1

Wheat Hybridization and Polyploidization Results in Deregulation of small

RNAs

Michal Kenan-Eichler1, Dena Leshkowitz2, Lior Tal1, Elad Noor1, Cathy Melamed-Bessudo1, Moshe Feldman1, Avraham A. Levy1*

1 Department of Plant Sciences,

2 Bioinformatics Unit Weizmann Institute of Science,

Rehovot, 76100 Israel

*Corresponding author

Abstract

Speciation via interspecific or intergeneric hybridization and polyploidization triggers

genomic responses involving genetic and epigenetic alterations. Such modifications

may be induced by small RNAs, which affect key cellular processes, including gene

expression, chromatin structure, cytosine methylation and transposable element (TE)

activity. To date, the role of small RNAs in the context of wide hybridization and

polyploidization has received little attention. In this work, we performed high-

throughput sequencing of small RNAs of parental, intergeneric hybrid, and

allopolyploid plants that mimic the genomic changes occurring during bread wheat

speciation. We found that the percent of small RNAs corresponding to miRNAs

increased with ploidy level, while the percent of siRNAs corresponding to TEs

decreased. The abundance of most miRNA species was similar to mid-parent values

in the hybrid, with some deviations, as seen in overrepresentation of miR168, in the

allopolyploid. In contrast, the number of siRNAs corresponding to TEs strongly

decreased upon allopolyploidization, but not upon hybridization. The reduction in

corresponding siRNAs, together with decreased CpG methylation, as shown here for

the Veju element, represent hallmarks of TE activation. TE-siRNA downregulation in

the allopolyploid may contribute to genome destabilization at the initial stages of

speciation. This phenomenon is reminiscent of hybrid dysgenesis in Drosophila.

Genetics: Published Articles Ahead of Print, published on April 5, 2011 as 10.1534/genetics.111.128348

Copyright 2011.

2

Article Summary

Evolution through interspecies hybridization and polyploidization plays an important

role in plant speciation. We have analyzed newly synthesized bread wheat-analagous

hybrids and allopolyploids, in order to characterize the epigenetic events that occur

during early speciation via allopolyploidization. The abundance of small RNAs

corresponding to transposable elements was significantly reduced in the

allopolyploid. This observation correlated with hypomethylation of transposable

elements, a hallmark of active elements. These data suggest that small RNAs

involved in maintaining genome integrity, can be de-regulated in wide crosses. This

alteration might present one of the barriers controling gene flow between related

species.

3

Introduction

Interspecific or intergeneric hybridization and whole genome doubling provide a

mechanism for “overnight” speciation (LEITCH and LEITCH 2008; RIESEBERG and

WILLIS 2007; SOLTIS and SOLTIS 2009; WOOD et al. 2009). Wheat, Spartina, Senecio,

and Tragopogon are examples of recent speciation via wide hybridization and

polyploidization. It has been argued that in nature, there are plenty of opportunities

for interspecific hybridization and genome doubling, with an estimated 10%

hybridization among animals and 25% among plants (MALLET 2007). Moreover,

unreduced gametes, which are occasionally produced in most plant species

(BRETAGNOLLE and THOMPSON 1995), were shown to occur at a frequency of up to

50% in some combinations of intergeneric hybrids of wheat (KIHARA and LILIENFELD

1949). Therefore, one might expect new hybrid and polyploid species to be formed

more frequently than documented (VAN DE PEER et al. 2009). This apparent paradox

may be resolved by works demonstrating the genome-wide genetic and epigenetic

impact of genome merging or doubling, consequently challenging maintenance of

genome functionality and stability. While some intergenomic combinations, show

hybrid incompatibility (BOMBLIES and WEIGEL 2007; ISHIKAWA and KINOSHITA

2009; WALIA et al. 2009) or hybrid dysgenesis (MALONE and HANNON 2009), or

feature reduced fitness, others show improved vigor (CHEN 2010). The mechanisms

dictating nascent hybrid and polyploid survival are therefore of particular interest

when attempting to understand the opportunities and bottlenecks of speciation.

A genetic model for such hybrid incompatibility was proposed by Dobzhansky

(DOBZHANSKY 1936) and thoroughly reviewed by LANDRY et al. (LANDRY et al.

2007), whereby divergent loci or alleles demonstrate incompatibility when merged

into the same nucleus. More recently, TIROSH et al. (TIROSH et al. 2009) performed a

genome-wide analysis of gene expression in yeast interspecific hybrids and analyzed

interactions between cis and trans-acting regulatory factors and their relation to gene

expression rewiring in hybrid genomes. Distinct expression patterns in the hybrid

were shown to account for both hybrid failure (LANDRY et al. 2007) and hybrid vigor

(BIRCHLER et al. 2010; NI et al. 2009).

Whole genome doubling of interspecific or intergeneric hybrids gives rise to

allopolyploid species, which present the same type of novel intergenomic interactions

as those found in interspecific hybrids while also providing fertility rescue. Plant

4

allopolyploidy also offers an additional level of opportunities for the newly formed

species, such as mutation buffering, sub- and neofunctionalization of duplicated

genes, fixed heterozygosity and a broader range of dosage responses (CHEN 2010;

COMAI 2005; DOYLE et al. 2008). Most angiosperms undergo one or more

polyploidization events in their lineage (VAN DE PEER et al. 2009) and 2-4% of all

speciation events seem to occur via polyploidization (OTTO and WHITTON 2000).

Despite these potential advantages, polyploidization events can lead to “genomic

shock” due to gene redundancy, imbalanced and antagonistic gene expression,

orchestration of DNA replication among the multiple and sometimes different

genomes, and pairing between multiple homologous and homeologous chromosomes.

Studies in several species have shown a broad range of adverse genetic and epigenetic

responses, which occur soon after hybridization and polyploidization, including DNA

deletions, rearrangements or cytosine methylation, gene silencing, activation of

transposons and modification of parental imprinting (CHEN 2010; COMAI 2005;

DOYLE et al. 2008). Small RNAs have been associated with all of these events

(MATZKE and BIRCHLER 2005) and therefore, changes in small RNA species in

hybrids and polyploids might provide mechanistic insight into the control of genetic

and epigenetic changes that occur in response to polyploidization.

Endogenous plant small RNAs can be divided into several classes (GHILDIYAL and

ZAMORE 2009), where two of the most prominent classes include the 21-nucleotide

(nt)-long species, mostly corresponding to microRNAs (miRNA), and the small

interfering RNAs (siRNAs), typically 24 nt in length. Several dsRNA-mediated

pathways operating at the level of the nuclear genome, have been described in plants

and include RNA-directed DNA methylation (MATZKE and BIRCHLER 2005) and

small RNA-mediated DNA demethylation (PENTERMAN et al. 2007). Small RNAs

have been shown to be involved in a broad range of functions including

heterochromatin formation and silencing (LIPPMAN and MARTIENSSEN 2004). siRNAs

seem to function as guardians against transposable elements (TEs) during plant

development (MOSHER et al. 2009). However, their role in transposon regulation in

the context of hybridization or polyploidization, has received far less attention.

