.Sc. thesis, Queen's University, Kingston, Canada

25. Benton, W. D., and Davis, R. W. (1977) Science 196 , 180-182 26. Scott, G. K., Davies, P. L., Kao, M. H., and Fletcher, G. L. (1988)

27. Schimke, R. T. (1984) Cell 37, 705-713 28. Futcher, A. B (1986) J. Theor. Biol. 1 1 9 , 197-204 29. Walsh, J. B. (1987) Genetics 115,553-567 30. Cleveland, D. W., Lopata, M. A., Macdonald, R. J., Cowan, N. J.,

31. Scott, G. K., Hayes, P. H., Fletcher, G. L., and Davies, P. L.

2308

Acad. Sci. U. S. A. 82,2613-2617

J. Mol. Euo~. 2 7 , 29-35

Rutter, W. J., and Kirschner, M. W. (1980) Cell 20,95-105

(1988) Mol. Cell. Biol., in press

AfP =DNA clones. Liver poI,y(A)+ RNA was prepared from Newfoundland ocean pout and s12e fractlonated on a sucrose density gradient as described previously ( 9 ) . AfP mRNA sediment- ing i n the 10s peak was used as template to synthesize double- Stranded cDNA by the method of land et d. ( 1 9 ) . The =DNA was inserted into the &I rite of pUC-9 by homopolymeric talling with an oliqo(d6) tail being added to the =DNA and an ollqo(dC)

The plasmid/cDNA chimeras were transfected into E . & J M 8 3 and tail to the plasrnld. In this way the pStI site was destroyed.

ampicillin-resistant clones were screened by colony hybrldlzatlon ( 2 0 ) to the insert Of AFP =DNA clone : 3 6 1 9 ) .

genomlc clones were Subcloned info M 1 3 vectors ( 2 1 ) for sequenc- DNA seauence analysis. Restriction fragments from AFP =DNA and

lnq by the dideoxy method ( 2 2 ) .

RESULTS

The amino acld ~ 0 m p 0 ~ 1 t ~ 0 n s of the malor AFP components are Shown in Table 1. Both XPLC-1 and 6 lack arginine while HPLC-12 lacks phenylalanlne. HPLC-12. the only CDmpOnent that hlnds to QAE-Sephddex at pH 9.5. has a distinct Cornp~sitlon compared to the other comnonents. Nonethelesg. the" a r e verv s l r n l l a r overa l l

PrirnarY structure of HPLC-12. Thls sequence was deduced from automated Edman degradation of selected tryptlc. chymotryptlc and CNBr-cleavage peptides, toqether vlth 28 cycles of Edman decrradatlon of the undiaesfed Dentide (Tables 2 and 3 1 . Cleavaae

Primam structure of HPLC-1.7.9 and 11. Unllke the N-termlnl of

qlutaminyl residues. the Other major ATP components were directly HPLC-I. 5 and 6 which were blocked due to the cyCllzation of

HPLC-1.7.9. and 11 were unequivocally deduced from 6 5 cycles of accessible to automated protein sequencing. The stcuctures of

Their StrUCtUreQ Were confirmed by tryptic mappinq on HPLC and Edman degradation. They each gave one Unlque sequence (Fig. 3 1 .

4 . 7 . 9 . and 11 all contained an identical peptide ( 4 - 9 , 11-9, 9-9 analysis of the isolated peptldes LFlq. 4 1 . For example. HPLC-

and 7-9 in F q . 4 1 WhlCh corresponded to positions 2 6 to 4 3 uslnq the numberinq system in Fig. 3 . Similarly, peptides 11-7 and 9-7 were identical and corresponded to positions 5 2 to 65, having an Internal lysine not cleaved by trypsin. A shorter peptide 7 - 6 lposttions 5 2 to 61) was present. however. In HPLC-7 instead. Peptldes 4 - 6 and 11-6 represented the N-termlnal region ipos- itions 2 / 3 to 2 5 ) . Although peptide 4-8 contained an ddditlondi pyrolidane carboxylic acid at the N-terminus these two peptides had similar elution times off the HPLC column. The substitution of arginine at position 9 in HPLC-7 generated a shorter peptide 7-7 (positions 10 to 25).

