Vonetta Edwards, Kathy Goodson, Habi Mojidi and Sarah Mae Sucayan Biochemistry 674, University of Maryland, College Park, MD

Designing Minor Groove Binding Drugs

Figure 14:Interaction of the different combinations of amides with specific WC base pairs.

• Triple Helix forming molecules

• Synthetic Polyamides

• Zn++ Finger proteins

Introduction

Categories of Sequence Specific DNA Binding Drugs

Biological Effects of DNA Binding Drugs

Transcription factors – The most effective inhibitors bind to both the major and minor grooves and allow ‘threading’ which keeps the DNA inaccessible to transcriptions factors.1

Topoisomerases – “cleavable complex” poisons ,such as quinolones, stabilize covalent enzyme-DNA complexes thus prevent resealing of DNA ends. This converts type II enzymes into a cellular poison..“catalytic inhibitors,” such as coumermycin, inhibit essential ATP hydrolysis needed for topoisomerase function.3

TAATTACGTATATAATATCGGCTAATGC

Fe

Fe

5’

5’

5’ 3’ 3’

3’

3’5’High Resolution Gel

Figure 6:EDTA•Fe(II) affinity cleavage model reflecting the asymmetric DNA cleavage pattern seen in the minor groove of B-DNA. The frequency of cleavage is represented by the lengths of the arrows. Figure adapted from Youngquist and Dervan.10

Beginning with the work of Galas and Schmitz, methods of DNA footprinting1 with DNase I allowed for determination of the location of molecular binding sites on DNA.8 A synthetic cleavage agent methidiumpropyl-EDTA (MPE) is comprised of methidium, a DNA intercalator, which is covalently bound to the metal chelator EDTA. This agent was later adopted for use in footprinting due to its smaller size and its preferable mode of activation.9

Figure 411: MPE

The mode of cleavage of EDTA•Fe(II) is through the use of a non-specific hydroxyl radical, thus cleavage is attributed to the binding ligand. In experiments by Younguist and Dervan, EDTA was attached to either the amino or carboxyl end of tri-, tetra-, penta-, and hexa(tris-N-methylpyrrolecarboxamide)s. The result of experimentation was the outline of an n+1 binding motif, where n is the number of amides.10

Figure 511: Amino and carboxyl labeled tris-N-methylpyrrolecarboxamide

References

Conclusion and Future Work

One of the first chemical approaches to targeting double-stranded DNA used oligonucleotides linked to intercalators to bind in the major groove of DNA and form a sequence specific triple helix.4

Another strategy in improving sequence specificity of minor groove binding drugs is the use of polyamides. These group of molecules contain combinations of three different aromatic amino acids (hydroxypyrrole, imidazole, pyrrole), which uniquely bind with each of the Watson-Crick base pairs.(see Figure 9).4

Figure 9 :Molecules such as Pyrole-imidazole polyamides are linear Beta-alanine linked polyamides that recognize a large range of DNA.12

DNA binding molecules have various affinities for specific regions of DNA. Synthetic analogs of the AT-selective minor groove-binding ligands13 created the foundation for synthetic DNA binding drugs. Sequence specificity of DNA binding drugs will provide insight into drug design that will target genes and be used as a class of potential therapeutics against unknown biological weapons and personalized medicines.14 Currently, various clinical trials of genetic therapies are in progress to find effective, safe designer drugs to target various harmful genetic conditions. Once some of the conditions have been met this will lead to the possible eradication of some genetic disorders.

Factors in Recognizing the Minor Groove

• DNA binding drugs are generally flat and small, which makes them fit well into the minor groove.• Groove width varies with sequence; A/T rich tracks tend to make the groove width narrower.• The convex shape of the minor groove floor complements the typical shapes of minor groove binding drugs• A/T sequences result in a smooth convex curve whereas G/C sequences have “little” bumps due to the 2-amino groups of guanine.