In this work, we performed a high-throughput screen of small RNAs in parental,

hybrid, and allopolyploid plants mimicking the events that shaped the genome during

the speciation of bread wheat. We show that miRNAs and repeat-derived siRNAs

respond differently to changes in ploidy level. In addition, the siRNA pools

5

corresponding to transposons were significantly reduced upon allopolyploidization.

In parallel, we show that the reduction or total disappearance of siRNAs, correlated

with decreased CpG methylation of target transposons. This deregulation of siRNAs,

and the associated reduction in transposon methylation, may contribute to genome

instability and may hinder speciation via hybridization and polyploidization.

Materials and Methods

Plant material

Seeds were germinated on wet 3MM papers in Petri dishes. All seeds were imbibed

for 24 hours at room temperature under regular light. Seeds of Aegilops tauschii then

underwent 3-6 weeks of vernalization, at 4OC in the dark. After germination, plantlets

were placed in 5-liter pots and grown in a greenhouse. All plants were grown during

the winter, at 20OC and short daylight conditions.

Pollen from the diploid wheat Aegilops tauschii, cultivar TQ113 (genome DD, kindly

provided by J. Dvořak), was used to manually pollinate stigmas of the tetraploid

wheat Triticum turgidum ssp. durum, cultivar Langdon (TTR16, genome BBAA),

which served as the female parent, to generate BAD F1 hybrids. Pollination was

performed early in the morning, using freshly collected pollen, two to three days after

emasculation of the female-parent flowers. The hybrid plants were mostly sterile. F1

spikes were bagged to prevent out-crossing. Occasionally, seeds were obtained from

the spikes of F1 plants. Typically, spikes from F1 plants spontaneously gave zero to

one seed, corresponding to an average frequency of ~ 1%, consistent with reports of

frequent occurrence of unreduced gametes, in similar intergeneric hybrids of wheat

(KIHARA and LILIENFELD 1949). Allopolyploid plants derived from these seeds were

then characterized (see results for details).

Preparation of metaphase chromosomes from wheat root tips

To count chromosomes in F1 hybrids and in newly synthesized amphiploids, root tips

of germinated seeds were cut, subjected to 24h cold treatment in double-distilled

water to arrest mitosis, and then transferred to a 2% acetocarmine staining solution for

2-3 days. Before squashing, root tips were briefly heated in a solution containing 4

6

drops of 2% acetocarmine and 1 drop of 1N HCl. Squashing was performed on a

preparative slide, in one drop of 2% acetocarmine.

RNA extraction

Total RNA was extracted from 2 g of whole two-month-old plant tiller tissue, using

25 ml TRI reagent (Molecular Research Center, Inc. Cincinnati, Ohio), according to

the manufacturer's protocol, with the exception of isopropanol precipitations and

ethanol washes which were performed overnight, at -20OC. The plant material used

in this study consisted of six TTR16 plants, six TQ113 plants, three F1 hybrid plants,

and six newly synthesized S1 amphiploid plants, whose polyploid nature had been

previously confirmed by karyotype analysis. Tissues from all genotypes were at the

vegetative phase.

Small RNA library preparation

RNA quality of all samples was verified using a bio-analyzer. Cloning of small RNAs

was performed by Illumina (San Diego, California), using the DGE small-RNA

sample preparation kit protocol v1.0 (Illumina Hayward, California). In brief, small

RNAs (18-32 nt long) were size-selected, purified, and ligated with 3’ and 5’

adaptors. Four cDNA libraries of size-selected RNA from the four pools of plants

were prepared by reverse-transcription PCR, followed by PCR.

Bioinformatic analysis of small RNA high-throughput sequencing data

Eighteen million reads were obtained from high-throughput sequencing of small

RNAs from the four libraries. Within each library, the unique sequences were

reported as tags containing sequence information and frequency. There were 9.8

million tags in total for all four libraries. A script was developed to trim the 3’

adaptor: in the first step, the first 7 bases from the adaptor and any downstream

sequence were removed. Then the process was repeated allowing one mismatch in the

adaptor sequence. Sequences which contained more than 3 N’s were also eliminated.

Tag frequencies were recalculated after these steps, and resulted in 8.9 million tags.

Following quality control, tags with a frequency of at least 30 reads were assembled

into short contigs using the Staden sequence analysis program's (STADEN 1996)

"normal shotgun assembly" module with a minimal initial match of 20 bases,

allowing 5% maximal mismatch, and then allowing additional assembly with 17

7

bases with no mismatch. Eventually, 21,787 tags were assembled into 6,892 contigs.

The number of reads and tags in each library is summarized in Table 1 of the

Supplementary data. The Staden program produces a file, which reveals the

relationship between the contigs and the sequences and thus helps determine the

contigs composition and library frequencies. Contigs were annotated using Eland

version 0.3 and BLAST 2.2.17 (ALTSCHUL et al. 1990). Searches were performed

against the following databases: NCBI nr/nt (July 2008), the rice genome

(ftp://ftp.plantbiology.msu.edu/pub/data/Eukaryotic_Projects/o_sativa/annotation_dbs

/pseudomolecules /version_5.0 and version_6.0), wheat repeats

(http://www.tigr.org/tdb/e2k1/tae1/wheat_downloads.shtml – wheat repeat database),

Triticum aestivum release 2 (ftp://ftp.tigr.org/pub/data/plantta/Triticum_aestivum),

Triticum turgidum release 1 (ftp://ftp.tigr.org /pub/data/plantta/Triticum_turgidum),

and mature miRNA (http://microrna.sanger.ac.uk/sequences/). Specifically, for

miRNA detection Eland_21 (seed of 21 bases) was run against plant miRNAs using a

script that slides a window of 21 bases along the contig sequence. Only miRNAs with

no mismatches were reported. Using the output of BLASTn table against the TIGR

wheat repeat database, the contig hits were divided into several subcategories:

retroelements, DNA transposons, repetitive element, and unclassified repeats.

Contig frequency was calculated by summing the frequency of each tag comprising

the contig. Interlibrary normalization was performed by dividing the contig frequency

count per library, by a factor which was calculated by dividing by the total number of

reads from tags with more than 30 reads. Therefore, the calculation represents the

frequency per million reads. A rigorous significance test was performed according to

Audic & Claverie (AUDIC and CLAVERIE 1997). For miRNA counting, all contigs

with the same seed sequence were summed.