AFP =DNA clones, The impetus to make a new =DNA library came from the Obseivatlon that =DNA clones PrevIous1y Isolated (9) Were lacking 5eYuence informdtlon at the 3 ' end and Possibly also at the 5' end. The neu llbrary was made by the method of Land et al. (191 to avold the use of 5 nuclease. Inserts were released from the multiple cloning sfte by digestion with both ECORI and &dl11 and their lengths estimated by agarose gel electrophoresis. On average their length was 100-200 bp lonqer than that of the Inserts from the prev1ou5 library. The Inserfs

Of 400 bp and 550 bp respectively, were sequenced (Fig. 5 ) . The from t w o new AFP =DNA clones ( X 7 and 110). with estimated lengths

3 ' end of both cDNAs appears to be intact as ludged by the presence of a complete polyadenylatlon signal (AATIUVL). whlch was lncomplete o r absent from e a r l l e r claner, and a pOly(R) tract downstream. Clone 110 is actually shorter at the 5' end than clones 116 and 177 (9). but c l o n e $7 has an extensLon of 251 bp beyond the 5' end of clone Y77. clones 117 and 110 both code for SP-type A F P COmPOnents as Opposed to the rarer QAE-type, and both represent minor variants most closely related to HPLC-1 ( F l q . 3 1 .

-

-

12054 Antifreeze Protein Multigene Family in the Ocean Pout

thc da;ker s ~ g n a l s appeared' t imposed.

TO help evaluate Slqndl intensity a duplicate Southern blot was probed WLth a n ocean pout liver cDNA clone unrelated to AFP. This clone. 115, contamed a 450 bp =DNA insert complementary to an "RNA of 750 nucleotides In length that Was One or two orders of magnitude less abundant in ocean pout liver than the AFP "RNA

the RFP cDNR probe. Other detalis of the hybridizatlan. washing 124). It was nlck-translated to the same specific DCtlVlty as

and autoradlography Were identical. Clone X15 hybridized to

the and &dl11 digests. The intensity of the hybridiratlon slngle bands in the -HI and m R I digests and to two bands in

Thus, estimation of the total number of AFP gene signals con- signals matched the fainter ones in the AFP CDNA-probed blot.

trlbutlnq to the auforadlograph was limited by the resolution obtalned wlth this techniaue.

, ~ ~ ~~ ~ . .

TO study the organization of the AFP genes in mare detail. Newfoundland ocean pout genomic DNA war partially digested With - SaulA, size fractionated, and cloned into Charon 10. when 12,000 unampllfied. independent recornbrnant phage were screened

were obtalned. Eight of these putative AFP genomic clones were 125) With labelled AFP =DNA clone X36 (9) 20 positive signals

selected at random, plaque-purified and prepared an a large scale by banding on CsCl gradients. The phage DNAs from these elght clones I AOP 3.5,6.12.19. 21.21 and 2 8 ) were mapped with the same

SstI. LWRI and HmdIII. The map5 of DNA inserts are organized restriction enzymes used on the genomic Southern blot: -HI,

in ~ i g . 7 into four Sets. In set I. hop 12 and 21 each contain -

two Or more isolated restriction fragments that hybridize Stron91y to AFP cDNA clone " 3 6 : bv the distribution of their restrictlan 51tes they could repreient an DverlappLng SectLon

Of set 11. each have two distinct regions of hybridization but from the same chromosomal region. TWO Other clones. AOP 6 and 23

show no slrnilaritv ~n thelr restriction m a ~ s to each Other or to

ChrODOsomal locus. Finally, in set IV the restriction patterns flankinq the hvbridlzinq reqions a r e . like those in set 11.