• A/T sequences (Figure 2A) have a higher negative potential while G/C sequences (Figure 2B) have higher positive potential• H-bonding to base edges in the minor groove can be used to distinguish between A:T and G:C base pairs• A:T is distinguished from a T:A base pair through indirect read out

1. Bassi, L.; Palitti, F., Anti-topoisomerase drugs as potent inducers of chromosomal aberrations. Genetics and Molecular Biology 2000, 23, (4), 1065-1069.2. Gambari, R.; Feriotto, G.; Rutigliano, C.; Bianchi, N.; Mischiati, C., Biospecific interaction analysis (BIA) of low-molecular weight DNA-binding drugs. Journal of Pharmacology and Experimental Therapeutics 2000, 294, (1), 370-377.3. Welch, J. J.; Rauscher, F. J.; Beerman, T. A., Targeting DNA-Binding Drugs to Sequence-Specific Transcription Factor DNA Complexes Differential-Effects of Intercalating and Minor-Groove Binding-Drugs. Journal of Biological Chemistry 1994, 269, (49), 31051-31058.4. Uil, T. G.; Haisma, H. J.; Rots, M. G., Therapeutic modulation of endogenous gene function by agents with designed DNA-sequence specificities. Nucl. Acids Res. 2003, 31, (21), 6064-6078.

5. Neidle, S., DNA minor-groove recognition by small molecules. Natural Product Reports 2001, 18, (3), 291-309.

6. Moser, H. E.; Dervan, P. B., Sequence-specific cleavage of double helical DNA by triple helix formation. Science 1987, 238, (4827), 645-650.

7. Dickerson, R. E., In Oxford Handbook of Nucleic Acid Structure, Neidle, S., Ed. Oxford University Press: 1999; pp 145-197.8. Galas, D. J.; Schmitz, A., DNAse footprinting: a simple method for the detection of protein-DNA binding specificity. Nucleic Acids Res 1978, 5, (9), 3157-70.9. Van Dyke, M. W.; Dervan, P. B., Methidiumpropyl-EDTA.Fe(II) and DNase I footprinting report different small molecule binding site sizes on DNA. Nucleic Acids Res 1983, 11, (16), 5555-67.10. Youngquist, R. S.; Dervan, P. B., Sequence-Specific Recognition of B-DNA by Oligo(N-methylpyrrolecarboxamide)s. PNAS 1985, 82, (9), 2565- 2569.11. Dervan, P. B., Design of sequence-specific DNA-binding molecules. Science 1986, 232, (4749), 464-71.12. Burnett, R.; Melander, C.; Puckett, J. W.; Son, L. S.; Wells, R. D.; Dervan, P. B.; Gottesfeld, J. M., DNA sequence-specific polyamides alleviate transcription inhibition associated with long GAA{middle dot}TTC repeats in Friedreich's ataxia. PNAS 2006, 103, (31), 11497-11502.13. Schaal, T. D.; Mallet, W. G.; McMinn, D. L.; Nguyen, N. V.; Sopko, M. M.; John, S.; Parekh, B. S., Inhibition of human papilloma virus E2 DNA binding protein by covalently linked polyamides. Nucleic Acids Research 2003, 31, (4), 1282-1291.

Figure 25: Electrostatic potential surface of dsDNA crystal structures.

Width Depth

Major Groove

11.6Å 8.5Å

Minor Groove

6.0Å 8.2Å

Electrostatics

Structure

A B

Initial Probe Studies

Current Strategies

Figure 84: Hairpin Polyamide Model

Figure 74: Triple Helix Model

Transcription or replication of DNA only occurs after a signal has been received, usually in the form of a protein that binds to a particular region of the DNA. If a small artificial protein can be developed that would mimic the binding strength and specificity of the natural regulatory protein, then DNA function can be artificially modulated, inhibited or activated. Drugs may bind irreversibly, or reversibly in which non-covalent bonds are formed. The latter is preferred when developing drugs.1-3

• Minor groove binders – are crescent shaped, bind via Van der Waals interactions and hydrogen bonds and have a preference for AT rich sequences. e.g. distamycin, Hoescht 33258.

• Intercalators – consist of planar heterocyclic/chromopore groups that stack between adjacent DNA bases and also have hydrogen interactions. Most prefer GC rich regions (bleomycin).

Figure 3: Left: Groove dimensions5. Right: WC base pairs.7

Major groove

Major groove

Minor groove

Minor groove