Northern blot analyses

Northern blot analyses were performed as previously described (BROWN and MACKEY

2001). Briefly, 15 µg of total RNA were loaded on Formamide-agarose gels and later

transferred to a Hybond N+ nylon membrane (Amersham) via the standard wet

transfer method. The Wis2-1A LTR probe was prepared using the forward primer 5’

TGTTGGAAATATGCCCTAGAG 3’ and the reverse primer 5’

GCACAATCTCATGGTCTAAGG 3’; the Veju LTR probe was prepared using the

8

forward primer 5’ TAGAATAAATCCGAGGCATACC 3’ and the reverse primer 5’

TTAGGTTACAGTTGGACTTGG 3’, for amplification from the Triticum aestivum

var. Chinese Spring genome.

Probes were labeled with α[32P] dCTP (Amersham) using Klenow DNA polymerase

(Fermentas). The membranes were blotted overnight with 20 pmol of the labeled

probe and then exposed overnight to a phosphorimager screen, and images were

visualized using the Image Gauge programme. Membranes were stripped for re-use,

in 0.1% SDS and verified to give no signal.

Bisulfite sequencing

Hybrid and polyploid genomic DNA was extracted from 100mg of leaf tissue, using

the GeneElute Plant genomic DNA miniprep kit (Sigma). Two micrograms of

genomic DNA suspended in 0.5ml double-distilled water, were sheared on ice by

ultrasound (Microson sonicator, Misonix) set at 3W output power, four pulses of 10

seconds each with 50 second intervals between pulses. Sheared DNA was

concentrated to a final volume of 20µl, using a speed vacuum set at 60OC for 2 hours.

The genomic DNA was then subjected to bisulfite conversion and purification using

the EpiTect Bisulfite kit (Qiagen), according to the manufacturer's instructions.

Bisulfite ions convert non-methylated cytosine residues to uracil residues. Fifty

nanograms of purified DNA were then subjected to PCR, using degenerate primers

(Metabion), designed to amplify the Veju retrotransposon LTR (Veju degenerate

forward primer: 5’ AGTGAATGTYAAGTTGTTGGTG 3’, Veju degenerate reverse

primer: 5’ TCRAACAACCTARCTCATRATAC 3'). The PCR products were then

separated on a 2% agarose gel and purified using a PCR purification kit (RBC).

Cleaned PCR products were ligated to a pGem-T easy vector (Promega), which were

then used to transform E. coli (top 10 strain); transformed bacteria were then plated

on selective plates. Plasmid DNA was extracted from 25 bacterial colonies for each

plant and then sequenced. Sequences were analyzed using the Sequencher 4.9

programme, and methylation patterns were analyzed using the Kismeth programme

http://katahdin.mssm.edu/kismeth/revpage.pl (GRUNTMAN et al. 2008).

Results

Phenotypic analysis of hybrid and polyploid wheat

9

In order to gain insight into the molecular mechanisms leading to the genetic and

epigenetic changes occurring upon hybrid and polyploid formation, the small RNA

profiles of parental wheat lines were compared to those of the derived hybrid and the

first allopolyploid generation. More specifically, the four wheat species analyzed

included the parental tetraploid Triticum turgidum ssp. durum (genome BBAA) and

the diploid Aegilops tauschii (genome DD), their synthetic triploid hybrid (genome

BAD), and their derived hexaploid (genome BBAADD). This synthetic hexaploid is

analogous in genome structure to bread wheat Triticum aestivum ssp. aestivum.

Parental lines were self pollinated for several generations, with spike bagging to

prevent cross-pollination, and were thus considered inbred. Hybrid seeds were

obtained by crossing Triticum turgidum and Aegilops tauschii. The hybrid F1 seeds

were obtained from the female tetraploid plants and were found to be very small and

shriveled compared to their parents (Figure 1). Upon germination, F1 seeds gave rise

to F1 plants bearing necrotic leaves (Figure 1), a typical hybrid incompatibility

phenotype (BOMBLIES and WEIGEL 2007). Some F1 plants died shortly after

germination. Nevertheless, those which survived were vigorous and featured spikes

larger than their parents (Figure 1), but most were sterile. Occasionally, seeds were

spontaneously obtained from the spikes of F1 plants (See Materials and Methods) and

were termed "S1". While these seeds were slightly shriveled, they were larger in size

than the seeds of either parent (Figure 1). Plants germinating from S1 seeds, has a

duplicated genome as confirmed by karyotype analysis (Figure S1). The resulting S1

plants were fertile and bore spikes that yielded S2 seeds, which were less shriveled

than but similar in size to S1 seeds. While S1 plant leaves were highly necrotic, the

plants were vigorous, and featured spikes larger than in the hybrid or in the parents,

and leaves similar in size to the tetraploid parent (Figure 1).

High-throughput sequencing of small RNAs

Total RNA was isolated from tillers of two-month-old wheat plants, which primarily

included somatic tissues, namely, leaves and stems, and some meristematic tissues. A

small RNA library was prepared for each of the analyzed wheat types and was

comprised of a pool of RNA collected from 3-6 plants of each genotype. Eighteen

million reads were obtained from small RNA sequencing of the four libraries

(Supplementary data: Table 1). The unique sequences within each library were

reported as tags (containing sequence information and frequency). These tags

10

underwent strict quality checks (Figure S2 and Materials & methods), and only tags

that had 30 reads or more were included in the analysis, due to lack of a fully

sequenced reference genome. As the data from a number of small RNA sequencing

experiments proved highly reproducible (with a correlation of Spearman’s ρ=0.95-

0.98) for tags with ≥30 reads (FAHLGREN et al. 2009), this number was set as the

threshold for data analysis. Of the 18 million reads obtained, 6 million high-quality

reads, corresponding to 21,787 unique sequence tags, were analyzed. The small RNA

sizes ranged between 18 and 35 nt and included the two prominent classes of 21 nt-

and 24 nt-long small RNAs (Figure 2). The 21 nt class corresponds mainly to

miRNA, while the 24 nt class corresponds most likely to siRNAs (GHILDIYAL and

ZAMORE 2009). The 24nt-long small RNAs were most abundant within the two

parental and and the hybrid libraries, whereas, the 21nt-long small RNAs were most

prevalent in the allopolyploid library.

The various small RNAs obtained from tags with ≥30 reads, were categorized

according to sequence similarity (Figure S3). miRNAs were one of the most abundant

small RNA species (21-44%, depending on the genotype). Small RNAs that matched

repeats, which were largely TEs, represented ~12% of the total reads for all libraries,

aside from the allopolyploid library, where a significant decrease (P(χ2)<0.0001) to

only 6% was observed. Surprisingly, tRNAs comprised ~9% of total hits in the

parental and hybrid libraries, and rose to ~20% (P(χ2)<0.0001) in the allopolyploid

library (Figure S3). Small RNA contigs matching tRNA genes ranged in size between

18 and 36 bases. However, 55% of the small RNA tags corresponding to tRNAs

showed distinct peaks at 19, 20 and 21nt, suggesting that they were not degradation

products of larger tRNA molecules. No exceptional RNA degradation was observed

in any of the samples, hence degradation could not explain the higher tRNA

frequency observed in allopolyploid samples.