Structural analVsls of two AFP Qenes. TO analyze the hybridizlng regions in more detail, two were selected. again randomly. for

XOP 5 and the hybridizing =I fraqinent from AOP 3 were cloned DNA sequence analysis. The hybridizing &I111 fragment from

of these subclones were recloned into MI3 vectors for sequence into pUC 19 I" the W d I I I and &%I Sites respectively. Sections

analysis according to the strategy outlined in Fig. 8 . The DNA sequences Showed that both hybridizing regions contaln complete AFP genes which are each interrupted by a s~ngle. short interven- Lng sequence of 177 bp in AOP 3 , and 182 bp in AOP 5 (Fig. 9). The lntervenrnq sequence effectively divides the gene into an exon that codes for the signal Peptide and one that codes for the mature ATP. Both genes habe- conventional splice junctlan sequences, initialon and termination codons, and typical polyadenylatlon signals. In ADP 5 a "TATA" box is located 118 bp upstream Of the lnltlation codan and a "CAAT" box 45 bp further ubstream. In AOP 3 the same signals can be observed in the equivalent locations. The SDElCing between these two 514n111 and

their 5 ' and 3 ' untransiated regions and of the signal peptide are sufficiently simllar to account for the selection of clones llke AOP 3 from the genomic library when using AFP CDNA clone # l 6 as a probe

Table 2 . Amino acld dndlys15 of cleavage peptlder from HPLC-12. Yield of amino acids is tabulated a5 "mol. Numbers in parentheses represent the number of resldues/peptlde based on sequence data and are totalled below. HSr is homoserine

0.2

0 1

Table 3 . Automated Edman degradation of HPLC-12 and its cleavage peptldes. Residues are numbered from the anino- terminus. Dotted lines signify the continuation of the Sequence beyond the last resldue deteralned.

Table 1. A m l n ~ acld analysls of ocean pout antifreeze poly- peptides. Yield of amino acids is tabulated as nrnal. Column I represents the number of re5ldueS/protein

column I1 were derived from protein sequence determin- calculated from amino acid analysis. The numbers in

atians. The data for HPLC-6 is from reference 9.

0.:

0.'

a n TRYPTIC DIGEST r 50

10 20 30 40 50 60 ELUTION TIME (mml

Fig. 2 HPLC analysls of the tryptic. ahyrnotrypfic and CNBr dlqests of HPLC-12. Chromatography Was performed a5 described I n the legend to Pig. 1. (a) tryptic dlgest; lbl chymotryptic dlgest: IC1 CNBr dlgest.

Antifreeze Protein Multigene Family in the Ocean Pout 12055

F l q . 7 ReScriCtlOn maps Of Ocean pout A F P genomic clones. The

and the parallel Ilnes the adjolning DNA sequences. single horizontal lines denote Inserts ~n the clones

Vertical Ilnes indlcate the placement of restrlctlon 51teS. The vertlcal dotted lines In AOP 12 and AOP 2 1

W d I I I Site. The Stippling between restriction sites represent the two possible locations of a single

identifies DNA fragments that hybridlze strongly to the ocean pout AFP CDNA.

I , , , - I , L l O 0 10 20 30 40 50 60

ELUTION TIME (mlnl

I 420 "I"

380

l 220 < ' 320 230

x3 I 360 I F l q . 4 Tryptlc peptlde mapping Of different ocean pout A F P . Tryptic digests of (a) H P L C - 1 2 : (b) H P L C - 4 : (c) HPLC-

described in the legend to Fig. 1. 11: (dl H P L C - 9 : (e) HPLC-7 were chromatoqraphed

I I

320 I

I 270

, 190 ,

x5 I70

F i g . 5 Sequence O f ocean pout A F P CDNA clones L7 and 110. The COntlnUOUS DNA sequence is that Of the (17 CDNA insert wlth the corresponding amino acid sequence above. The cUNA of : l o is Lndlcated below by base Changcs from the

changes Indicated. The :10 DNA sequence beglns at base : I sequence. four of whlch lead to the amino acld

3 0 1 .

3 E S E H E S E H

4.4-

2.3- 2.0-

F l q . b Genomic Southern blots. Genomic DNA ( 1 5 119) from Ocean pout vas digested with reStr1Ction enzymes &"HI 1 8 ) . S S I ( 5 ) . Ec__oRI (E) and Hind111 (Hi. The left-hand blot was Drobed wlth CDNA clone : 1 5 . the riqht-hand