Abundance of miRNAs in parent, hybrid and allopolyploid libraries

Twenty-one known plant miRNA sequences were identified with high certainty, i.e.

with ≥30 reads each, and were identical to known miRNAs from other plant species

(Supplementary data: Table 2). For example, miR168, the most abundant miRNA in

rice (LU et al. 2008), was the most abundant in the present data. Interestingly, the

amount of miRNA, relative to total small RNA, increased with increasing levels of

11

ploidy, being the lowest (21%) in the diploid Aegilops tauschii DD genome, 33% in

the triploid hybrid genome (BAD), 38% in the tetraploid Triticum turgidum BBAA

genome, and 44% in the synthetic hexaploid BBAADD genome (Figure 3).

In order to assess the changes in the abundance and profile of miRNAs expressed as a

result of hybridization and polyploidization, we compared the normalized number of

hits (in reads per million) found in the hybrid and the polyploid libraries to the

average number of hits in the two parental libraries, namely the mid-parent value

(MPV). Under the assumption of additive expression, the number of hits in F1 or S1

should be similar to the mid-parent value: log2(F1/MPV) or log2(S1/MPV)=0.

Positive log2 values indicate that the number of small RNAs for a given tag is higher

in the hybrid or the polyploid than in the parent average; negative values indicate the

opposite. When applying a cutoff value in which |log2|<0.5 is considered similar to

MPV, most miRNAs were expressed to similar degrees as the MPV, (Figure 4).

However, miR390a was under-represented (log2(F1/MPV)= -4.8), and miR160f was

over-represented (log2(F1/MPV)=4.86) when comparing hybrid miRNA expression

profiles to those of the parent libraries. Interestingly, both miR390 and miR160 play

key roles in auxin regulation, via regulation of TAS3, a trans-acting siRNA involved

in auxin signaling (FAHLGREN et al. 2006) by the former and via targeting of ARF10

(LIU et al. 2007) by the latter. In the allopolyploid plants, several miRNA expression

patterns significantly deviated from those observed in the parental lines. miR157a,

miR160f, miR159a, miR396d, and miR168 were significantly over-represented

relative to MPV, while miR156b, miR165a, and miR1135 were significantly under-

represented. miR168, had the highest number of reads in almost all libraries,

amounting to 25% of the polyploid library reads and 119,710 and 79,244 reads in T.

turgidum and Ae. tauschii libraries, respectively (Supplementary data: Table 2). It

was over-represented by 1.27-fold in the hybrid, and by 2.46-fold in the synthetic

polyploid, relative to the mid-parent value (MPV=99,477) and is suggested to have

genome-wide effects on small RNA species (see discussion). miR156 was the

second-highest tag expressed in the model, while miR1135 was only moderately

expressed (Supplementary data: Table 2). miR156a was over-represented by 2.4-

fold in the polyploid relative to the MPV. miR156 and its related sequence is of

particular interest, as its overexpression has been suggested to prolong the vegetative

phase and to delay flowering in Arabidopsis (SCHWARZ et al. 2008) and may explain

the heterotic effects seen here in the allopolyploid plants.

12

siRNAs that correspond to repeats

Small 24 nt-long RNAs were abundant in all the libraries, where a large percentage of

these siRNAs corresponded to repeats: 1,113 Staden contigs out of a total of 6,892

correspond to transposons and retrotransposons. An additional 130 contigs

corresponded to ribosomal RNA genes, telomeric and centromeric repeats. siRNAs

matching known genes, often corresponded to repeats as well. Here, we focused on

repeats, using the complete wheat repeat database

(http://wheat.pw.usda.gov/ITMI/Repeats/flatfile.total) as reference.

Transposons, which make up approximately 80% of the wheat genome (CHARLES et

al. 2008), comprise a major class of repeats. Recently, small RNAs have been

mapped to the repeat sequences of the Triticeae repeats database (CANTU et al. 2010).

The present work demonstrates the changes in TE-related small RNAs following

hybridization and polyploidization and confirms that TEs are targets of small RNAs,

particularly at their termini. In contrast to miRNAs, the amount of siRNAs

corresponding to transposons decreased with increased ploidy (Figure 3). In the

hybrid, 42% of siRNAs corresponding to transposons were represented similarly to

the MPV (defined here as |log2|<0.5), while 39% were under-represented and 19%

were over-represented. In the allopolyploid, a massive reduction and significant shift

(P(χ2)<0.0001) in the relative abundance of siRNAs corresponding to transposons

was observed, with 85% of the hits below the MPV (Figure 5). This under-

representation affected both DNA elements and retroelements (Table 1). Small RNA

matching to the sequenced and annotated Triticum aestivum BAC genome region

(accession number CT009735), using IGB (Integrative Genome Browser), confirmed

the massive reduction of small RNAs corresponding to transposons, in the polyploid

compared to the parental lines (Figure 6). Note that in the data used by CANTU et al.

(CANTU et al . 2010), the number of reads corresponding to Veju in natural hexaploid

wheat was very low (1/400,000), similar to the data shown here for the synthetic

hexaploid, but contrasting with the present data collected from natural tetraploid and

diploid wheat.

We then examined whether the reduction in TE-related siRNAs correlated with

hallmarks of transposons activation. Table 1 summarizes several examples of

retrotransposons and DNA transposons for which small RNAs were under-

13

represented in the polyploid compared to the parental lines. We then tested whether

siRNA under-representation correlated with transcriptional activation of the copia-

like retrotransposon Wis2-1A and of Veju, a “terminal-repeat retrotransposon in

miniature” (TRIM) element (SANMIGUEL et al. 2002). In both cases, the

allopolyploid expressed higher transcript levels than the hybrid, further substantiating

the observed reduction in corresponding siRNAs. However, the tetraploid parent also

expressed high transcript levels, thus, no straightforward correlation can be drawn

between small RNA and corresponding mRNA levels, detected by Northern

hybridization (Figure S4).

Cytosine methylation represents an additional hallmark of transposon activity, and

has been reported to be reduced in active and hypermethylated in silent transposons

(CHANDLER and WALBOT 1986). As a case study, we performed bisulfite sequencing

of the LTR of a Veju element, using the available sequence from a transposon-rich

region in the Triticum aestivum genome (Genebank accession number CT009735,

coordinates 38,989-39,363). Seven different small RNAs, corresponding to hundreds

of reads, were mapped along the LTR sequence (Figure 7, middle panel) and shown

to derive from both strands. All seven were almost fully suppressed in the

allopolyploid line (Figure 7, top panel). Sequencing of 25 different Veju-LTR clones

per plant type, following bisulfite conversion, enabled us to determine the average

methylation of Veju elements similar in sequence to the Triticum aestivum LTR

(Genebank accession number CT009735, see Methods). A decrease in CG

methylation (Figure 7, bottom panel) but not in CHG or CHH methylation (data not

shown), was observed in the allopolyploid line and correlated with decreased

abundance of Veju LTR small RNAs in the polyploid. These results are consistent

with and further elucidate data reported by KRAITSHTEIN et al. with regard to AFLP-

based Veju methylation (KRAITSHTEIN et al. 2010).

Discussion

Small RNAs are involved in a number of key cellular processes, and perturbations in

their steady-state expression levels can lead to genome-wide changes in gene

expression or in chromatin and genome structure. Modified small RNA expression

levels have been widely reported in the context of developmental regulation of plants,

14

but to a lesser extent in the context of speciation via interspecific hybridization and

allopolyploidization (HA et al. 2009). Ha et al. (2009) describe an allotetraploid

hybrid, analogous to A. suecica, formed between a synthetic Arabidopsis

autotetraploid line and the natural Arabidopsis tetraploid, A. arenosa and report

significant deviations in hybrid miRNA expression from MPV. In the present study,

most hybrid miRNA expression profiles did not deviate from their MPVs (Figure 4).

However, a number of deviations were found in the allopolyploid (Table 2-

Supplementary data). In addition, some classes, such as miR156 and miR166,

included several sequence variants, each demonstrating differential expression

patterns. However, in the absence of the wheat genome sequence, it is difficult to

associate changes in miRNA levels to the expression of target genes or to plant

phenotypes.

Another difference between the present model and that described in the Arabidopsis

allopolyploid analysis (HA et al. 2009), lies in the nature of the genetic material

analyzed, where the Arabidopsis work involved plants of the same ploidy level

(parents and hybrid were all tetraploids), while this study encompassed lines of

different ploidy levels (parents (2x and 4x), hybrid (3x) and a derived allohexaploid

(6x) analogous to natural bread wheat). The wheat material offered unique and novel

insight into an unexpected response to changes in ploidy levels. Remarkably, and

unexpectedly, the relative amount of small RNAs corresponding to miRNAs,

increased with ploidy (Figure 3). Inversely, the relative amount of 24 nt small RNAs

corresponding to transposons decreased with increased ploidy (Figure 3). Similarly,

in the work of CANTU et al. (2010), the count/bp of small RNAs corresponding to

transposons was lower in hexaploid versus tetraploid wheat varieties (CANTU et al.

2010). This ploidy-dependence seems to be insensitive to genomic composition, but

sensitive to dosage. Indeed, while the diploid, tetraploid and hexaploid wheat had

different genomic composition, the triploid (hybrid) and allohexaploid, which both

featured the same three wheat genomes (A,B and D) but at varying doses (3x versus

6x), expressed divergent small RNAs profiles.

Mechanistically, a correlation can be drawn between specific miRNA over-

representation and repressed siRNAs formation. More specifically, miR168 over-

representation in polyploids may account for ARGONAUTE 1 (AGO1) suppression

(MALLORY and VAUCHERET 2009), which in turn reduces the production of siRNAs

(VAUCHERET 2008). Although, the regulation of AGO1 is quite complex (MALLORY

15

and VAUCHERET 2009), it is conceivable that affecting regulatory loops responsible

for AGO1 activity, e.g. via alterations in miR168, may bear genome-wide effects on

siRNAs. In fact, the novel intergenomic interactions and novel dosage effects

demonstrated in the allopolyploid lines, may account for the disruption of the activity

of several genes related to small RNA expression and stability. Previously, we have

shown that novel interactions between cis and trans-acting regulatory elements can

lead to overexpression or, alternatively, to suppression of ~10% of the genes of an

interspecific hybrid (TIROSH et al. 2009). Deregulation of central genes involved in

the gene silencing machinery could account for some of the alterations in small RNA

profiles reported here, which in turn can affect TE activities, as discussed below.

siRNAs play a critical role in heterochromatin maintenance and in transposable

element silencing (ZARATIEGUI et al. 2007). The strong decrease in the percentage of

siRNAs corresponding to TEs reported here, could thus lead to transposon activation.

Transposons, notoriously responsive to “genomic shocks” (MCCLINTOCK 1984), may

be responsive to hybridization- and polyploidization-induced “shocks”, linked with

downregulation of small RNAs. Indeed, it has been reported that silent transposons

and retrotransposons may become transcriptionally and sometime transpositionally

active upon hybrid and polyploid formation (CHEN and NI 2006; KASHKUSH et al.

2003; KRAITSHTEIN et al. 2010; MADLUNG et al. 2005). The correlation between

small RNAs cytosine methylation and transposon silencing (MATZKE et al. 2007) may

further explain transposon activation following small RNAs-related demethylation, as

reported here for the Veju TE.

A fascinating aspect of TE regulation involves their capacity to transit between

inactive and active states. Remarkably, a hypomethylated TE can become re-

methylated within one generation, as shown here for a specific element (Figure 7) and

as shown on a genome-wide scale for the Veju element (KRAITSHTEIN et al. 2010).

An attractive model for such kinetics is demonstrated via the disappearance of small

RNAs, as seen here in S1 for several elements, including WIS2-1A (Table 1), which

then leads to transcription of otherwise silent TEs. As a result, high levels of aberrant

and double stranded RNAs may be generated, as many TEs are nested within each

other in opposite orientations (SANMIGUEL et al. 1996). In the subsequent generation,

small RNAs produced by such transcriptional activation, might reverse the element to

its original methylated and silenced state. This proposed mechanism may account for

the reported maintenance-silencing of repeats by small RNAs produced by RNA

16

polymerases IV and V (MATZKE et al. 2009; PIKAARD et al. 2008). In other words,

TE activation may catalyze TE silencing via upregulation of small RNA production.

However, the association between small RNAs and TE transcription still remains

elusive. In an earlier work (KASHKUSH et al. 2003), we analyzed an allopolyploid

resulting from a cross between two diploid parents and measured S1 transcriptional

activation of transposons that were silent in the parents. The present model, using

different parental species, is a bit more complex (Figure S4), where S1 transposon

transcript levels was higher than in F1, substantiating an earlier report of

transcriptional activation in the S1 generation (KASHKUSH et al. 2003). However, high

levels of both small RNAs and TE transcripts were found in the tetraploid parent

(Figure S4), which may be due to transcription of a divergent subfamily of

transposons, not targeted by the small RNAs, or to alteration in small RNA mobility,

processing or other unknown phenomenon.

Another intriguing question remaining relates to the changes measured in

allopolyploid small RNA species, and to a lesser extent in the hybrid. This

observation may be linked to polyploidy per se. Alternatively, this may be a result of

the kinetics of small RNA alterations which begin in the hybrid and peak in the S1

generation. Another interesting possibility is that global demethylation and activation

of TEs may occur through disruption of developmentally regulated processes in the

germline. Such modifications may occur during meiosis, or gametogenesis, or during

the development of an embryo derived from “deregulated” gametes. In such cases,

massive changes would be found in the S1 only, and not in the F1.

In summary, the data reported here, together with previous findings, suggest that

deregulation of small RNAs may stimulate TE activation in interspecific hybrids and

allopolyploids. This phenomenon is reminiscent of hybrid dysgenesis in Drosophila

(MALONE and HANNON 2009), a mechanism of incompatibility that can hinder

speciation via hybridization and polyploidization. The correlation between the

different hallmarks of transposon activation (small RNAs, hypomethylation,

transcription and transposition) is complex, as they undergo rapid changes between

generations. In addition, it is important to note that the present study was performed

on plants which survived hybridization and allopolyploidization. The events of

seedling death and seed abortion, which were observed in the hybrid and

allopolyploid lines, may have occurred as a result of severe transposon activation and

were not considered in our analysis.

17

Acknowledgements

We thank Naomi Avivi-Ragolski and other members of the Levy laboratory for their

help and discussions; Idan Efroni for help in data analysis; Yehudit Posen for editing

the manuscript and members of the bioinformatics unit, especially Jaime Prilusky for

writing the quality-control script and Ester Feldmesser for help with statistical analysis.

This work was funded by a grant from the Israeli Science Foundation, #616/09, to

A.A.L.

18

References

ALTSCHUL, S. F., W. GISH, W. MILLER, E. W. MYERS and D. J. LIPMAN, 1990 Basic local alignment search tool. J Mol Biol 215: 403-410.

AUDIC, S., and J. M. CLAVERIE, 1997 The significance of digital gene expression profiles. Genome Res 7: 986-995.

BIRCHLER, J. A., H. YAO, S. CHUDALAYANDI, D. VAIMAN and R. A. VEITIA, 2010 Heterosis. Plant Cell 22: 2105-2112.

BOMBLIES, K., and D. WEIGEL, 2007 Hybrid necrosis: autoimmunity as a potential gene-flow barrier in plant species. Nat Rev Genet 8: 382-393.

BRETAGNOLLE, F., and J. D. THOMPSON, 1995 Tansley Review No-78 - Gametes with the Somatic Chromosome-Number - Mechanisms of Their Formation and Role in the Evolution of Autopolyploid Plants. New Phytologist 129: 1-22.

BROWN, T., and K. MACKEY, 2001 Analysis of RNA by northern blot hybridization. Curr Protoc Hum Genet Appendix 3: Appendix 3K.

BURKE, J. M., and M. L. ARNOLD, 2001 Genetics and the fitness of hybrids. Annu Rev Genet 35: 31-52.

CANTU, D., L. S. VANZETTI, A. SUMNER, M. DUBCOVSKY, M. MATVIENKO et al., 2010 Small RNAs, DNA methylation and transposable elements in wheat. BMC Genomics 11: 408.

CHANDLER, V. L., and V. WALBOT, 1986 DNA modification of a maize transposable element correlates with loss of activity. Proc. Natl. Acad. Sci. USA 83: 1767-1771.

CHARLES, M., H. BELCRAM, J. JUST, C. HUNEAU, A. VIOLLET et al., 2008 Dynamics and differential proliferation of transposable elements during the evolution of the B and A genomes of wheat. Genetics 180: 1071-1086.

CHEN, Z. J., 2010 Molecular mechanisms of polyploidy and hybrid vigor. Trends Plant Sci 15: 57-71.

CHEN, Z. J., and Z. F. NI, 2006 Mechanisms of genomic rearrangements and gene expression changes in plant polyploids. Bioessays 28: 240-252.

COMAI, L., 2005 The advantages and disadvantages of being polyploid. Nat Rev Genet 6: 836-846.

DOBZHANSKY, T., 1936 Studies on Hybrid Sterility. II. Localization of Sterility Factors in Drosophila Pseudoobscura Hybrids. Genetics 21: 113-135.

DOYLE, J. J., L. E. FLAGEL, A. H. PATERSON, R. A. RAPP, D. E. SOLTIS et al., 2008 Evolutionary genetics of genome merger and doubling in plants. Annu Rev Genet 42: 443-461.

FAHLGREN, N., T. A. MONTGOMERY, M. D. HOWELL, E. ALLEN, S. K. DVORAK et al., 2006 Regulation of AUXIN RESPONSE FACTOR3 by TAS3 ta-siRNA affects developmental timing and patterning in Arabidopsis. Curr Biol 16: 939-944.

FAHLGREN, N., C. M. SULLIVAN, K. D. KASSCHAU, E. J. CHAPMAN, J. S. CUMBIE et al., 2009 Computational and analytical framework for small RNA profiling by high-throughput sequencing. RNA 15: 992-1002.

GEHRING, M., K. L. BUBB and S. HENIKOFF, 2009 Extensive demethylation of repetitive elements during seed development underlies gene imprinting. Science 324: 1447-1451.

19

GHILDIYAL, M., and P. D. ZAMORE, 2009 Small silencing RNAs: an expanding universe. Nat Rev Genet 10: 94-108.

GRUNTMAN, E., Y. QI, R. K. SLOTKIN, T. ROEDER, R. A. MARTIENSSEN et al., 2008 Kismeth: analyzer of plant methylation states through bisulfite sequencing. BMC Bioinformatics 9: 371.

HA, M., J. LU, L. TIAN, V. RAMACHANDRAN, K. D. KASSCHAU et al., 2009 Small RNAs serve as a genetic buffer against genomic shock in Arabidopsis interspecific hybrids and allopolyploids. Proc Natl Acad Sci U S A 106: 17835-17840.

HSIEH, T. F., C. A. IBARRA, P. SILVA, A. ZEMACH, L. ESHED-WILLIAMS et al., 2009 Genome-wide demethylation of Arabidopsis endosperm. Science 324: 1451-1454.

ISHIKAWA, R., and T. KINOSHITA, 2009 Epigenetic programming: the challenge to species hybridization. Mol Plant 2: 589-599.

KASHKUSH, K., M. FELDMAN and A. A. LEVY, 2003 Transcriptional activation of retrotransposons alters the expression of adjacent genes in wheat. Nature Genetics 33: 102-106.

KIHARA, H., and F. LILIENFELD, 1949 A new synthesized 6x-wheat, pp. 307-319 in Proceedings of Eighth International Congress of Genetics, edited by G. B. A. R. LARSSON. Hereditas (Suppl.), Stockholm, Sweden.

KRAITSHTEIN, Z., B. YAAKOV, V. KHASDAN and K. KASHKUSH, 2010 Genetic and epigenetic dynamics of a retrotransposon after allopolyploidization of wheat. Genetics 186: 801-812.

LANDRY, C. R., D. L. HARTL and J. M. RANZ, 2007 Genome clashes in hybrids: insights from gene expression. Heredity 99: 483-493.

LEITCH, A. R., and I. J. LEITCH, 2008 Genomic plasticity and the diversity of polyploid plants. Science 320: 481-483.

LEVY, A. A., and V. WALBOT, 1990 Regulation of the timing of transposable element excision during maize development. Science 248: 1534-1537.

LIPPMAN, Z., and R. MARTIENSSEN, 2004 The role of RNA interference in heterochromatic silencing. Nature 431: 364-370.

LIU, P. P., T. A. MONTGOMERY, N. FAHLGREN, K. D. KASSCHAU, H. NONOGAKI et al., 2007 Repression of AUXIN RESPONSE FACTOR10 by microRNA160 is critical for seed germination and post-germination stages. Plant J 52: 133-146.

LU, C., D. H. JEONG, K. KULKARNI, M. PILLAY, K. NOBUTA et al., 2008 Genome-wide analysis for discovery of rice microRNAs reveals natural antisense microRNAs (nat-miRNAs). Proc Natl Acad Sci U S A 105: 4951-4956.

MADLUNG, A., A. P. TYAGI, B. WATSON, H. M. JIANG, T. KAGOCHI et al., 2005 Genomic changes in synthetic Arabidopsis polyploids. Plant Journal 41: 221-230.

MALLET, J., 2007 Hybrid speciation. Nature 446: 279-283. MALLORY, A. C., and H. VAUCHERET, 2009 ARGONAUTE 1 homeostasis invokes

the coordinate action of the microRNA and siRNA pathways. EMBO Rep 10: 521-526.

MALONE, C. D., and G. J. HANNON, 2009 Small RNAs as guardians of the genome. Cell 136: 656-668.

MATZKE, M., T. KANNO, L. DAXINGER, B. HUETTEL and A. J. MATZKE, 2009 RNA-mediated chromatin-based silencing in plants. Curr Opin Cell Biol 21: 367-376.

20

MATZKE, M., T. KANNO, B. HUETTEL, L. DAXINGER and A. J. MATZKE, 2007 Targets of RNA-directed DNA methylation. Curr Opin Plant Biol 10: 512-519.

MATZKE, M. A., and J. A. BIRCHLER, 2005 RNAi-mediated pathways in the nucleus. Nat Rev Genet 6: 24-35.

MCCLINTOCK, B., 1984 The significance of responses of the genome to challenge. Science 226: 792-801.

MOSHER, R. A., C. W. MELNYK, K. A. KELLY, R. M. DUNN, D. J. STUDHOLME et al., 2009 Uniparental expression of PolIV-dependent siRNAs in developing endosperm of Arabidopsis. Nature 460: 283-286.

NI, Z., E. D. KIM, M. HA, E. LACKEY, J. LIU et al., 2009 Altered circadian rhythms regulate growth vigour in hybrids and allopolyploids. Nature 457: 327-331.

OTTO, S. P., and J. WHITTON, 2000 Polyploid incidence and evolution. Annu Rev Genet 34: 401-437.

PENTERMAN, J., D. ZILBERMAN, J. H. HUH, T. BALLINGER, S. HENIKOFF et al., 2007 DNA demethylation in the Arabidopsis genome. Proc Natl Acad Sci U S A 104: 6752-6757.

PIKAARD, C. S., J. R. HAAG, T. REAM and A. T. WIERZBICKI, 2008 Roles of RNA polymerase IV in gene silencing. Trends Plant Sci 13: 390-397.

RIESEBERG, L. H., and J. H. WILLIS, 2007 Plant speciation. Science 317: 910-914. SANMIGUEL, P., A. TIKHONOV, Y. K. JIN, N. MOTCHOULSKAIA, D. ZAKHAROV et al.,

1996 Nested Retrotransposons in the Intergenic Regions of the Maize Genome. Science 274: 765-768.

SANMIGUEL, P. J., W. RAMAKRISHNA, J. L. BENNETZEN, C. S. BUSSO and J. DUBCOVSKY, 2002 Transposable elements, genes and recombination in a 215-kb contig from wheat chromosome 5A(m). Funct Integr Genomics 2: 70-80.

SCHWARZ, S., A. V. GRANDE, N. BUJDOSO, H. SAEDLER and P. HUIJSER, 2008 The microRNA regulated SBP-box genes SPL9 and SPL15 control shoot maturation in Arabidopsis. Plant Mol Biol 67: 183-195.

SLOTKIN, R. K., M. VAUGHN, F. BORGES, M. TANURDZIC, J. D. BECKER et al., 2009 Epigenetic reprogramming and small RNA silencing of transposable elements in pollen. Cell 136: 461-472.

SOLTIS, P. S., and D. E. SOLTIS, 2009 The role of hybridization in plant speciation. Annual Review of Plant Biology 60: 561-588.

STADEN, R., 1996 The Staden sequence analysis package. Mol Biotechnol 5: 233-241. TIROSH, I., S. REIKHAV, A. A. LEVY and N. BARKAI, 2009 A yeast hybrid provides

insight into the evolution of gene expression regulation. Science 324: 659-662.

VAN DE PEER, Y., S. MAERE and A. MEYER, 2009 The evolutionary significance of ancient genome duplications. Nat Rev Genet 10: 725-732.

VAUCHERET, H., 2008 Plant ARGONAUTES. Trends Plant Sci 13: 350-358. WALIA, H., C. WILSON, A. M. ISMAIL, T. J. CLOSE and X. CUI, 2009 Comparing

genomic expression patterns across plant species reveals highly diverged transcriptional dynamics in response to salt stress. BMC Genomics 10: 398.

WOOD, T. E., N. TAKEBAYASHI, M. S. BARKER, I. MAYROSE, P. B. GREENSPOON et al., 2009 The frequency of polyploid speciation in vascular plants. Proc Natl Acad Sci U S A 106: 13875-13879.

ZARATIEGUI, M., D. V. IRVINE and R. A. MARTIENSSEN, 2007 Noncoding RNAs and gene silencing. Cell 128: 763-776.

Figure legends

21

Figure 1: Parents, hybrids and allopolyploid plant material. Triticum turgidum

durum (female parent, genome BBAA) and Aegilops tauschii (male parent, genome

DD) leaves, spikes and seeds are shown in the top left and top right panels,

respectively. Plant crossing yielded small and shriveled hybrid (F1) seeds (genome

BAD, in the center), from which hybrid F1 plants were grown. F1 plants featured

necrotic leaves and were mostly sterile, occasionally and spontaneously giving rise to

allopolyploid (S1) seeds (middle panel), with a doubled chromosome number. S1

seeds were larger than the seeds of both parents, and were somewhat shriveled. S1

plants (bottom panel), derived from S1 seeds, bore leaves as broad as the maternal

plant, spikes larger than those of both parents, and yielded S2 seeds (bottom left),

which were as large as S1 seeds, and a little less shriveled. Scale bar =0.5cm.

Figure 2: Length distribution of small RNAs. Length distribution of small RNAs in

the four libraries. Small RNAs ranged in size from 18-35 nucleotides, with two

prominent peaks at 21 and 24 nucleotides. Note that the X axis is not linear at the

end.

Figure 3: Changes in small RNA expression levels as a function of plant ploidy.

Percent of siRNAs corresponding to repeats, and of miRNA reads, as a function of

genome ploidy (where X is a haploid genome) and genomic composition. The percent

of reads was determined from the total number of small RNA reads in each library,

thus enabling a comparison between the different ploidy groups.

Figure 4: miRNA abundance in the hybrid and polyploid lines. miRNA

abundance in the hybrid (F1, gray) and the polyploid (S1, black) relative to the mid-

parent value is shown as a logarithmic cumulative distribution function (n=21).

Positive values indicate higher abundance in the hybrid or polyploid compared to the

mid-parent value (MPV), negative values indicate the opposite and values close to

zero indicate similar abundance between the analyzed and parental lines.

Figure 5: Abundance of small RNAs corresponding to transposons. The

abundance in the hybrid (F1, gray) and the polyploid (S1, black) relative to the mid-

parent value is shown as a logarithmic cumulative distribution function (n=1113). The

22

box on the top left summarizes the abundance relative to the mid-parent value. In the

hybrid, 42% of the small RNAs corresponding to transposons had an abundance

similar to the mid-parent (|log2|<0.5), 19% were over-represented (log2>0.5), and 39%

were under-represented (log2<-0.5). In the polyploid, 12% of the small RNAs

corresponding to transposons had an abundance similar to the mid-parent value, 3%

were over-represented and 85% were under-represented, compared to the mid-parent

value. This under-representation was highly significant P(χ2)<0.0001.

Figure 6: Viewing of small RNAs on a BAC sequence. A view of small RNAs

mapped to the Triticum aestivum BAC CT009735, using the IGB tool from

Affymetrix, with coordinates indicating the nucleotide number (nt). Horizontal gray

bars correspond to transposable elements, vertical black lines indicate the abundance

of corresponding small RNAs in each library.

Figure 7: Veju-related small RNAs and CpG methylation. The abundance of small

RNAs that correspond to the Veju retrotransposon LTR found on BAC CT009735, is

shown in the top panel for the mid-parent value, the hybrid (F1) and the polyploid

(S1). The coordinates of small RNAs on the Veju LTR genomic DNA are shown in

the middle panel. The percent of CpG methylation was determined by bisulfite

sequencing for the Veju LTR region. A decrease in CpG methylation in the first

generation of the polyploid (S1), compared to Aegilops tauschii (genome DD) was

observed. In the second polyploid generation (S2), CpG methylation increased. A

natural hexaploid (Genome BBAADD, variety Chinese Spring) is shown for

comparison.

23

Table 1: Number of reads (normalized to reads per million) of siRNAs corresponding to transposable elements (TEs), in parents, hybrid and first generation allopolyploid (S1). TEsa durum

BBAA tauschii DD

F1 BAD

S1 BBAADD

WIS2-1A 756 528 475 0 Latidu 1267 486 747 94 Veju 326 211 400 6 WHAM 83 2646 420 69 Caspar 701 315 472 8 Thalos 532 656 753 5 a Caspar and Thalos are DNA transposons, other TEs are retroelements

24

Supporting figure legends

FIGURE S1: Metaphase chromosomes from a root tip of an S1 allopolyploid plant,

spontaneously derived from a TTR16XTQ113 F1 hybrid. The expected 42

chromosomes are shown.

FIGURE S2: Flow chart of small RNA high-throughput sequencing data analysis.

FIGURE S3: Abundance of small RNA classes in the four analyzed libraries, namely,

the tetraploid parent (genome BBAA), the diploid parent (genome DD), their hybrid

and derived allopolyploid (first generation= S1), and the calculated mid-parent value

(MPV). The total number of reads in each library is shown at the top of each column.

FIGURE S4: Northern blot analyses of Wis2-1A (left) and Veju (right) retrotransposon

LTR regions in the tetraploid parent (genome BBAA), the diploid parent (genome

DD), their hybrid and derived allopolyploid. Methylene blue staining of the

membranes shows equal loading of RNA samples. Probes were derived from a

consensus sequence from wheat Wis2-1A LTRs (a 354bp fragment) and from

Veju1_TM_LTR entry at TREP (a 339 bp fragment).

BBAA

F1 seeds (BAD)

S1 plant

X

Triticum turgidum durum Aegilops tauschii

S1 seeds (BBAADD)

DD

S2 seeds (BBAADD)

F1 plant

Figu

re 1

0

10

20

30

40

50

60

70

35 33 28 27 26 25 24 23 22 21 20 19 18

Perc

ent o

f rea

ds p

er s

ampl

e

Nucleotides

parent BBAA parent DD Hybrid Polyploid

Figu

re 2

0

5

10

15

20

25

30

35

40

45

50 Pe

rcen

t fro

m to

tal s

mal

l RN

As

miRNAs

siRNAs

2X 3X 4X 6X

Figu

re 3

DD BBAA BAD BBAADD Ploidy level and genome composition

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

-12 -10 -8 -6 -4 -2 0 2 4 6 8 10

Perc

ent m

iRN

As

(cum

ulat

ive)

Log2[(reads in F1 or S1)/(reads in MPV)]

Hybrid Polyploid

Figu

re 4

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

-16 -14 -12 -10 -8 -6 -4 -2 0 2 4 6 8 10 12

Perc

ent t

rans

poso

ns s

iRN

As

(c

umul

ativ

e)

Log2[(reads in F1 or S1)/(reads in MPV)]

Hybrid Polyploid

~MPV <MPV >MPV Hybrid Polyploid

39% 85%

42% 12%

19% 3%

Figu

re 5

Parent BBAA 

Parent DD 

Hybrid 

Polyploid 

CT009735(+) 

CT009735(‐) 

nt  20,000 40,000 60,000 80,000 100,000 120,000 140,000 160,000 180,000

Figu

re 6

130-114 27-4 0 374 180 90 270

1-22 38-61

317-301

255-270 67-87

gDNA

Figu

re 7